Genetically modified soybean incident JK1013-2 and its detection method

Abstract

This invention belongs to the field of plant breeding technology and relates to the transgenic soybean event JK1013-2 and its detection method. This invention provides a nucleic acid molecule for detecting the transgenic soybean event JK1013-2, the sequence of which is shown in one or more of SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5 or their complementary sequences, and the nucleic acid molecule originates from the transgenic soybean event JK1013-2. Soybean plants containing the transgenic soybean event JK1013-2 of this invention have the following advantages: they contain the human milk β-casein gene and can stably express human milk β-casein; they are tolerant to the commonly used commercial herbicide glufosinate; they do not reduce soybean yield; and they allow for the tracking of transgenic insertion fragments in the breeding population and its offspring using molecular markers.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant breeding, and relates to a transgenic soybean event JK1013-2 and a detection method thereof. BACKGROUND

[0002] Casein (CN), also known as casein, casein and lactalbumin, is a kind of phosphorus-calcium binding protein, which widely exists in the milk of mammals (cows, yaks, goats, horses, rabbits, etc.) and humans, among which the content in cow milk is the most, accounting for about 80% of the total protein in cow milk. The molecular structure of casein is extremely complex, and its molecular weight is about 20 kDa-25 kDa. Casein can be divided into four categories according to the different molecular properties, which are αS1-casein, αS2-casein, β-casein and κ-casein.

[0003] β-casein (β-CN) is a phosphorylated protein synthesized by mammary gland alveolar epithelial cells, which has multiple important functional properties. In terms of nutrition, it is a high-quality protein source, rich in essential amino acids for the human body, and can provide the nutrients required for growth, repair and maintenance of physiological functions. In addition, β-casein can bind to calcium ions and other minerals to form soluble complexes, promoting the absorption and utilization of minerals and having a positive impact on bone health. In terms of physiological regulation, β-casein can be enzymatically hydrolyzed into various bioactive peptides during digestion, and these active peptides have multiple physiological functions such as blood pressure reduction, antioxidant, antibacterial, immune regulation, etc. For example, certain peptide segments derived from β-casein can inhibit the activity of angiotensin-converting enzyme, thereby reducing blood pressure and benefiting cardiovascular health.

[0004] Due to its good nutritional value and physiological function, β-casein has a wide range of applications in food, medical and other fields. In the food industry, β-casein can be used to improve the texture, taste and stability of dairy products, and improve the quality of products. For example, in the production process of yogurt, cheese and other products, the addition of β-casein can optimize the gel structure of the product, making it more delicate and smooth in taste. In the medical field, β-casein and its derived bioactive peptides are expected to be developed as functional foods or drugs for the prevention and treatment of certain chronic diseases such as hypertension, cardiovascular disease, etc.

[0005] With the development of biotechnology and the acquisition of large amounts of genome and transcriptome sequencing data, tobacco, maize, rice, potato, duckweed, microalgae, plant cell suspension systems, and hairy roots have become key research subjects for plant chassis. Compared with synthetic biology using animals and microorganisms as chassis, plants have advantages in expressing exogenous proteins, such as simple methods, low cost, easy large-scale production, and convenient storage and transportation. Furthermore, using higher plants to express exogenous proteins allows for post-translational modification of the expressed protein without the risk of infection by pathogens or endotoxins, making plants one of the ideal choices for expressing exogenous proteins. To effectively produce exogenous proteins, selecting a suitable plant host is crucial.

[0006] Soybeans Glycine max Soybeans (Linn.) Merr., as a high-quality source of plant protein, are important food and oilseed crops in many parts of the world. Biotechnology has been applied to soybeans to improve their agronomic traits and quality. An important agronomic trait in soybean production is herbicide tolerance, especially tolerance to glufosinate-ammonium herbicide. Tolerance to glufosinate-ammonium herbicide in soybeans can be improved through transgenic methods by introducing the glufosinate-ammonium-tolerant gene (…). pat It was obtained by expression in soybean plants.

[0007] Besides the functional genes themselves, the selection and sequential arrangement of regulatory elements are crucial for obtaining favorable transformation events, and their technical effects are unpredictable. Furthermore, it is known that the expression of exogenous genes in plants is influenced by their insertion location into the soybean chromosome, possibly due to the proximity of chromatin structures (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) to the integration site. Therefore, it is often necessary to screen a large number of events to identify those suitable for commercialization (i.e., events where the introduced target gene is optimally expressed). For example, significant differences in the expression levels of introduced genes have been observed between events in plants and other organisms; differences may also exist in spatial or temporal expression patterns, such as the relative expression of transgenes in different plant tissues. These differences manifest as the actual expression pattern potentially differing from the expected expression pattern of the transcriptional regulatory elements in the introduced gene construct. Therefore, it is often necessary to generate hundreds or thousands of different events and screen from these events to identify a single event with the expected transgene expression levels and patterns for commercial purposes. Such transformation events, containing the human milk β-casein gene and exhibiting excellent glufosinate herbicide resistance without affecting soybean yield, can be backcrossed into other genetic backgrounds using conventional breeding methods. The offspring produced through this hybridization retain the transgenic expression characteristics and phenotypic traits of the original transformant. Applying this strategy can ensure reliable gene expression in many varieties, containing stable human milk β-casein gene expression and possessing glufosinate herbicide resistance, giving these varieties broad-spectrum weed control capabilities while allowing them to adapt well to local growing conditions.

[0008] Being able to detect the presence of specific events to determine whether the offspring of sexual hybridization contain the target gene would be beneficial. Furthermore, methods for detecting specific events would help comply with relevant regulations, such as the requirement for formal approval and labeling of foods derived from recombinant crops before they can be placed on the market. Detecting the presence of transgenes using any well-known polynucleotide detection method is possible, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These methods typically focus on commonly used genetic elements, such as promoters, terminators, and marker genes. Therefore, unless the sequence of the chromosomal DNA adjacent to the inserted transgenic DNA (“flanking DNA”) is known, the above methods cannot be used to distinguish different events, especially those produced using the same DNA construct. Therefore, it is currently common to use a pair of primers spanning the junction of the inserted T-DNA and the flanking DNA via PCR to identify transgenic specific events; specifically, a first primer containing the flanking sequence and a second primer containing the inserted sequence. Summary of the Invention

[0009] The purpose of this invention is to provide a genetically modified soybean event JK1013-2 and a nucleic acid sequence for detecting the JK1013-2 event in soybean plants, as well as a detection method thereof, which can accurately and rapidly identify whether a biological sample contains DNA molecules of a specific genetically modified soybean event JK1013-2.

[0010] To achieve the above objectives, this invention provides a nucleic acid molecule for detecting the transgenic soybean event JK1013-2. The sequence of the nucleic acid molecule comprises any one of sequences selected from SEQ ID NO:1-5 and their complementary sequences. The nucleic acid molecule originates from transgenic soybean plants, seeds, or cells containing the transgenic soybean event JK1013-2. Soybean seeds containing the transgenic soybean event JK1013-2 have been deposited with the China Center for Type Culture Collection (CCTCC, address: Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China) under accession number CCTCC NO:P202528, and are classified as: Soybean Seed JK1013-2 Glycine max. L, deposit date: September 13, 2025.

[0011] In some embodiments, the sequences of the nucleic acid molecules are shown in one or more of SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5 or their complementary sequences, and the nucleic acid molecules are derived from the transgenic soybean event JK1013-2. Soybean seeds containing the transgenic soybean event JK1013-2 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202528.

[0012] In some embodiments, the nucleic acid molecules are derived from plants, seeds, or cells that include the transgenic soybean event JK1013-2.

[0013] In some embodiments of the present invention, a nucleic acid molecule is provided comprising at least 12 consecutive nucleotides of SEQ ID NO:3 or its complementary sequence, and / or at least 8 consecutive nucleotides of SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid molecule comprises SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence. In some embodiments, the nucleic acid molecule comprises SEQ ID NO:3 or its complementary sequence, and / or SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid molecule comprises SEQ ID NO:5 or its complementary sequence.

[0014] The SEQ ID NO:1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in transgenic soybean event JK1013-2. The SEQ ID NO:1 or its complementary sequence spans the flanking genomic DNA sequence of the soybean insertion site and the DNA sequence at the 5' end of the inserted sequence. The presence of the SEQ ID NO:1 or its complementary sequence is sufficient to identify the transgenic soybean event JK1013-2. The SEQ ID NO:2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in transgenic soybean event JK1013-2. The SEQ ID NO:2 or its complementary sequence spans the DNA sequence at the 3' end of the inserted sequence and the flanking genomic DNA sequence of the soybean insertion site. The presence of the SEQ ID NO:2 or its complementary sequence is sufficient to identify the transgenic soybean event JK1013-2.

[0015] The nucleic acid molecule provided by this invention can be at least 12 or more consecutive polynucleotides (first nucleic acid sequence) of any portion of the transgenic insertion sequence in SEQ ID NO:3 or its complementary sequence, or at least 12 or more consecutive polynucleotides (second nucleic acid sequence) of any portion of the 5' flanking soybean genomic DNA region in SEQ ID NO:3 or its complementary sequence. The nucleic acid molecule can further be a portion of SEQ ID NO:3 that is homologous to or complementary to the complete SEQ ID NO:1. When the first and second nucleic acid sequences are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method for generating amplification products. When the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:1, the presence of transgenic soybean event JK1013-2 or its progeny can be diagnosed. Those skilled in the art will appreciate that the first and second nucleic acid sequences do not necessarily consist solely of DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogues that do not serve as templates for one or more polymerases. Furthermore, the probes or primers described in this invention should be at least approximately 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length, which may be selected from the nucleotides described in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. When selected from the nucleotides shown in SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, the probes and primers may be approximately 17 to 50 or more consecutive nucleotides in length. The SEQ ID NO:3 or its complementary sequence is a 1031-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in the transgenic soybean event JK1013-2. The SEQ ID NO:3 or its complementary sequence consists of a 488-nucleotide soybean flanking genomic DNA sequence (nucleotides 1-488 of SEQ ID NO:3), a 385-nucleotide JK1013-2 construct RB end sequence (nucleotides 489-873 of SEQ ID NO:3), and a 158-nucleotide prGmA1aB1b partial sequence (nucleotides 874-1031 of SEQ ID NO:3). The presence of the SEQ ID NO:3 or its complementary sequence is sufficient to identify the transgenic soybean event JK1013-2.

[0016] The nucleic acid sequence may be at least 11 or more consecutive polynucleotides (third nucleic acid sequence) of any portion of the transgenic insertion sequence in SEQ ID NO:4 or its complementary sequence, or at least 11 or more consecutive nucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking soybean genomic DNA region in SEQ ID NO:4 or its complementary sequence. The nucleic acid sequence may further be a portion of SEQ ID NO:4 that is homologous to or complementary to the complete SEQ ID NO:2. When the third and fourth nucleic acid sequences are used together, these nucleic acid sequences include a DNA primer pair in the DNA amplification method that produces the amplification product. The presence of transgenic soybean event JK1013-2 or its progeny can be diagnosed when the amplification product produced in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:2. The SEQ ID NO:4 or its complementary sequence is a 794-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in the transgenic soybean event JK1013-2. The SEQ ID NO:4 or its complementary sequence consists of a 195-nucleotide t35S partial sequence of the JK1013 construct (nucleotides 1-195 of SEQ ID NO:4), a 181-nucleotide LB end sequence (nucleotides 196-376 of SEQ ID NO:4), and a 418-nucleotide flanking genomic DNA sequence of the soybean integration site (nucleotides 377-794 of SEQ ID NO:4). The presence of the SEQ ID NO:4 or its complementary sequence is sufficient to identify the transgenic soybean event JK1013-2.

[0017] The SEQ ID NO:5 or its complementary sequence is a 5903-nucleotide sequence characterizing the transgenic soybean event JK1013-2, and its specific genomic and genetic elements are shown in Table 1. The presence of the transgenic soybean event JK1013-2 can be identified by the presence of the SEQ ID NO:5 or its complementary sequence.

[0018] Table 1. Genome and genetic elements contained in SEQ ID NO:5

[0019] genetic element length position on SEQ ID NO: 5 5' genome 488 bp 1-488 RB region 385 bp 489-873 prGmA1aB1b 2202 bp 874-3075 HomoCSN2 681 bp 3088-3768 tNos 253 bp 3775-4027 p35S 530 bp 4028-4557 cPAT 552 bp 4558-5109 t35S 195 bp 5110-5304 LB region 181 bp 5305-5485 3' genome 418 bp 5486-5903

[0020] The nucleic acid molecules can be used in DNA amplification methods to generate amplification products, and the presence of transgenic soybean event JK1013-2 or its progeny in biological samples can be diagnosed by detecting the amplification products; the nucleic acid molecules can also be used in nucleotide detection methods to detect the presence of transgenic soybean event JK1013-2 or its progeny in biological samples.

[0021] This invention provides a DNA primer pair comprising a first primer and a second primer. When the first primer and the second primer are used together with DNA containing the transgenic soybean event JK1013-2 in an amplification reaction, an amplicon for detecting the transgenic soybean event JK1013-2 in the sample is generated.

[0022] The first primer is selected from SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or the first primer is selected from SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:14;

[0023] Soybean seeds containing the aforementioned transgenic soybean event JK1013-2 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202528.

[0024] In some embodiments of the present invention, the amplification product comprises at least 12 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 8 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence.

[0025] Further, the amplification product includes consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0026] Furthermore, the amplification product includes SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, or SEQ ID NO:7 or its complementary sequence.

[0027] The present invention also provides a DNA probe comprising a fragment of SEQ ID NO:5 or its complementary sequence, wherein the DNA probe hybridizes under strict hybridization conditions with DNA molecules comprising nucleic acid sequences selected from SEQ ID NO:1-5 or their complementary sequences, and does not hybridize under strict hybridization conditions with DNA molecules not comprising nucleic acid sequences selected from SEQ ID NO:1-5 or their complementary sequences.

[0028] In some embodiments, the DNA probe comprises a sequence selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and SEQ ID NO:7 or its complementary sequence.

[0029] In some embodiments, the DNA probe is labeled with a fluorescent group.

[0030] In some embodiments, the probe comprises at least 12 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 8 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence; further, the probe comprises consecutive nucleotides at positions 1-11 or 12-22 in SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 in SEQ ID NO:2 or its complementary sequence.

[0031] The present invention also provides a marker nucleic acid molecule comprising a fragment of SEQ ID NO:5 or its complementary sequence, wherein the marker nucleic acid molecule hybridizes under strict hybridization conditions with DNA molecules comprising nucleic acid sequences selected from SEQ ID NO:1-5 or their complementary sequences, and does not hybridize under strict hybridization conditions with DNA molecules not comprising nucleic acid sequences selected from SEQ ID NO:1-5 or their complementary sequences.

[0032] In some embodiments, the marker nucleic acid molecule comprises a sequence selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and SEQ ID NO:7 or its complementary sequence.

[0033] In one embodiment, the marker nucleic acid molecule comprises at least 12 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 8 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence.

[0034] In some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0035] Furthermore, the present invention provides a method for detecting the presence of DNA from the transgenic soybean event JK1013-2 in a sample, comprising:

[0036] (1) Contact the sample to be tested with the DNA primer pair in the nucleic acid amplification reaction;

[0037] (2) Perform nucleic acid amplification reaction;

[0038] (3) Detect the presence of amplification products;

[0039] The amplification product includes a nucleic acid sequence of SEQ ID NO:3-4 or its complementary sequence, indicating that the test sample contains DNA of the transgenic soybean event JK1013-2. The soybean seeds containing the transgenic soybean event JK1013-2 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202528.

[0040] Furthermore, the present invention also provides a method for detecting the presence of DNA from the transgenic soybean event JK1013-2 in a sample, comprising:

[0041] (1) Contact the sample to be tested with the DNA probe and / or the labeled nucleic acid molecule;

[0042] (2) Hybridize the sample to be tested with the probe and / or the labeled nucleic acid molecule under strict hybridization conditions;

[0043] (3) Detect the hybridization of the sample to be tested with the probe and / or the marker nucleic acid molecule.

[0044] The stringent conditions can be defined as hybridization at 65°C in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution, followed by washing the membrane once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.

[0045] The process involves detecting the hybridization of the sample to be tested and the marker nucleic acid molecules, and then using marker-assisted breeding analysis to determine whether herbicide tolerance is genetically linked to the marker nucleic acid molecules.

[0046] This invention also provides a DNA detection kit, comprising: a DNA primer pair that generates an amplicon for diagnosing the transgenic soybean event JK1013-2; and a probe specific to SEQ ID NO:1-5 or a marker nucleic acid molecule specific to SEQ ID NO:1-5. Specifically, the detection kit includes the probe, primer pair, or marker nucleic acid molecule described in this invention.

[0047] Furthermore, the present invention provides a DNA detection kit comprising the aforementioned DNA primer pair.

[0048] In some embodiments, the present invention provides a DNA detection kit comprising at least one DNA molecule, said DNA molecule comprising at least 12 consecutive nucleotides in the homologous sequence of SEQ ID NO:3 or its complementary sequence, or at least 8 consecutive nucleotides in the homologous sequence of SEQ ID NO:4 or its complementary sequence, which can serve as a DNA primer or probe specific to the transgenic soybean event JK1013-2 or its progeny.

[0049] Further, the DNA molecule comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0050] Furthermore, the DNA molecule includes the homologous sequence of SEQ ID NO:1 or its complementary sequence, the homologous sequence of SEQ ID NO:2 or its complementary sequence, the homologous sequence of SEQ ID NO:6 or its complementary sequence, or the homologous sequence of SEQ ID NO:7 or its complementary sequence. To achieve the above objectives, the present invention also provides a plant cell comprising a nucleic acid sequence encoding human milk β-casein HomoCSN2 and a nucleic acid sequence encoding a glufosinate-ammonium herbicide-resistant PAT protein, wherein the nucleic acid sequence in the specific region includes the sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7.

[0051] The sequences provided by this invention include those listed in Table 2 below:

[0052] Table 2. Relevant Sequences of the Invention

[0053] SEQ ID NO sequence description 1 RB end junction sequence (contains partial T-DNA RB end sequence and genomic sequence, 22 bp) 2 LB end junction sequence (contains partial T-DNA LB end sequence and genomic sequence, 22 bp) 3 5' end of insert sequence located near the insertion junction site, for T-DNA this is the RB end (contains approximately 488 bp of genomic sequence, 543 bp of T-DNA) 4 3' end of insert sequence located near the insertion junction site, for T-DNA this is the LB end (contains 418 bp of genomic sequence, 376 bp of T-DNA) 5 T-DNA full length sequence (contains 418 bp and 488 bp of genomic sequence at each end of the LB and RB, respectively) 6 Sequence located within SEQ ID NO: 3, JK1013-2 T-DNA sequence 7 Sequence located within SEQ ID NO: 4, JK1013-2 T-DNA sequence 8 First primer to amplify SEQ ID NO: 3, primer 5 9 Second primer to amplify SEQ ID NO: 3, primer 6 10 First primer to amplify SEQ ID NO: 4, primer 7 11 Second primer to amplify SEQ ID NO: 4, primer 8 12 Primer on 5' flanking genome, primer 9 13 Primer on T-DNA paired with sequence 12, primer 10 14 Primer on 3' flanking genome, primer 11 15 Primer on T-DNA paired with sequence 14, primer 12 16 Taqman detection CSN primer 1 17 Taqman detection CSN primer 2 18 Taqman detection CSN probe 1 19 Taqman detection PAT primer 3 20 Taqman detection PAT primer 4 21 Taqman detection PAT probe 2 22 Probe for CSN in Southern hybridization detection 23 Probe for PAT in Southern hybridization detection 24 Primer 15 on T-DNA in the same direction as SEQ ID NO: 13 25 Primer 16 on T-DNA in the opposite direction of SEQ ID NO: 13 26 Primer 17 on T-DNA in the opposite direction of SEQ ID NO: 13 27 Primer 18 on T-DNA in the same direction as SEQ ID NO: 15 28 Primer 19 on T-DNA in the opposite direction of SEQ ID NO: 15 29 Primer 20 on T-DNA in the opposite direction of SEQ ID NO: 15 30 Soybean elongation factor gene Gm-EF1a primer 13 31 Soybean elongation factor gene Gm-EF1a primer 14

[0054] The present invention also provides a method for protecting soybean plants from damage caused by glufosinate herbicide, comprising: planting transgenic soybean plants containing transgenic soybean event JK1013-2, applying an effective dose of glufosinate herbicide, wherein soybean seeds containing said transgenic soybean event JK1013-2 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202528.

[0055] The present invention also provides a method for controlling weeds in a field where soybean plants are grown, comprising applying an effective dose of glufosinate herbicide to a field where transgenic soybean plants are grown, the transgenic soybean plants comprising transgenic soybean event JK1013-2, and soybean seeds comprising transgenic soybean event JK1013-2 being deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202528.

[0056] The present invention also provides a method for culturing soybean plants that express human milk β-casein and are tolerant to glufosinate herbicide, comprising: planting soybean seeds containing transgenic soybean event JK1013-2;

[0057] The soybean seeds are allowed to grow and develop into soybean plants;

[0058] The soybean plants were sprayed with an effective dose of glufosinate herbicide, and plants with reduced plant damage compared to other plants that do not have the transgenic soybean event JK1013-2 were harvested. Soybean seeds containing the transgenic soybean event JK1013-2 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202528.

[0059] In some embodiments, the present invention also provides a method for producing soybean plants tolerant to glufosinate-ammonium herbicide, comprising introducing transgenic soybean event JK1013-2 into the genome of the soybean plant and selecting glufosinate-tolerant soybean plants. In some embodiments, the method comprises: sexually crossing a first parent soybean plant tolerant to glufosinate-ammonium herbicide transgenic soybean event JK1013-2 with a second parent soybean plant lacking glufosinate tolerance to produce a large number of progeny plants; treating the progeny plants with glufosinate-ammonium herbicide; and selecting the glufosinate-tolerant progeny plants.

[0060] This invention also provides a composition derived from the transgenic soybean event JK1013-2, said composition being soybean flour, soybean oil, soybean protein, soybean products, or soybean by-products. In some embodiments, the composition may be soybean flour, soy protein isolate, soybean oil, soybean protein, soybean products, soybean by-products, feed, or industrial products or commodities. If sufficient expression levels are detected in said composition, the composition is expected to contain nucleic acid sequences capable of diagnosing the presence of transgenic soybean event JK1013-2 material in said composition. Specifically, the composition includes, but is not limited to, soybean flour, soy protein isolate, soybean oil, soybean protein, soybean products, soybean by-products, and any other food intended as a food source for animal consumption, or additionally as a component of soybean oil or stearic acid for food industry use.

[0061] The probe- or primer-based detection method and / or kit of the present invention can be used to detect the nucleic acid sequence of transgenic soybean event JK1013-2, such as SEQ ID NO:1 or SEQ ID NO:2, in biological samples, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, to diagnose the presence of transgenic soybean event JK1013-2.

[0062] In summary, the genetically modified soybean JK1013-2 of this invention exhibits herbicide tolerance and has the following advantages:

[0063] 1) Possesses a human milk β-casein gene with stable genetic expression;

[0064] 2) The ability to apply glufosinate-containing agricultural herbicides to soybean crops for broad-spectrum weed control;

[0065] 3) Soybean production did not decrease.

[0066] Specifically, the transgenic soybean event JK1013-2 of this invention has a human milk β-casein expression level of up to 1.94 mg / g; it also exhibits high tolerance to glufosinate herbicide, protecting plants to a damage rate as low as 0% even at 4 times the recommended dose; and plants containing this event show excellent agronomic traits, with a yield percentage as high as 100%. Furthermore, the primer or probe sequences provided in the detection method of this invention can generate amplification products that identify transgenic soybean event JK1013-2 or its progeny, enabling rapid, accurate, and stable identification of plant materials derived from transgenic soybean event JK1013-2.

[0067] term

[0068] The following definitions and methods are intended to better define this invention and guide those skilled in the art in carrying it out. Unless otherwise stated, the terms should be understood according to their conventional usage by those skilled in the art.

[0069] The soybean ( Glycine max ), and includes all plant species that can interbreed with soybeans, including wild soybean species.

[0070] The term "comprising" means "including but not limited to". The term "processed product" refers to a product obtained by processing raw materials such as plants and seeds, such as compositions.

[0071] The term "plant" includes the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, plant clumps, and complete plant cells in a plant or plant part, such as embryo, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that parts of transgenic plants within the scope of this invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves, and roots, all of which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of this invention and are therefore at least partially composed of transgenic cells.

[0072] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including the regulatory sequence preceding the coding sequence (5' non-coding sequence) and the regulatory sequence following the coding sequence (3' non-coding sequence). A "natural gene" is a gene that is naturally found to have its own regulatory sequence. A "chimeric gene" is any gene that is not a natural gene but contains regulatory and coding sequences not naturally found. An "endogenous gene" is a natural gene located at its natural position in an organism's genome. A "foreign gene" is a foreign gene that is currently present in an organism's genome and was not originally present; it also refers to a gene introduced into a recipient cell through a transgenic process. Foreign genes can include natural genes inserted into non-natural organisms or chimeric genes. A "transgenic gene" is a gene that has been introduced into the genome through a transformation process. The site where recombinant DNA has been inserted into the plant genome can be called an "insertion site" or a "target site."

[0073] "Flanking DNA" can comprise the genome naturally present in organisms such as plants or exogenous (heterologous) DNA introduced through a transformation process, such as fragments associated with the transformation event. Therefore, flanking DNA can comprise a combination of natural and exogenous DNA. In this invention, a "flanking region," "flanking sequence," "genome boundary region," or "genome boundary sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or longer, located directly upstream or downstream of and adjacent to the original exogenous inserted DNA molecule. When the flanking region is downstream, it can also be referred to as a "left boundary flanking," "3' flanking," "3' genome boundary region," or "genome 3' boundary sequence," etc. When this flanking region is located upstream, it can also be referred to as the "right boundary flanking region", "5' flanking region", "5' genome boundary region", or "genome 5' boundary sequence", etc.

[0074] Transformation procedures that induce random integration of exogenous DNA result in transformants containing distinct flanking regions, which are unique to each transformant. When recombinant DNA is introduced into plants via conventional hybridization, these flanking regions typically remain unchanged. Transformants also contain unique junctions between segments of the heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. A "junction" is the point where two specific DNA segments join. For example, junctions exist where the insert DNA joins flanking DNA. Junction points also exist in transformed organisms, where two DNA segments are joined together in a manner modified from those found in natural organisms. "Junction DNA" refers to DNA containing junction points.

[0075] This invention provides a transgenic soybean event called JK1013-2 and its progeny, wherein the transgenic soybean event JK1013-2 is the soybean plant JK1013-2, which includes the plant and seeds of the transgenic soybean event JK1013-2 and its plant cells or renewable parts thereof. The plant parts of the transgenic soybean event JK1013-2 include, but are not limited to, cells, pollen, ovules, flowers, buds, roots, stems, inflorescences, leaves and products from the soybean plant JK1013-2, such as soybean flour, soybean oil, soy milk, soy protein, soy products and biomass remaining in the soybean crop field.

[0076] The present invention relates to a transgenic soybean event JK1013-2 containing a DNA construct that, when expressed in plant cells, acquires human milk β-casein gene expression and tolerance to glufosinate herbicide.

[0077] In some embodiments of the present invention, the DNA construct comprises two tandem expression cassettes. The first expression cassette contains a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to a gene encoding human milk β-casein (HomoCSN2). The second expression cassette contains a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to a gene encoding phosphinic acid acetyltransferase (cPAT), the PAT protein being resistant to glufosinate herbicide. Further, the promoter can be a suitable promoter isolated from plants, including constitutive, inducible, and / or tissue-specific promoters, including but not limited to the soybean endogenous gene prGmA1aB1b promoter and the 35S promoter of cauliflower mosaic virus (CaMV). The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants, including but not limited to the tNos terminator derived from cauliflower mosaic virus 35S and the t35S terminator derived from cauliflower mosaic virus 35S.

[0078] Furthermore, the expression cassette may also include other genetic elements, including but not limited to enhancers. These enhancers can amplify gene expression levels, and include, but are not limited to, the prGmA1aB1b enhancer.

[0079] In some embodiments of the present invention, soybean cells, seeds or plants comprising the transgenic soybean event JK1013-2 contain, in sequence, the nucleic acid sequences of positions 500-5474 of SEQ ID NO:1 and SEQ ID NO:5 and SEQ ID NO:2, or contain SEQ ID NO:5.

[0080] The glufosinate-ammonia acetyltransferase (PAT) gene can be isolated from *Streptomyces viridochromogenes*, and the stability and availability of transcripts in transformed cells can be increased by optimizing the codons or otherwise altering the polynucleotides encoding the EPSPS gene. The glufosinate-ammonia acetyltransferase (PAT) gene can also serve as a selective marker gene. "Glufosinate" refers to ammonium 4-[hydroxy(methyl)phosphono]-DL-holylanine or 2-amino-4-[hydroxy(methyl)phosphono]butyrate. Treatment with "glufosinate herbicide" means treatment with any glufosinate-containing herbicide formulation. The selection of the application rate of a glufosinate formulation to achieve an effective biological dose shall not exceed the skill level of a general agronomist. Treatment of fields containing plant material derived from the transgenic soybean event JK1013-2 with any glufosinate-containing herbicide formulation will control weed growth in the fields without affecting the growth or yield of the plant material derived from the transgenic soybean event JK1013-2.

[0081] The DNA construct is introduced into plants using transformation methods, including but not limited to Agrobacterium-mediated transformation, gene gun transformation, and pollen tube pathway transformation.

[0082] Agrobacterium-mediated transformation is a commonly used method for plant transformation. Exogenous DNA to be introduced into the plant is cloned into the T-DNA region between the common sequences on the left and right boundaries of a vector. The vector is then transformed into Agrobacterium cells, which are subsequently used to infect plant tissues, whereby the T-DNA region of the vector containing the exogenous DNA is inserted into the plant genome.

[0083] The gene gun transformation method refers to bombarding plant cells with a vector containing exogenous DNA (particle-mediated biological bombardment transformation).

[0084] The pollen tube pathway transformation method utilizes the natural pollen tube pathway (also known as pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into the embryo sac via the nucellus pathway.

[0085] After transformation, transgenic plants must be regenerated from the transformed plant tissues, and offspring with exogenous DNA must be selected using appropriate markers.

[0086] DNA constructs are combinations of interconnected DNA molecules that provide one or more expression cassettes. Specifically, DNA constructs are plasmids capable of self-replication within bacterial cells and containing various restriction endonuclease sites for introducing DNA molecules that provide functional genetic elements, namely promoters, introns, leader sequences, coding sequences, 3' terminator regions, and other sequences. The expression cassettes contained in the DNA constructs include genetic elements necessary for the transcription of messenger RNA, and these cassettes can be designed for expression in prokaryotic or eukaryotic cells. The expression cassettes of the present invention are designed most specifically for expression in plant cells.

[0087] A transgenic “event” is obtained by transforming plant cells with a heterologous DNA construct, comprising at least one nucleic acid expression cassette containing the target gene, inserted into the plant genome via transgenic methods to generate a plant population, regenerate the plant population, and select specific plants with characteristics of the insertion at a specific genomic site. The term “event” refers to the original transformant containing heterologous DNA and the offspring of that transformant. The term “event” also refers to the offspring obtained by sexual hybridization between the transformant and other varietal individuals containing heterologous DNA, where, even after repeated backcrossing with a backcross parent, the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the hybrid offspring. The term “event” also refers to a DNA sequence from the original transformant containing the inserted DNA and flanking genomic sequences closely adjacent to the inserted DNA, which is intended to be transferred to offspring produced by sexual hybridization of a parental line containing the inserted DNA (e.g., the original transformant and its self-crossed offspring) with a parental line not containing the inserted DNA, and the offspring receiving the inserted DNA containing the target gene.

[0088] In this invention, "recombination" refers to a form of DNA and / or protein and / or organism that is not normally found in nature and is therefore produced through artificial intervention. Such artificial intervention can produce recombinant DNA molecules and / or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two sequence segments that are otherwise separate, for example, by chemical synthesis or by manipulating isolated nucleic acid segments using genetic engineering techniques. Techniques for manipulating nucleic acids are well known.

[0089] The term "transgenic" includes any cell, cell line, callus, tissue, plant part, or plant whose genotype has been altered due to the presence of a heterologous nucleic acid. "Transgenic" includes the original transgenic organism that was so altered, as well as offspring individuals generated from the original transgenic organism through sexual hybridization or asexual reproduction. In this invention, the term "transgenic" does not include genomic (chromosomal or extrachromosomal) alterations achieved through conventional plant breeding methods or naturally occurring events such as random allogeneic fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

[0090] In this invention, "heterogeneous" means that the first molecule is not typically found to combine with the second molecule in nature. For example, a molecule may originate from a first species and be inserted into the genome of a second species. Therefore, such a molecule is heterologous to the host and is artificially introduced into the host cell's genome.

[0091] Two different transgenic plants can also be hybridized to produce offspring containing two independent, segregated foreign genes. Self-pollination of appropriate offspring can yield plants that are homozygous for both added foreign genes. Backcrossing of parental plants and heteromorphic hybridization with non-transgenic plants, as described above, are also expected, as is asexual reproduction.

[0092] The term "probe" refers to a segment of isolated nucleic acid molecule to which conventional detectable markers or reporter molecules, such as radioisotopes, ligands, chemiluminescent agents, or enzymes, may be bound. This probe is complementary to one strand of the target nucleic acid. In this invention, the probe is complementary to one strand of the genome from the transgenic soybean event JK1013-2, regardless of whether the genomic DNA originates from the transgenic soybean event JK1013-2, its seeds, or from plants, seeds, or extracts of the transgenic soybean event JK1013-2. The probes of this invention include not only deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of that target DNA sequence.

[0093] The term "primer" refers to a segment of isolated nucleic acid molecule that binds to a complementary target DNA strand through nucleic acid hybridization and annealing, forming a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of this invention relate to their application in the amplification of target nucleic acid sequences, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0094] Methods for designing and using primers and probes are well known in the art. DNA molecules containing full-length or fragmented sequences of SEQ ID NO:1-7 can be used as primers and probes for detecting soybean event JK1013-2, and can be readily designed by those skilled in the art using the sequences provided herein.

[0095] The probes and primers are typically 11 polynucleotides or longer, preferably 18 polynucleotides or longer, more preferably 24 polynucleotides or longer, and most preferably 30 polynucleotides or longer. These probes and primers specifically hybridize to the target sequence under highly stringent hybridization conditions. Although probes that differ from the target DNA sequence and maintain hybridization ability to the target DNA sequence can be designed using conventional methods, preferably, the probes and primers of this invention have complete DNA sequence identity with the continuous nucleic acid of the target sequence.

[0096] Primers and probes for the flanking genomic DNA and insert sequences based on the present invention can be determined using conventional methods, for example, by isolating the corresponding DNA molecules from plant material derived from the transgenic soybean event JK1013-2 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule contains the transgenic insert sequence and a flanking region of the soybean genome, and fragments of the DNA molecule can be used as primers or probes.

[0097] The nucleic acid probes and primers of this invention hybridize with target DNA sequences under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic soybean event JK1013-2 in a sample. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. As used in this invention, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, one nucleic acid molecule is called a "complement" of the other nucleic acid molecule. As used in this invention, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under at least conventional "low stringency" conditions, the two nucleic acid molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under conventional "high stringency" conditions, the two nucleic acid molecules are said to be "complementary". Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. For a nucleic acid molecule to function as a primer or probe, it only needs to be sufficiently complementary in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.

[0098] As used in this invention, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions for promoting DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one can remain constant while the other is changed. Specifically, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under moderately stringent conditions, such as about 2.0 × SSC and about 65°C. More specifically, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under highly stringent conditions. In the present invention, preferred marker nucleic acid molecules have SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or their complementary sequences, or any fragment of the above sequences. SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 can be used as markers in plant breeding methods to identify offspring of genetic hybridization. Hybridization of the probe with the target DNA molecule can be detected by any method well known to those skilled in the art, including but not limited to fluorescent labeling, radioactive labeling, antibody labeling and chemiluminescent labeling.

[0099] Regarding amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "strict conditions" refer to conditions in which primers are allowed to hybridize only with the target nucleic acid sequence during a DNA thermal amplification reaction. Primers having a wild-type sequence (or its complementary sequence) corresponding to the target nucleic acid sequence are able to bind to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

[0100] The term "specific binding (target sequence)" means that, under strict hybridization conditions, the probe or primer hybridizes only with the target sequence in a sample containing the target sequence.

[0101] As used in this invention, "amplified DNA," "amplification product," or "amplifier" refers to the nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether soybean plants are produced by sexual hybridization from a transgenic soybean event JK1013-2 containing this invention, or whether soybean samples collected from the field contain transgenic soybean event JK1013-2, or whether soybean extracts, such as coarse flour, powder, or oil, contain transgenic soybean event JK1013-2, DNA extracted from soybean plant tissue samples or extracts can be amplified using a primer pair nucleic acid amplification method to generate an amplifier that is diagnostic for the presence of DNA related to transgenic soybean event JK1013-2. The primer pair includes a first primer derived from a flanking sequence in the plant genome adjacent to the insertion site of the inserted exogenous DNA, and a second primer derived from the inserted exogenous DNA. The amplifier has a specific length and sequence that is also diagnostic for the transgenic soybean event JK1013-2. The length of the amplicon can be the binding length of the primer pair plus one nucleotide base pair, preferably about fifty nucleotide base pairs, more preferably about two hundred and fifty nucleotide base pairs, and most preferably about four hundred and fifty nucleotide base pairs or more.

[0102] Optionally, primer pairs can be derived from flanking genomic sequences on either side of the inserted DNA to generate amplicons comprising the entire inserted nucleic acid sequence. One of the primer pairs derived from plant genome sequences can be located at a distance from the inserted DNA sequence, ranging from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplifier" specifically excludes primer dimers formed during thermal amplification of DNA.

[0103] Nucleic acid amplification reactions can be performed using any nucleic acid amplification method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22kb of genomic DNA and 42kb of bacteriophage DNA. These methods, as well as other DNA amplification methods in the art, can be used in this invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic soybean event JK1013-2 can be used to amplify the genome of the transgenic soybean event JK1013-2 using the provided primer sequences, followed by standard DNA sequencing of the PCR amplicons or cloned DNA.

[0104] DNA detection kits based on DNA amplification methods may contain DNA primer molecules that specifically hybridize to target DNA and amplify diagnostic amplicones under appropriate reaction conditions. The kits may provide agarose gel-based detection methods or many methods known in the art for detecting diagnostic amplicones. Kits containing DNA primers homologous to or complementary to any portion of the soybean genome region of SEQ ID NO:3 or SEQ ID NO:4, and homologous to or complementary to any portion of the transgenic insertion region of SEQ ID NO:5, are provided by this invention. In particular, primer pairs useful in DNA amplification methods are SEQ ID NO:8 and SEQ ID NO:9, which amplify diagnostic amplicones homologous to a portion of the 5' transgenic / genomic region of transgenic soybean event JK1013-2, wherein the amplicon includes SEQ ID NO:1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO:5.

[0105] The amplicon generated by these methods can be detected using a variety of techniques. One such method is GeneticBit Analysis, which designs a DNA oligonucleotide chain spanning the insert DNA sequence and adjacent flanking genomic DNA sequences. This oligonucleotide chain is immobilized in the wells of a microplate. After PCR amplification of the target region (using one primer each in the insert sequence and adjacent flanking genomic sequences), the single-stranded PCR product hybridizes with the immobilized oligonucleotide chain and serves as a template for a single-base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next expected base. Results can be obtained using fluorescence or ELISA-like methods. The signal indicates the presence of the insert / flanking sequence, signifying successful amplification, hybridization, and single-base extension.

[0106] Another method is pyrosequencing. This method designs an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with single-stranded PCR products of the target region (using one primer each within the insertion sequence and in adjacent flanking genomic sequences), and then incubated with DNA polymerase, ATP, thioacylase, luciferase, adenosine triphosphate diphosphatase, adenosine-5'-phosphate sulfate, and luciferin. dNTPs are added separately, and the resulting light signal is measured. The light signal represents the presence of the insertion / flanking sequence, indicating that amplification, hybridization, and single- or multi-base extension reactions were successful.

[0107] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) can also be used to detect the amplicon of this invention. This method requires designing an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with a single-stranded PCR product of the target region (using one primer within the insertion sequence and one primer in adjacent flanking genomic sequences), and then incubated with DNA polymerase and a fluorescently labeled ddNTP. Single-base extension results in the insertion of ddNTPs. This insertion can be measured using a fluorometer to determine the change in polarization. The change in polarization indicates the presence of the insertion / flanking sequence, signifying that the amplification, hybridization, and single-base extension reactions were successful.

[0108] Taqman is described as a method for detecting and quantifying the presence of DNA sequences, detailed in the manufacturer's instructions for use. A brief example is provided below: a FRET oligonucleotide probe is designed to bind across the insert DNA sequence and adjacent flanking genomic regions. This FRET probe and PCR primers (one primer within the insert sequence and one primer in adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the splitting of the fluorescent and quenched portions of the probe, and the release of the fluorescent portion. The generation of a fluorescent signal indicates the presence of the insert / flanking sequence, signifying successful amplification and hybridization.

[0109] Based on the principle of hybridization, suitable techniques for detecting plant material derived from the transgenic soybean event JK1013-2 may also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. Specifically, these suitable techniques include incubating the probe and sample, washing to remove unbound probes, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe; for example, radiolabeled probes can be detected by X-ray exposure and development, or enzyme-labeled probes can be detected by a color change resulting from substrate transformation.

[0110] Tyangi et al. (Nature Biotech 14:303-308, 1996) described the application of molecular markers in sequence detection. Briefly, a FRET oligonucleotide probe was designed that spans the insertion DNA sequence and the adjacent flanking genomic region. The unique structure of this FRET probe results in a secondary structure that allows for the retention of fluorescent and quenched portions in close proximity. The FRET probe and PCR primers (one primer within the insertion sequence and one primer in the adjacent flanking genomic sequence) were cyclically reacted in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe and the target sequence leads to the loss of the probe's secondary structure, causing spatial separation of the fluorescent and quenched portions and generating a fluorescent signal. The generation of the fluorescent signal indicates the presence of the insertion / flanking sequence, signifying successful amplification and hybridization.

[0111] Other described methods, such as microfluidics, provide methods and devices for isolating and amplifying DNA samples. Optical dyes are used to detect and determine specific DNA molecules. Nanotube devices containing electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules of this invention.

[0112] DNA detection kits can be developed using the compositions described in this invention and methods described or known in the field of DNA detection. These kits are advantageous for identifying the presence of DNA from the transgenic soybean event JK1013-2 in samples and can also be used to cultivate soybean plants containing DNA from the transgenic soybean event JK1013-2. The kits may contain DNA primers or probes homologous to or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes homologous to or complementary to DNA contained in transgenic genetic elements, these DNA sequences being used for DNA amplification reactions or as probes in DNA hybridization methods.

[0113] Contained in the soybean genome and inFigure 1 The DNA structure at the site of binding of the transgenic insertion sequence to the soybean genome, as described in Table 1, comprises: a soybean JK1013-2 flanking genome region located at the 5' end of the transgenic insertion sequence; a portion of the insertion sequence from the right boundary region (RB) of Agrobacterium; a first expression cassette consisting of the soybean endogenous gene prGmA1aB1b promoter operably linked to the human milk β-casein gene (HomoCSN2) and operably linked to the tNos terminator; a second expression cassette consisting of the cauliflower mosaic virus (CaMV) p35S promoter operably linked to the glufosinate-ammonium acetyltransferase (cPAT) and operably linked to the cauliflower mosaic virus (CaMV) 35S terminator; a portion of the insertion sequence from the left boundary region (LB) of Agrobacterium; and a soybean JK1013-2 flanking genome region (SEQ ID NO:5) located at the 3' end of the transgenic insertion sequence. In the DNA amplification method, the DNA molecule used as a primer can be any part of the transgenic insertion sequence from the transgenic soybean event JK1013-2, or any part of the DNA region of the flanking soybean genome from the transgenic soybean event JK1013-2.

[0114] The transgenic soybean event JK1013-2 can be combined with other transgenic soybean varieties, such as herbicide-tolerant soybeans (e.g., 2,4-D). Various combinations of all these different transgenic events, bred together with the transgenic soybean event JK1013-2 of this invention, can provide improved hybrid transgenic soybean varieties tolerant to multiple herbicides. These varieties can exhibit superior traits such as increased yield compared to non-transgenic varieties and single-trait transgenic varieties.

[0115] This invention provides a transgenic soybean event JK1013-2, a method for detecting the nucleic acid sequence of soybean plants containing this event, and a transgenic soybean event JK1013-2 containing the human milk β-casein gene and exhibiting tolerance to the phytotoxic effects of glufosinate-containing agricultural herbicides. Soybean plants exhibiting this trait express human milk β-casein and glufosinate-resistant glufosinate acetyltransferase (PAT) protein from *Streptomyces viride*, thus conferring tolerance to glufosinate. Attached Figure Description

[0116] Figure 1 This is a schematic diagram of the binding site between the transgenic insertion sequence and the soybean genome in the present invention for detecting the nucleic acid sequence of soybean plant JK1013-2 and its detection method.

[0117] Figure 2This is a schematic diagram of the recombinant expression vector JK1013 used in the present invention for detecting the nucleic acid sequence of soybean plant JK1013-2 and its detection method.

[0118] Figure 3 This is a Western blot immunoblotting result of the transgenic soybean containing transgenic soybean event JK1013-2 of the present invention.

[0119] Figure 4 The diagram shows the effect of spraying the genetically modified soybeans of the present invention, including the genetically modified soybean event JK1013-2, at the recommended spraying concentration of 4 times the dose of glufosinate herbicide. Detailed Implementation

[0120] The present invention will be further described in detail below through examples. Through these exemplary descriptions, the features and advantages of the present invention will become clearer and more apparent.

[0121] In this context, the technical term "exemplary" means "used as an example, embodiment, or illustration." Any embodiment illustrated herein as "exemplary" is not necessarily to be construed as superior to or better than other embodiments.

[0122] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0123] The technical solution of the present invention for detecting the nucleic acid sequence of soybean plant JK1013-2 and its detection method is further illustrated below through specific embodiments.

[0124] Example 1: Cloning and Transformation

[0125] 1.1 Vector Cloning

[0126] The recombinant expression vector JK1013 was constructed using standard gene cloning techniques. Figure 2 (As shown). The vector JK1013 contains two tandem transgenic expression cassettes. The first cassette consists of a soybean endogenous gene prGmA1aB1b promoter operably linked to the human milk β-casein gene (HomoCSN2) and operably linked to the tNos terminator. The second cassette consists of a cauliflower mosaic virus (CaMV) p35S promoter operably linked to the gene encoding glufosinate-ammonia acetyltransferase (cPAT) and operably linked to the CaMV 35S terminator sequence. The vector JK1013 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using liquid nitrogen, and the transformed cells were screened using glufosinate-ammonia acetyltransferase (cPAT) as a selection marker.

[0127] 1.2 Plant Transformation

[0128] Transformation was carried out using the conventional Agrobacterium infection method. Aseptically cultured soybean (variety: Tianlong No. 1) embryos were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector JK1013 into the soybean chromosome to generate transgenic soybean events.

[0129] For Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salt 3.1 g / L, B5 vitamin, sucrose 20 g / L, agar 8 g / L, pH 5.6). Seeds were inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1°C; photoperiod (light / dark) 16 / 8 h. After 4-6 days of germination, fresh, green, swollen, sterile soybean seedlings were harvested. The hypocotyl was removed 3-4 mm below the cotyledon node, the cotyledons were longitudinally cut, and the terminal bud, lateral buds, and seed roots were removed. The cotyledon node was wound with the back of a scalpel, and the wounded cotyledon node tissue was contacted with an Agrobacterium suspension. Agrobacterium can transfer the nucleotide sequences of the PAT gene and the human milk β-casein gene to the wounded cotyledon node tissue (step 1: infection step). In this step, the cotyledon node tissue was preferably immersed in an Agrobacterium suspension (OD). 660=0.5-0.8, infection was initiated in an infection medium (MS salt 2.15 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 40 mg / L, 2-morpholine ethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3). The cotyledonary tissue was co-cultured with Agrobacterium for a period (3 days) (Step 2: Co-culture step). Preferably, after the infection step, the cotyledonary tissue was cultured on a solid medium (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, 2-morpholine ethanesulfonic acid (MES) 4 g / L, zeatin 2 mg / L, agar 8 g / L, pH 5.6). Following this co-culture phase, a selective "recovery" step was performed. In the "recovery" step, the recovery medium (B5 salt 3.1 g / L, B5 vitamin, 2-morpholinoethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, zeatin (ZT) 2 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, pH 5.6) contains at least one known antibiotic that inhibits the growth of Agrobacterium (cephalosporin 150-250 mg / L), without adding a selector for plant transformants (Step 3: Recovery Step). Preferably, the cotyledonary regenerated tissue blocks are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the cotyledonary regenerated tissue blocks are cultured on a medium containing a selector (glufosinate) and the growing transformed callus is selected (Step 4: Selection Step). Preferably, the cotyledonary regenerated tissue blocks are cultured on a selection solid medium containing a selector (B5 salt 3.1 g / L, B5 vitamin, 2-morpholine ethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, glufosinate selection agent 10 mg / L, pH 5.6), allowing the transformed cells to continue growing. The transformed cells then regenerate into plants (step 5: regeneration step). Preferably, the cotyledonary regenerated tissue blocks grown on the selector-containing medium are cultured on solid media (B5 differentiation medium and B5 rooting medium) to regenerate plants. The resistant tissue blocks obtained from screening were transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, 2-morpholinoethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, zeatin (ZT) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, glufosinate screening agent 10 mg / L, pH 5.6) and cultured for differentiation at 25°C.The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, 2-morpholine ethanesulfonic acid (MES) 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured at 25°C until they reached a height of approximately 10 cm. They were then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the seedlings were cultured at 26°C for 16 hours daily, followed by 8 hours at 20°C.

[0130] 1.3 Identification and Screening of Genetically Modified Organisms

[0131] A total of 500 independent transgenic T0 plants were generated. Molecular analysis (including target gene copy number detection and insertion site analysis), target traits, and agronomic traits were evaluated in the stably inherited progeny of all T0 plants, ultimately resulting in JK1013-2. JK1013-2 exhibits single-copy transgenicity, high expression of human milk β-casein, good tolerance to glufosinate-ammonium herbicide, and favorable agronomic traits.

[0132] Example 2: Transgenic Soybean Event JK1013-2 Detection by TaqMan

[0133] Approximately 100 mg of leaves from the genetically modified soybean JK1013-2 was taken as a sample, and its genomic DNA was extracted using Qiagen's DNeasy PlantMaxi Kit. The DNA was then detected using Taqman probe-based quantitative PCR. pat and HomoCSN2 The copy number was determined. Wild-type soybean (transformation recipient) plants were used as a control, and the results were analyzed using the same method. The experiment was repeated in triplicate, and the average value was taken.

[0134] The specific method is as follows:

[0135] Step 11: Take 100 mg of leaves from the transgenic soybean event JK1013-2, grind them into a homogenate in a mortar using liquid nitrogen, and take 3 replicates for each sample;

[0136] Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product manual for specific methods.

[0137] Step 13: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0138] Step 14: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μl;

[0139] Step 15: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type soybean plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:

[0140] The following primers and probes are used to detect HomoCSN2 Gene sequence:

[0141] Primer 1: GCAGGGTGATGCCTGTTCTT, as shown in SEQ ID NO:16 in the sequence listing;

[0142] Primer 2: TTCTCGAGGTCAGTCAGCTTAGG, as shown in SEQ ID NO:17 in the sequence listing;

[0143] Probe 1: TCCCCAACCATTCCTTTCTTTGATCCA, as shown in SEQ ID NO:18 in the sequence listing;

[0144] The following primers and probes are used to detect pat Gene sequence:

[0145] Primer 3: CCGCGGTTTGTGATATCGTT, as shown in SEQ ID NO:19 in the sequence listing;

[0146] Primer 4: TCTTGCAACCTCTCTAGATCATCAA, as shown in SEQ ID NO:20 in the sequence listing;

[0147] Probe 2: TAGGACAGAGCCACAAACACCACAAGAGTG, as shown in SEQ ID NO:21 in the sequence listing;

[0148] The PCR reaction system is

[0149] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.

[0150] PCR reaction conditions are

[0151]

[0152] Data were analyzed using SDS2.3 (Applied Biosystems) software to obtain the single-copy transgenic soybean event JK1013-2.

[0153] Example 3: Transgenic Soybean Event JK1013-2 Detection

[0154] 3.1 Genomic DNA Extraction

[0155] DNA extraction was performed using the conventional CTAB (hexadecyltrimethylammonium bromide) method: 2 grams of young transgenic soybean leaves (JK1013-2) were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB Buffer (20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM...) was added. EDTA (ethylenediaminetetraacetic acid) was added, and the pH was adjusted to 8.0 with NaOH. After thorough mixing, the mixture was extracted at 65°C for 90 min. 0.5 volumes of phenol and chloroform were added, and the mixture was inverted and mixed. The mixture was centrifuged at 12,000 rpm for 10 min. The supernatant was collected, and 1 volume of isopropanol was added. The centrifuge tube was gently shaken and incubated at -20°C for 30 min. The mixture was then centrifuged again at 12,000 rpm for 10 min. The DNA was collected at the bottom of the tube. The supernatant was discarded, and the precipitate was washed with 0.5 mL of 70% ethanol. The mixture was centrifuged at 12,000 rpm for 5 min. The precipitate was vacuum dried or air-dried in a clean bench. The DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at -20°C.

[0156] 3.2 Analysis of flanking DNA sequences

[0157] The concentration of the extracted DNA samples was determined to be between 80-100 ng / μL. The selected restriction endonuclease was then used. Spe I, Pst I, Bss HII (5' end analysis) and Sac I, Kpn I, Xma I, NheI (3' end analysis) Genomic DNA was digested separately. 26.5 μL of genomic DNA, 0.5 μL of the selected restriction endonuclease, and 3 μL of digestion buffer were added to each digestion system, and digestion was performed at an appropriate temperature for 1 hour. After digestion, 70 μL of anhydrous ethanol was added to the digestion system, the mixture was incubated on ice for 30 min, centrifuged at 12000 rpm for 7 min, the supernatant was discarded, and the mixture was dried. Then, 8.5 μL of double-distilled water (ddH2O), 1 μL of 10×T4 buffer, and 0.5 μL of T4 ligase were added, and ligation was performed overnight at 4°C. PCR amplification was performed using a series of nested primers to separate 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for separating 5' transgenic / genomic DNA included SEQ ID NO:13 and SEQ ID NO:24 as the first primer, SEQ ID NO:25 and SEQ ID NO:26 as the second primer, and SEQ ID NO:13 as the sequencing primer. The primer combination for isolating 3' transgenic / genomic DNA included SEQ ID NO:15 and SEQ ID NO:27 as the first primer, SEQ ID NO:28 and SEQ ID NO:29 as the second primer, and SEQ ID NO:15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.

[0158] The obtained amplicon was electrophoresed on a 2.0% agarose gel to separate the PCR reaction products, and the target fragment was then isolated from the agarose matrix using the QIAquickGel Extraction Kit (catalog #28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABI Prism™ 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR Sequencing Software, DNASTAR Inc., Madison, WI).

[0159] The 5' and 3' flanking and junction sequences were confirmed using standard PCR methods. The 5' flanking and junction sequences can be confirmed using SEQ ID NO:8 or SEQ ID NO:12, in combination with SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:24. The 3' flanking and junction sequences can be confirmed using SEQ ID NO:11 or SEQ ID NO:14, in combination with SEQ ID NO:10, SEQ ID NO:15, or SEQ ID NO:27. The PCR reaction system and amplification conditions are shown in Tables 3 and 4. Those skilled in the art will understand that other primer sequences can also be used to confirm the flanking and junction sequences.

[0160] DNA sequencing of the PCR product provides DNA that can be used to design other DNA molecules, which can be used as primers and probes for the identification of soybean plants or seeds derived from the transgenic soybean event JK1013-2.

[0161] Nucleotide positions 1-488 of SEQ ID NO:5 show the right flanking (5' flanking sequence) of the soybean genome sequence in the transgenic soybean event JK1013-2, and nucleotide positions 5486-5903 of SEQ ID NO:5 show the left flanking (3' flanking sequence) of the soybean genome sequence in the transgenic soybean event JK1013-2. The 5' conjugation sequence is listed in SEQ ID NO:1, and the 3' conjugation sequence is listed in SEQ ID NO:2.

[0162] 3.3 PCR Conjugation Assay

[0163] The conjugation sequence is a relatively short polynucleotide molecule, a novel DNA sequence that is diagnostic for the DNA of transgenic soybean event JK1013-2 when detected in polynucleotide assays. The conjugation sequence of SEQ ID NO:1 consists of 11 bp from the T-DNA RB region insertion site of transgenic soybean event JK1013-2 and 11 bp from the soybean genomic DNA insertion site. The conjugation sequence of SEQ ID NO:2 consists of 11 bp from the T-DNA LB region insertion site of transgenic soybean event JK1013-2 and 11 bp from the soybean genomic DNA insertion site. Longer or shorter polynucleotide conjugation sequences can be selected from SEQ ID NO:3 or SEQ ID NO:4. The conjugation sequences (5' conjugate region SEQ ID NO:1 and 3' conjugate region SEQ ID NO:2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The conjugation sequences SEQ ID NO:6 and SEQ ID NO:7 are also novel DNA sequences from the transgenic soybean event JK1013-2, and can be used as DNA probes or DNA primers to detect the presence of DNA from the transgenic soybean event JK1013-2. SEQ ID NO:6 (nucleotides 489-1031 of SEQ ID NO:3) is the JK1013 vector DNA sequence, and SEQ ID NO:7 (nucleotides 1-376 of SEQ ID NO:4) is the JK1013 vector DNA sequence.

[0164] In addition, amplicon is generated by using primers from at least one of SEQ ID NO:3 or SEQ ID NO:4, which, when used in a PCR method, produce diagnostic amplicon for transgenic soybean event JK1013-2.

[0165] Specifically, a PCR product was generated from the 5' end of the transgenic insertion sequence. This PCR product comprised a portion of genomic DNA flanking the 5' end of the T-DNA insertion sequence from the genome of plant material derived from the transgenic soybean event JK1013-2. This PCR product contained SEQ ID NO:3. For PCR amplification, primer 5 (SEQ ID NO:8) was designed to hybridize with the genomic DNA sequence flanking the 5' end of the transgenic insertion sequence, and primer 6 (SEQ ID NO:9) was designed to pair with it located at the transgenic RB sequence.

[0166] A PCR product was generated from the 3' end of the transgenic insert sequence. This PCR product contained a portion of genomic DNA flanking the 3' end of the T-DNA insert sequence from the genome of plant material derived from the transgenic soybean event JK1013-2. This PCR product contained SEQ ID NO:4. For PCR amplification, primer 8 (SEQ ID NO:11) was designed to hybridize with the genomic DNA sequence flanking the 3' end of the transgenic insert sequence, and primer 7 (SEQ ID NO:10) was designed to pair with the LB sequence located at the 3' end of the insert.

[0167] The DNA amplification conditions described in Tables 3 and 4 can be used for the above-described PCR conjugation assay to generate diagnostic amplicones for transgenic soybean event JK1013-2. Amplicon detection can be performed using a Stratagene Robocycle, MJEngine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermal cycler, or by methods and equipment known to those skilled in the art.

[0168] Table 3. PCR steps and reaction mixture conditions for identification of the 5' transgenic insert / genome-conjugating region in transgenic soybean event JK1013-2.

[0169]

[0170] Table 4. Conditions for the Perkin-Elmer 9700 Thermal Cyclist

[0171]

[0172] Mix gently. If the thermal cycler does not have an insulation cap, add 1-2 drops of mineral oil above each reaction mixture. Perform PCR using the above cycling parameters (Table 4) on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. For the Perkin-Elmer 9700 thermal cycler, set the ramp speed to its maximum value.

[0173] The experimental results showed that primers 5 and 6 (SEQ ID NO: 8 and 9) produced a 1031 bp amplification product when used in the PCR reaction of transgenic soybean event JK1013-2 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed soybean genomic DNA and non-JK1013-2 soybean genomic DNA; primers 7 and 8 (SEQ ID NO: 10 and 11) produced a 794 bp amplification product when used in the PCR reaction of transgenic soybean event JK1013-2 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed soybean genomic DNA and non-JK1013-2 soybean genomic DNA.

[0174] PCR conjugation assays can also be used to identify whether materials derived from the transgenic soybean event JK1013-2 are homozygous or heterozygous. Primers 9 (SEQ ID NO:12), 10 (SEQ ID NO:13), and 11 (SEQ ID NO:14), or primers 10 (SEQ ID NO:13), 11 (SEQ ID NO:14), and 12 (SEQ ID NO:15) are used in the amplification reaction to generate diagnostic amplicones for the transgenic soybean event JK1013-2. The DNA amplification conditions described in Tables 5 and 6 can be used for the above conjugation assays to generate diagnostic amplicones for the transgenic soybean event JK1013-2.

[0175] Table 5. Reaction solution for bonding test

[0176]

[0177] Table 6. Adhesion determination conditions using the Perkin-Elmer 9700 thermal cycler.

[0178]

[0179] PCR was performed using the cycling parameters (Table 6) on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. The ramp speed should be set to its maximum value when using the Perkin-Elmer 9700 thermal cycler.

[0180] In the amplification reaction, the biological sample containing template DNA contains DNA that diagnoses the presence of the transgenic soybean event JK1013-2 in the sample. Alternatively, the reaction will generate two distinct DNA amplicones from a biological sample containing DNA derived from the soybean genome, wherein the soybean genome DNA is heterozygous relative to the allele corresponding to the inserted DNA present in the transgenic soybean event JK1013-2. These two distinct amplicones will correspond to a first amplicon derived from a wild-type soybean genomic locus and a second amplicon diagnosing the presence of the transgenic soybean event JK1013-2 DNA. A soybean DNA sample that produces only a single amplicon corresponding to the second amplicon described for a heterozygous genome can diagnose the presence of the transgenic soybean event JK1013-2 in the sample, and this sample is produced from soybean seeds that are homozygous relative to the allele corresponding to the inserted DNA present in the transgenic soybean plant JK1013-2.

[0181] It should be noted that the primer pairs for the transgenic soybean event JK1013-2 were used to generate diagnostic amplicones for the genomic DNA of the transgenic soybean event JK1013-2. These primer pairs include, but are not limited to, primers 5 and 6 (SEQ ID NO: 8 and 9), and primers 7 and 8 (SEQ ID NO: 10 and 11), used in the DNA amplification method described above. Additionally, primers 13 and 14 (SEQ ID NO: 30 and SEQ ID NO: 31) for amplifying endogenous soybean genes are included as an intrinsic standard for the reaction conditions. Analysis of DNA extracts from transgenic soybean event JK1013-2 should include a positive tissue DNA extract control from transgenic soybean event JK1013-2, a negative DNA extract control from non-transgenic soybean event JK1013-2, and a negative control containing no template soybean DNA. In addition to these primer pairs, any primer pairs from SEQ ID NO:3 or SEQ ID NO:4, or their complementary sequences, can be used to generate, when used in a DNA amplification reaction, diagnostic amplicon containing SEQ ID NO:1 or SEQ ID NO:2 for tissues derived from the transgenic soybean plant JK1013-2. The DNA amplification conditions described in Tables 3-6 can be used to generate diagnostic amplicon for transgenic soybean event JK1013-2 using appropriate primer pairs. Extracts of soybean plant or seed DNA presumed to contain transgenic soybean event JK1013-2, or products derived from transgenic soybean event JK1013-2, that produce diagnostic amplicon for transgenic soybean event JK1013-2 during testing in DNA amplification methods, can be used as templates for amplification to determine the presence of transgenic soybean event JK1013-2.

[0182] Example 4: Western Blot Detection of Human Milk Beta-Casein Expression in Transformation Event JK1013-2

[0183] In this experiment, mature JK1013-2 seeds were ground into powder for detection. The specific procedure was as follows: 0.05 g of JK1013-2 powder was weighed and extracted with 0.5 ml of extraction buffer (prepared as 0.05 M Tris, 0.5 M NaCl, 0.05% TWEEN 20, pH 7.4) for 1 hour. The mixture was then centrifuged at 12000 rpm for 10 minutes. The supernatant was collected and subjected to Western blotting for human milk β-casein expression detection. The results are as follows: Figure 3 As shown, 1 represents the use of human milk β-casein standard (concentration 1 mg / g), 2 represents the transgenic event JK1013-2, and 3 represents non-GMO soybeans. From... Figure 3As can be seen from this, the genetically modified soybean JK1013-2 can successfully express human milk β-casein.

[0184] Example 5: Human Milk Beta-Casein Content Detection in Transgenic Soybean Seeds

[0185] Three soybean plants (3 replicates) from the transgenic soybean event JK1013-2 (0.05 g each) were used as samples. After grinding, 500 μl of extraction buffer (containing 0.05 M Tris, 0.5 M NaCl, 0.05% TWEEN 20, pH 7.4) was added. The mixture was centrifuged at 12000 rpm for 10 min. The supernatant was diluted 10000 times with the extraction buffer, and 100 μl of the diluted supernatant was used for ELISA detection. The proportion of human milk β-casein in the seed dry weight was analyzed using an ELISA kit (Abmart).

[0186] The results of the determination of human milk β-casein content in soybean seeds of the transgenic soybean event JK1013-2 are shown in Table 7. The average expression level of human milk β-casein was 1.94 mg / g, which indicates that human milk β-casein achieved high expression level and stability in soybeans.

[0187] Table 7. Results of human milk β-casein concentration detection in genetically modified soybean case JK1013-2

[0188]

[0189] Example 6: Glufosinate Herbicide Tolerance Detection of Soybean Transformation Events

[0190] This experiment used phosphonoammonium phosphate (PAP) herbicide for spraying. A randomized block design was employed with three replicates. The plot area was 1 m². 2(1m×1m), with 30 seedlings per plot, and conventional field experimental cultivation management. Transgenic soybean JK1013-2 and wild-type soybean plants (non-transgenic, transformation recipient control (CK-)) were subjected to the following two treatments: 1) spraying with water; 2) spraying with phosmet at the V3 leaf stage at a dose of 1680 ae / ha, followed by a second spraying at the same dose at the V8 stage. It should be noted that different concentrations and formulations of glufosinate-ammonium herbicides, when converted to an equivalent amount of glufosinate-ammonium acid, are applicable to the following conclusions. Symptoms of herbicide damage were investigated 1 week and 2 weeks after application, and yields were measured at harvest. The grading criteria for herbicide damage symptoms are shown in Table 8. Herbicide damage rate was used as an evaluation index to assess herbicide tolerance in a transformation event. Specifically, the herbicide damage rate (%) = ∑(number of affected plants of the same level × number of levels) / (total number of plants × highest level); where the herbicide damage rate refers to the glufosinate damage rate, which was determined based on the herbicide damage survey results two weeks after glufosinate treatment. Yield differences between different treatments were measured as yield percentages, yield percentage (%) = glufosinate-treated yield / water-treated yield. The results of herbicide tolerance and soybean yield for the transgenic soybean event JK1013-2 are as follows: Figure 4 As shown in Table 9.

[0191] Table 8. Grading Standards for the Severity of Herbicide Damage to Soybeans from Glufosinate-Ammonium

[0192]

[0193] Table 9. Results of tolerance to glufosinate herbicide and soybean yield in transgenic soybean event JK1013-2.

[0194]

[0195] The results showed that, regarding the herbicide (glufosinate) damage rate: 1) the damage rate of transgenic soybean event JK1013-2 under glufosinate herbicide treatment (1680g ae / ha) was basically 0. Therefore, transgenic soybean event JK1013-2 has good glufosinate herbicide tolerance.

[0196] In terms of yield: there was no significant difference in yield between the two treatments of spraying with water and spraying with 1680g ae / ha glufosinate-ammonium. After spraying with glufosinate-ammonium herbicide, the yield of the genetically modified soybean event JK1013-2 was not reduced compared with the treatment of spraying with water. This further indicates that the genetically modified soybean event JK1013-2 has good tolerance to glufosinate-ammonium herbicide.

[0197] In summary, through TaqMan TM Analysis (see Example 2) detected the presence of transgenic soybean plants in the regenerated plants.pat and HomoCSN2 The copy number of human milk β-casein gene was determined and characterized in strains exhibiting stable high expression of human milk β-casein and tolerance to glufosinate-ammonium herbicide. Stable expression of the human milk β-casein gene was confirmed by Western blotting analysis (see Example 4). Based on the expression level of the human milk β-casein gene, glufosinate-ammonium herbicide tolerance, and agronomic traits, event JK1013-2 was selected as superior due to its single-copy transgene, highly stable expression of the human milk β-casein gene (see Example 5), glufosinate-ammonium herbicide tolerance, and superior agronomic traits (Example 6).

[0198] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. A nucleic acid molecule for detecting transgenic soybean event JK1013-2, characterized in that, The sequence of the nucleic acid molecule is shown in SEQ ID NO: 5 or its complement, and the soybean seed comprising the transgenic soybean event JK1013-2 has been deposited with the China Center for Type Culture Collection under accession number CCTCC NO: P202528.

2. A pair of DNA primers comprising a first primer and a second primer, characterized in that, When the first primer and the second primer are used in an amplification reaction with DNA containing the transgenic soybean event JK1013-2, an amplicon of the transgenic soybean event JK1013-2 in the sample is produced; The first primer is SEQ ID NO: 12, the second primer is SEQ ID NO: 14, and the amplification product of the first primer and the second primer comprises the nucleic acid sequence of the sequence of SEQ ID NO: 5 or its complement; The soybean seed comprising the transgenic soybean event JK1013-2 has been deposited with the China Center for Type Culture Collection under accession number CCTCC NO: P202528.

3. A method of detecting the presence of DNA of transgenic soybean event JK1013-2 in a sample, characterized in that, It comprises: (1) contacting a sample to be detected with the DNA primer pair of claim 2 in a nucleic acid amplification reaction; (2) performing a nucleic acid amplification reaction; (3) detecting the presence of the amplification product; The amplification product comprises the nucleic acid sequence of the sequence of SEQ ID NO: 5 or its complement, indicating that the DNA containing the transgenic soybean event JK1013-2 is contained in the sample to be detected, and the soybean seed comprising the transgenic soybean event JK1013-2 has been deposited with the China Center for Type Culture Collection under accession number CCTCC NO: P202528.

4. A DNA detection kit, characterized by, It comprises the DNA primer pair of claim 2.

Images