Nucleic acid aptamer combination for predicting acupuncture sensitivity of allergic rhinitis patient and application thereof

Abstract

The application relates to the technical field of biomedical detection, in particular to a nucleic acid aptamer combination for predicting acupuncture sensitivity of allergic rhinitis patients and application thereof, wherein the nucleic acid aptamer combination is a nucleic acid aptamer of group a or group b; group a: a nucleic acid aptamer with sequences shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3; group b: a combination consisting of nucleic acid aptamers described in the following i, ii or iii, i, three variants corresponding to the three sequences in group a; ii, two variants corresponding to any two sequences in group a, and a nucleic acid aptamer shown in the remaining one sequence in group a; iii, one variant corresponding to any one sequence in group a, and nucleic acid aptamers shown in the remaining two sequences in group a. The application solves the problem of how to distinguish acupuncture sensitive populations in allergic rhinitis patients in the prior art.

Description

Technical Field

[0001] This invention relates to the field of biomedical detection technology, and in particular to a combination of nucleic acid aptamers for predicting acupuncture sensitivity in patients with allergic rhinitis and its application. Background Technology

[0002] Allergic rhinitis is a common allergic disease worldwide. The main symptoms include nasal congestion, runny nose, sneezing, and nasal itching. Some patients also experience symptoms such as itchy eyes, allergic conjunctivitis, throat discomfort, and ear fullness, which affect their quality of life and mental health.

[0003] Clinical management of allergic rhinitis includes both Western and Traditional Chinese Medicine (TCM) treatments. Among TCM therapies, acupuncture has been included in relevant treatment guidelines due to its unique advantages. However, the clinical efficacy of acupuncture varies significantly from person to person, and currently, there is a lack of technical means to effectively predict whether a patient with allergic rhinitis is sensitive to acupuncture before treatment. This lack of predictive tools leads to inaccurate allocation of medical resources, and some patients may experience ineffective treatment, affecting not only overall efficacy but also wasting medical resources. Therefore, developing a technology that can objectively and accurately identify acupuncture-sensitive individuals before treatment has become a key technological bottleneck in achieving precision medicine for allergic rhinitis and improving treatment efficiency.

[0004] Chinese patent document CN117949666A discloses a biomarker, method, and application for predicting or evaluating the efficacy of anti-IL-4Rα monoclonal antibody in treating nasal mucosal inflammation-related rhinitis type 2. Its IPC main classification number is G01N. It uses biomarkers such as TARC, TNF-α, TGF-β2, 15[S]-HETE, IL-25, CST1, CLC, and ALOX15 as indicators for predicting or evaluating the efficacy of anti-IL-4Rα monoclonal antibody treatment for nasal mucosal inflammation-related rhinitis type 2. In particular, ALOX15 is a preferred biomarker, and its expression level is detected to predict or evaluate the treatment effect and the degree of inflammation. Chinese patent document CN119804873A discloses the use of FGL1 protein in the preparation of a diagnostic kit for allergic rhinitis. Its IPC main classification number is G01N. It utilizes FGL1 protein as a diagnostic biomarker to prepare a serum detection kit to distinguish between healthy subjects and patients with allergic rhinitis. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] In view of the above-mentioned shortcomings and deficiencies of the prior art, the present invention provides a combination of nucleic acid aptamers for predicting acupuncture sensitivity in patients with allergic rhinitis and its application, which solves the problem in the prior art of how to distinguish acupuncture-sensitive individuals among patients with allergic rhinitis.

[0007] (II) Technical Solution

[0008] To achieve the above objectives, the main technical solutions adopted by the present invention include:

[0009] In a first aspect, the present invention provides a combination of nucleic acid aptamers for predicting acupuncture sensitivity in patients with allergic rhinitis, wherein the combination is a group of nucleic acid aptamers or a group of b.

[0010] Group a: Nucleic acid aptamers with sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3;

[0011] Group b: A combination of nucleic acid aptamers described in items i, ii or iii below, wherein when the nucleic acid aptamers in group b are mixed with blood samples from patients with acupuncture-sensitive and acupuncture-insensitive allergic rhinitis respectively, the concentration difference of the generated target-nucleic acid aptamer complex is not less than 2.

[0012] i. Three variants corresponding to the three sequences in group a;

[0013] ii. Two variants corresponding to any two sequences in group a, and the aptamer shown by the remaining sequence in group a;

[0014] iii. A variant corresponding to any one of the sequences in group a, and aptamers representing the other two sequences in group a.

[0015] Optionally, the nucleic acid aptamer is a single-stranded DNA or RNA molecule, and the variant is a nucleic acid aptamer obtained by base insertion, sequence truncation, base mutation, or circularization modification of the nucleic acid aptamer.

[0016] Optionally, the method further includes chemically modifying the nucleic acid aptamer, wherein the chemical modification is performed by modifying or labeling the nucleic acid aptamer with at least one of biotin, fluorescent molecules, isotopes, electrochemistry, enzymes, or thiol groups.

[0017] In a second aspect, the present invention provides a test kit for predicting acupuncture sensitivity in patients with allergic rhinitis, comprising a combination of nucleic acid aptamers for predicting acupuncture sensitivity in patients with allergic rhinitis as described above.

[0018] Optionally, the test kit further includes a solid matrix for immobilizing proteins in blood samples, a buffer reagent suitable for binding nucleic acid aptamers to proteins, and a blocking agent.

[0019] Thirdly, the present invention provides a method for predicting acupuncture sensitivity in patients with allergic rhinitis, comprising the following steps:

[0020] S1. Using the nucleic acid aptamers in the above-mentioned nucleic acid aptamer combination as molecular probes, they interact with blood samples from patients with allergic rhinitis to form target-nucleic acid aptamer complexes.

[0021] S2. The concentration of nucleic acid aptamers existing in the form of target-nucleic acid aptamer complexes is quantified to obtain a set of nucleic acid aptamer concentration values ​​corresponding to the nucleic acid aptamer combination.

[0022] S3. Input the set of nucleic acid aptamer concentration values ​​into a pre-constructed acupuncture sensitivity prediction model for allergic rhinitis to obtain prediction results that characterize whether the allergic rhinitis patient to be tested is an acupuncture sensitive patient.

[0023] Optionally, in S1, the blood sample is whole blood, plasma, or serum.

[0024] Optionally, the acupuncture sensitivity prediction model for allergic rhinitis is a trained machine learning classification model that can classify allergic rhinitis patients as acupuncture-sensitive or acupuncture-insensitive based on the set of nucleic acid aptamer concentration values.

[0025] Optionally, the machine learning classification model is constructed based on one or more of the following algorithms: logistic regression, K-nearest neighbors, support vector machine, decision tree, random forest, gradient boosting decision tree, multilayer perceptron, adaptive augmentation algorithm, and extreme random forest algorithm.

[0026] Optionally, the nucleic acid aptamer assembly comprises nucleic acid aptamers with sequences as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3; the blood sample is serum; and the acupuncture sensitivity prediction model for allergic rhinitis is an adaptive enhancement model.

[0027] Optionally, the process of constructing the acupuncture sensitivity prediction model for allergic rhinitis includes:

[0028] S01. Obtain the training dataset;

[0029] S02. Using the training dataset, train multiple different machine learning classification models to obtain multiple candidate prediction models;

[0030] S03. The test dataset is used to evaluate the multiple candidate prediction models, and the candidate prediction model with the best performance is selected from them according to the preset evaluation index as the acupuncture sensitivity prediction model for allergic rhinitis.

[0031] The training dataset and the prediction dataset both contain a set of nucleic acid aptamer concentration values ​​and corresponding acupuncture sensitivity classification labels for multiple allergic rhinitis patient samples.

[0032] Fourthly, the present invention provides a computer device including a memory and a processor, wherein the memory stores a computer program, and when the computer program is executed by the processor, it implements the method described above for predicting acupuncture sensitivity in patients with allergic rhinitis.

[0033] (III) Beneficial Effects

[0034] The beneficial effects of this invention are as follows: The nucleic acid aptamer combination for predicting acupuncture sensitivity in patients with allergic rhinitis provided by this invention and its application, the nucleic acid aptamer combination can efficiently and specifically distinguish the sensitivity of patients with allergic rhinitis to acupuncture treatment using blood samples. Furthermore, by using the nucleic acid aptamer in the nucleic acid aptamer combination as a molecular probe, it is incubated with blood samples from patients with allergic rhinitis to be tested, so that the molecular probe and the target form a target-nucleic acid aptamer complex. By quantitatively detecting the nucleic acid aptamer existing in the form of the target-nucleic acid aptamer complex, a set of nucleic acid aptamer concentration values ​​corresponding to the nucleic acid aptamer combination is obtained. Then, the set of nucleic acid aptamer concentration values ​​is input into a pre-constructed acupuncture sensitivity prediction model for allergic rhinitis, which can accurately predict whether the patients with allergic rhinitis to be tested are acupuncture sensitive. Attached Figure Description

[0035] Figure 1 This is a flowchart illustrating a method for predicting acupuncture sensitivity in patients with allergic rhinitis according to a specific implementation.

[0036] Figure 2 This is a schematic diagram showing the relative concentration distribution of nucleic acid aptamers corresponding to the nucleic acid aptamers shown in SEQ ID NO.1 of Example 1, for sensitive enrolled samples, insensitive enrolled samples, sensitive ex-enrolled samples, and insensitive ex-enrolled samples.

[0037] Figure 3 This is a schematic diagram showing the distribution of nucleic acid aptamer concentration differences between sensitive and insensitive input / output group samples and the distribution of relative nucleic acid aptamer concentration differences between insensitive and insensitive input / output group samples, based on the nucleic acid aptamer sequence shown in SEQ ID NO.1 of Example 1.

[0038] Figure 4 This is a schematic diagram showing the relative concentration distribution of nucleic acid aptamers corresponding to the nucleic acid aptamers shown in SEQ ID NO.2 of Example 1, for sensitive enrolled samples, insensitive enrolled samples, sensitive ex-enrolled samples, and insensitive ex-enrolled samples.

[0039] Figure 5 This is a schematic diagram showing the distribution of nucleic acid aptamer concentration differences between sensitive and insensitive input / output group samples and the distribution of relative nucleic acid aptamer concentration differences between insensitive and insensitive input / output group samples, based on the nucleic acid aptamer sequence shown in SEQ ID NO.2 of Example 1.

[0040] Figure 6This is a schematic diagram showing the relative concentration distribution of nucleic acid aptamers corresponding to the sensitive enrolled sample, insensitive enrolled sample, sensitive ex-enrolled sample, and insensitive ex-enrolled sample according to the nucleic acid aptamer sequence shown in SEQ ID NO.3 of Example 1;

[0041] Figure 7 This is a schematic diagram showing the distribution of nucleic acid aptamer concentration differences between sensitive and insensitive input / output group samples and the distribution of relative nucleic acid aptamer concentration differences between insensitive and insensitive input / output group samples, based on the nucleic acid aptamer sequence shown in SEQ ID NO.3 of Example 1.

[0042] Figure 8a This is a schematic diagram of the ROC curves and AUC values ​​of the logistic regression, K-nearest neighbors, and support vector machine models during the training process of the training set according to Example 2.

[0043] Figure 8b The diagram shows the ROC curves and AUC values ​​of the decision tree, random forest, and gradient boosting models during the training process according to Example 2, where the ROC curves of the random forest and gradient boosting models completely overlap.

[0044] Figure 8c This is a schematic diagram of the ROC curves and AUC values ​​of the multilayer perceptron, adaptive augmentation, and extreme random forest models during the training process according to Example 2.

[0045] Figure 9a This is a schematic diagram of the ROC curves and AUC values ​​of the logistic regression, K-nearest neighbor, and support vector machine models during the test set testing process according to Example 2.

[0046] Figure 9b This is a schematic diagram of the ROC curves and AUC values ​​of the decision tree, random forest, and gradient boosting models during the testing process of the test set according to Example 2.

[0047] Figure 9c This is a schematic diagram of the ROC curves and AUC values ​​of the multilayer perceptron, adaptive augmentation, and extreme random forest models during the test set testing process according to Example 2. Detailed Implementation

[0048] To better explain and facilitate understanding of the present invention, the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0049] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Guide (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. All technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art unless otherwise defined. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0050] The flowchart shown in the attached diagram is for illustrative purposes only and does not necessarily include all content and operations / steps, nor does it require execution in the described order. For example, some operations / steps can be broken down, combined, or partially merged, so the actual execution order may change depending on the actual situation.

[0051] Nucleic acid aptamers are single-stranded oligonucleotides that can specifically bind to various target molecules, such as DNA, RNA, and nucleic acid derivatives, with a certain high affinity. The binding of aptamers to various target molecules is based on the diversity of nucleotide structure and spatial conformation. They can adaptively fold through pairing of certain complementary bases within the chain, as well as electrostatic interactions and hydrogen bonding, forming stem-loop structures, hairpin structures, pseudo-intercalation structures, or tetramer structures, and further coiling and folding into complex three-dimensional spatial structures. Based on these stable three-dimensional spatial structures, aptamers can recognize targets or target molecules through structural complementarity, base stacking forces, van der Waals forces, hydrogen bonding, or electrostatic interactions. In this field, the screening of nucleic acid aptamers typically employs SELEX technology, which includes five main steps: binding, separation, elution, amplification, and identification. SELEX technologies include magnetic bead SELEX, Capture-SELEX, Cell-SELEX, serum SELEX, etc.

[0052] In a first aspect, the present invention provides a combination of nucleic acid aptamers for predicting acupuncture sensitivity in patients with allergic rhinitis, wherein the combination is a group of nucleic acid aptamers from group a or b below.

[0053] Group a: Nucleic acid aptamers with sequences as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0054] The sequence shown in SEQ ID NO.1 is: ttcagcactc cacgcatagc acgtcgtacgattggtctgg tttggtttgg ttcgtcgacc tatgcgtgct accgtgaa; the sequence shown in SEQ ID NO.2 is: ttcagcactc cacgcatagc cgtacgctca ctcgccctca cactcacaca cacacgtgcc tatgcgtgctaccgtgaa; and the sequence shown in SEQ ID NO.3 is: ttcagcactc cacgcatagc tagactttat ggtctggttggtttgggtct tgtttttccc tatgcgtgct accgtgaa.

[0055] Experimental verification showed that, under the same experimental conditions, equal amounts of each nucleic acid aptamer probe from group a were co-incubated with equal amounts of blood samples from acupuncture-sensitive and acupuncture-insensitive allergic rhinitis patients who had been clearly genotyped. This allowed the nucleic acid aptamer probes to fully bind with the targets in the samples, forming target-nucleic acid aptamer complexes. The concentration of nucleic acid aptamers in the target-nucleic acid aptamer complexes was detected using absolute quantitative techniques, such as quantitative real-time PCR. The difference between the target-nucleic acid aptamer complex concentrations of the sensitive samples and the insensitive samples was not less than 2 fold.

[0056] Thus, the nucleic acid aptamer combination shown in group a can effectively capture the essential differences in the content of biomarkers related to acupuncture treatment sensitivity in blood samples of patients with allergic rhinitis. Furthermore, the nucleic acid aptamers in the nucleic acid aptamer combination shown in group a can be used as molecular probes to interact with blood samples from patients with allergic rhinitis to be tested, quantifying the nucleic acid aptamers existing in the form of target-nucleic acid aptamer complexes, obtaining a set of nucleic acid aptamer concentration values ​​corresponding to the nucleic acid aptamer combination, and then inputting the set of nucleic acid aptamer concentration values ​​into a pre-constructed acupuncture sensitivity prediction model for allergic rhinitis, which can accurately predict whether the patients with allergic rhinitis to be tested are acupuncture sensitive.

[0057] Group b: A combination of nucleic acid aptamers described in items i, ii or iii below, wherein when the nucleic acid aptamers in group b are mixed with blood samples from patients with acupuncture-sensitive and acupuncture-insensitive allergic rhinitis respectively, the concentration difference of the generated target-nucleic acid aptamer complex is not less than 2.

[0058] i. Three variants corresponding to the three sequences in group a. That is, three variants corresponding to the sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3.

[0059] ii. Two variants corresponding to any two sequences in group a, and an aptamer representing the remaining sequence in group a. Specifically, two variants corresponding to the sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and an aptamer representing SEQ ID NO.3; or, two variants corresponding to the sequences shown in SEQ ID NO.1 and SEQ ID NO.3, and an aptamer representing SEQ ID NO.2; or, two variants corresponding to the sequences shown in SEQ ID NO.2 and SEQ ID NO.3, and an aptamer representing SEQ ID NO.1.

[0060] iii. A variant corresponding to any one of the sequences in group a, and the nucleic acid aptamers shown by the other two sequences in group a. Specifically, a variant corresponding to the sequence shown in SEQ ID NO.1, and the nucleic acid aptamers shown in SEQ ID NO.2 and SEQ ID NO.3; or, a variant corresponding to the sequence shown in SEQ ID NO.2, and the nucleic acid aptamers shown in SEQ ID NO.1 and SEQ ID NO.3; or, a variant corresponding to the sequence shown in SEQ ID NO.3, and the nucleic acid aptamers shown in SEQ ID NO.1 and SEQ ID NO.2.

[0061] Among them, the nucleic acid aptamers in group b must meet the following experimental verification: Under the same experimental conditions, equal amounts of nucleic acid aptamer probes are mixed with equal amounts of blood samples from acupuncture-sensitive and acupuncture-insensitive allergic rhinitis patients who have been clearly genotyped, so that they fully bind to form target-nucleic acid aptamer complexes; the concentration of nucleic acid aptamers in the target-nucleic acid aptamer complex is detected by absolute quantitative techniques, such as real-time PCR, and the difference between the target-nucleic acid aptamer complex concentration corresponding to the sensitive sample and the target-nucleic acid aptamer complex concentration corresponding to the insensitive sample is not less than 2 fold.

[0062] Thus, the nucleic acid aptamer combination shown in group b can effectively capture the essential differences in the content of biomarkers related to acupuncture treatment sensitivity in blood samples of patients with allergic rhinitis. Furthermore, the nucleic acid aptamers in the nucleic acid aptamer combination shown in group b are used as molecular probes to interact with blood samples from patients with allergic rhinitis to be tested, quantifying the nucleic acid aptamers existing in the form of target-nucleic acid aptamer complexes, obtaining a set of nucleic acid aptamer concentration values ​​corresponding to the nucleic acid aptamer combination, and then inputting the set of nucleic acid aptamer concentration values ​​into a pre-constructed acupuncture sensitivity prediction model for allergic rhinitis, which can accurately predict whether the patients with allergic rhinitis to be tested are acupuncture sensitive.

[0063] Among them, variants are nucleic acid aptamers obtained by base insertion, sequence truncation, base mutation or circularization modification of nucleic acid aptamers.

[0064] The nucleic acid aptamer assembly provided by this invention further includes chemical modification of the nucleic acid aptamer. This chemical modification involves modifying or labeling the nucleic acid aptamer with at least one of biotin, fluorescent molecules, isotopes, electrochemicals, enzymes, or thiol groups. This chemical modification enables the nucleic acid aptamer to be detected, thereby facilitating target detection. The chemical modification can be located at one end of the nucleic acid aptamer or embedded within its structure.

[0065] In this invention, patients with acupuncture-sensitive allergic rhinitis and patients with acupuncture-insensitive allergic rhinitis are defined as follows:

[0066] Patients with allergic rhinitis are defined as individuals who meet the diagnostic criteria established in the "Guidelines for the Diagnosis and Treatment of Allergic Rhinitis in China (2022 Revised Edition)". These criteria include the presence of at least two of the following symptoms: sneezing, clear nasal discharge, nasal congestion, and nasal itching, with symptoms lasting or accumulating for more than one hour each day. Ocular manifestations such as itchy eyes or conjunctival congestion may also be present. Physical examinations commonly reveal pale nasal mucosa, edema, and watery nasal discharge. Laboratory tests show positive serum-specific IgE antibodies. After four consecutive weeks of acupuncture treatment three times a week, patients with allergic rhinitis were evaluated for efficacy according to the "Principles and Recommendations for the Diagnosis and Treatment of Allergic Rhinitis (2004 Revised Edition)". The reduction rate of the total score of nasal symptoms and signs was used as the criterion for efficacy evaluation. The reduction rate was calculated as follows: the difference between the total score before treatment and the total score after treatment, divided by the total score before treatment, and then multiplied by 100%. A reduction rate of 66% or higher was considered significant, a reduction rate between 25% and 66% was considered effective, and a reduction rate of 25% or lower was considered ineffective. Significant and effective results were observed in patients with acupuncture-sensitive allergic rhinitis, while ineffective results were observed in patients with acupuncture-insensitive allergic rhinitis.

[0067] Secondly, the present invention provides a test kit for predicting acupuncture sensitivity in patients with allergic rhinitis, comprising the nucleic acid aptamer combination described above for predicting acupuncture sensitivity in patients with allergic rhinitis.

[0068] Preferably, the test kit further includes a solid-phase matrix for immobilizing proteins in blood samples, a buffer reagent suitable for the binding of nucleic acid aptamers to proteins, and a blocking agent. The buffer reagent may be DPBS buffer, and the blocking agent may be bovine serum albumin (BSA) solution.

[0069] Thirdly, the present invention provides a method for predicting acupuncture sensitivity in patients with allergic rhinitis, such as... Figure 1 As shown, it includes the following steps:

[0070] S1. Using the nucleic acid aptamers in the above-mentioned nucleic acid aptamer combination as molecular probes, they interact with blood samples from patients with allergic rhinitis to form target-nucleic acid aptamer complexes.

[0071] The blood sample can be whole blood, plasma, or serum.

[0072] S2. Quantify the concentration of nucleic acid aptamers existing in the form of target-nucleic acid aptamer complexes to obtain a set of nucleic acid aptamer concentration values ​​corresponding to the nucleic acid aptamer combinations.

[0073] Among them, the quantitative detection method of nucleic acid aptamers in the form of target-nucleic acid aptamer complexes is a general method for absolute quantification of nucleic acid molecules, including real-time quantitative PCR technology, digital PCR technology, etc.

[0074] S3. Input the set of nucleic acid aptamer concentration values ​​into the pre-constructed acupuncture sensitivity prediction model for allergic rhinitis to obtain prediction results that characterize whether the allergic rhinitis patient to be tested is an acupuncture sensitive patient.

[0075] Among them, the acupuncture sensitivity prediction model for allergic rhinitis is a machine learning classification model that has been trained to classify allergic rhinitis patients into acupuncture-sensitive or acupuncture-insensitive types based on the set of nucleic acid aptamer concentration values.

[0076] Specifically, the machine learning classification model is constructed based on one or more of the following algorithms: logistic regression, K-nearest neighbors, support vector machine, decision tree, random forest, gradient boosting decision tree, multilayer perceptron, adaptive augmentation algorithm, and extreme random forest algorithm.

[0077] The construction process of the acupuncture sensitivity prediction model for allergic rhinitis includes:

[0078] S01. Obtain the training dataset.

[0079] S02. Use the training dataset to train various machine learning classification models to obtain multiple candidate prediction models.

[0080] S03. Use the test dataset to evaluate multiple candidate prediction models, and select the candidate prediction model with the best performance from them according to the preset evaluation index, as the prediction model for acupuncture sensitivity of allergic rhinitis.

[0081] The pre-defined evaluation metrics include precision, recall, F1 score, accuracy, specificity, and area under the ROC curve (AUC). Specifically, precision represents the proportion of samples predicted as acupuncture-sensitive by the model that are actually sensitive, reflecting the reliability of the prediction results; recall measures the proportion of patients who are actually sensitive and correctly identified by the model, reflecting the model's coverage of the effective population; the F1 score is the harmonic mean of precision and recall, used to comprehensively evaluate the balance between accuracy and completeness of the model; accuracy represents the overall percentage of samples correctly predicted by the model, reflecting the overall discrimination level of the model; specificity refers to the proportion of patients who are actually insensitive and correctly identified as insensitive, used to assess the model's ability to distinguish negative samples; and the AUC value, calculated by the area under the receiver operating characteristic curve, measures the model's overall discrimination efficacy between sensitive and insensitive patients at different decision thresholds. The values ​​of all the above evaluation metrics range from 0 to 1, with values ​​closer to 1 indicating better model discrimination ability. By comprehensively analyzing the above multiple indicators, the target model with the best predictive performance can be objectively and comprehensively selected, ensuring its high reliability in practical applications.

[0082] It should be noted that both the training and prediction datasets contain sets of nucleic acid aptamer concentration values ​​and corresponding acupuncture sensitivity classification labels for multiple allergic rhinitis patient samples. Furthermore, the case samples used to obtain the training and prediction datasets must be the same as those used for the experimental validation of nucleic acid aptamers in groups a and b above. Generally, the training set:test set ratio is 8:2.

[0083] Fourthly, the present invention provides a computer device including a memory and a processor, wherein the memory stores a computer program, and when the computer program is executed by the processor, it implements the method described above for predicting the acupuncture sensitivity of patients with allergic rhinitis.

[0084] The computer device can be a mobile device or a fixed device. The computer programs stored in the memory include, but are not limited to, web-based applications, native computer applications, and mobile terminal applications. These applications all integrate pre-built acupuncture sensitivity prediction models for allergic rhinitis and provide user-friendly interfaces that allow medical professionals or researchers to input a set of nucleic acid aptamer concentration values ​​obtained from the test kit or to directly upload relevant test data.

[0085] Example 1

[0086] This embodiment provides a test kit for predicting acupuncture sensitivity in patients with allergic rhinitis, comprising:

[0087] 1. Nucleic Acid Aptamers. Nucleic acid aptamers are single-stranded DNA molecules with sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3. Nucleic acid aptamers are available in solution or dry powder form. When available in solution form, the solvent is a buffer solution for the user's testing environment, such as DPBS buffer, at a concentration of 100 nM. When available in dry powder form, the user must reconstitute the dry powder with a buffer solution for their testing environment, such as DPBS buffer, and dilute it to a concentration of 100 nM before testing.

[0088] 2. DPBS buffer. Its formula is: 0.9 mM CaCl2, 2.7 mM KCl, 1.5 mM KH2PO4, 0.6 mM MgCl2·H2O, 0.1 M NaCl and 20 mM Na2HPO4, pH=7.4. DPBS buffer provides a suitable liquid environment for the binding of proteins and nucleic acid aptamers.

[0089] 3. 96-well plates that can adsorb proteins are used for protein fixation in blood samples.

[0090] 4. 1 mg / mL bovine serum albumin (BSA) was used to block the 96-well plate to reduce the detection background.

[0091] The binding affinity of nucleic acid aptamers to blood samples is expressed by the concentration of the nucleic acid aptamer in the target-aptamer complex. A higher concentration indicates a stronger binding affinity and a higher concentration of the target substance in the blood sample. The concentration is accurately detected using real-time quantitative PCR. The specific operating steps of the detection kit are as follows:

[0092] A1. Take 3 μg of serum protein from the patient to be tested, and adjust the volume to 100 μL with DPBS buffer. Incubate in a 96-well plate at 4°C for 12 h to allow the serum protein to fully bind and immobilize with the inner wall of the plate. Each sample to be tested requires 9 reaction wells, i.e., 3 parallel wells for each of the three aptamers shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0093] A2. Wash the 96-well plate three times with DPBS buffer, and add 100 μL of 1 mg / mL BSA to each well for 1 h to block.

[0094] A3. After blocking, discard the blocking solution and wash the plate three times with DPBS buffer. Add the corresponding nucleic acid aptamer solution to each well: add the solution of the aptamer shown in SEQ ID NO.1 to the three parallel wells corresponding to the aptamer shown in SEQ ID NO.2, add the solution of the aptamer shown in SEQ ID NO.2 to the three parallel wells corresponding to the aptamer shown in SEQ ID NO.3, and add the solution of the aptamer shown in SEQ ID NO.3 to the three parallel wells corresponding to the aptamer shown in SEQ ID NO.3. Incubate for 1 hour to allow the nucleic acid aptamers to fully bind to the target and form a complex.

[0095] A4. Wash the 96-well plate three times with DPBS buffer, add 100 μL of sterile water to each well, heat at 95°C for 10 min, and collect the nucleic acid aptamers from the target-aptamer complex in each well.

[0096] A5. A standard curve was prepared using serially diluted nucleic acid aptamer standards. Based on the standard curve, the nucleic acid aptamers in the eluent were absolutely quantified using real-time PCR to obtain concentration values. The standard curve used in this example is:

[0097]

[0098] Where y represents the Cq value detected by real-time PCR, and C represents the aptamer concentration in nM. The total system used was 20 μL, containing 2 μL of sample, 2 μL of 10 μM upstream and downstream primers, 10 μL of commercially available amplification enzyme mix (2×), and 4 μL of sterile water. The amplification program is shown in Table 1. The upstream and downstream primer sequence information is shown in Table 2.

[0099] Table 1. Quantitative Real-Time PCR Amplification Procedure

[0100]

[0101] Table 2. Upstream and downstream primer sequence information

[0102]

[0103] A6. Calculate the average nucleic acid aptamer concentration values ​​for each group of parallel samples, and then normalize the average nucleic acid aptamer concentration values ​​based on the original total protein concentration of the serum samples to obtain the set of nucleic acid aptamer concentration values ​​for the patients to be tested.

[0104] It should be noted that the nucleic acid aptamer concentration values ​​in the set of nucleic acid aptamer concentration values ​​can be either raw concentration values ​​or relative concentration values. Specifically, the raw concentration value of the nucleic acid aptamer for a single patient is the average concentration value of the nucleic acid aptamers in three parallel samples of that patient. The relative concentration value of the nucleic acid aptamer for a single patient is calculated as the average concentration value of the nucleic acid aptamers in the three parallel samples of that patient divided by the average concentration value of the same type of nucleic acid aptamers in the sensitive group. The sensitive group refers to the set of blood samples collected before the start of acupuncture treatment from a group of allergic rhinitis patients who have undergone rigorous clinical screening and been confirmed as acupuncture-sensitive in the experimental design and sample cohort of this invention.

[0105] In this embodiment, to verify the effectiveness of nucleic acid aptamers with sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 in differentiating the sensitivity of patients with allergic rhinitis to acupuncture treatment, a serum sample cohort of 340 patients with allergic rhinitis was included. Among them, 259 patients had acupuncture-sensitive allergic rhinitis and 81 patients had acupuncture-insensitive allergic rhinitis. The serum sample cohort included paired serum samples from patients before acupuncture treatment (enrollment) and after four weeks of continuous treatment (discharge). The aim was to objectively evaluate the ability of nucleic acid aptamers with sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 to identify efficacy-related biomarkers through large-sample data. Specifically, the serum sample cohort included sensitive enrolled samples, insensitive enrolled samples, sensitive discharged samples, and insensitive discharged samples.

[0106] The detection procedures A1-A6 above were performed on the sensitive enrolled samples, sensitive expired samples, insensitive enrolled samples, and insensitive expired samples, respectively. A schematic diagram of the nucleic acid aptamer concentration distribution corresponding to the nucleic acid aptamer of the sequence shown in SEQ ID NO.1 was obtained, as shown below. Figure 2 As shown; obtain the distribution maps of the differences in nucleic acid aptamer concentrations between sensitive and insensitive input / output samples corresponding to the nucleic acid aptamer sequence shown in SEQ ID NO.1, as shown. Figure 3 As shown in the diagram, the concentration distribution of nucleic acid aptamers corresponding to the nucleic acid aptamers of the sequence shown in SEQ ID NO.2 is illustrated. Figure 4 As shown; obtain the distribution maps of the differences in nucleic acid aptamer concentrations between sensitive and insensitive input / output samples corresponding to the nucleic acid aptamer sequence shown in SEQ ID NO.2, as shown. Figure 5As shown in the diagram, the concentration distribution of nucleic acid aptamers corresponding to the nucleic acid aptamers of the sequence shown in SEQ ID NO.3 is illustrated in the diagram. Figure 6 As shown; obtain the distribution maps of the differences in nucleic acid aptamer concentrations between sensitive and insensitive input / output samples corresponding to the nucleic acid aptamer sequence shown in SEQ ID NO.3, as shown. Figure 7 As shown. It should be noted that, Figures 2-7 The nucleic acid aptamer concentrations mentioned are relative concentrations.

[0107] exist Figure 2 , 4 In section 6, an independent samples t-test was used to compare the differences in relative concentrations between groups. Furthermore, to accurately analyze the changes in the content of target substances in each patient before and after acupuncture treatment, in... Figure 3 , 5 In section 7, paired-samples t-tests were used to compare the differences before and after treatment in sensitive and insensitive patients, respectively. * represents p<0.05, ** represents p<0.01, *** represents p<0.001, and **** represents p<0.0001.

[0108] Depend on Figure 2 It can be seen that the binding ability of the nucleic acid aptamer of the sequence shown in SEQ ID NO.1 to the sensitive enrolled sample is significantly lower than that to the insensitive enrolled sample, with a difference of 3.17 times, suggesting that the target molecule specifically recognized by the nucleic acid aptamer of the sequence shown in SEQ ID NO.1 is present in lower concentrations in the serum of the sensitive enrolled sample. Figure 3 In the diagram, the change in relative concentration on the vertical axis equals the difference between the relative concentration at the end of the treatment group and the relative concentration at the beginning of the treatment group. A value greater than 0 indicates upregulation of the corresponding target after acupuncture treatment, while a value less than 0 indicates downregulation of the corresponding target after acupuncture treatment. Figure 3 The paired-samples t-test results showed that the concentration changes before and after treatment were statistically significant. In sensitive patients, the concentration increased after treatment, with a fold change of 2.63 between the sensitive and non-sensitive groups. In insensitive patients, the concentration decreased after treatment, with a fold change of 1.28 between the non-sensitive and sensitive groups. A fold change less than 2 is considered insignificant, and therefore, there was no difference before and after treatment. In summary, the target corresponding to the nucleic acid aptamer sequence shown in SEQ ID NO.1 was present at a lower level in the serum of sensitive patients, and its level increased after acupuncture treatment. In non-sensitive patients, the level remained almost unchanged before and after acupuncture treatment. Therefore, the low detection concentration of the nucleic acid aptamer sequence shown in SEQ ID NO.1 indicates that this patient with allergic rhinitis is sensitive to acupuncture treatment; that is, the detection data of the nucleic acid aptamer in SEQ ID NO.1 is negatively correlated with the sensitivity to acupuncture treatment.

[0109] Depend on Figure 4It can be seen that the binding ability of the nucleic acid aptamer of the sequence shown in SEQ ID NO.2 to the sensitive enrolled sample is significantly lower than that to the insensitive enrolled sample, with a difference of 2.51 times, suggesting that the target substance of the nucleic acid aptamer of the sequence shown in SEQ ID NO.2 is at a lower content in the serum of the sensitive enrolled sample. Figure 5 In the diagram, the change in relative concentration on the vertical axis equals the difference between the relative concentration at the end of the treatment group and the relative concentration at the beginning of the treatment group. A value greater than 0 indicates upregulation of the corresponding target after acupuncture treatment, while a value less than 0 indicates downregulation of the corresponding target after acupuncture treatment. Figure 5 The paired-samples t-test results showed that the concentration changes before and after treatment were statistically significant. In the sensitive group, the concentration decreased after treatment, with a fold change of 1.72 between the sensitive and non-sensitive groups, which can be considered as no difference before and after treatment. In the insensitive group, the concentration decreased after treatment, with a fold change of 4.48 between the insensitive and non-sensitive groups. Therefore, the low detection concentration value of the nucleic acid aptamer in SEQ ID NO.2 indicates that this patient with allergic rhinitis is sensitive to acupuncture treatment; that is, the detection data of the nucleic acid aptamer in SEQ ID NO.2 is negatively correlated with the sensitivity to acupuncture treatment.

[0110] Depend on Figure 6 It can be seen that the binding ability of the nucleic acid aptamer of the sequence shown in SEQ ID NO.3 to the sensitive enrolled sample is significantly higher than that to the insensitive enrolled sample, with a difference of 2-fold, suggesting that the target substance of the nucleic acid aptamer of the sequence shown in SEQ ID NO.3 is present in higher concentrations in the serum of the sensitive enrolled sample. Figure 7 In the diagram, the change in relative concentration on the vertical axis equals the difference between the relative concentration at the end of the treatment group and the relative concentration at the beginning of the treatment group. A value greater than 0 indicates upregulation of the corresponding target after acupuncture treatment, while a value less than 0 indicates downregulation of the corresponding target after acupuncture treatment. Figure 7 The paired-samples t-test results showed that the concentration changes before and after treatment were statistically significant. In sensitive patients, the concentration decreased after treatment, with a fold change of 1.92-fold between the sensitive and non-sensitive groups, close to 2-fold, indicating a significant decrease. In non-sensitive patients, there was no significant difference in the corresponding target concentration in their serum before and after treatment. Therefore, the high detection concentration of the nucleic acid aptamer in SEQ ID NO.3 indicates that this patient with allergic rhinitis is sensitive to acupuncture treatment, meaning that the detection data of the nucleic acid aptamer in SEQ ID NO.3 is positively correlated with the sensitivity to acupuncture treatment.

[0111] In summary, the nucleic acid aptamers of the sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 all exhibit good specificity for identifying biomarkers related to sensitivity to acupuncture treatment in allergic rhinitis. They can all be used as probes to construct detection kits and can be used in combination to differentiate between patients who are sensitive to acupuncture treatment and those who are not, thereby providing efficacy prediction before treatment.

[0112] Example 2

[0113] This embodiment uses a dataset consisting of the set of relative concentration values ​​of nucleic acid aptamers corresponding to the serum sample cohort of 340 patients with allergic rhinitis in Example 1. The acquisition of the set of nucleic acid aptamer concentration values ​​corresponding to each serum sample follows the procedures A1-A6 of Example 1.

[0114] The dataset was divided into a training dataset and a test dataset. The training dataset consisted of a set of nucleic acid aptamer concentration values ​​for 279 samples, including 209 sensitive samples and 70 insensitive samples. The test dataset consisted of a set of nucleic acid aptamer concentration values ​​for 61 samples, including 50 sensitive samples and 11 insensitive samples.

[0115] Nine different machine learning classification models were trained using the training dataset. Each model was iterated multiple times until it reached its optimal state, resulting in nine candidate prediction models. The ROC curves and AUC values ​​of the nine candidate prediction models are shown below. Figures 8a-8c As shown. Then, the nine candidate prediction models were evaluated using the test dataset, and the resulting ROC curves and area under the curve (AUC) are shown below. Figures 9a-9c As shown in Table 3, the parameter values ​​for other preset evaluation indicators are also shown.

[0116] Table 3. Parameters of the preset evaluation indicators for candidate prediction models

[0117]

[0118] Testing on the test dataset revealed that the AUC values ​​of all nine candidate prediction models were greater than or equal to 0.9, indicating high prediction accuracy. Combining the evaluation metrics of precision, recall, F1 score, accuracy, and specificity for each prediction model, candidate models with parameters less than or equal to 0.9 were removed. The final models meeting the design objectives included: K-Nearest Neighbors algorithm, decision tree, random forest, multilayer perceptron, adaptive augmentation, and extreme random forest—a total of six candidate prediction models. The adaptive augmentation model demonstrated the best performance, with an AUC of 1.00 on the training set and 0.98 on the test set, a precision of 1.00, a recall of 0.96, an F1 score of 0.98, an accuracy of 0.97, and a specificity of 1.00. The learning rate for the adaptive augmentation model was 0.01, and the number of weak learners (n_estimators) was set to 200. The adaptive enhancement model is the acupuncture sensitivity prediction model for allergic rhinitis obtained in this embodiment, which can be used to predict whether patients with allergic rhinitis are sensitive to acupuncture therapy.

[0119] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A set of nucleic acid aptamers for predicting acupuncture sensitivity of a patient with allergic rhinitis, characterized in that, The nucleic acid aptamer of the combination is: The nucleic acid aptamer is a single-stranded DNA or RNA molecule.

2. The aptamer panel for predicting acupuncture sensitivity of allergic rhinitis patients according to claim 1, wherein, The nucleic acid aptamer is further chemically modified, and the chemical modification is at least one of biotin, a fluorescent molecule, an isotope, electrochemistry, an enzyme, or a thiol group.

3. The aptamer combination for predicting acupuncture sensitivity of a patient with allergic rhinitis according to claim 1 or 2, characterized by, The nucleic acid aptamer combination for predicting acupuncture sensitivity of allergic rhinitis patients according to any one of claims 1-3.

4. A test kit for predicting acupuncture sensitivity in patients with allergic rhinitis, characterized in that, The computer program is stored in the memory and is executed by the processor to implement a method for predicting acupuncture sensitivity of allergic rhinitis patients, the method comprising the steps of:

5. A computer device, comprising: The nucleic acid aptamer concentration value set is input into a pre-constructed allergic rhinitis acupuncture sensitivity prediction model for prediction to obtain a prediction result for characterizing whether the patient to be tested is an acupuncture-sensitive patient. The nucleic acid aptamer concentration value set is obtained by: The nucleic acid aptamer in the nucleic acid aptamer combination of any one of claims 1-3 is used as a molecular probe to react with a blood sample from the patient to be tested to form a target-nucleic acid aptamer complex; the nucleic acid aptamer in the form of a target-nucleic acid aptamer complex is quantified to obtain a set of nucleic acid aptamer concentration values corresponding to the nucleic acid aptamer combination. The blood sample is whole blood, plasma, or serum.

6. The computer device of claim 5, wherein, The allergic rhinitis acupuncture sensitivity prediction model is a trained machine learning classification model that can classify allergic rhinitis patients into acupuncture-sensitive or non-sensitive types according to the nucleic acid aptamer concentration value set.

7. The computer device of claim 5, wherein, The nucleic acid aptamer combination comprises nucleic acid aptamers with sequences as shown in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3; 8. The computer device of claim 5, wherein, The blood sample is serum. The allergic rhinitis acupuncture sensitivity prediction model is an adaptive enhancement model. The construction process of the allergic rhinitis acupuncture sensitivity prediction model comprises:

9. The computer device of claim 5, wherein, S01, obtaining a training data set; S02, training multiple different machine learning classification models using the training data set to obtain multiple candidate prediction models; S03, evaluating the multiple candidate prediction models using a test data set, and selecting the candidate prediction model with the best performance according to a pre-set evaluation index as the allergic rhinitis acupuncture sensitivity prediction model; The training data set and the prediction data set each contain a nucleic acid aptamer concentration value set of multiple allergic rhinitis patient samples and corresponding acupuncture sensitivity classification labels. ​

Images