Method for rapidly screening immunosuppressant

Abstract

The invention discloses a method for rapidly screening an immunosuppressant, relates to the field of biotechnology detection, and can be used for detecting the effect of a novel immunosuppressant and screening an efficient immunosuppressant. The effect of the immunosuppressor is evaluated mainly by detecting the agglutination effect of insect hemolymph treated by the inhibitor on chicken red blood cells, expression of insect immune genes and changes of the encapsulation rate of insects, so that the inhibition effect of the immunosuppressor on immune response is reflected. The method is suitable for a general detection scheme of a wide range of immune inhibitors, provides a detection method and a verification means for detecting and screening the immune inhibitors, is helpful for deeply understanding an insect immune mechanism, also provides a theoretical basis for developing a new immune inhibitor, and has a wide application prospect. Revolutionary changes are expected to be brought to pest control and even development and utilization of novel immunosuppressive drugs in various fields.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and biotechnology detection, and specifically relates to a screening method for immunosuppressants. Background Technology

[0002] Insects, as one of the most diverse groups of organisms on Earth, have always had a unique immune defense mechanism that is a key focus of life science research. In the open circulatory system of insects, hemolymph is equivalent to blood and lymph in higher animals, not only performing the function of material transport but also forming a unique humoral immune defense system. Agglutinins in hemolymph act as pattern recognition receptors, triggering agglutination reactions by specifically recognizing glycoproteins on the surface of pathogens, thereby triggering a series of immune responses, including but not limited to phagocytosis, cyst formation, and melanization. These constitute the first line of defense in insect immune systems. For example, patent 201910981821.0 discloses the application of the CvBV3-3 gene in reducing humoral immune responses in insects. Using transgenic technology, the CvBV3-3 polynucleotide viral gene from the diamondback moth wasp was transferred into the Drosophila genome, obtaining a stable, homozygous transgenic Drosophila strain. Using the UAS / GAL4 system, the homozygous CvBV3-3 transgenic Drosophila was crossed with the BS8700 Drosophila strain. After the resulting strain expressed the polynucleotide viral gene, it was found that this gene significantly inhibited the melanization activity of insect hemolymph and reduced the cysting effect of Drosophila larvae on parasitic wasp larvae. Therefore, utilizing the rapid immune response in insect hemolymph to address the current need for rapid screening of immunosuppressive drugs is a good option and provides a theoretical basis for developing new anti-infection strategies.

[0003] Traditional methods for screening immunosuppressive drugs primarily rely on in vitro cell models and animal experiments. In vitro experiments commonly use lymphocyte proliferation assays (such as mixed lymphocyte reactions) to screen candidate compounds by detecting the inhibitory effects of drugs on T-cell and B-cell proliferation. Animal models mainly utilize allogeneic organ transplantation models (such as mouse skin transplantation and rat heart transplantation) to assess the ability of drugs to prolong graft survival. However, this approach has significant limitations: in vitro models cannot accurately simulate the complex immune microenvironment in vivo, potentially leading to ineffective screening of drugs; species differences exist between animal models and human immune mechanisms, resulting in some drugs exhibiting toxicity or poor efficacy in clinical trials; furthermore, traditional methods often target single immune targets, making it difficult to address the multi-target regulatory needs of complex diseases such as autoimmune diseases, and the long screening cycle and high cost limit the efficiency of new drug development.

[0004] In conclusion, with the advancement of science and technology, overcoming current technological bottlenecks and developing more sensitive and efficient methods for screening immunosuppressants is particularly urgent. This will not only contribute to a deeper understanding of insect immune mechanisms and provide a theoretical basis for developing new anti-infection strategies, but also hold the promise of bringing revolutionary changes to agricultural production. Future work should focus on improving existing extraction and purification techniques, establishing standardized quantitative analysis procedures, and exploring universal detection schemes applicable to a wide range of insect species. In this way, we can better utilize insects, this valuable natural resource, to serve the development of human society. Summary of the Invention

[0005] To address the aforementioned problems, this invention proposes a rapid screening method for immunosuppressants, which provides a convenient way to screen immunosuppressants.

[0006] The technical solution of this invention is implemented as follows: This invention provides a method for rapid screening of immunosuppressants, including treatment of cotton bollworm larvae with immunosuppressants, collection and treatment of cotton bollworm hemolymph, preparation of fresh chicken blood erythrocyte suspension, detection of hemolymph agglutination effect and reading of immune titer, detection of expression levels of immune genes in host hemolymph, and comparison of cyst encapsulation rate of parasitic wasp eggs by host hemolymph.

[0007] The immunosuppressant treatment of cotton bollworm larvae provided by this invention is achieved by adding immunosuppressants to the artificial feed of cotton bollworm larvae.

[0008] On one hand, this invention claims a method for screening immunosuppressants, the steps of which are: (1) The test immunosuppressant was added to the cotton bollworm feed as the treatment group, and the cotton bollworm feed without the immunosuppressant was used as the control group; (2) The cotton bollworms were fed with the same feed as the treatment group and the control group, and then parasitized with parasitic wasps to collect the cotton bollworm hemolymph. (3) Prepare chicken blood red blood cell suspension, and detect the immunoagglutination effect, expression of immune genes and encapsulation rate of hemolymph in the treatment group and the control group respectively, and compare and evaluate the immune effect.

[0009] Preferably, the final concentration of the immunosuppressant in the bollworm feed in step (1) above is 10-100 μg / mL.

[0010] Preferably, in step (2) above, the parasitic wasp parasitizes the cotton bollworm larvae once and at a time to lay eggs; the rearing conditions for the parasitized larvae are a photoperiod of 14 L:10 D, relative humidity of 40-60%, and temperature of 24-26℃; the parasitic wasp is a 5-10 day old female cotton bollworm tooth-lipped wasp.

[0011] Preferably, the step of collecting cotton bollworm hemolymph in step (2) above is as follows: after puncturing the abdomen of the larva with a dissecting needle, collect the hemolymph with a micro-capillary tube in an ice bath, and then add phenylthiourea for treatment.

[0012] Preferably, the concentration of the phenylthiourea is 10 mM, and the volume ratio of hemolymph to phenylthiourea is 5-10:1.

[0013] Preferably, the preparation steps of chicken blood red blood cell suspension in step (3) above are as follows: fresh chicken blood is collected and added to pre-cooled PBS, centrifuged and the supernatant is removed to prepare chicken blood red blood cell suspension.

[0014] Preferably, the volume ratio of the fresh chicken blood to PBS is 1:10-20, and the concentration of the chicken blood red blood cell suspension is 2-5%.

[0015] The steps for detecting the immunoagglutination effect in step (3) above are as follows: Add PBS and collected hemolymph to a 96-well plate and mix them. Dilute the mixture in a gradient and add it to the next well. Repeat this cycle 6-10 times. Then add chicken blood red blood cell suspension to each well. Take a picture after precipitation and agglutination occurs and record the immunogenicity.

[0016] The specific steps are as follows: (1) The first row of the 96-well plate is an example, and 15 μL of PBS sample is added to the solvent control well.

[0017] (2) In the second row, add 15 μL of PBS and 15 μL of the above hemolymph to well 1, add 10 μL of PBS and 20 μL of the above hemolymph to well 2, and add 15 μL of PBS to the remaining wells.

[0018] (3) Mix the second well with suction and beat to avoid air bubbles. Then take 15 μL and put it into the third well to mix again with suction and beat. Take 15 μL and put it into the fourth well, and so on until the last well is mixed with suction and beat.

[0019] (4) Add 15 μL (1:1) of 2% chicken blood red blood cell suspension to each experimental well.

[0020] (5) Take a picture of the precipitation and aggregation phenomenon after about an hour, and label the aggregation titer according to the order of the holes based on the aggregation effect.

[0021] Preferably, the volume ratio of PBS to hemolymph is 1:2-20, and the volume ratio of chicken blood red blood cell suspension to solution in the well is 1:1.

[0022] The above step (3) to calculate the cyst rate is as follows: dissect under an optical microscope, observe the cysts, and calculate the cyst rate method = number of cysts / total number of embryos.

[0023] Secondly, this invention claims protection for the application of the above-described method for screening immunosuppressants in the detection and screening of immunosuppressants.

[0024] The present invention has the following beneficial effects: This invention discloses a rapid method for screening immunosuppressants, which can be used to detect the efficacy of novel immunosuppressants and screen for highly effective immunosuppressants. The efficacy and potency of the immunosuppressants are mainly evaluated by detecting the agglutination effect of insect hemolymph on chicken erythrocytes, changes in the expression of insect immune genes, and changes in cyst formation rate, thus reflecting the inhibitory effect of the immunosuppressant on the immune response. This method is a universal detection scheme applicable to a wide range of insect species. This invention provides a detection method and verification means for detecting and screening immunosuppressants, contributing to a deeper understanding of insect immune mechanisms and providing a theoretical basis for developing new anti-infection strategies, potentially bringing revolutionary changes to agricultural production. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This refers to the immunoagglutination reaction of cotton bollworm larvae's hemolymph against immunosuppressants.

[0027] Figure 2 This refers to the immunoagglutination reaction of hemolymph from parasitized bollworm larvae to immunosuppressants.

[0028] Figure 3 This refers to the expression of immune genes in cotton bollworm larvae in response to immunosuppressants.

[0029] Figure 4 This study investigated the expression of immune genes in post-parasitic cotton bollworm larvae in response to immunosuppressants.

[0030] Figure 5 The effect of immunosuppressants on encapsulation rate. Detailed Implementation

[0031] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0032] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0033] Example 1: Immunoglucoagulation reaction of hemolymph from unparasitized and parasitized bollworm larvae to immunosuppressants. 1. Prepare feed for cotton bollworm larvae containing immunosuppressants. (1) Weigh 80 g soybean flour, 150 g wheat germ flour, 30 g yeast powder and 20 g sucrose, mix them in a stainless steel bowl and stir well; prepare 3 g sorbic acid and 3 g methylparaben for later use.

[0034] (2) Boil 500 mL of distilled water, add the above reagent and stir until dissolved, then quickly pour into (1) and mix well.

[0035] (3) Boil 600 mL of distilled water at 2500 W, reduce the heat to 300 W and add 20 g of agar powder. Stir for 20 min until dissolved, then add 40 g of casein and stir for 2 min. Quickly pour into (2) and mix well.

[0036] (4) Weigh 3 g of vitamin C and 8 g of multivitamins, add 100 mL of distilled water and stir to dissolve for later use.

[0037] (5) Cool (3) to 45°C, add (4), 2 mL and 4 mL of glacial acetic acid, and stir well.

[0038] (6) Weigh 50 mL of cotton bollworm feed and add immunosuppressants. No immunosuppressants were added to the control group.

[0039] 2. Parasitic wasps parasitize cotton bollworm larvae Prepare 5-10 day old female *Ichthyophthirius multifiliis* wasps of similar size that have successfully mated and are larvae of similar size. For each larval experiment, select a female wasp to parasitize a single cotton bollworm larva. Perform a single parasitism and oviposition on each group of larvae. After parasitism, place the cotton bollworm larvae at a depth of 25 cm. 3 They were kept individually in plastic containers under the following conditions: photoperiod 14 L:10 D, relative humidity 40%-60%, and temperature 25±1℃.

[0040] 3. Preparation of 2% chicken red blood cells (1) Take 100 μL of chicken blood cells into a 2 mL EP tube and add 1 mL of PBS to dilute (1:10). (2) Centrifuge at 500 g, 5 min, 4℃ to collect the precipitate, discard the supernatant and keep the precipitate, repeat three times; (3) Extract the lower layer of chicken blood red blood cell precipitate; (4) Extract 20 μL of chicken blood red blood cells and add 980 μL of PBS to make a 2% chicken blood suspension (2:98).

[0041] 4. Collection and processing of hemolymph (1) Take 120 μL of hemolymph from 4th and 5th instar cotton bollworm larvae (20-30 larvae) using a pre-cooled microcapillary tube, place it on ice and centrifuge at 4°C, 12000 g, for 10 min, and take 100 μL of supernatant.

[0042] (2) Add 10 μL of PTU (10 mM) at a final PTU concentration of 1 mM.

[0043] 5. Sampling method and procedure (1) The first row of the 96-well plate is an example, and 15 μL of PBS sample is added to the solvent control well.

[0044] (2) In the second row, add 15 μL of PBS and 15 μL of the above hemolymph to well 1, add 10 μL of PBS and 20 μL of the above hemolymph to well 2, and add 15 μL of PBS to the remaining wells.

[0045] (3) Mix the second well with suction and beat to avoid air bubbles. Then take 15 μL and put it into the third well to mix again with suction and beat. Take 15 μL and put it into the fourth well, and so on until the last well is mixed with suction and beat.

[0046] (4) Add 15 μL (1:1) of 2% chicken blood red blood cell suspension to each experimental well.

[0047] 6. Results Recording and Statistics (1) After about an hour, sedimentation and aggregation will occur. Take a picture as shown. Figure 1 and Figure 2 As shown.

[0048] (2) Mark the agglomeration valence according to the order of the holes based on the agglomeration effect.

[0049] Depend on Figure 1 It can be seen that in unparasitized bollworm larvae, the hemolymph treated with immunosuppressants exhibited a weaker agglutination effect on chicken erythrocytes compared to the control group; Figure 2 It can be seen that the hemolymph agglutination ability of parasitic cells treated with immunosuppressants is enhanced compared with that of unparasitic cells, but still lower than that of the parasitic control group.

[0050] Example 2: Expression of immune genes in unparasitized and parasitized bollworm larvae in response to immunosuppressants 1. Prepare feed for cotton bollworm larvae containing immunosuppressants. (1) Weigh 80 g soybean flour, 150 g wheat germ flour, 30 g yeast powder and 20 g sucrose, mix them in a stainless steel bowl and stir well; prepare 3 g sorbic acid and 3 g methylparaben for later use.

[0051] (2) Boil 500 mL of distilled water, add the above reagent and stir until dissolved, then quickly pour into (1) and mix well.

[0052] (3) Boil 600 mL of distilled water at 2500 W, reduce the heat to 300 W and add 20 g of agar powder. Stir for 20 min until dissolved, then add 40 g of casein and stir for 2 min. Quickly pour into (2) and mix well.

[0053] (4) Weigh 3 g of vitamin C and 8 g of multivitamins, add 100 mL of distilled water and stir to dissolve for later use.

[0054] (5) Cool (3) to 45°C, add (4), 2 mL and 4 mL of glacial acetic acid, and stir well.

[0055] (6) Weigh 50 g of cotton bollworm feed and add immunosuppressants. No immunosuppressants were added to the control group.

[0056] 2. Parasitic wasps parasitize cotton bollworm larvae Prepare 5-10 day old female *Ichthyophthirius multifiliis* wasps of similar size that have successfully mated and are larvae of similar size. For each larval experiment, select a female wasp to parasitize a single cotton bollworm larva. Perform a single parasitism and oviposition on each group of larvae. After parasitism, place the cotton bollworm larvae at a depth of 25 cm. 3 They were kept individually in plastic containers under the following conditions: photoperiod 14 L:10 D, relative humidity 40%-60%, and temperature 25±1℃.

[0057] 3. Expression of immune genes (1) RNA extraction After dissecting the treated cotton bollworm larvae, tissue samples were collected. RNAiso Plus was added, mixed, and incubated on ice for 5 min; centrifuged at 12000 g for 10 min at 4°C, and the supernatant was collected; chloroform was added, vortexed, and incubated on ice for 5 min; centrifuged at 12000 g for 15 min at 4°C, and the supernatant was collected; isopropanol was added, and mixed; centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was discarded; 75-80% anhydrous ethanol was added, the precipitate was resuspended in the liquid, and centrifuged at 7500 g for 5 min at 4°C, and the supernatant was discarded. The centrifuge tube was placed in a fume hood to evaporate the ethanol, and DEPC water was added to dissolve the RNA. The RNA concentration was measured and the solution was used for later use.

[0058] (2) Reverse transcription The assay was performed using the HiScript IV RT SuperMix for qPCR (+gDNAwiper) kit from Nanjing Novizan Biotechnology Co., Ltd.

[0059] (3) Quantitative fluorescence Primers were designed using NCBI: upstream primer F: TATCAGGGCTCTGCCTGACT, and downstream primer R: GTATGCGTCGTCAAAGGTGC. qRT-PCR was performed using a three-step method in a real-time quantitative PCR instrument, and the amplification efficiency of the primers was calculated based on the CT value. EF-1α (U20129.1) and β-actin (HM629442.1) is the internal reference gene. The reaction system for each well in the qPCR is shown in Table 1. Table 1 qPCR reaction system The operation was performed using dedicated qPCR plates, with three replicates per group. The mixture was prepared first, then added to the corresponding wells, followed by 1 μL of cDNA. The plates were centrifuged cis-centrifuged before qPCR. The qPCR reaction program is shown in Table 2. Table 2 qPCR reaction procedure 4. Results Recording and Statistics All quantitative PCR data in this article were used to calculate expression levels using two internal references, as shown in the following formula. The results were analyzed using the LSD method in DPS 9.01 software to assess the significance of each indicator, and corresponding charts were created using GraphPrism 9.01 software. Figure 3 and Figure 4 It can be seen that after treatment with immunosuppressants, the expression of immune genes in both unparasitized and parasitized cotton bollworm larvae was significantly reduced.

[0060] Example 3: Effect of immunosuppressants on encapsulation rate 1. Prepare feed for cotton bollworm larvae containing immunosuppressants. (1) Weigh 80 g soybean flour, 150 g wheat germ flour, 30 g yeast powder and 20 g sucrose, mix them in a stainless steel bowl and stir well; prepare 3 g sorbic acid and 3 g methylparaben for later use.

[0061] (2) Boil 500 mL of distilled water, add the above reagent and stir until dissolved, then quickly pour into (1) and mix well.

[0062] (3) Boil 600 mL of distilled water at 2500 W, reduce the heat to 300 W and add 20 g of agar powder. Stir for 20 min until dissolved, then add 40 g of casein and stir for 2 min. Quickly pour into (2) and mix well.

[0063] (4) Weigh 3 g of vitamin C and 8 g of multivitamins, add 100 mL of distilled water and stir to dissolve for later use.

[0064] (5) Cool (3) to 45°C, add (4), 2 mL and 4 mL of glacial acetic acid, and stir well.

[0065] (6) Weigh 50 mL of cotton bollworm feed and add immunosuppressants. No immunosuppressants were added to the control group.

[0066] 2. Parasitic wasps parasitize cotton bollworm larvae Prepare 5-10 day old female *Ichthyophthirius multifiliis* wasps of similar size that have successfully mated and are larvae of similar size. For each larval experiment, select a female wasp to parasitize a single cotton bollworm larva. Perform a single parasitism and oviposition on each group of larvae. After parasitism, place the cotton bollworm larvae at a depth of 25 cm. 3 They were kept individually in plastic containers under the following conditions: photoperiod 14 L:10 D, relative humidity 40%-60%, and temperature 25±1℃.

[0067] 3. Anatomy and cyst rate statistics of cotton bollworm larvae Select normal and healthy second-instar cotton bollworms, attach them to the corresponding feed, and after they have finished feeding, use a successfully mated and parasitized normal female wasp (similar in size and age) to parasitize the cotton bollworm larvae individually in a transparent glass tube. Place the tube in a climate chamber at 34℃, and dissect the cysts under an optical microscope after parasitism. Calculate the cyst rate as: number of cysts / total number of embryos.

[0068] Depend on Figure 5 It can be seen that the cysting rate of cotton bollworms on parasitic wasps is significantly reduced after treatment with immunosuppressants.

[0069] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method of screening for immunosuppressants, characterized by, The steps are: (1) adding the immune inhibitor to be tested into the cotton bollworm feed as a treatment group, and using the cotton bollworm feed without addition as a control group; (2) feeding the cotton bollworms with the feed of the treatment group and the control group, and then using the parasitic wasps to parasitize the cotton bollworm larvae, and collecting the cotton bollworm blood lymph; (3) preparing chicken red blood cell suspension, and respectively detecting the immune agglutination effect, immune gene expression and statistical encapsulation rate of the blood lymph of the treatment group and the control group, and evaluating the immune effect.

2. The method of screening for immunosuppressants according to claim 1, characterized in that: In the step (1), the final concentration of the immune inhibitor in the cotton bollworm feed is 10-100 μg / mL.

3. The method of screening for immunosuppressants according to claim 1, wherein: In the step (2), the parasitic wasps lay eggs on the cotton bollworm larvae once and one by one; the rearing conditions of the parasitized larvae are a light cycle of 14 L:10 D, a relative humidity of 40-60%, and a temperature of 24-26℃; and the parasitic wasps are 5-10 day-old female cotton bollworm Cotesia platyellae.

4. The method of screening for immunosuppressants according to claim 3, wherein, In the step (2), the collecting step of the cotton bollworm blood lymph is as follows: after the larvae are pricked in the abdomen with a dissecting needle, the blood lymph is collected with an ice-bathed micro-capillary, and phenylthiourea is added for treatment.

5. The method of screening for immunosuppressants according to claim 4, wherein: The concentration of the phenylthiourea is 10 mM, and the volume ratio of the blood lymph to the phenylthiourea is 5-10:

1.

6. The method of screening for immunosuppressants according to claim 1, wherein, In the step (3), the preparation step of the chicken red blood cell suspension is as follows: after the fresh chicken blood is collected, pre-cooled PBS is added, and after centrifugation, the supernatant is removed to prepare the chicken red blood cell suspension.

7. The method of screening for immunosuppressants according to claim 6, wherein: The volume ratio of the fresh chicken blood to the PBS is 1:10-20, and the concentration of the chicken red blood cell suspension is 2-5%.

8. The method of screening for immunosuppressants according to claim 7, wherein, In the step (3), the detection step of the immune agglutination effect is as follows: the PBS and the collected blood lymph are mixed in a 96-well plate, the mixed solution is gradiently diluted and added into the next well, the cycle is repeated for 6-10 times, then the chicken red blood cell suspension is added into each well, and after the precipitation and agglutination phenomenon appears, a photograph is taken, and the immune effect is recorded.

9. The method of screening for immunosuppressants according to claim 8, wherein: The volume ratio of the PBS to the blood lymph is 1:2-20, and the volume ratio of the chicken red blood cell suspension to the mixed solution in each well is 1:

1.

10. The use of the method for screening the immune inhibitor according to any one of claims 1-9 in the detection and screening of the immune inhibitor.

Images