Molecular marker related to disease resistance of ricefield eel and application of molecular marker

Abstract

The invention discloses a molecular marker related to disease resistance of ricefield eel and application of the molecular marker, and relates to the biological field of aquaculture and molecular marker screening. According to the invention, SNP loci in SFRP2 and TC1A gene coding regions in a ricefield eel group are screened through sequence alignment, and the two genes and a combination thereof are subjected to genetic typing; and comparing the differences of the disease resistance of the genotypes, and screening to obtain the genotype with the strongest disease resistance and the combination thereof, thereby providing an effective molecular marker for detecting the disease resistance of the ricefield eel. According to the monopterus albus disease resistance screening method developed based on the molecular marker, monopterus albus varieties with excellent disease resistance can be screened by utilizing SNP differences of disease-resistant genes, and then the monopterus albus varieties are used for disease resistance breeding. Effective technical support is provided for breeding of disease-resistant ricefield eel varieties.

Description

TECHNICAL FIELD

[0001] The present application relates to the biological field of aquaculture and molecular marker screening, and particularly relates to a molecular marker related to the disease resistance of Monopterus albus and application thereof. BACKGROUND

[0002] Monopterus albus is commonly known as eel, and its scientific name is Monopterus albus. Monopterus albus has tender and nutritious meat, and the content of high-quality protein in its muscle tissue is 18%-20%. Monopterus albus is rich in DHA, vitamins, and mineral elements such as calcium and iron, and has high edible value and traditional medicinal value. In recent years, the market demand for Monopterus albus has been rising due to the increasing popularity of Monopterus albus among consumers. Under this background, the artificial breeding scale of Monopterus albus has been expanding, and the breeding mode has gradually shifted from traditional rice field ecological breeding to pond intensive breeding and factory circular water breeding. However, with the increase of breeding density and the deepening of intensification, Monopterus albus breeding industry is facing a prominent bottleneck problem: the deterioration of the breeding environment and the intensification of the stress response, which further leads to frequent diseases. Common diseases include water mold disease, red skin disease, enteritis disease and Edwardsiella disease, and the disease incidence can reach 30%-50%, and the mortality rate can be over 70% in severe cases.

[0003] There are still obvious shortcomings in the research on Monopterus albus. Firstly, as a lower bony fish, the immune regulation mechanism of Monopterus albus (such as the innate immune response pathway and the function of disease resistance related genes) has not been systematically elucidated. Secondly, the research on pathogen identification and pathogenic mechanism related to diseases is insufficient, and the development of rapid diagnosis technology and green prevention and control technology (such as probiotic preparations and plant-derived antibacterial agents) is lagging behind. Thirdly, the breeding of disease-resistant varieties started late, and there is still a lack of genetically stable excellent disease-resistant strains. The above problems lead to disease prevention and control as a key bottleneck restricting the healthy development of Monopterus albus breeding industry. Therefore, systematic excavation of Monopterus albus disease resistance gene resources, analysis of its immune defense mechanism, development of efficient disease diagnosis and control technology, and breeding of disease-resistant high-yield excellent varieties have become the core research content in the field of Monopterus albus aquaculture research, and have important theoretical value and practical significance for the sustainable development of Monopterus albus breeding industry.

[0004] Single nucleotide polymorphism (SNP) is a DNA sequence polymorphism caused by a single nucleotide variation at the genomic level, which is the most common type of heritable variation. It widely exists in various organisms and has high genetic stability. In recent years, SNP has become one of the mainstream breeding methods. SNP breeding has achieved various results in animals and plants. The prerequisite for SNP breeding is to find functional genes. At present, the research on disease resistance genes and related SNPs of Monopterus albus is being continuously deepened. SUMMARY

[0005] The present application aims to provide a molecular marker related to the disease resistance of Monopterus albus and application thereof, so as to solve the problems existing in the prior art. The molecular marker provided by the present application is related to the disease resistance of Monopterus albus and can be applied to the identification of the disease resistance of Monopterus albus, thereby providing effective technical support for the breeding of Monopterus albus varieties with disease resistance.

[0006] To achieve the above-mentioned object, the present application provides the following solutions.

[0007] The present application provides a TC1A gene molecular marker related to the disease resistance of Monopterus albus, wherein the nucleotide sequence of the TC1A gene molecular marker is shown in SEQ ID NO. 6; and a SNP site exists at the 508th base of the TC1A gene molecular marker, which is a T / C mutation.

[0008] The present application also provides a primer pair for detecting the disease resistance of Monopterus albus, comprising an upstream primer TC1A-F with a nucleotide sequence shown in SEQ ID NO. 4 and a downstream primer TC1A-R with a nucleotide sequence shown in SEQ ID NO. 5.

[0009] The present application also provides a SFRP2 gene molecular marker related to the disease resistance of Monopterus albus, wherein the nucleotide sequence of the SFRP2 gene molecular marker is shown in SEQ ID NO. 3.

[0010] A SNP site exists at the 575th base of the SFRP2 gene molecular marker, which is a T / C mutation; and a SNP site exists at the 587th base of the SFRP2 gene molecular marker, which is a T / C mutation.

[0011] The present application also provides a primer combination for detecting the disease resistance of Monopterus albus, wherein the primer combination comprises the primers described in (a) or (b) below:

[0012] (a) an upstream primer SFRP2-F with a nucleotide sequence shown in SEQ ID NO. 1 and a downstream primer SFRP2-R with a nucleotide sequence shown in SEQ ID NO. 2;

[0013] (b) an upstream primer SFRP2-F with a nucleotide sequence shown in SEQ ID NO. 1, a downstream primer SFRP2-R with a nucleotide sequence shown in SEQ ID NO. 2, an upstream primer TC1A-F with a nucleotide sequence shown in SEQ ID NO. 4, and a downstream primer TC1A-R with a nucleotide sequence shown in SEQ ID NO. 5.

[0014] The present application also provides the application of the primer pair or primer combination described above in the preparation of a product for detecting the disease resistance of Monopterus albus.

[0015] The application also provides a detection product for detecting the disease resistance of the rice field eel, comprising the primer pair or the primer combination.

[0016] The application also provides application of the TC1A gene molecular marker, the primer pair, the SFRP2 gene molecular marker, the primer combination or the detection product in detecting the disease resistance of the rice field eel for non-disease diagnosis or treatment purposes.

[0017] Further, the detection of the disease resistance of the rice field eel refers to detection of the resistance of the rice field eel to the rhabdovirus.

[0018] The application also provides a method for detecting the disease resistance of the rice field eel by using the TC1A gene molecular marker, comprising the following steps:

[0019] Extracting blood lymph RNA of a rice field eel to be detected to obtain cDNA by reverse transcription;

[0020] Taking the cDNA as a template, performing PCR amplification by using the primer pair, obtaining a genotype by sequencing, and judging the disease resistance of the rice field eel to be detected: the individual with the C haplotype has stronger resistance to the rhabdovirus than the individuals with other haplotypes.

[0021] The application also provides a method for detecting the disease resistance of the rice field eel by using the primer combination, comprising the following steps:

[0022] Extracting blood lymph RNA of a rice field eel to be detected to obtain cDNA by reverse transcription;

[0023] Taking the cDNA as a template, performing PCR amplification by using the primer combination, obtaining a genotype by sequencing, and judging the disease resistance of the rice field eel to be detected:

[0024] When the primer combination in (a) is used for PCR amplification, the individual with the TC haplotype has stronger resistance to the rhabdovirus than the individuals with other haplotypes;

[0025] When the primer combination in (b) is used for PCR amplification, the individual with the TCC haplotype has stronger resistance to the rhabdovirus than the individuals with other haplotypes.

[0026] The application discloses the following technical effects:

[0027] The application screens SNP sites in the coding regions of SFRP2 and TC1A genes in the population of Misgurnus anguillicus through sequence alignment, and genotypes the two genes and combinations thereof; the differences in disease resistance among genotypes are compared, and the genotype and combination thereof with the strongest disease resistance are screened, thereby providing effective molecular markers for detecting the disease resistance of Misgurnus anguillicus. The screening method for the disease resistance of Misgurnus anguillicus based on molecular markers can screen Misgurnus anguillicus varieties with excellent disease resistance by using the SNP differences of disease resistance genes, and then be used for disease resistance breeding. The application provides effective technical support for the breeding of Misgurnus anguillicus varieties with disease resistance. BRIEF DESCRIPTION OF DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed in the embodiments. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor.

[0029] Figure 1 PCR amplification agarose gel electrophoresis map of SFRP2 (A) and TC1A (B) genes cloned by the present application;

[0030] Figure 2 Statistical diagram of the death time of Misgurnus anguillicus in Example 1;

[0031] Figure 3 Disease resistance ability analysis diagram of different SNP genotypes of SFRP2 gene;

[0032] Figure 4 Disease resistance ability analysis diagram of different SNP genotypes of TC1A gene;

[0033] Figure 5 Disease resistance ability analysis diagram after combined analysis of SNP genotypes of SFRP2 and TC1A genes. DETAILED DESCRIPTION

[0034] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.

[0035] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the stated range, and any other stated value or intermediate value in the stated range, is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0036] Unless otherwise indicated, all technical and scientific terms have the same meaning as those one of ordinary skill in the art of the present application would attribute to them. Although preferred methods and materials are described, any method and material similar or equivalent to those described herein can be used in the practice of the present application. All documents mentioned in this specification are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict between the present specification and any incorporated document, the present specification controls.

[0037] Various modifications and changes can be made to the present disclosure without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the disclosure of the specification. The specification and examples given are exemplary only.

[0038] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” and the like are open-ended terms that are intended to mean including, but not limited to.

[0039] Example 1

[0040] SNP site mining and disease resistance analysis were performed on SFRP2 gene. For SNP site mining, 200 individuals of rice field eel were selected; for disease resistance analysis, 300 individuals of rice field eel were selected (based on the actual breeding needs in the art, heterozygous individuals were excluded).

[0041] 1. SNP site mining

[0042] (1) The blood lymph RNA of 200 individuals was extracted, respectively, and the specific method was as follows:

[0043] Using 1 mL syringe from the body of the yellow shrimp 150 μL blood samples, placed in EP tube, and placed on ice. Add pre-cooled Trizol reagent (from the treasure of biological engineering Dalian Co. Ltd.) 200 μL, using a grinder grinding Trizol solution (reagent) pink, each sample again 600 μL Trizol reagent; at room temperature for 5 min, then at 4℃, 12000xg centrifugation 10 min; take 900 μL supernatant placed in a new EP tube, add 200 μL chloroform, fully mixed under the condition of shaking, do not vortex, shake 15 s or so, room temperature for 5 min; at 4℃, 12000xg, centrifugation 10 min; after centrifugation solution presents three layers, with the gun head placed below the liquid surface carefully take 400 μL supernatant; add equal amount of isopropanol to 400 μL, gently mixed, at room temperature for 5 min; at 4℃, 12000xg, centrifugation 15 min, until a white precipitate is observed; remove the supernatant, do not suck the precipitate, if no precipitate leave a small amount of solution, add DEPC water configuration of 1 mL 75% concentration of ethanol, resuspended; at 4℃, 8000xg, centrifugation 5 min, remove the supernatant; suction dry solution, the EP tube placed in the fume hood dry 5 min.

[0044] (2) using reverse transcription kit produced by Tiangen Biotech (Beijing) Co. Ltd. Reverse transcription to get cDNA, the specific steps are as follows:

[0045] 8 μL RNA solution, 2 μL 5x FastKing-RT SuperMix, 10 μL ddH2O mixed in PCR tube, placed in PCR instrument, reaction program: 42℃ 15 min; 95℃ 3 min.

[0046] (3) design primers for PCR amplification of SFRP2 gene full-length sequence, amplification of different individual SFRP2 gene fragments (SFRP2-1, SFRP2-2, SFRP2-3, SFRP2-4) Figure 1 ), sent to commercial sequencing company (Shanghai Sangon Biological Technology Co. Ltd.) for sequencing, the specific sequence information feedback from the sequencing company, using software Sequencher to compare the sequence differences of disease resistance genes among individuals, and screen SNP sites. It is determined by detection that the disease resistance gene SFRP2 has 2 SNP sites, respectively located at the 575th and 587th bases of SFRP2 gene, and 4 genotypes, see Table 1 for detailed typing.

[0047] Table 1 summary of SFRP2 gene SNP typing results

[0048]

[0049] 2. Disease resistance detection

[0050] (1) Primers were designed by Primer5 software for detecting the genotypes of SNP sites at positions 575 and 587 of SFRP2 gene.

[0051] 575 and 587 site amplification primers:

[0052] Primer SFRP2-F: 5'-ATGAGAGCCTTTACATCCACGGTG-3' (SEQ ID NO. 1);

[0053] Primer SFRP2-R: 5'-CTAGCACTGAAGCTTACGGATGC-3' (SEQ ID NO. 2);

[0054] 575 and 587 site PCR amplification products (SEQ ID NO. 3):

[0055] ATGAGAGCCTTTACATCCACGGTGACAGTCTTGTGGGTGATAACAATACCCTACATGGAAGCCATCCACGGATTGTACAGTTTTGGCCAACATGAATTATTCTACAAAAAGAATAACTGTAAGCCAATTCCTACAAGCCTCCTCCTATGCCACAATATAGAATACACGGCGATGCGCCTACCGAATCTCCTCGGACACGAAACTATGAATGAAGTTCTGCAGCAAGCTTCGTCTTGGATCCCACTGGTTCAGAAGCAATGTCACCCCGACACAAGAAAGTTCCTCTGCTCCCTTTTCGCTCCCGTCTGTCTGGACGATTTGGACGAGCCTATTCAACCGTGCAGGTCTCTGTGCGAAAACGTCAAAAATGGCTGTGCGCCCGTGATGTCCGCGTTTGGCTTTCCCTGGCCGAAGATGTTGGACTGCGACCGTTTTCCACCCGACAATGACCTGTGCATACCACCTGCAAACACCGAGAACTTTGTGCCAGCCACCAAAGAAGGTGACGGTTGTTAAATTGTGTTTTAGAAGTAATTTTACCCCTCCCAAGTTCGGCACATAAATGTCAAGTTCA Y TTAGTTGCGCA YGTAGATTTTCAATATAGCCACTCATTTGTCCGTGCATGACCAAATTCATCTGTGGTCGTGTGTCCTACGTATTATGTACACTACATAAATTTTTATTATATAATAGGCCTATTCACCTGTAGATTGTGCCATTTCTTTCCCTAACGATTACTGATTTGTTATTGAACCTAATCTATTTGTTTTAGTGCCCAGAGTGTGTGATGCTTGCAAAGAAACAGATGAAAATGACAACGAAATTGCTGTCAACCTGTGCAAGAATGACTTCGCTCTGAAGATCAAAGTCAAGGAAATTTCCTACATCAACGGTGATACAAAGATTGTGCCAGACTCCAAGAGTAAGACCATTTATAAGCTGAGCGGCGTGACCGAGCGTGACCTGAAGAAGACGGTGCTGTGGTTGAAGGACGGCCTGCAGTGCATCTGTGAGGAGATGAACGACATCAACGCTGCCTACCTGGTCATGGGCCAAAAGATGGACGGCCACCTGGTCATCACCTCGCTGAAGCGCTGGCAGAAGGGACAGCGCGAGTTTAAGAGGATTTCCCGCAGCATCCGTAAGCTTCAGTGCTAG; wherein Y represents T or C.

[0056] PCR amplification reaction system: 2x PCR Mix 10 μL, primer SFRP2-F and SFRP2-R each 1 μL, cDNA template 1 μL, ddH2O 7 μL.

[0057] PCR amplification reaction conditions: 95℃ pre-denaturation 5 min; 95℃ denaturation 30 s, 50℃ annealing 30 s, 72℃ extension 30 s, 35 cycles; 72℃ re-extension 10 min; 4℃ preservation.

[0058] (2) In addition, 300 swamp eels were taken, and after extracting blood lymph RNA, reverse transcription into cDNA, the method is the same as "1. SNP site excavation" part, then PCR amplification was carried out to detect the genotypes of two SNP sites, and the primers, reaction system and reaction conditions were the same as step (1). Then each swamp eel individual was inoculated with virus, 100 each time, three times repeated, a total of 300, and the specific inoculation method was as follows:

[0059] The cell line was used to extract swamp eel rhabdovirus, and the number reached 10 8Copy number / mL, diluted to a final concentration of 10% with physiological saline 6 Copy number / mL, 200 μL of the Rhabdovirus suspension was injected into the abdominal cavity of each adult. Each adult was marked after being inoculated with the virus, and the time of death was recorded and plotted into a survival curve Figure 2 .

[0060] (3) The genotype of the SNP site of the SFRP2 gene was matched with the survival time. According to the survival time, the difference in disease resistance ability of different genotypes was screened. Through induction and summary, the genotype combination with the strongest disease resistance ability was obtained (see Figure 3 ).

[0061] (4) Result analysis: the average survival time of the adult after being inoculated with the virus was between 72 hours and 144 hours, so 72 hours to 144 hours was taken as the boundary, the survival time below 72 hours was the disease resistance ability; the survival time above 144 hours was the disease resistance ability. The results showed that in the SFRP2 gene, the adult with SFRP2-2 haplotype (i.e. TC haplotype) had the most survival time above 144 hours, and the disease resistance ability was the strongest.

[0062] Example 2

[0063] SNP site mining and disease resistance ability analysis were carried out on the TC1A gene. 200 adult R. sinensis were selected for SNP site mining; 300 adult R. sinensis (based on the actual breeding needs in the field, heterozygous individuals were excluded) were selected for disease resistance ability analysis.

[0064] 1. SNP site mining

[0065] (1) The blood lymph RNA of 200 adult R. sinensis individuals was extracted, and the method was the same as that in Example 1.

[0066] (2) The cDNA was obtained by reverse transcription using the reverse transcription kit of Tiangen Biochemical (Beijing) Co., Ltd., and the method was the same as that in Example 1.

[0067] (3) The primers for PCR amplification of the full-length sequence of the TC1A gene were designed, and the TC1A gene fragments of different individuals were amplified (see Table 1) Figure 1 ), and were sent to a commercial sequencing company (Shanghai Sangon Biological Technology Co., Ltd.) for sequencing. After the sequencing company fed back the specific sequence information, the sequence differences of the disease resistance genes among the individuals were compared by using the software Sequencher, and the SNP sites were screened. It was determined by detection that the disease resistance gene TC1A had one SNP site at the 508th base of the TC1A gene, and there were two genotypes, and the detailed typing was shown in Table 2.

[0068] Table 2 Summary of SNP typing results of TC1A gene

[0069]

[0070] 2. Disease resistance detection

[0071] (1) Primers were designed using Primer 5 software for detecting the genotypes of SNP site at position 508 of TC1A gene.

[0072] Primer TC1A-F: 5'-ATGCCAAGATCCAAAGAAATTCAGGA-3' (SEQ ID NO. 4);

[0073] Primer TC1A-R: 5'-CCACCCTTAGCAGCAATAACTGC-3' (SEQ ID NO. 5).

[0074] PCR amplification product (SEQ ID NO. 6):

[0075]

[0076] PCR amplification reaction system: 2x PCR Mix 10 μL, TC1A-F and TC1A-R 1 μL each, cDNA template 1 μL, ddH2O 7 μL.

[0077] PCR amplification reaction conditions: 95°C pre-denaturation 5 min; 95°C denaturation 30 s, 50°C annealing 30 s, 72°C extension 30 s, 35 cycles; 72°C re-extension 10 min; 4°C storage.

[0078] (2) Another 300 eels were taken, and after extracting blood lymph RNA, reverse transcription into cDNA, the method is the same as example 1, then PCR amplification was carried out to detect the genotypes of the two SNP sites, and the primers, reaction system and reaction conditions were the same as step (1). Then each eel was inoculated with virus, 100 times each time, three times repeated, a total of 300, and the specific inoculation method was the same as example 1. Each eel inoculated with virus was marked, and its death time was recorded.

[0079] (3) The genotype of TC1A gene SNP site was corresponded with the survival time. According to the survival time, the difference of disease resistance ability of different genotypes was screened. Through induction and summary, the genotype with the strongest disease resistance ability was obtained (see Figure 4 ).

[0080] (4) Result analysis: the average survival time of eels after inoculation with virus was between 72 hours and 144 hours, therefore, 72 hours to 144 hours was taken as the boundary, the survival time below 72 hours was poor in disease resistance ability, and the survival time above 144 hours was strong in disease resistance ability. The results showed that in TC1A gene, the proportion of eels with haplotype TC1A-2 above 144 hours was the most, and the disease resistance ability was the strongest.

[0081] Example 3

[0082] 300 eels were selected, and the SNP sites of SFRP2 gene and TC1A gene were combined to further analyze the difference of disease resistance ability of different genotype combinations.

[0083] (1) After extracting blood lymph RNA, reverse transcription into cDNA, the method is the same as example 1, then PCR amplification was carried out to detect the genotypes of the three SNP sites, and the primers, reaction system and reaction conditions were the same as examples 1 and 2. Then each eel was inoculated with virus, 100 times each time, three times repeated, a total of 300, and the specific inoculation method was the same as example 1. Each eel inoculated with virus was marked, and its death time was recorded.

[0084] (2) Corresponding the genotypes of SFRP2 and TC1A gene SNP sites with the survival time. According to the survival time, the difference of disease resistance ability of different genotypes is screened. By induction and summary, the genotype with the strongest disease resistance ability is obtained (see Figure 5 ).

[0085] (3) Result analysis: the average survival time of the virus inoculated in the rice field eel is between 72 hours and 144 hours, so 72 hours to 144 hours is taken as the boundary, the survival time below 72 hours is poor in disease resistance ability, and the survival time above 144 hours is strong in disease resistance ability. The results show that under the joint action of the two genes, the rice field eel individuals with haplotype SFRP2-2+TC1A-2 (i.e. TCC) have the best disease resistance effect.

[0086] The above-described embodiments are only used to describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements of the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. A molecular marker for the TC1A gene associated with disease resistance in swamp eels, characterized in that, The nucleotide sequence of the TC1A gene molecular marker is shown in SEQ ID NO.6; the SFRP2 gene molecular marker has an SNP site at the 508th base, which is a T / C mutation.

2. A primer pair for detecting disease resistance in swamp eels, characterized in that, It includes the upstream primer TC1A-F with the nucleotide sequence shown in SEQ ID NO.4 and the downstream primer TC1A-R with the nucleotide sequence shown in SEQ ID NO.

5.

3. A molecular marker for the SFRP2 gene associated with disease resistance in swamp eels, characterized in that, The nucleotide sequence of the SFRP2 gene molecular marker is shown in SEQ ID NO.3; The SFRP2 gene molecular marker has an SNP site at position 575, which is a T / C mutation; and an SNP site at position 587, which is also a T / C mutation.

4. A primer combination for detecting disease resistance in swamp eels, characterized in that, The primer combination includes the primers described in (a) or (b) below: (a) The upstream primer SFRP2-F with the nucleotide sequence shown in SEQ ID NO.1 and the downstream primer SFRP2-R with the nucleotide sequence shown in SEQ ID NO.2; (b) The upstream primer SFRP2-F with nucleotide sequence as shown in SEQ ID NO.1, the downstream primer SFRP2-R with nucleotide sequence as shown in SEQ ID NO.2, the upstream primer TC1A-F with nucleotide sequence as shown in SEQ ID NO.4, and the downstream primer TC1A-R with nucleotide sequence as shown in SEQ ID NO.

5.

5. The application of a primer pair as described in claim 2 or a primer combination as described in claim 4 in the preparation of a detection product for the disease resistance of swamp eels.

6. A product for detecting the disease resistance of eels, characterized in that, Includes the primer pair as described in claim 2 or the primer combination as described in claim 4.

7. The application of the TC1A gene molecular marker as described in claim 1, the primer pair as described in claim 2, the molecular marker combination as described in claim 3, the primer combination as described in claim 4, or the detection product as described in claim 6 in detecting the disease resistance of swamp eels for non-disease diagnosis or treatment purposes.

8. The application according to claim 7, characterized in that, The detection of disease resistance in eels refers to the detection of eels' resistance to rhabdoviruses.

9. A method for detecting disease resistance in swamp eels using the TC1A gene molecular marker as described in claim 1, characterized in that, Includes the following steps: Hemolymph RNA was extracted from individual eels to be tested and reverse transcribed to obtain cDNA; Using the cDNA as a template, PCR amplification was performed using the primer pair described in claim 2. The genotype was obtained by sequencing, and the disease resistance of the tested eel individuals was determined: individuals with haplotype C showed stronger resistance to rhabdovirus than those with other haplotypes.

10. A method for detecting disease resistance in swamp eels using the molecular marker combination described in claim 3, characterized in that, Includes the following steps: Hemolymph RNA was extracted from individual eels to be tested and reverse transcribed to obtain cDNA; Using the cDNA as a template, PCR amplification was performed using the primer combination described in claim 4. The genotype was obtained by sequencing, and the disease resistance of the tested eel individuals was determined. When PCR amplification is performed using the primer combination described in claim 4(a), individuals with the TC haplotype have stronger resistance to rhabdovirus than other haplotypes. When PCR amplification is performed using the primer combination described in claim 4(b), individuals with the TCC haplotype exhibit stronger resistance to rhabdovirus than those with other haplotypes.

Images