Application of aptamer in addressable detection

By combining aptamer-target unit amplification with solid-phase support, the problems of non-specific amplification and high cost of labeled probes in nucleic acid detection are solved, achieving efficient and low-cost multiplex nucleic acid target detection.

CN121272015APending Publication Date: 2026-01-06CHANGZHOU FLUOSCIENCE MEDICAL TECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410888549.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-07-03
Publication Date
2026-01-06

AI Technical Summary

Technical Problem

Existing PCR, isothermal amplification, and addressable detection technologies have limitations in nucleic acid detection, including non-specific amplification, limited target weights, high cost of labeled probes, long and costly antibody preparation cycles, and antibody cross-reactivity, which restrict their widespread application.

Method used

The aptamer-target unit is used. The aptamer-target unit is prepared by amplification and then immobilized on a solid support to capture the target. The target is then combined with a specific marker to form a complex for detection. By utilizing the high specificity and reversibility of the aptamer, addressable detection of nucleic acid targets can be achieved.

Benefits of technology

It reduces production costs, simplifies the labeling process, improves the signal-to-noise ratio and sensitivity of detection, and enables rapid and low-cost detection of multiple targets.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121272015A_ABST
    Figure CN121272015A_ABST
Patent Text Reader

Abstract

The present invention provides a method for addressable detection of a nucleic acid target comprising a) preparing an aptamer-target unit by amplification; b) preparing a solid-phase support and one or more capture elements fixed on the surface and / or inside the solid-phase support; c) a marker capable of specifically recognizing and / or combining the aptamer-target unit, wherein the aptamer-target unit and the capture element form a compound; and d) detecting the signal. The invention also provides a kit, which comprises a primer group for aptamer-target unit amplification, a marker, a solid-phase support and a capture element, and optionally also comprises a specification of the detection method. According to the method, the detection cost of nucleic acid can be reduced, the detection speed of nucleic acid can be increased, and the detection target number of single-tube nucleic acid can be remarkably increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to aptamer-target units and their application in the addressability detection of amplification products of nucleic acid targets. Background Technology

[0002] Nucleic acid testing, including DNA and RNA detection, has shown significant value in disease diagnosis, treatment monitoring, and prognosis assessment. With the discovery of more and more nucleic acid biomarkers, higher demands are being placed on nucleic acid testing technologies. Multi-target parallel detection and low-cost, rapid on-site testing are the development trends of nucleic acid testing technology. Three key issues must be addressed in the nucleic acid testing process: 1. Amplification of the target nucleic acid sequence; 2. Visual labeling of nucleic acid target molecules; 3. Detection of nucleic acid target molecules.

[0003] In the amplification of nucleic acid sequences, PCR amplification technology is currently the most commonly used. After nearly two decades of development, various PCR techniques have emerged, making it a routine technique in laboratories. It is an important tool in modern molecular biology research and a sensitive amplification system. However, whether it's quantitative real-time PCR or other PCR amplification techniques, the amplification process requires high-end, expensive equipment and demanding detection conditions. Isothermal amplification of nucleic acids is an alternative to PCR. Its amplification is achieved under constant temperature conditions, eliminating the need for a precisely controlled thermal cycling system. The equipment used is neither complex nor expensive. Furthermore, isothermal amplification can efficiently amplify nucleic acid sequences, achieving amplification efficiencies comparable to PCR. Currently commonly used isothermal amplification methods include sequence-dependent amplification (NASBA), strand substitution amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), recombinant polymerase amplification (RPA), exponential amplification reaction (EXPAR), nickase amplification (NEAR), whole genome amplification (WGA), or linear and cascade amplification methods. Combined with transcription systems such as T7, it can achieve efficient amplification of DNA and RNA. However, both PCR and isothermal amplification techniques suffer from non-specific amplification. Furthermore, the homogeneous detection process after amplification also has the problem of limited target weights.

[0004] In the visualization and labeling of nucleic acid target molecules, commonly used nucleic acid labeling molecules include nucleic acid non-specific binding probe molecules, such as first-generation nucleic acid labeling probes like SYBR Green, EB, and TOTO. These molecules lack sequence specificity for nucleic acid labeling and are only suitable for labeling and detecting single purified targets. Second-generation TaqMan probes can specifically report the amplification of specific targets, but these probes only light up when cleaved and free in solution, and cannot report target location information. Therefore, they are only suitable for detection in homogeneous systems, and a single tube can detect a maximum of six target complexes, limiting their application scenarios. Sequence-specific probes also include hybridization probes and molecular beacons. However, these probes require solid-state nucleic acid synthesis and rigorous purification processes, resulting in high costs during use.

[0005] In the field of visual labeling of immunoassays, numerous high-performance reporter groups have been developed, such as dyes, fluorescent dyes, latent fluorescent dyes, fluorescent microspheres, quantum dots, carbon dots, colored latex spheres, redox molecules, luminescent molecules, enzymes, colloidal particles, radioactive labels, electrochemical functional groups, enzyme-based detectable substrates, and colloidal gold particles. These labels typically require an immune reaction between an antibody and an antigen to achieve specific labeling of the target. However, antibodies are relatively expensive, and the antibody type needs to be adjusted for different test samples. Furthermore, antibody preparation is dependent on mammals, resulting in long preparation cycles, high costs, poor batch-to-batch stability, and stringent storage and transportation requirements. Secondly, antibodies suffer from insufficient specificity, such as cross-reactivity. Moreover, not all antigens, such as small molecule toxic targets, can produce effective antibodies. Additionally, antibodies exhibit poor compatibility with post-modification, making it difficult to precisely control the modification site, and modifications often affect antibody activity.

[0006] With the rapid development of biotechnology, nucleic acid aptamer technology has emerged rapidly and has been well applied in food safety testing, environmental pollution detection, and clinical diagnostic methods. Nucleic acid aptamers are a class of oligonucleotide sequences that, through their specific three-dimensional structures, can exhibit properties similar to antibodies, such as high specificity and high affinity binding to targets. Meanwhile, the following characteristics of aptamers make them ideal antibody substitutes in the field of small molecule toxicity detection: 1. Aptamers are applicable to a wide range of molecules, including toxins, metal ions, organic dyes, antibiotics, peptides, and other small molecules, solving the problem of difficulty in preparing antibodies against small molecule toxicity targets; 2. Aptamers have good reproducibility in synthesis, are low in cost (only one-sixth that of antibodies), and have good stability; 3. Aptamers have reversible denaturation, can be chemically synthesized in vitro, and can be stored and transported at room temperature. Temperature-induced denaturation is reversible, solving the problems of long synthesis time, high cost, and poor reproducibility and regeneration of antibodies; 4. Aptamers are easy to functionalize, and biological modifications can achieve signal generation, affinity capture, covalent cross-linking, nanocarrier modification, and interface immobilization, solving the problem of easy inactivation of antibody labels; most importantly, aptamers have excellent specificity, effectively distinguishing subtle structural differences in target molecules and separating substances with similar structures or cross-reactivity, solving the problem of antibody cross-reactivity.

[0007] With the further development of aptamer technology, aptamers are constantly being endowed with new functions, such as fluorescent RNA / DNA aptamers. Fluorescent RNA / DNA aptamers can specifically bind to activating fluorescent dyes and activate their fluorescence. Without removing excess activating fluorescent dye, aptamers can be used to qualitatively, quantitatively, and detect the location and motion state of aptamer-labeled targets, greatly promoting the development of the nucleic acid field. Currently, developed fluorescent RNAs include Spinach, Broccoli, Mango, Pepper, BiRhoBAST, biSiRA, Civias, and Okra. Among them, Pepper effectively improves the problems of low correct folding rate, high fluorescence background, and low signal-to-noise ratio of previous fluorescent RNAs, achieving high-sensitivity RNA imaging. Developed fluorescent DNAs include Mango and Lettuce. Importantly, aptamers are also compatible with amplification systems and are generated along with the amplification of nucleic acid targets, eliminating the need for complex in vitro synthesis and purification processes. The expressed aptamers can specifically bind to their ligands, which not only greatly reduces production costs but also solves the complex process and non-specific binding problems of target labeling. Therefore, aptamers are particularly suitable as reporter groups or as linking groups between target molecules and reporter group labels.

[0008] In the detection of nucleic acid targets, addressable detection technologies have been widely applied, such as lateral flow chromatography strips, dot blot hybridization, gene chip technology, microfluidics, and suspended microarray technology. These technologies immobilize capture elements on a solid support, achieving effective enrichment of target concentrations through the specific capture of labeled target molecules by the capture elements. Combined with advantages such as flow rate differences in heterogeneous systems, rapid separation and purification are achieved, effectively improving the signal-to-noise ratio and sensitivity in the target detection process. Furthermore, by incorporating the positional information of the support or encoding information about the support, single or multiple target detection of samples can be achieved, overcoming the drawbacks of traditional nucleic acid blotting hybridization techniques, such as complex operation and low automation. However, the labeled probes used in current addressable detection processes are expensive, the labeling process is complex, and the signal-to-noise ratio is limited, which to some extent restricts the further application of this technology.

[0009] In summary, PCR, isothermal amplification, and addressable detection technologies play important roles in nucleic acid detection, but they all have bottlenecks and require technological updates before they can be used more widely. Summary of the Invention

[0010] To address the bottleneck issues of PCR, isothermal amplification, and addressable detection technologies in nucleic acid detection, the first aspect of this invention provides an aptamer-target unit for addressable detection of nucleic acid targets, comprising one or more aptamers and one or more nucleic acid targets that bind to the one or more aptamers.

[0011] In some implementations, the aptamers may be of the same type or different types.

[0012] In some implementations, the types of nucleic acid targets may be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0013] In some implementations, the number of aptamers can be one or more, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0014] In some specific implementations, when there are multiple aptamers, each aptamer binds independently to the nucleic acid target.

[0015] In some specific implementation schemes, different types of aptamers can bind to different types of nucleic acid targets in a one-to-one correspondence, or the same type of aptamer can bind to different types of nucleic acid targets.

[0016] In some implementations, the aptamer and the nucleic acid target are located on the same nucleic acid strand.

[0017] In some specific implementations, the aptamer and the nucleic acid target are directly linked, the aptamer and the nucleic acid target are operatively linked by one or more nucleotide sequences, or the aptamer and the nucleic acid target contain one or more shared nucleotide sequences.

[0018] In some implementations, the aptamer and the nucleic acid target are not on the same nucleic acid strand.

[0019] In some specific implementations, the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are bound by affinity or covalent bonds, or the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are bound by base complementary pairing hybridization.

[0020] In some implementations, the aptamer is selected from DNA aptamers or RNA aptamers.

[0021] In some implementations, when the aptamer is a DNA aptamer, the aptamer is a non-G tetrad.

[0022] In some embodiments, the aptamer comprises at least one modification that occurs independently at one or more positions selected from the ribose position, deoxyribose position, phosphate position, and base position.

[0023] In some specific implementations, the modification occurs at the phosphate position of the aptamer, and the modification is to introduce a modification that resists nuclease activity.

[0024] In some more specific embodiments, the modification is selected from one or a combination of thiophosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, hydrogenated phosphate bonds, and alkylamino phosphate bonds.

[0025] In some specific embodiments, the modification occurs at the ribose position of the aptamer, and the modification is selected from one or a combination of 2'-sugar modification, 2'-amino (2'-NH2), 2'-fluorine (2'-F), 2'-methoxy (2'-OMe), 2'-ethoxy (2'-OEt), 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, 1-(4'-thio-PD-furanose) modification, 2-O-4-C modification, L-DNA, and mirror-image nucleic acid analogs.

[0026] In some specific embodiments, the modification occurs at the base position of the aptamer, and the modification is selected from one or a combination of 5'-pyrimidine modification, 8'-purine modification, cytosine extracyclic modification, substitution of 5'-bromouracil, substitution of 5'-bromodeoxyuridine, substitution of 5'-bromodeoxycytidine, main chain modification, methylation, 2'-methoxyethylidene (2'-MOE), 3' cap, and 5' cap.

[0027] In some embodiments, the aptamer is selected from one or a combination of Pepper or its mutants, Clivias or its mutants, Mango or its mutants, Spinach or its mutants, Broccoli or its mutants, BiRhoBAST or its mutants, biSiRA or its mutants, Riboglow RNA tags or their mutants, Chili or its mutants, o-Coral or its mutants, DIR2s-apt or its mutants, 13-2min or its mutants, and MGA or its mutants, Okra or its mutants.

[0028] In some embodiments, the length of the aptamer is 10-500 nt, preferably 10-300 nt, more preferably 10-250 nt, even more preferably 10-200 nt, and even more preferably 10-100 nt.

[0029] In some implementations, the nucleic acid target is derived from a virus, bacteria, fungus, animal, plant, or a synthetic construct.

[0030] In some implementations, the nucleic acid target is obtained from water, soil, blood, whole blood, leukocytes, peripheral blood, monocytes, plasma, serum, sputum, breath, urine, semen, saliva, meningeal fluid, amniotic fluid, glandular fluid, lymph, papillary aspiration fluid, tracheal aspiration fluid, nasal aspirate, synovial fluid, joint aspiration fluid, cells, cell extracts, feces, tissue, tissue extracts, tissue biopsy, or cerebrospinal fluid.

[0031] A second aspect of the present invention provides a method for addressability detection of nucleic acid targets, comprising:

[0032] a) An aptamer-target unit is prepared by amplification, wherein the aptamer-target unit comprises one or more aptamers and one or more nucleic acid targets that bind to the one or more aptamers;

[0033] b) Prepare a solid support and one or more capture elements fixed on the surface and / or inside the solid support, the capture elements being capable of specifically capturing the aptamer-target unit;

[0034] c) A complex formed by specifically recognizing and / or binding the marker of the aptamer-target unit, the aptamer-target unit, and the capture element, wherein the marker has a detectable signal upon binding to the aptamer-target unit; and

[0035] d) Detect the signal.

[0036] In some implementations, the amplification is either temperature-dependent or isothermal amplification.

[0037] In some specific implementations, the isothermal amplification is selected from one or a combination of nucleic acid sequence-dependent amplification (NASBA), strand substitution amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), recombinant polymerase amplification (RPA), exponential amplification reaction (EXPAR), nickase amplification (NEAR), whole genome amplification (WGA), linear and cascade amplification methods, and RNA transcription.

[0038] In some implementations, the aptamers may be of the same type or different types.

[0039] In some implementations, the types of nucleic acid targets may be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0040] In some implementations, the number of aptamers can be one or more, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0041] In some specific implementations, when there are multiple aptamers, each aptamer binds independently to the nucleic acid target.

[0042] In some specific implementation schemes, different types of aptamers can bind to different types of nucleic acid targets in a one-to-one correspondence, or the same type of aptamer can bind to different types of nucleic acid targets.

[0043] In some implementations, the aptamer and the nucleic acid target are located on the same nucleic acid strand.

[0044] In some specific implementations, the aptamer and the nucleic acid target are directly linked, the aptamer and the nucleic acid target are operatively linked by one or more nucleotide sequences, or the aptamer and the nucleic acid target contain one or more shared nucleotide sequences.

[0045] In some implementations, the aptamer and the nucleic acid target are not on the same nucleic acid strand.

[0046] In some implementations, the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are amplified independently in the same system.

[0047] In some implementations, the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are amplified in different systems and then mixed.

[0048] In some specific implementations, the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are bound by affinity or covalent bonds, or the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are bound by base complementary pairing hybridization.

[0049] In some implementations, the aptamer is selected from DNA aptamers or RNA aptamers.

[0050] In some specific implementations, when the aptamer is a DNA aptamer, the aptamer is a non-G tetrad.

[0051] In some embodiments, the aptamer comprises at least one modification that occurs independently at one or more positions selected from the ribose position, deoxyribose position, phosphate position, and base position.

[0052] In some specific implementations, the modification occurs at the phosphate position of the aptamer, and the modification is to introduce a modification that resists nuclease activity.

[0053] In some more specific embodiments, the modification is selected from one or a combination of thiophosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, hydrogenated phosphate bonds, and alkylamino phosphate bonds.

[0054] In some specific embodiments, the modification occurs at the ribose position of the aptamer, and the modification is selected from one or a combination of 2'-sugar modification, 2'-amino (2'-NH2), 2'-fluorine (2'-F), 2'-methoxy (2'-OMe), 2'-ethoxy (2'-OEt), 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, 1-(4'-thio-PD-furanose) modification, 2-O-4-C modification, L-DNA, and mirror-image nucleic acid analogs.

[0055] In some specific embodiments, the modification occurs at the base position of the aptamer, and the modification is selected from one or a combination of 5'-pyrimidine modification, 8'-purine modification, cytosine extracyclic modification, substitution of 5'-bromouracil, substitution of 5'-bromodeoxyuridine, substitution of 5-bromodeoxycytidine, main chain modification, methylation, 2'-methoxyethylidene (2'-MOE), 3' cap, and 5' cap.

[0056] In some embodiments, the aptamer is selected from one or a combination of Pepper or its mutants, Clivias or its mutants, Mango or its mutants, Spinach or its mutants, Broccoli or its mutants, BiRhoBAST or its mutants, biSiRA or its mutants, Riboglow RNA tags or their mutants, Chili or its mutants, o-Coral or its mutants, DIR2s-apt or its mutants, 13-2min or its mutants, and MGA or its mutants, Okra or its mutants.

[0057] In some specific implementations, the aptamer is a fluorescent light-up aptamer.

[0058] In some embodiments, the length of the aptamer is 10-500 nt, preferably 10-300 nt, more preferably 10-250 nt, even more preferably 10-200 nt, and even more preferably 10-100 nt.

[0059] In some implementations, the nucleic acid target is derived from a virus, bacteria, fungus, animal, plant, or a synthetic construct.

[0060] In some implementations, the nucleic acid target is obtained from water, soil, blood, whole blood, leukocytes, peripheral blood, monocytes, plasma, serum, sputum, breath, urine, semen, saliva, meningeal fluid, amniotic fluid, glandular fluid, lymph, papillary aspiration fluid, tracheal aspiration fluid, nasal aspirate, synovial fluid, joint aspiration fluid, cells, cell extracts, feces, tissue, tissue extracts, tissue biopsy, or cerebrospinal fluid.

[0061] In some implementations, the aptamer-target unit forms a covalent or non-covalent complex with the marker.

[0062] In some specific implementations, when the aptamer-target unit forms a non-covalent complex with the marker, the binding dissociation constant (Kd) between the aptamer-target unit and the marker is about 0.001 nM to about 100 μM, preferably about 0.01 nM to about 1 μM, and more preferably about 0.01 nM to about 10 nM.

[0063] In some embodiments, the dissociation rate (t) of the aptamer-target unit and the marker to form a complex is... 1 / 2 A dissociation rate greater than or equal to 30 minutes is preferred (t) 1 / 2 ) Greater than or equal to 120 minutes.

[0064] In some implementations, the marker comprises a ligand that specifically recognizes and / or binds to the aptamer-target unit.

[0065] In some embodiments, the marker further comprises a reporter group linked to the ligand, and the reporter group is selected from one or a combination of dyes, nanoparticles, microspheres, redox molecules, luminescent molecules, radioactive labels, electrochemical functional groups, enzymes, and enzyme-detectable enzyme substrates.

[0066] In some specific implementations, the dyes are selected from one or a combination of phosphorescent dyes, time-resolved fluorescent dyes, fluorescent dyes, and latent fluorescent dyes.

[0067] In some specific implementations, the microspheres are selected from one or a combination of fluorescent microspheres, quantum dots, carbon dots, colored latex spheres, fluorescent latex spheres, colloidal particles, colloidal gold particles, and oxide clusters.

[0068] In some specific implementations, the enzyme added to detect the enzyme substrate is horseradish peroxidase (HRP), luciferase (NanoLuc), alkaline phosphatase (AP), urease, or β-galactosidase.

[0069] In some implementations, the detectable signal is selected from one or a combination of color signals, optical signals, photoacoustic signals, electro-optic signals, electrical signals, magnetic signals, and radioactive signals.

[0070] In some specific implementations, the optical signal is selected from one or a combination of fluorescence, phosphorescence, chemiluminescence, bioluminescence, color, circular dichroism, and Raman spectroscopy.

[0071] In some implementations, the marker has a detectable signal of different intensities before and after binding to the aptamer-target unit.

[0072] In some specific implementations, when the detectable signal is a fluorescent signal, the fluorescence signal intensity of the marker after binding with the aptamer-target unit is increased by more than 5 times compared to before the marker binds to the aptamer-target unit. Preferably, the fluorescence signal intensity is increased by more than 10 times, or the excitation wavelength shift is greater than 10 nm, or the emission wavelength shift is greater than 10 nm. More preferably, the fluorescence signal intensity is increased by more than 20 times, or the excitation wavelength shift is greater than 20 nm, or the emission wavelength shift is greater than 20 nm. Even more preferably, the fluorescence intensity is increased by more than 50 times, or the excitation wavelength shift is greater than 50 nm, or the emission wavelength shift is greater than 50 nm.

[0073] In some specific embodiments, the complex formed by the marker and the aptamer-target unit is selected from one or a combination of Pepper485, Pepper497, Pepper508, Pepper514, Pepper525, Pepper530, ​​Pepper599, Pepper620, Clivia580, Clivia577, Clivia581, Clivia582, Clivia590, Clivia600, Clivia624, Clivia565, Clivia570, Clivia571, Clivia574, Clivia578, Clivia595, Clivia618, Chili-DMHBI-Imi, and Chili-DMHBO.

[0074] In some more specific implementations, when the aptamer is Pepper or a mutant thereof, the marker is an HBC dye or a derivative thereof.

[0075] In some more specific embodiments, when the aptamer is Mango or a mutant thereof, the marker is a hemicyanine dye, preferably TO1-Biotin or a mutant thereof.

[0076] In some more specific embodiments, when the aptamer is Spinach or a mutant thereof, Broccoli or a mutant thereof, the marker is a green fluorescent protein chromophore dye, preferably DFHBI.

[0077] In some more specific embodiments, when the aptamer is RhoBAST or a mutant thereof, BiRhoBAST or a mutant thereof, the marker is a tetramethylrhodamine derivative, preferably, the marker is TMR.

[0078] In some more specific implementations, when the aptamer is biSiRA or a mutant thereof, the marker is a SiR-type derivative.

[0079] In some more specific implementations, when the aptamer is Riboglow RNA tags or a mutant thereof, the marker is a Cbl-F class derivative.

[0080] In some implementations, the aptamer-target unit binds to the marker and then to the capture element to form the complex.

[0081] In some implementations, the aptamer-target unit binds to the capture element and then to the marker to form the complex.

[0082] In some implementations, the process of combining the aptamer-target unit with the marker and the capture element to form the complex occurs simultaneously.

[0083] In some embodiments, the solid support is selected from one or a combination of polymer beads, agarose beads, polystyrene beads, acrylamide beads, solid core beads, porous beads, paramagnetic beads, glass beads, controlled pore beads, microtiter beads, cyclic olefin copolymer beads, biomembranes, filter paper, plastic substrates, nylon, Langmuir-Blaugert membranes, glass, germanium substrates, silicon substrates, silicon wafers, ceramics, laminates, flow-through chips, microspheres, nanoparticles, polytetrafluoroethylene sheets, polystyrene sheets, gallium arsenide substrates, and gold and silver substrates; preferably one or a combination of glass, silicon substrates, nitrocellulose membranes, cellulose acetate membranes, flow-through chips, and gold substrates; more preferably one or a combination of nitrocellulose membranes, cellulose acetate membranes, nylon membranes, flow-through chips, glass, silicon substrates, silicon wafers, microspheres, and plastics.

[0084] In some embodiments, the capture element is selected from one or a combination of natural nucleic acid sequences, non-natural nucleic acid sequences, morpholine-substituted main-chain nucleic acids, peptide nucleic acids, antigens, antibodies, haptens, enzymes, nanozymes, aptamers, monosaccharides, polysaccharides, avidins, antibody mimics, cell receptors, ligands, lipids, biotin, avidin, streptavidin, exavidin, neutral avidin, traptavidin, metals, and histidines; preferably one or a combination of natural nucleic acid sequences, non-natural nucleic acid sequences, antigens, antibodies, aptamers, or biotin; more preferably one or a combination of natural nucleic acid sequences, non-natural nucleic acid sequences, or biotin.

[0085] In some specific implementations, when the capture element is a nucleic acid sequence, the nucleic acid sequence contains at least one modification, and the modification occurs independently at one or more positions selected from ribose, deoxyribose, phosphate, and base positions.

[0086] In some more specific embodiments, the modification occurs at the phosphate position of the aptamer, and the modification is to introduce a modification that resists nuclease activity.

[0087] In some more specific embodiments, the modification is selected from one or a combination of thiophosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, hydrogenated phosphate bonds, and alkylamino phosphate bonds.

[0088] In some specific embodiments, the modification occurs at the ribose position of the aptamer, and the modification is selected from one or a combination of 2'-sugar modification, 2'-amino (2'-NH2), 2'-fluorine (2'-F), 2'-methoxy (2'-OMe), 2'-ethoxy (2'-OEt), 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, 1-(4'-thio-PD-furanose) modification, 2-O-4-C modification, L-DNA, and mirror-image nucleic acid analogs.

[0089] In some specific embodiments, the modification occurs at the base position of the aptamer, and the modification is selected from one or a combination of 5'-pyrimidine modification, 8'-purine modification, cytosine extracyclic modification, substitution of 5'-bromouracil, substitution of 5'-bromodeoxyuridine, substitution of 5-bromodeoxycytidine, main chain modification, methylation, 2'-methoxyethylidene (2'-MOE), 3' cap, and 5' cap.

[0090] In some implementations, the capturing element specifically captures the aptamer-target unit via affinity capture or covalent reaction.

[0091] In some implementations, the capturing element directly and specifically captures the aptamer-target unit.

[0092] In some embodiments, the capture element specifically captures the aptamer-target unit through base complementarity hybridization capture, antibody-antigen / hapten capture, chemical tag-substrate capture, enzyme-substrate capture, or nanozyme-substrate capture.

[0093] In some implementations, the capture element specifically captures the aptamer-target unit via a mediator probe.

[0094] In some specific embodiments, the mediator probe comprises a probe region and a capture-binding region; wherein the probe region has affinity for the aptamer-target unit, and the capture-binding region has recognition binding force for the capture element; the probe region and the capture-binding region are independently selected from one or a combination of natural nucleic acid sequences, non-natural nucleic acid sequences, peptide nucleic acids, antigens, antibodies, haptens, enzymes, nanozymes, aptamers, monosaccharides, polysaccharides, avidins, antibody mimics, cell receptors, ligands, lipids, biotin, avidin, streptavidin, exavidin, neutral avidin, traptavidin, metals, and histidines, preferably selected from one or a combination of peptide nucleic acids, natural nucleic acid sequences, non-natural nucleic acid sequences, antigens, antibodies, aptamers, and biotin; more preferably selected from one or a combination of peptide nucleic acids, natural nucleic acid sequences, non-natural nucleic acid sequences, and biotin.

[0095] In some specific embodiments, the mediator probe further includes an intermediate linker region; wherein the intermediate linker region is selected from one or a combination of nucleosides, peptide chains, peptide nucleic acid chains, monosaccharides, polysaccharides, PEG chains, polymers, short-chain chemical linking groups, and chain segments.

[0096] In some specific implementations, when the probe region and / or the capture-binding region is a nucleic acid sequence, the nucleic acid sequence contains at least one modification, and the modification occurs independently at one or more positions selected from ribose, deoxyribose, phosphate, and base positions.

[0097] In some more specific embodiments, the modification occurs at the phosphate position of the aptamer, and the modification is to introduce a modification that resists nuclease activity.

[0098] In some more specific embodiments, the modification is selected from one or a combination of thiophosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, hydrogenated phosphate bonds, and alkylamino phosphate bonds.

[0099] In some more specific embodiments, the modification occurs at the ribose position of the aptamer, and the modification is selected from one or a combination of 2'-sugar modification, 2'-amino (2'-NH2), 2'-fluorine (2'-F), 2'-methoxy (2'-OMe), 2'-ethoxy (2'-OEt), 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, 1-(4'-thio-PD-furanose) modification, 2-O-4-C modification, L-DNA, and mirror-image nucleic acid analogs.

[0100] In some more specific embodiments, the modification occurs at the base position of the aptamer, and the modification is selected from one or a combination of 5'-pyrimidine modification, 8'-purine modification, cytosine extracyclic modification, substitution of 5'-bromouracil, substitution of 5'-bromodeoxyuridine, substitution of 5-bromodeoxycytidine, main chain modification, methylation, 2'-methoxyethylidene (2'-MOE), 3' cap, and 5' cap.

[0101] A third aspect of the present invention provides a kit for addressability detection of nucleic acid targets, comprising a primer set for aptamer-target unit amplification, a label, a solid support, a capture element, and optionally, instructions for the detection method.

[0102] The primer set includes primers for amplification of one or more nucleic acid targets and the 5' end of the primers further includes an aptamer coding sequence, or the primer set includes primers for amplification of one or more nucleic acid targets and primers for amplification of one or more aptamers.

[0103] The aptamer-target unit is formed by thermotropic amplification or isothermal amplification; the marker has a detectable signal after binding with the aptamer-target unit; the capture element is fixed to the surface or interior of a solid support and can specifically capture the aptamer-target unit.

[0104] In some implementations, the aptamers may be of the same type or different types.

[0105] In some implementations, the types of nucleic acid targets may be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0106] In some implementations, the number of aptamers can be one or more, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0107] In some specific implementations, when there are multiple aptamers, each aptamer binds independently to the nucleic acid target.

[0108] In some specific implementation schemes, different types of aptamers can bind to different types of nucleic acid targets in a one-to-one correspondence, or the same type of aptamer can bind to different types of nucleic acid targets.

[0109] In some implementations, the aptamer and the nucleic acid target are located on the same nucleic acid chain after amplification.

[0110] In some specific implementations, the aptamer and the nucleic acid target are directly linked, the aptamer and the nucleic acid target are operatively linked by one or more nucleotide sequences, or the aptamer and the nucleic acid target contain one or more shared nucleotide sequences.

[0111] In some implementations, the aptamer and the nucleic acid target are not on the same nucleic acid strand after amplification.

[0112] In some specific implementations, the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are amplified independently in the same system.

[0113] In some specific implementations, the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are amplified in different systems and then mixed.

[0114] In some specific implementations, the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are bound by affinity or covalent bonds, or the nucleic acid strand containing the aptamer and the nucleic acid strand containing the nucleic acid target are bound by base complementary pairing hybridization.

[0115] In some implementations, the aptamer is selected from DNA aptamers or RNA aptamers.

[0116] In some specific implementations, when the aptamer is a DNA aptamer, the aptamer is a non-G tetrad.

[0117] In some specific embodiments, the aptamer comprises at least one modification that occurs independently at one or more positions selected from the ribose position, deoxyribose position, phosphate position, and base position.

[0118] In some specific implementations, the modification occurs at the phosphate position of the aptamer, and the modification is to introduce a modification that resists nuclease activity.

[0119] In some specific embodiments, the modification is selected from one or a combination of thiophosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, hydrogenated phosphate bonds, and alkylamino phosphate bonds.

[0120] In some specific embodiments, the modification occurs at the ribose position of the aptamer, and the modification is selected from one or a combination of 2'-sugar modification, 2'-amino (2'-NH2), 2'-fluorine (2'-F), 2'-methoxy (2'-OMe), 2'-ethoxy (2'-OEt), 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, 1-(4'-thio-PD-furanose) modification, 2-O-4-C modification, L-DNA, and mirror-image nucleic acid analogs.

[0121] In some specific embodiments, the modification occurs at the base position of the aptamer, and the modification is selected from one or a combination of 5'-pyrimidine modification, 8'-purine modification, cytosine extracyclic modification, substitution of 5'-bromouracil, substitution of 5'-bromodeoxyuridine, substitution of 5-bromodeoxycytidine, main chain modification, methylation, 2'-methoxyethylidene (2'-MOE), 3' cap, and 5' cap.

[0122] In some embodiments, the aptamer is selected from one or a combination of Pepper or its mutants, Clivias or its mutants, Mango or its mutants, Spinach or its mutants, Broccoli or its mutants, BiRhoBAST or its mutants, biSiRA or its mutants, Riboglow RNA tags or their mutants, Chili or its mutants, o-Coral or its mutants, DIR2s-apt or its mutants, 13-2min or its mutants, and MGA or its mutants.

[0123] In some embodiments, the length of the aptamer is 10-500 nt, preferably 10-300 nt, more preferably 10-250 nt, even more preferably 10-200 nt, and even more preferably 10-100 nt.

[0124] In some implementations, the nucleic acid target is derived from a virus, bacteria, fungus, animal, plant, or a synthetic construct.

[0125] In some implementations, the nucleic acid target is obtained from water, soil, blood, whole blood, leukocytes, peripheral blood, monocytes, plasma, serum, sputum, breath, urine, semen, saliva, meningeal fluid, amniotic fluid, glandular fluid, lymph, papillary aspiration fluid, tracheal aspiration fluid, nasal aspirate, synovial fluid, joint aspiration fluid, cells, cell extracts, feces, tissue, tissue extracts, tissue biopsy, or cerebrospinal fluid.

[0126] In some implementations, the aptamer-target unit forms a covalent or non-covalent complex with the marker.

[0127] In some specific implementations, when the aptamer-target unit forms a non-covalent complex with the marker, the binding dissociation constant (Kd) between the aptamer-target unit and the marker is about 0.001 nM to about 100 μM, preferably about 0.01 nM to about 1 μM, and more preferably about 0.01 nM to about 10 nM.

[0128] In some implementations, the marker comprises a ligand that specifically recognizes and / or binds to the aptamer-target unit.

[0129] In some embodiments, the marker further comprises a reporter group linked to the ligand, and the reporter group is selected from one or a combination of dyes, nanoparticles, microspheres, redox molecules, luminescent molecules, radioactive labels, electrochemical functional groups, enzymes, and enzyme-detectable enzyme substrates.

[0130] In some specific implementations, the dyes are selected from one or a combination of phosphorescent dyes, time-resolved fluorescent dyes, fluorescent dyes, and latent fluorescent dyes.

[0131] In some specific implementations, the microspheres are selected from one or a combination of fluorescent microspheres, quantum dots, carbon dots, colored latex spheres, fluorescent latex spheres, colloidal particles, colloidal gold particles, and oxide clusters.

[0132] In some specific implementations, the enzyme added to detect the enzyme substrate is horseradish peroxidase (HRP), luciferase (NanoLuc), alkaline phosphatase (AP), urease, or β-galactosidase.

[0133] In some implementations, the detectable signal is selected from one or a combination of color signals, optical signals, photoacoustic signals, electro-optic signals, electrical signals, magnetic signals, and radioactive signals.

[0134] In some specific implementations, the optical signal is selected from one or a combination of fluorescence, phosphorescence, chemiluminescence, bioluminescence, color, circular dichroism, and Raman spectroscopy.

[0135] In some implementations, the marker has a detectable signal of different intensities before and after binding to the aptamer-target unit.

[0136] In some specific implementations, when the detectable signal is a fluorescent signal, the fluorescence signal intensity of the marker after binding with the aptamer-target unit is increased by more than 5 times compared to before the marker binds to the aptamer-target unit. Preferably, the fluorescence signal intensity is increased by more than 10 times, or the excitation wavelength shift is greater than 10 nm, or the emission wavelength shift is greater than 10 nm. More preferably, the fluorescence signal intensity is increased by more than 20 times, or the excitation wavelength shift is greater than 20 nm, or the emission wavelength shift is greater than 20 nm. Even more preferably, the fluorescence intensity is increased by more than 50 times, or the excitation wavelength shift is greater than 50 nm, or the emission wavelength shift is greater than 50 nm.

[0137] In some specific embodiments, the complex formed by the marker and the aptamer-target unit is selected from one or a combination of Pepper485, Pepper497, Pepper508, Pepper514, Pepper525, Pepper530, ​​Pepper599, Pepper620, Clivia580, Clivia577, Clivia581, Clivia582, Clivia590, Clivia600, Clivia624, Clivia565, Clivia570, Clivia571, Clivia574, Clivia578, Clivia595, Clivia618, Chili-DMHBI-Imi, and Chili-DMHBO.

[0138] In some embodiments, the solid support is selected from one or a combination of polymer beads, agarose beads, polystyrene beads, acrylamide beads, solid core beads, porous beads, paramagnetic beads, glass beads, controlled pore beads, microtiter beads, cyclic olefin copolymer beads, biomembranes, filter paper, plastic substrates, nylon, Langmuir-Blaugert membranes, glass, germanium substrates, silicon substrates, silicon wafers, ceramics, laminates, flow-through chips, microspheres, nanoparticles, polytetrafluoroethylene sheets, polystyrene sheets, gallium arsenide substrates, and gold and silver substrates; preferably one or a combination of glass, silicon substrates, nitrocellulose membranes, cellulose acetate membranes, flow-through chips, and gold substrates; more preferably one or a combination of nitrocellulose membranes, cellulose acetate membranes, nylon membranes, flow-through chips, glass, silicon substrates, silicon wafers, microspheres, and plastics.

[0139] In some embodiments, the capture element is selected from one or a combination of natural nucleic acid sequences, non-natural nucleic acid sequences, morpholine-substituted main-chain nucleic acids, peptide nucleic acids, antigens, antibodies, haptens, enzymes, nanozymes, aptamers, monosaccharides, polysaccharides, avidins, antibody mimics, cell receptors, ligands, lipids, biotin, avidin, streptavidin, exavidin, neutral avidin, traptavidin, metals, and histidines; preferably one or a combination of natural nucleic acid sequences, non-natural nucleic acid sequences, antigens, antibodies, aptamers, or biotin; more preferably one or a combination of natural nucleic acid sequences, non-natural nucleic acid sequences, or biotin.

[0140] In some embodiments, when the capture element is a nucleic acid sequence, the nucleic acid sequence contains at least one modification, and the modification occurs independently at one or more positions selected from ribose, deoxyribose, phosphate, and base positions.

[0141] In some specific implementations, the modification occurs at the phosphate position of the aptamer, and the modification is to introduce a modification that resists nuclease activity.

[0142] In some specific embodiments, the modification is selected from one or a combination of thiophosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, hydrogenated phosphate bonds, and alkylamino phosphate bonds.

[0143] In some specific embodiments, the modification occurs at the ribose position of the aptamer, and the modification is selected from one or a combination of 2'-sugar modification, 2'-amino (2'-NH2), 2'-fluorine (2'-F), 2'-methoxy (2'-OMe), 2'-ethoxy (2'-OEt), 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, 1-(4'-thio-PD-furanose) modification, 2-O-4-C modification, L-DNA, and mirror-image nucleic acid analogs.

[0144] In some specific embodiments, the modification occurs at the base position of the aptamer, and the modification is selected from one or a combination of 5'-pyrimidine modification, 8'-purine modification, cytosine extracyclic modification, substitution of 5'-bromouracil, substitution of 5'-bromodeoxyuridine, substitution of 5-bromodeoxycytidine, main chain modification, methylation, 2'-methoxyethylidene (2'-MOE), 3' cap, and 5' cap.

[0145] In some embodiments, the kit further includes a mediator probe, which includes a probe region and a capture-binding region;

[0146] The probe region has an affinity for the aptamer-target unit, and the capture-binding region has a recognition binding force on the capture element. The probe region and the capture-binding region are independently selected from one or a combination of natural nucleic acid sequences, non-natural nucleic acid sequences, peptide nucleic acids, antigens, antibodies, haptens, enzymes, nanozymes, aptamers, monosaccharides, polysaccharides, avidins, antibody mimics, cell receptors, ligands, lipids, biotin, avidin, streptavidin, exavidin, neutral avidin, traptavidin, metals, and histidines. Preferably, they are selected from one or a combination of peptide nucleic acids, natural nucleic acid sequences, non-natural nucleic acid sequences, antigens, antibodies, aptamers, and biotin; more preferably, they are selected from one or a combination of peptide nucleic acids, natural nucleic acid sequences, non-natural nucleic acid sequences, and biotin.

[0147] In some specific embodiments, the mediator probe further includes an intermediate linker region; wherein the intermediate linker region is selected from one or a combination of nucleosides, peptide chains, peptide nucleic acid chains, monosaccharides, polysaccharides, PEG chains, polymers, short-chain chemical linking groups, and chain segments.

[0148] In some specific implementations, when the probe region and / or the capture-binding region is a nucleic acid sequence, the nucleic acid sequence contains at least one modification, and the modification occurs independently at one or more positions selected from ribose, deoxyribose, phosphate, and base positions.

[0149] In some specific implementations, the modification occurs at the phosphate position of the aptamer, and the modification is to introduce a modification that resists nuclease activity.

[0150] In some specific embodiments, the modification is selected from one or a combination of thiophosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, alkyl phosphate bonds, aryl phosphate bonds, hydrogenated phosphate bonds, and alkylamino phosphate bonds.

[0151] In some specific embodiments, the modification occurs at the ribose position of the aptamer, and the modification is selected from one or a combination of 2'-sugar modification, 2'-amino (2'-NH2), 2'-fluorine (2'-F), 2'-methoxy (2'-OMe), 2'-ethoxy (2'-OEt), 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, 1-(4'-thio-PD-furanose) modification, 2-O-4-C modification, L-DNA, and mirror-image nucleic acid analogs.

[0152] In some specific embodiments, the modification occurs at the base position of the aptamer, and the modification is selected from one or a combination of 5'-pyrimidine modification, 8'-purine modification, cytosine extracyclic modification, substitution of 5'-bromouracil, substitution of 5'-bromodeoxyuridine, substitution of 5-bromodeoxycytidine, main chain modification, methylation, 2'-methoxyethylidene (2'-MOE), 3' cap, and 5' cap.

[0153] The fourth aspect of the present invention provides the application of the aptamer-target unit as described above or the kit as described above in the addressability detection of nucleic acid targets.

[0154] definition

[0155] Target detection in amplification products

[0156] Aptamer: A single-stranded nucleic acid molecule having one or more base-pairing regions and one or more unpaired regions, capable of specifically recognizing / binding ligand molecules. In addition to the portion capable of specifically recognizing / binding ligand molecules, the aptamer in this invention may optionally include a sequence capable of hybridization.

[0157] Marker: In this invention, the term "marker" refers to a ligand that can specifically recognize / bind to an aptamer, or a complex of a ligand and a reporter group. The marker is a small molecule, microsphere, or nanoparticle with a detectable signal. The detectable signal includes signals that can be detected by detection methods such as photon detection, electronic detection, acoustic detection, electrochemical detection, enzyme detection, and magnetic detection.

[0158] Reporter group: In this invention, the term "reporter group" refers to a group that has a detectable signal. The detectable signal includes signals that can be detected by detection methods such as photon detection, electronic detection, acoustic detection, electrochemical detection, enzyme detection, and magnetic detection.

[0159] Color signal: In this invention, the term "color signal" refers to the color that the reported object has that is recognizable to the naked eye under non-excitation conditions such as natural light, and this color is a color signal under the subtractive color principle.

[0160] Enzyme-based detectable substrate: In this invention, the term "enzyme-based detectable substrate" refers to a substance that can react with an enzyme, and the product of the reaction has a detectable signal. The detectable signal refers to a signal with color, absorption wavelength, and emission wavelength.

[0161] Mediator probe: In this invention, the term "mediator probe" refers to a probe that has one end capable of specifically binding to the target gene and aptamer complex, the other end capable of binding to a capture unit on an addressable support, and optionally a linking group linking the two parts.

[0162] Target gene: In this invention, the term "target gene" refers to a gene containing the gene sequence to be detected. Optionally, the gene may also contain additional sequences that allow nucleic acid hybridization.

[0163] Target: In this invention, the terms "target", "nucleic acid target" or "target gene" or "target sequence" refer to the nucleic acid sequence to be detected in the amplification product;

[0164] Complementarity: In this invention, the term "complementarity" refers to the ability of two nucleic acid (natural or non-natural) sequences to form hydrogen bonds with each other according to the base complementarity pairing principle (Waston-Crick principle), thereby forming a double helix.

[0165] Hybridization: In this invention, the term "hybridization" refers to the process by which complementary single-stranded nucleic acid (natural or non-natural) molecules form double-stranded nucleic acids;

[0166] The term "conditions that allow nucleic acid hybridization" as used in this invention has the meaning commonly understood by those skilled in the art and can be determined by conventional methods. For example, two nucleic acid molecules with complementary sequences can hybridize under suitable hybridization conditions, which may involve factors such as temperature, pH of the hybridization buffer, composition and ionic strength, and can be determined based on the length and GC content of the complementary double-stranded nucleic acid molecules.

[0167] Compared with the prior art, the advantages of the present invention include:

[0168] This invention discloses a method for detecting the addressability of amplified samples using nucleic acid aptamers and its applications. The method utilizes the specific binding of aptamers and ligands to achieve simple and rapid labeling. Combined with the advantages of addressable detection, it enables rapid, sensitive, and low-cost detection of single or multiple targets. This invention offers advantages such as rapid labeling, good stability, high specificity, high sensitivity, wide linear range, and accurate quantification. Attached Figure Description

[0169] Figure 1 A schematic diagram showing the aptamer and target gene on the same nucleic acid sequence. A. The aptamer sequence is directly linked to the target sequence; B. The aptamer sequence is linked to the target gene through several nucleotide sequences; C. The aptamer sequence and target sequence are linked by sharing a nucleotide sequence.

[0170] Figure 2 A schematic diagram showing that the aptamer and the target gene are not on the same nucleic acid sequence; the sequence containing the aptamer and the sequence containing the target gene form a target gene-aptamer complex through affinity or covalent bonds.

[0171] Figure 3Schematic diagram of aptamer markers; A. The aptamer ligand is used directly as a marker; B. The complex formed by linking the aptamer ligand with the reporter group is used as a marker.

[0172] Figure 4 A. Schematic diagram of the mediator probe and its capture; B. Schematic diagram of the mediator probe, including a probe region capable of specifically binding to the target gene-aptamer complex, a capture-binding region capable of specifically recognizing capture units on the support, and an optional intermediary linking region between the probe region and the capture-binding region; C. Schematic diagram of the capture of the mediator probe in addressable tagging, whereby the target gene-aptamer complex is tagged on the support by the recognition of the target gene-aptamer complex by the probe region and the capture binder and the capture unit.

[0173] Figure 5 Pepper530 was used as a reporter group for the detection of feline mycoplasma amplification markers. Figure 5 The left image in A shows the test result of a negative sample on the test strip; Figure 5 The right image in section A shows the test results of a positive sample on the test strip; Figure 5 B is the result of using a dry test strip reader. Figure 5 The results were obtained by detecting the fluorescence signal of test strip A.

[0174] Figure 6 HBC620 is used as a reporter group, and a mediator probe is used for the detection of feline mycoplasma amplification markers. The left image shows the detection results of a negative sample on the test strip; the right image shows the detection results of a positive sample on the test strip.

[0175] Figure 7 Clivias574 is used as a reporter group, and a mediator probe is used for the detection of feline mycoplasma amplification markers. The left image shows the detection result of a negative sample on the test strip; the right image shows the detection result of a positive sample on the test strip.

[0176] Figure 8 The .bG aptamer is an aptamer, and the complex constructed by linking the ligand with the dye serves as a reporter group to detect the addressability of the target on a microfluidic chip.

[0177] Figure 9 Addressability detection on test strips using ligand-labeled microsphere complexes as reporter groups.

[0178] Figure 10 Addressability detection on test strips using ligand-labeled HRP proteins as reporter groups.

[0179] Figure 11 Addressability detection on gene chips using ligand-labeled chemiluminescent groups—acrididine esters—as reporter groups.

[0180] Figure 12 Pepper599 was used as a reporter group for the detection of Mycoplasma felidum targets in NASBA amplified samples. Figure 12 The left image in A shows the test result of a negative sample on the test strip; Figure 12 The middle and right images in Figure A show the test results of positive samples on the test strip. Figure 12 B is the result of using a dry test strip reader. Figure 12 The results were obtained by detecting the fluorescence signal of test strip A.

[0181] Figure 13 Addressability detection on a gold electrode using ligand-labeled methylene blue as a reporter group.

[0182] Figure 14 A shows the structure of the RCA probe; B shows a schematic diagram of RCA amplification; C shows the detection results under a microscope after the amplified products of different target concentrations were captured by the gene chip; D shows the fluorescence intensity of the amplified products of different target concentrations after they were captured by the gene chip.

[0183] Figure 15 Fluorescent DNA was used as a reporter group for the detection of feline mycoplasma amplification markers. Figure 15 The left image in A shows the test result of a negative sample on the test strip; Figure 15 The right image in section A shows the test results of a positive sample on the test strip; Figure 15 B is the result of using a dry test strip reader. Figure 15 The results were obtained by detecting the fluorescence signal of test strip A.

[0184] Figure 16 Okra is used as a reporter group in ultra-multiple target detection in lateral chromatography. Detailed Implementation

[0185] The embodiments are intended to describe the invention, but it should be understood that the invention is not intended to be limited to these embodiments. Rather, the invention is intended to cover all alternatives, modifications and equivalents that may be included within the scope of the invention as defined by the claims.

[0186] Example:

[0187] Example 1. Application of Pepper530 as a reporter group in lateral chromatography detection.

[0188] Sample pad preparation:

[0189] a) Preparation of the treatment solution:

[0190] Hepes (pH=8.0) 4 moles <![CDATA[Na2CO3]]> 2 moles Tween-20 0.5% PEG 10K 1 gram Purified water Adjust the volume to 100 ml

[0191] b) Lay the fiberglass flat on the glass plate, spray the appropriate amount evenly using a measuring cylinder or syringe, and roll it flat with a roller.

[0192] c) Lay the fiberglass flat on a stainless steel mesh and dry it overnight in an oven at 37°C;

[0193] d) After removal, dry, seal, and store in a light-proof container for later use.

[0194] Test strip application method:

[0195] In this invention, both the T-line and C-line capture probes are modified with biotin. Before being sprayed onto the nitrocellulose membrane, streptavidin for membrane application is added to the detection capture probes so that the biotin labeled on the capture probes reacts spontaneously with the streptavidin to fix the detection capture probes onto the nitrocellulose membrane, thereby preventing them from being washed away by the liquid.

[0196] The method for capturing probes and modifying them with streptavidin involves the following steps:

[0197] 75 μL of a 20 μM biotin-modified capture probe (Jierui Biotechnology Co., Ltd.) was mixed with 25 μL of a 1 mg / mL streptavidin solution and reacted at room temperature for 2 h to generate a capture probe modified with biotin and streptavidin. The incubated sample was centrifuged at 6000 r / min for 20 min at 4 °C to remove the precipitate and stored at 4 °C for later use.

[0198] Using a gold-spraying scribing instrument, capture probes are scribbled onto a nitrocellulose membrane to form a detection line (T line); control capture probes are scribbled on the side near the absorbent pad to form a control line (C line); the coated nitrocellulose membrane is dried overnight at 45°C and stored in a dry environment at room temperature away from light for later use.

[0199] How to assemble the test strip:

[0200] The nitrocellulose membrane, sample pad, conjugate pad, and absorbent pad are sequentially glued onto the pad plate, with an overlap of 2 mm between adjacent pads. After assembly, the pads are cut into 3.6 mm wide test strips, packaged, and stored in a dry, room-temperature environment away from light for later use.

[0201] Feline mycoplasma nucleic acid test:

[0202] (1) Primer design

[0203] This embodiment describes a method for isothermal amplification detection of pathogens. In this method, the product obtained by amplifying primer DNA containing the T7 promoter and a specific pepper sequence is used as a template for simultaneous T7 in vitro transcription. The complete sequence of *Mycoplasma feli* is submitted to the database of the U.S. National Biotechnology Center website for BLAST search. The website's program analyzes the sequence to identify homology, and sequences with low homology are selected as template sequences for primer design.

[0204] Template sequence:

[0205] TCACCGCCCGTCACACCATGGGAGCTGGTAATGCCCGAAGTCGGTTTTGTTAACTACGGAGACAACTGCCTAAGGCAGGGCCGGTGACTGGGGTGAAGTCGTAACAAGGTATCCCTACGAGAACGTGGGGATGGATTACCTCCTTCTACGGAGTACAAGTT ACAATTCATTTTAGTAACATTACACTTTATATGACTATTTAAATTTAATAAATGTTATGTGCTTTTGATAATAGTCCAAAAGATATATCTAGTTTTGAGAGAACTTTCTCTCATTTGTTCTTTGAAAACTGAATAGTAAAGATAAATTAATATAACAA(SEQ ID NO:32)

[0206] Primers:

[0207] Primer F 5'-3'

[0208] TAATACGACTCACTATAGGGAGGTATCCCTACGAGAACGT GGG(SEQ ID NO:1)

[0209] Primer R 5'-3'

[0210] GgcggCGGCGCCAGTGCCTCTCCGAAGAGAGGCCGACACGC CACGATTGGccgccGTCATATAAAGTGTAATGTTACTAAAATG(SEQ ID NO:2)

[0211] The nucleic acid sequence of the above detection and capture probe after biotin modification is shown below:

[0212] T-line capture probe:

[0213] 5'-TTGTAACTTGTACTCCGTAGTTTTTTTTTTTTTTTT-biotin-3' (SEQ ID NO: 3);

[0214] C-line capture probe:

[0215] 5'-ATAAAGTGTAATGTTACTAAAAAAAAAAAAAAAAAA-biotin-3' (SEQ ID NO: 4);

[0216] Methods for marking test lines and control lines: After incubating the probe with streptavidin, the membrane was streaked according to the above streaking method, with a streaking volume of 1 μL / cm.

[0217] (2) Synthesis of template DNA:

[0218] The template DNA used in this invention is a plasmid template composed of the full sequence of Mycoplasma felis and the pUC57 vector (purchased from Nanjing Genscript, catalog number C230KCMEG0-2, and the plasmid dilution steps were strictly performed in accordance with the company's instructions for use of the synthesized product).

[0219] (3) Isothermal amplification of nucleic acid:

[0220] Preparation of reaction reagents:

[0221] The reaction reagents described here are those used in this isothermal amplification reaction; all solvents should be prepared and used immediately.

[0222] Reagent A:

[0223] Components Final concentration Volume / μL rNTPs 2.5mM 7 spermidine 2mM 0.14

[0224] Reagent B:

[0225] Components Final concentration Volume / μL <![CDATA[Mg 2+ ]]> 12mM 1.68 MgAc 0.7mM 2.5

[0226] Isothermal amplification:

[0227] Add 14.7 μL of buffer A from the commercial kit (Amprogene DNA Isothermal Rapid Amplification Kit (Basic), catalog number 24041901C) to a lyophilized enzyme test tube (purchased from Amprogene and stored at -20°C). Then add the following components to the tube in sequence:

[0228]

[0229] After adding all the components listed in the table above, cap the tube, mix well, and place the 200 μL reaction tube into the PCR instrument. Set the PCR instrument program (cap temperature 45℃) as follows:

[0230] PCR instrument temperature time 37℃ 45min 4℃ ∞

[0231] (4) Detection of amplification products

[0232] The test strip testing procedure is as follows:

[0233] After amplification, add 1 μL of DMSO solution of HBC530 dye to the reaction tube to bring the final dye concentration to 1 μM. Mix thoroughly. Add 60 μL of the incubated sample to the sample well of the test strip and incubate at 30°C for 5 minutes. After incubation, under UV light, the test strips for positive samples will show bright green T and C fluorescent bands, while the test strips for negative samples will only show a bright green C fluorescent band without a T band. Figure 5 As shown in Figure A, fluorescence was read using a dry test strip reader, and the results are as follows. Figure 5 As shown in Figure B, the test strip for the positive sample showed strong fluorescence signals in both the T and C lines, while the test strip for the negative sample showed strong fluorescence signals only in the C line, with no fluorescence signal in the T line. This indicates that Pepper530 can be used as a reporter group on an addressable test strip to detect targets in amplified samples.

[0234] Example 2: Pepper620 as a reporter group in lateral chromatography detection.

[0235] Test strips were prepared according to the method in Example 1, and samples identical to those in Example 1 were amplified. Sample testing is as follows:

[0236] After amplification, add 70 μM DMSO solution of HBC620 dye to the reaction tube to bring the final dye concentration to 1 μM. Mix thoroughly. Add 60 μL of the incubated sample to the sample well of the test strip and incubate at 30°C for 5 minutes. After incubation, use a dry test strip reader to read the fluorescence. The results are as follows: Figure 6 As shown, under ultraviolet light, the test strips for positive samples show bright red T-line and C-line fluorescent bands, while those for negative samples show only bright red C-line fluorescent bands without T-line bands. This indicates that Pepper620 can be used as a reporter group on addressable test strips to detect targets in amplified samples.

[0237] Example 3: Application of silirodamine aptamer as a reporter group and locked nucleic acid as a capture probe in lateral chromatography detection.

[0238] Primers:

[0239] Forward primer 5'-3'

[0240] TAATACGACTCACTATAGGGAGGTATCCCTACGAGAACGT GGG(SEQ ID NO:1)

[0241] Reverse primer 5'-3'

[0242] GGCCAAAGGATACAACTGCCGAAGCAGCCAGGTTTTCAAA CCCGGTGGCCGTCATATAAAGTGTAATGTTACTAAAATG(SEQ ID NO:5)

[0243] I. Reaction System

[0244] Reaction system 1 (10 μL): 50 mM Tris-HCl, 35 mM KCl, 20 mM MgCl2, 4 mM NTPs, 1 mM dNTPs, 10% (v / v) glycerol, 15% (v / v) DMSO, 0.5 μM primer F (SEQ ID NO:1), 0.5 μM primer R (SEQ ID NO:5), SiR-NH2 (J.Am.Chem.Soc.2019,141,7562-7571.)1 μM.

[0245] Reaction system 2 (5 μL): 6.4 U AMV reverse transcriptase, 32 U T7 RNA polymerase, 0.08 U RNase H, 2.1 μg BSA, 900 mM potassium sorbate.

[0246] II. Testing:

[0247] Amplification process: First, mix the first-stage reactants (excluding the reaction enzymes) thoroughly, then add different amounts of SARS-CoV-2 N gene RNA (SEQ ID NO:33) (1pM, 100fM, 10fM, no RNA added (0)) and mix thoroughly. Incubate at 65°C for 5 min, then continue incubation at 43°C for 60 min.

[0248] The product analysis method used in this invention is lateral flow test strip detection. The test strip application and manufacturing method of the lateral flow test strip are as described in Example 1.

[0249] T-line capture probe: (The capture probe was synthesized by Shanghai Jierui Biotechnology Co., Ltd.)

[0250] 5'-A+A+C+G+T+G+G+G+G+A+T+G+G+A+T+T+A+C+C+T+C+C+TTTTTTTTTTTTTT-biotin-3'; (Here, N+ indicates that the base is a locked nucleic acid (LNA), and N represents any base) (SEQ ID NO:6)

[0251] C-line capture probe:

[0252] 5'-ATAAAGTGTAATGTTACTAAAAAAAAAAAAAAAAAA-biotin-3'(SEQ ID NO:4)

[0253] The test strip detection procedure is as follows (this procedure is performed in a biosafety cabinet in a Class C area): After amplification, add 1 μL of DMSO solution of SiR-NH2 dye to the reaction tube to bring the final dye concentration to 1 μM. Mix thoroughly and incubate the system in a 50℃ metal bath for 10 min. After incubation, cool to room temperature, add 60 μL of the incubated sample to the sample well of the test strip, and incubate in a 30℃ test strip incubator for 5 min. After incubation, perform fluorescence readings. The results are shown in Table 1. Negative samples showed almost no signal at the T line of the test strip, while positive samples all showed signal at the T line. Furthermore, the fluorescence intensity at the T line continuously increased with the increase of the target concentration, and strong fluorescence signals were observed at the C line of the test strip. This indicates that the silirodamine aptamer can serve as a reporter group on an addressable test strip for detecting the target in the amplified sample, and within a certain range, the fluorescence intensity of the T line on the test strip is positively correlated with the target concentration.

[0254] Table 1:

[0255] Target concentration T-line fluorescence intensity C-line fluorescence intensity Positive / Negative 1pM 25634 19156 +++ 100fM 1569 18625 ++ 10fM 186 19864 + 0fM 6 18260 -

[0256] Example 4: Application of Clivia574 as a reporter group in lateral chromatography detection in the presence of a mediator probe.

[0257] Forward primer 5'-3'

[0258] TAATACGACTCACTATAGGGAGGTATCCCTACGAGAACGT GGG(SEQ ID NO:1)

[0259] Reverse primer 5'-3'

[0260] CATCATGTGTCCAATGCATCTGCCGAAGCAGATGAGAGTGT TTACAGTCATAATGGTCATATAAAGTGTAATGTTACTAAAATGC(SEQ ID NO:7)

[0261] The method for modifying the C-line capture probe with streptavidin is as follows:

[0262] 75 μL of a 20 μM biotin-modified C-line capture probe (Jierui Biotechnology Co., Ltd.) was mixed with 25 μL of a 1 mg / mL streptavidin solution and reacted at room temperature for 2 h to generate a capture probe modified with biotin and streptavidin. The incubated sample was centrifuged at 6000 r / min for 20 min at 4 °C to remove the precipitate and stored at 4 °C for later use.

[0263] The preparation method for the T-line capture probe is as follows:

[0264] Prepare a 0.25 mg / mL streptavidin solution, centrifuge at 6000 r / min for 20 min, remove the precipitate, and store at 4℃ for later use.

[0265] The nucleic acid sequence of the above detection and capture probe after biotin modification is shown below:

[0266] Mediator probe:

[0267] 5'-TTGTAACTTGTACTCCGTAGTTTTTTTTTTTTTTTT-biotin-3'(SEQ ID NO:3)

[0268] C-line capture probe:

[0269] 5'-ATAAAGTGTAATGTTACTAAAAAAAAAAAAAAAAAA-biotin-3'(SEQ ID NO:4)

[0270] The test strips were scribed according to the scribing method in Example 1. The scribed strips were dried overnight in an oven at 45°C. After drying, the strips were placed in a dry and dark environment for later use. The test strips were assembled according to the preparation method in Example 1.

[0271] Amplification product detection

[0272] The test strip testing procedure is as follows:

[0273] The sample was amplified according to the method described in Example 1, identical to that in Example 1. After amplification, 1 μL of DMSO solution of NBSI574 dye was added to the reaction tube to bring the final dye concentration to 100 μM. A mediator probe was then added to bring the final mediator probe concentration to 200 nM. The mixture was thoroughly mixed and incubated in a 50°C metal bath for 10 min. After incubation, the mixture was cooled to room temperature. 60 μL of the incubated sample was added to the sample well of the test strip and incubated in a 30°C test strip incubator for 5 min. After incubation, fluorescence was read using a dry test strip reader. The results are as follows: Figure 7As shown, under ultraviolet light, the test strips for positive samples show bright orange T-line and C-line fluorescent bands, while the test strips for negative samples only show bright orange C-line fluorescent bands without T-line bands. This indicates that Clivia574 can be used as a reporter group, and the mediator probe can be used on an addressable test strip to detect targets in amplified samples.

[0274] Example 5: Taking the bG aptamer as an example, this illustrates how a complex constructed by linking a ligand to a dye can be used as a reporter group to detect the addressability of a target on a microfluidic chip.

[0275] Primers:

[0276] Forward primer 5'-3'

[0277] TAATACGACTCACTATAGGGAGGTATCCCTACGAGAACGT GGG(SEQ ID NO:1)

[0278] Reverse primer 5'-3'

[0279] GTGACGCGACTAGTTACGGACCCAAGAACTTTTCCCACTAGGTACTGCCGAAGCAGTAACTTGATCCGCATTTCAACTCGTTCATTCAGTTGGCGCCTCCGTCATATAAAGTGTAATGTTACTAAAATG(SEQ ID NO:8)

[0280] T-line capture probe:

[0281] 5'-TFTFGFTFAFAFCFTFTFGFTFAFCFCFCFCFGFTFAFGFTTTTTTTTTTTTTTTTT-biotin-3'(SEQ ID NO:9) (Here, NF indicates that the ribose of this base is 2-F substituted, and N represents any base)

[0282] C-line capture probe:

[0283] 5'-ATAAAGTGTAATGTTACTAAAAAAAAAAAAAAAAAA-biotin-3'(SEQ ID NO:4)

[0284] Microfluidic chip spotting:

[0285] Place 100 μL (300 μm particle size) of avidin-modified microspheres (Suzhou Nanomicro Technology Co., Ltd.) in a clean centrifuge tube, add 500 μL of sterile ultrapure water, disperse by sonication, centrifuge at 14000 rap / min at 4℃, carefully remove the supernatant, and repeat this step once.

[0286] Microsphere coupling: Add the cleaned microspheres to the PBS solution containing the capture probe to make the final concentration of the capture probe 1 μM. Then place the system on a rotary mixer and incubate at 4 °C for 30 min. After centrifugation, remove the supernatant, add 500 μL of reconstitution solution to dissolve the precipitate, sonicate to disperse, add 500 μL of sterile ultrapure water, sonicate to disperse, centrifuge at 14000 rap / min at 4 °C, carefully remove the supernatant, repeat this step once, and store at 4 °C for later use.

[0287] The labeled microspheres were applied to a surface-modified glass slide using a scrubbing apparatus, incubated overnight in a constant temperature and humidity chamber, washed three times with PBS the next day, dried at 30 degrees Celsius for 24 hours, and then assembled into a chip for later use.

[0288] The target sample and amplification method used in Example 1 were employed, with the difference being the use of forward primers (SEQ ID NO:1) and reverse primers (SEQ ID NO:8). Before sample amplification, a dye molecule (SNAP-Cell 647-SiR, NEB) linked to bG and silirodamine was directly added to the sample at a final concentration of 1 μM. After amplification, the sample was placed on a microfluidic plate, as shown... Figure 8 After incubation for 10 minutes, the fluorescence intensity on the microfluidic plate was read using a microfluidic plate fluorescence reader. The results are shown in Table 2. Negative results showed no fluorescence at the detection line, while positive samples showed clearly detectable fluorescence at the detection line. This indicates that the complex constructed by using bG aptamer as an aptamer and linking the ligand and dye as a reporter group can perform addressable detection of targets on a microfluidic chip.

[0289] Table 2:

[0290] Target concentration T-line signal C-line signal Result Interpretation <![CDATA[10 -9 μg / μL]]> 35961 21563 +++ 0 μg / μL 0 24622 -

[0291] Example 6: Using SRB-2 as an aptamer and DN-PEG3-NH2-labeled colored microspheres as a labeling complex, this example illustrates the application of aptamer-ligand-modified microspheres as reporter groups in lateral chromatography detection.

[0292]

[0293] DN-PEG3-NH2

[0294] Step 1:

[0295] 1.1 Microsphere washing: Take 100 μL of carboxylated microspheres (particle size 200 μm, blue, microsphere solid content 4 mg) (Suzhou Nanomicro Technology Co., Ltd.) into a clean centrifuge tube, add 500 μL of sterile ultrapure water, disperse by sonication, centrifuge at 14000 rap / min at 4℃, carefully remove the supernatant, and repeat this step once.

[0296] 1.2 Microsphere Activation: The microspheres from step 1.1 were dispersed in 4 mL of morpholine ethanesulfonic acid (MES) buffer solution at a concentration of 10 mmol. After ultrasonic dispersion, 0.2 mL of 5 mg / mL N-hydroxythiosuccinimide (sμLfo-NHS) and 0.1 mL of 5 mg / mL 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) solution were added, and the mixture was shaken in a shaker at 37 °C for 2 h to activate the carboxyl groups. After centrifugation at 8000 rpm - 14000 rpm at 4 °C, the supernatant was carefully removed, 500 μL of sterile ultrapure water was added, and the mixture was ultrasonically dispersed. This step was repeated once.

[0297] 1.3 Microsphere Coupling: The activated microspheres were added to the aptamer's aminated ligand -- DN-PEG3-NH2, so that the final concentration of the aminated ligand was 1 μM. The system was then placed on a rotary mixer and incubated at 4 °C for 12 h. After centrifugation, the supernatant was removed, 500 μL of reconstitution solution was added to dissolve the precipitate, and the mixture was ultrasonically dispersed. 50 μL of blocking solution containing 10% BSA was added to block the mixture for 1 h, and the mixture was centrifuged and washed. The mixture was then stored at 4 °C for later use.

[0298] Step 2: Sample pad treatment: Soak the sample pad with the treatment solution, then place it in a 37℃ constant temperature drying oven for 2 hours, and then perform the same spraying operation. The treatment solution consists of: Tris-HCl buffer solution with a working concentration of 0.05M and pH = 7.5-8.0, BSA with a mass concentration of 0.05%-0.5%, sucrose with a mass concentration of 1%, and Proclin 300 with a mass concentration of 0.05%.

[0299] Step 3: Microsphere treatment with pads: Using a three-dimensional gold spraying film applicator, the ligand-labeled microspheres prepared in Step 1 were sprayed onto a glass fiber membrane at a rate of 10 μL / mL and dried at 37°C for 12 h for later use.

[0300] Assemble the test strips according to the method in Example 1, and package them for later use;

[0301] Amplification was performed according to the sample amplification protocol in Example 1, wherein the primers and probes are as follows:

[0302] Forward primer 5'-3'

[0303] TAATACGACTCACTATAGGGAGGTATCCCTACGAGAACGT GGG(SEQ ID NO:1)

[0304] Reverse primer 5'-3'

[0305] GGAACCTGAGGCGGTTAACCTTGCGCCTCTCCATCATCGCC GAAGCGAGGTTCCGTCATATAAAGTGTAATGTTACTAAAATG(SEQ ID NO:10)

[0306] T-line capture probe:

[0307] 5'-T+T+G+T+A+A+C+T+T+G+T+A+C+T+C+C+G+T+A+G+TTTTTTTT TTTTTTT-biotin-3'(SEQ ID NO:11) (Here, N+ indicates that the base is modified with 2-OMe, and N represents any base)

[0308] C-line capture probe:

[0309] 5'-ATAAAGTGTAATGTTACTAAAAAAAAAAAAAAAAAA-biotin-3'(SEQ ID NO:4)

[0310] Amplification product detection

[0311] The test strip testing procedure is as follows:

[0312] Sample amplification was performed according to the method in Example 1, except that the forward primer was SEQ ID NO:1 and the reverse primer was SEQ ID NO:10. After amplification, 60 μL of the amplified sample was added to the sample well of the test strip and incubated in a 30°C test strip incubator for 5 min. After incubation, fluorescence was read using a dry test strip reader, and the results are as follows. Figure 9 As shown, the positive sample has clear T and C bands, while the negative sample only has a C band and no T band. This indicates that using SRB-2 as an aptamer and a DN-PEG3-NH2-labeled colored microsphere reporter group, the target can be detected on the test strip for addressability.

[0313] Example 7: Using SRB-2 as an aptamer and DN-PEG3-NH2-labeled HRP as a reporter group, this example illustrates the application of aptamer-ligand-modified microspheres as a reporter group in lateral chromatography detection.

[0314] Step 1: Weigh 4 mg HRP and dissolve it in 0.2 mL of water (20 mg / mL), weigh 37.9 mg NaIO4 and dissolve it in 1.895 mL of water (20 mg / mL), mix HRP and NaIO4 in a 1:1 volume ratio (i.e., take 200 μL of each and mix them slowly), and let it stand at 4°C in the dark for 30 min. At this time, the solution is green.

[0315] Step 2: Termination of oxidation

[0316] Add 4 μL of ethylene glycol to 40 μL of water, mix, and then add the entire mixture to the oxidized HRP (stir slowly). Incubate at 4°C in the dark for 30 minutes; the solution will be brown at this point.

[0317] Step 3, labeling ligands

[0318] The HRP solution used to terminate oxidation was directly added to DN-PEG3-NH2 to make the final concentration of DN-PEG3-NH2 400 μM, and the reaction was carried out at 4°C in the dark for 4 h.

[0319] 5. Termination Marker

[0320] Weigh 0.2 mg of NaBH4 and dissolve it in 40 μL of water (prepare fresh and do not store). Add the entire solution to the above reaction mixture and react at 4°C in the dark for 1 hour, shaking once every 10 minutes.

[0321] 6. Purification and preservation

[0322] Dialyze overnight at 4°C in 20mM PBS (pH=7.4) protected from light.

[0323] 7. The labeled protein from step 6 was treated with PB (0.02M, pH=7.4) containing 2.5% w / v BSA and 1% w / v trehalose and dried overnight at 37°C.

[0324] 8. Cut the conjugate pad to a width of about 0.7cm. Attach the conjugate pad to the top of the nitrocellulose membrane, making about 2mm contact with the membrane. Attach the sample pad to the top of the conjugate pad, making about 2mm contact with the sample pad. Attach absorbent paper to the top of the nitrocellulose membrane, making about 2mm contact with the membrane. Cut strips and pack them into clips for later use.

[0325] 9. Mix the amplification product from Example 6 with 3-amino-9-ethylcarbazole to a final concentration of 1 mM. After mixing thoroughly, add 60 μL to the sample pad of the test strip and incubate at 30°C for 5 min. Observe the test results. Figure 10The test strip results show that in positive samples, there are clear red T-line and C-line bands (the capture probe sequences for the T-line and C-line are consistent with those in Example 6), while negative samples only show red C-line bands and no T-line bands. This indicates that the complex of aptamer ligand and protein label can serve as a reporter group for the addressability detection of nucleic acid amplification samples.

[0326] Example 8: Using SRB-2 as an aptamer and acridine ester labeled with DN-PEG3-NH2 as a reporter group, addressability detection of the amplification target was performed on a gene chip.

[0327] Forward primer 5'-3'

[0328] TAATACGACTCACTATAGGGAGGTATCCCTACGAGAACGT GGG(SEQ ID NO:1)

[0329] Reverse primer 5'-3'

[0330] GGAACCTGAGGCGGTTAACCTTGCGCCTCTCCATCATCGCC GAAGCGAGGTTCCGTCATATAAAGTGTAATGTTACTAAAATG(SEQ ID NO:10)

[0331] Capture probe:

[0332] 5'-TTGTAACTTGTACTCCGTAGTTTTTTTTTTTTTT-NH2-3'

[0333] (SEQ ID NO:12)

[0334] Slide markings:

[0335] Immerse the amino glass slide in a 2.5% glutaraldehyde PBS buffer solution (pH = 7.2) and react at room temperature for 2 hours. After the reaction is complete, wash three times with PBS buffer and then three times with double-distilled water. Air dry at room temperature for later use.

[0336] Add 1 μL of 3 μM capture probe aqueous solution and incubate overnight in a humid environment at room temperature. After incubation, wash three times with TETBS (150 mM NaCl, 20 mM Tris, 5 mM EDTA, 0.05% (v / v) Tween 20, pH=7.4) and TBS (150 mM NaCl, 20 mM Tris, pH=7.4) solution to remove unbound oligonucleotide capture probes.

[0337] Immerse the slide in aldehyde blocking solution (0.12g sodium borohydride dissolved in 30mL PBS, then add 10mL anhydrous ethanol; prepare fresh and use immediately, do not store for a long time) for 15 minutes. The slide must be completely immersed in the aldehyde blocking solution to block the aldehyde groups. Alternatively, immerse the slide in 0.3M glycine for 15 minutes.

[0338] Rinse the slides again: rinse twice in 0.2% SDS for 2 minutes each time; then rinse twice with deionized water for 2 minutes each time.

[0339] Anhydrous triethylamine (1.5 mM) was added to 10 mL of anhydrous DMF with NHS-modified acridinium ester (NSP-SA-NHS) (1.05 mM) and DN-PEG3-NH2 ligand (1 mM). The mixture was stirred at room temperature under Ar protection. After the reaction was completed by TLC, the solvent was removed under reduced pressure. The residue was purified by reverse-phase preparative chromatography, freeze-dried, and stored at -20 °C for later use.

[0340] The sample was amplified according to the amplification method in Example 1, except that the forward primer was SEQ ID NO:1 and the reverse primer was SEQ ID NO:10. The amplified sample was mixed with acridinium ester-labeled ligand, and the system was incubated with a glass slide at room temperature for 30 min. After incubation, the sample was washed three times with TETBS (150 mM NaCl, 20 mM Tris, 5 mM EDTA, 0.05% (v / v) Tween 20, pH=7.4) and TBS (150 mM NaCl, 20 mM Tris, pH=7.4) solutions. 0.1 M sodium hydroxide solution and 0.1 M hydrogen peroxide solution were added, and the gel was imaged using a gel imaging system in the dark. The results are as follows: Figure 11 As shown in Table 3, the grayscale calculation was performed using ImageJ. In the negative sample, the signal of the chip was very weak, similar to the background fluorescence (values ​​were taken at the edge of the slide). The positive sample detection location had a clear signal, and the sample detection result was positive. Moreover, as the target concentration increased, the fluorescence at the chip detection point gradually increased, indicating that the ligand-bound chemiluminescent molecule acridinium ester as a reporter group can perform addressable detection of amplified targets on the gene chip. It also shows that this method can be used for the detection of multiple targets.

[0341] Table 3

[0342] Target concentration Luminous intensity Positive / Negative 1pM 89965 +++ 100fM 29864 ++ 10fM 6853 + 0fM 16 - Background 15 -

[0343] Example 9: Application of Spinach-DFHBI as a reporter group in lateral chromatography detection

[0344] Forward primer 5'-3'

[0345] TAATACGACTCACTATAGGGAGGTATCCCTACGAGAACGT GGG(SEQ ID NO:1)

[0346] Reverse primer 5'-3'

[0347] GGAGCTCACACTCTACTCAACGCGAACGGACCCGTCCTTCACCGTCATATAAAGTGTAATGTTACTAAAATG(SEQ ID NO:13)

[0348] T-line capture probe:

[0349] 5'-TTGTAACTTGTACTCCGTAGTTTTTTTTTTTTTTTT-Biotin-3'(SEQ ID NO:3)

[0350] C-line capture probe:

[0351] 5'-A+T+A+A+A+G+T+G+T+A+A+T+G+T+T+A+C+T+AAAAAAAAAA AAAAAAA-biotin-3'(SEQ ID NO:43); (Here, N+ indicates that the base is 2-MOE modified, and N represents any base)

[0352] The amplification method and target concentration used in Example 4 were employed, with the difference being the use of forward primers (SEQ ID NO:1) and reverse primers (SEQ ID NO:13). DFHBI was added during the amplification process. After amplification, the sample was added to the well of a microfluidic plate and incubated for 10 minutes. The fluorescence intensity on the microfluidic plate was read using a microfluidic plate fluorescence reader. The results are shown in Table 4. Negative samples showed almost no signal at the T-line of the test strip, while positive samples all showed signal at the T-line. Furthermore, the fluorescence intensity at the T-line continuously increased with increasing target concentration, and strong fluorescence signals were observed at the C-line of the test strip. This indicates that Spinach-DFHBI can serve as a reporter group on an addressable test strip for detecting the target in amplified samples, and within a certain range, the fluorescence intensity at the T-line of the test strip is positively correlated with the target concentration.

[0353] Table 4:

[0354] Target concentration T-line fluorescence intensity C-line fluorescence intensity Positive / Negative 1pM 49965 13254 +++ 100fM 29864 15362 ++ 10fM 1685 18623 + 0fM 11 11235 -

[0355] Example 10: Using Pepper599 as a reporter group and the SARS-CoV-2 nucleic acid sequence based on the N gene as the target molecule, the target molecule in the amplification product amplified by NASBA technology was detected by lateral chromatography.

[0356] The sequence is as follows:

[0357] Primers:

[0358] Forward primer 5'-3':

[0359] GGGCCCGGCGCCAGTGCCTCTCCGAAGAGAGGCCGACACG CCACGATTGGGGCCCGGGAGCCTTGAATACACCAAAA (SEQ ID NO: 14)

[0360] Primers:

[0361] Reverse primer 5'-3':

[0362] ATGATAATACGACTCACTATAGGGGTGTAGCACGATTGCA GCATTG(SEQ ID NO:15)

[0363] I. Reaction System

[0364] Reaction system 1 (10 μL): 50 mM Tris, 35 mM KCl, 20 mM MgCl2, 4 mM NTPs, 1 mM dNTPs, 10% (v / v) glycerol, 15% (v / v) DMSO, 0.5 μM primer F (SEQ ID NO:14), 0.5 μM primer R (SEQ ID NO:15), 1 μM HBC599;

[0365] Reaction system 2 (5 μL): 6.4 U AMV reverse transcriptase, 32 U T7 RNA polymerase, 0.08 U RNase H, 2.1 μg BSA, 900 mM potassium sorbate;

[0366] II. Testing

[0367] First, mix the first-stage reactants (excluding the reaction enzyme) thoroughly, then add different amounts of SARS-CoV-2 N gene RNA (1 pM, 10 fM, no RNA added (0)) and mix thoroughly. Incubate at 65°C for 5 min, then continue amplification at 43°C for 60 min.

[0368] The sequence of the SARS-CoV-2 N gene is as follows:

[0369] AUCGUGCUACAACUUCCUCAAGGAACAACAUUGCCAAAA GGCUUCUACGCAGAAGGGAGCAGAGGCGGCAGUCAAGCCUCU UCUCGUUCCUCAUCACGUAGUCGCAACAGUUCAAGAAA (SEQ ID NO: 33)

[0370] The preparation of the test strips and the method of applying the test strips to the film are the same as those in Example 1.

[0371] T-line capture probe:

[0372] 5'-AACGTGGGATGGATTACCTCCTTTTTTTTTTTTTTTTT-biotin-3'(SEQ ID NO:16)

[0373] C-line capture probe:

[0374] 5'-ATAAAGTGTAATGTTACTAAAAAAAAAAAAAAAAAA-biotin-3'(SEQ ID NO:4)

[0375] The test strip testing procedure is as follows:

[0376] After amplification, add 1 μL of DMSO solution of HBC599 dye to the reaction tube to bring the final dye concentration to 1 μM. Mix thoroughly and incubate the system in a 50°C metal bath for 10 min. After incubation, cool to room temperature, add 60 μL of the incubated sample to the sample well of the test strip, and incubate in a 30°C test strip incubator for 5 min. After incubation, under UV irradiation, the test strips for positive samples show bright red T and C fluorescent bands, while the test strips for negative samples show only a bright red C fluorescent band, with no red fluorescent signal in the T band. The results are as follows. Figure 12 As shown in Figure A, the fluorescence intensity of the test strips was read using a dry-type test strip fluorescence reader. For negative samples, fluorescence signals were only detected at line C, while for positive samples, fluorescence signals were detected at both line T and line C. Furthermore, the fluorescence signal at line T significantly increased with increasing target concentration. The results are as follows. Figure 12 As shown in B, Pepper599 can be used as a reporter group to detect the target in NASBA amplified samples on the test strip.

[0377] Example 11: Using SRB-2 as an aptamer and DN-PEG3-NH2-labeled methylene blue as a reporter group, this demonstrates the application of the aptamer-ligand-modified electrochemical signal group as a reporter group on a gold electrode.

[0378] DN-PEG3-NH2 and NHS-methylene blue were labeled and purified according to the method in Example 8, and stored at -20°C in the dark for later use.

[0379] Primers:

[0380] Forward primer 5'-3'

[0381] GGAACCTGAGGCGGTTAACCTTGCGCCTCTCCATCATCGCC GAAGCGAGGTTCCGGGAGCCTTGAATACACCAAAA (SEQ ID NO: 17)

[0382] Primers:

[0383] Reverse primer 5'-3':

[0384] ATGATAATACGACTCACTATAGGGGTGTAGCACGATTGCA GCATTG(SEQ ID NO:15)

[0385] T-line capture probe:

[0386] 5'-AACGTGGGATGGATTACCTCCTTTTTTTTTTTTTTTTT-SH-3' (SEQ ID NO: 18);

[0387] The capture probe was dispersed in a Tris-TE buffer solution at pH 7 (20 mM Tris, with the addition of 140 mmol NaCl and 5 mmol MgCl2) to prepare a 10 μM solution. 2 μL was added dropwise to the pretreated gold electrode and incubated at room temperature for 24 h. After incubation, the electrode was washed three times with 10 mM Tris-HCl at pH 7.0 and stored at 4 °C for later use.

[0388] The amplification method of Example 1 was followed, except that a forward primer (SEQ ID NO: 17) and a reverse primer (SEQ ID NO: 15) were used. The amplified product was dropped onto an electrode dried with nitrogen gas and incubated for 30 min. Square wave voltammetry was then performed on the electrode within the range of -0.35 to 1.5 V. The results are as follows: Figure 13 As shown, when a target is present, the electrode generates a significant electrochemical signal, while when no target is present, no significant electrochemical signal is detected. Figure 13 This indicates that the aptamer-ligand-modified electrochemical signaling group can be used as a reporter group to amplify the addressability detection of the target.

[0389] Example 12: Using fluorescent RNA Peppe530 as a reporter group, the target content of miRNA-21 in the system was detected by rolling circle amplification.

[0390] like Figure 14 The probe structure shown in Figure A includes inserted detection sequences, random sequences, and T7 promoter recognition sequences. The designed circular template mainly includes target recognition regions, promoter regions, and fluorescent RNA regions. An amplification diagram is shown below. Figure 14 As shown in B.

[0391] The probe sequences are as follows:

[0392] Detection probe sequence: 5'-3'

[0393] CTGATAAGCTAGAAAGAAACATATTATGCTGAGTGATATCC GCCAATCGTGGCGTGTCGGCCTGCTTCGGCAGGCACTGGCGCC GGAAAGAAATCAACATCAGT (SEQ ID NO: 19)

[0394] T7 Startup Sequence: 5'-3'

[0395] GTATAATACGACTCACTATAGG(SEQ ID NO:20)

[0396] Capture probe sequence: 5'-3'

[0397] CACGGTATAGGTTTCTTTCCGGCGTTTTTTTTTTTTT-NH2(SEQ ID NO:21)

[0398] Gene chips were prepared according to the method in Example 8 and stored at 2-8°C for later use.

[0399] (2) Synthesis of detection probes

[0400] The detection probe in this invention is a long single-stranded DNA, the 5' end of which needs to be phosphorylated (purchased from Nanjing GenScript, the primer dilution steps were performed according to the company's instructions for use of the synthetic product).

[0401] (3) Isothermal amplification of nucleic acid:

[0402] Preparation of reaction buffer solution:

[0403] The reaction solution described here should be prepared and used immediately, with a pH of 7.4 and a temperature of 25°C.

[0404] name concentration Tris-HCl 40mM MgCl2 6mM DTT 1mM spermidine 2mM

[0405] Isothermal amplification: Add the following components to the tube in sequence:

[0406]

[0407] After adding the ingredients, place the container in a temperature-controlled instrument (such as a PCR instrument) and proceed with the reaction according to the following procedure:

[0408] reaction temperature reaction time 37℃ 60min 4℃ ∞

[0409] The amplification product was dropped onto the chip capture area, with three replicates for each sample concentration. The samples were incubated at room temperature for 2 hours. After incubation, the samples were washed three times with TETBS (150 mM NaCl, 20 mM Tris, 5 mM EDTA, 0.05% (v / v) Tween 20, pH = 7.4) and TBS (150 mM NaCl, 20 mM Tris, pH = 7.4). Each sample pad was imaged using a microscope. The results are shown below. Figure 14 As shown in C, ImageJ is used for grayscale calculation, and the result is as follows. Figure 14 As shown in Figure D, the signal on the chip is very weak in the negative sample, while the detection location of the positive sample shows a clear signal, indicating a positive result. Furthermore, the fluorescence at the chip detection point gradually increases with the increase of the target concentration, demonstrating that fluorescent RNA, as a reporter group, can perform addressable detection of the amplification target in RCA amplification samples on the gene chip. It also shows that this method can fix capture probes for different targets at different locations, thus enabling the detection of multiple targets.

[0410] Example 13: Using fluorescent DNA as a label for multiplex detection of HPV on lateral chromatography test strips.

[0411] Based on the above principles, we first designed a detection method to detect five common HPV types: HPV 6, 11, 16, 18, and 33. To avoid potential false negatives, the human β-globin (HBB) gene was used as an internal positive control (IPC). Amplification was performed using universal primers GP5+ (SEQ ID NO:22) / GP6+ (SEQ ID NO:23), and the amplification system is shown in the table below.

[0412] Template sequence:

[0413] HPV6:

[0414] Gttgttactgtggtagataccacacgcagtaccaacatgacattatgtgcatccgtaactacatcttccacatacaccaattctgattataaagagtacatgcgtcatgtggaagagtatgatttacaatttatttttc(SEQID NO:35);

[0415] HPV18:

[0416] tttgttactgtggtagataccactcgtagtaccaatttaacaatatgtgcttctacacagtctcctgtac ctgggcaatatgatgctaccaaatttaagcagtatagcagacatgttgaagaatatgatttgcagtttatttttc(SEQ ID NO:36);

[0417] HPV-16:

[0418] Tttgttactgttgttgatactacacgcagtacaaatatgtcattatgtgctgccatatctacttcagaaactacatataaaaatactaactttaaggagtacctacgacatggggaggaatatgatttacagtttatttttc(SEQID NO:37);

[0419] HPV-33:

[0420] Tttgttactgtggtagataccactcgcagtactaatatgactttatgcacacaagtaactagtgacagtacatataaaaatgaaaattttaaagaatatataagacatgttgaagaatatgatttacagtttgtttttc(SEQID NO:38);

[0421] HPV-11:

[0422] Tttgttactgtggtagataccacacgcagtacaaatatgacactatgtgcatctgtgtctaaatctgctacatacactaattcagattataaggaatacatgcgccatgtggaggagtttgatttacagtttatttttc (SEQ ID NO: 39).

[0423] PCR system:

[0424]

[0425] PCR reaction conditions:

[0426]

[0427] GP5+ primers:

[0428] ACGTTGGATGCGTTTGTTACTGTGGTAGATACCAC(SEQ ID NO:22)

[0429] GP6+ primers:

[0430] ACGTTGGATGCGGAAAAATAAACTGTAAATCATATTC(SEQ ID NO:23)

[0431] IC primers:

[0432] IC forward primer sequence:

[0433] ACGTTGGATGCGTGGAATATATGTGGTGCTTATTTG(SEQ ID NO:24)

[0434] IC reverse primer sequence:

[0435] ACGTTGGATGGAGATTAGGGAAAGTATTAGGACGACGACG CTAGGAAGGCGTTGGTGGGCACGCCGGTCGTC(SEQ ID NO:25)

[0436] Capture probe:

[0437] HPV6:

[0438] 5'-TCCACATACACCAATTCTTTTTTTTTTTTTTTTTTTTT-biotin-3'(SEQ ID NO:26)

[0439] HPV11:

[0440] 5'-gtgcatctgtgtctaaatctTTTTTTTTTTTTTTTTTT-biotin-3'(SEQ ID NO:27)

[0441] HPV16:

[0442] 5'-CTTCAGAAAACTACATATAAATTTTTTTTTTTTTTTTTT-biotin-3'(SEQ ID NO:28)

[0443] HPV18:

[0444] 5'-GCAATATGATGCTACCATTTTTTTTTTTTTTTTTT-biotin-3'(SEQ ID NO:29)

[0445] HPV33:

[0446] 5'-gcacacaagtaactagtgacTTTTTTTTTTTTTTTTTT-biotin-3'(SEQ ID NO:30)

[0447] C-line capture probe:

[0448] 5'-TTTTAATATACTTTTTTGTTTATCTTTTTTTTTTTTTTTTTTTT-biotin-3' (SEQ ID NO: 31)

[0449] The probe was incubated with streptavidin and then traced onto the T1, T2, T3, T4, T5 and C lines of the NC membrane. The test strip was then assembled as described in Example 1.

[0450] Using an HPV test type as the positive sample, this test type is a standard synthetic plasmid containing GP5+ / GP6+ flanking regions, each containing HPV types (HPV6, HPV11, HPV16, HPV18, HPV33). The positive sample contains this synthetic plasmid. The negative sample uses only an equal volume of physiological saline. Both the positive and negative samples contain the HBB gene. Amplification is performed according to the components and amplification method listed in the table above. The amplified product is incubated with dye to a final dye concentration of 1 μM. After incubation, 100 μL is added to the test strip and lateral chromatography is performed at 30°C. After incubation, under UV light, the positive sample test strip shows 5 bright green T lines and 1 bright green C line fluorescent band, while the negative sample test strip shows only one bright green C line fluorescent band and no T line band. Figure 15As shown in Figure A, fluorescence was read using a dry test strip reader, and the results are as follows. Figure 15 As shown in Figure B, the test strip for the positive sample showed strong fluorescence signals in all five T lines and the C line, while the test strip for the negative sample showed strong fluorescence signals only in the C line and no fluorescence signal in the T line. This indicates that fluorescent DNA can be used as a reporter group on an addressable test strip for the simultaneous detection of multiple targets in amplified samples.

[0451] Example 14: Application of Okra as a reporter group in ultra-multiple target detection in lateral chromatography.

[0452] The film was applied and the test strips were prepared according to the method described in Example 1. .

[0453] Feline mycoplasma nucleic acid test:

[0454] (1) Primer design

[0455] This embodiment describes a method for isothermal amplification and detection of multiplex pathogens. In this method, the product obtained by amplifying primer DNA containing the T7 promoter and a specific Okra sequence is used as a template for simultaneous T7 in vitro transcription. Specific target sites of influenza A virus, rhinovirus B, respiratory syncytial virus B, influenza B virus, respiratory syncytial virus A, adenovirus, bocavirus, human metapneumovirus, parainfluenza virus I, parainfluenza virus II, parainfluenza virus III, and parainfluenza virus IV are selected as template sequences for primer design.

[0456]

[0457]

[0458]

[0459]

[0460]

[0461]

[0462] Methods for marking test lines and control lines: After incubating the probe with streptavidin, the membrane was streaked according to the above streaking method, with a streaking volume of 1 μL / cm.

[0463] (2) Synthesis of template DNA:

[0464] The template DNA used in this invention is a plasmid template composed of a target sequence and a pUC57 vector (purchased from Nanjing Genscript, including influenza A virus, catalog number C5549621G0-2; rhinovirus B, catalog number C048J166G0-2; respiratory syncytial virus B, catalog number C048J166G0-4; influenza B virus, catalog number C048J166G0-6; respiratory syncytial virus A, catalog number C9112BZNG0-2; and adenovirus, catalog number C092WF). MPG0-2, Bocavirus (C485T957G0-2), Human Metapneumovirus (C6866NGDG0-2), Parainfluenza Virus I (C707TCNPG0-1), Parainfluenza Virus II (C707TCNPG0-4), Parainfluenza Virus III (C707TCNPG0-6), Parainfluenza Virus IV (C707TCNPG0-8). Plasmid dilution procedures were strictly performed according to the company's instructions for use of the synthesized products.

[0465] (3) Isothermal amplification of nucleic acid:

[0466] Preparation of reaction reagents:

[0467] The reaction reagents described here are those used in this isothermal amplification reaction; all solvents should be prepared and used immediately.

[0468] Reagent A:

[0469] Components Final concentration Volume / μL rNTPs 3.5mM 10 spermidine 2mM 0.2

[0470] Reagent B:

[0471] Components Final concentration Volume / μL <![CDATA[Mg 2+ ]]> 12mM 1.8 MgAc 0.7mM 3.0

[0472] Isothermal amplification:

[0473] Add 14.7 μL of buffer A to an enzyme lyophilized reagent tube (purchased from AmpMed, stored at -20°C), followed by the following components:

[0474]

[0475]

[0476] After adding all the components listed in the table above, cap the tube, mix well, and place the 200 μL reaction tube into the PCR instrument. Set the PCR instrument program (cap temperature 45℃) as follows:

[0477] PCR instrument temperature time 37℃ 45min 4℃ ∞

[0478] (4) Detection of amplification products

[0479] The test strip testing procedure is as follows:

[0480] After amplification, add 1 μL of DMSO solution of ACE dye to the reaction tube to bring the final dye concentration to 3.5 μM. Mix thoroughly. Add 100 μL of the incubated sample to the sample well of the test strip and incubate at 37°C for 15 minutes. After incubation, under UV light, the test strips for positive samples will show bright green T and C fluorescent bands, while the test strips for negative samples will only show a bright green C fluorescent band without a T band. Figure 16 As shown in A and 16B, fluorescence was read using a dry test strip reader, and the results are as follows. Figure 16 As shown in D, the test strip for the positive sample showed strong fluorescence signals in both the T and C lines, while the test strip for the negative sample showed the following results. Figure 16 As shown in C, only line C has a strong fluorescence signal, while line T has no fluorescence signal. This indicates that Okra can be used as a reporter group on an addressable test strip for the detection of targets in ultra-multiplex amplified samples.

Claims

1. A method for addressable detection of a nucleic acid target, characterized in that, The method comprises: a) preparing aptamer-target units by amplification, wherein the aptamer-target units comprise one or more aptamers and one or more nucleic acid targets bound to the one or more aptamers; b) preparing a solid support and one or more capture elements immobilized on the surface and / or inside of the solid support, which can specifically capture the aptamer-target units; c) a label that can specifically recognize and / or bind to the aptamer-target units, the aptamer-target units and the capture elements form a complex, wherein the label has a detectable signal after binding to the aptamer-target units; and d) detecting the signal.

2. The method of claim 1, wherein, The amplification is a variable temperature amplification or an isothermal amplification.

3. The method of claim 1, wherein, The aptamer and the nucleic acid target are on the same nucleic acid strand; preferably, the aptamer and the nucleic acid target are directly connected, the aptamer and the nucleic acid target are operably linked by one or more nucleotide sequences, or the aptamer and the nucleic acid target comprise one or more shared nucleotide sequences; Alternatively, the aptamer and the nucleic acid target are not on the same nucleic acid strand; preferably, the nucleic acid strand where the aptamer is located and the nucleic acid strand where the nucleic acid target is located are independently amplified in the same system or mixed after amplification in different systems; more preferably, the nucleic acid strand where the aptamer is located and the nucleic acid strand where the nucleic acid target is located are hybridized and combined by affinity, covalent bond or base complementary pairing.

4. The method of claim 1, wherein, The aptamer is selected from a DNA aptamer or an RNA aptamer; Preferably, when the aptamer is a DNA aptamer, the aptamer is a non-G-quadruplex; More preferably, the length of the aptamer is 10-500 nt, preferably 10-300 nt, more preferably 10-250 nt, further more preferably 10-200 nt, most preferably 10-100 nt; Further more preferably, the aptamer is selected from one or a combination of Pepper or its mutants, Clivias or its mutants, Mango or its mutants, Spinach or its mutants, Broccoli or its mutants, BiRhoBAST or its mutants, biSiRA or its mutants, Riboglow RNA tags or its mutants, Chili or its mutants, Okra or its mutants, o-Coral or its mutants, DIR2s-apt or its mutants, 13-2min or its mutants, and MGA or its mutants.

5. The method of claim 1, wherein, The label comprises a ligand that specifically recognizes and / or binds to the aptamer-target unit; Preferably, the label further comprises a reporter group connected to the ligand, and the reporter group is selected from one or a combination of dyes, nanoparticles, microspheres, redox molecules, luminescent molecules, radioactive labels, electrochemical functional groups, enzymes and enzymes plus detectable enzyme substrates.

6. The method of claim 1, wherein, The label has a detectable signal before binding to the aptamer-target unit and the label has a detectable signal after binding to the aptamer-target unit with different intensities; More preferably, when the detectable signal is a fluorescent signal, the fluorescent signal intensity of the label after binding to the aptamer-target unit is enhanced by more than 5 times, preferably the fluorescent signal intensity is enhanced by more than 10 times or the excitation wavelength shift is more than 10 nm or the emission wavelength shift is more than 10 nm, more preferably the fluorescent signal intensity is enhanced by more than 20 times or the excitation wavelength shift is more than 20 nm or the emission wavelength shift is more than 20 nm, further preferably the fluorescent signal intensity is enhanced by more than 50 times or the excitation wavelength shift is more than 50 nm or the emission wavelength shift is more than 50 nm, compared to the fluorescent signal intensity of the label before binding to the aptamer-target unit; Further more preferably, the label forms a covalent or non-covalent complex with the aptamer-target unit; when the label forms a non-covalent complex with the aptamer-target unit, the dissociation constant (Kd) between the label and the aptamer-target unit is selected from the range of about 0.001 nM to about 100 μM, preferably from the range of about 0.01 nM to about 1 μM, more preferably from the range of about 0.01 nM to about 10 nM; Most preferably, the complex formed by the label and the aptamer-target unit is selected from one or a combination of Pepper485, Pepper497, Pepper508, Pepper514, Pepper525, Pepper530, Pepper599, Pepper620, Clivia580, Clivia577, Clivia581, Clivia582, Clivia590, Clivia600, Clivia624, Clivia565, Clivia570, Clivia571, Clivia574, Clivia578, Clivia595, Clivia618, Chili-DMHBI-Imi and Chili-DMHBO.

7. The method of claim 1, wherein, The aptamer-target unit binds to the label to form the complex before binding to the capture element; Alternatively, the aptamer-target unit binds to the capture element to form the complex before binding to the label; Alternatively, the process of the aptamer-target unit binding to the label and the capture element to form the complex is carried out simultaneously.

8. The method of claim 1, wherein, The capture element is selected from one or a combination of natural nucleic acid sequence, unnatural nucleic acid sequence, morpholino backbone nucleic acid, peptide nucleic acid, antigen, antibody, hapten, enzyme, nanoenzyme, aptamer, monosaccharide, polysaccharide, affibody, antibody mimetic, cell receptor, ligand, lipid, biotin, avidin, streptavidin, exavidin, neutravidin, Traptavidin, metal and histidine; preferably one or a combination of natural nucleic acid sequence, unnatural nucleic acid sequence, antigen, antibody, aptamer or biotin; more preferably one or a combination of natural nucleic acid sequence, unnatural nucleic acid sequence or biotin; More preferably, when the capture element is a nucleic acid sequence, the nucleic acid sequence comprises at least one modification, and the modification is independently at one or more selected from the group consisting of ribose position, deoxyribose position, phosphate position, and base position; Further more preferably, the modification is at the phosphate position of the aptamer, and the modification is a modification to resist nuclease activity selected from one or a combination of phosphorothioate linkage, alkyl phosphorotriester linkage, aryl phosphorotriester linkage, alkyl phosphorothioate linkage, aryl phosphorothioate linkage, hydrogen phosphorothioate linkage, and alkyl aminophosphorothioate linkage; or the modification is at the ribose position of the aptamer, and the modification is selected from one or a combination of 2'-position sugar modification, 2'-amino (2'-NH2), 2'-fluoro (2'-F), 2'-methoxy (2'-OMe), 2'-ethoxy (2'-OEt), 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, 1-(4'-thio-PD-ribofuranose) modification, 2-O-4-C modification, L-DNA, and a nucleic acid analogue of a mirror body; or the modification is at the base position of the aptamer, and the modification is selected from one or a combination of 5'-position pyrimidine modification, 8'-position purine modification, cytosine exocyclic modification, substitution of 5'-bromouracil, substitution of 5'-bromodeoxyuridine, substitution of 5-bromodeoxycytidine, backbone modification, methylation, 2'-methoxy ethylene (2'-MOE), 3' cap, and 5' cap.

9. The method of claim 1, wherein, The capture element specifically captures the aptamer-target unit is by affinity capture, covalent reaction, hybridization capture by base complementarity, capture of antibody and antigen / hapten, capture of chemical tag and substrate, capture of enzyme and substrate, capture of nanoenzyme and substrate, or mediator probe; More preferably, the mediator probe comprises a probe region and a capture binding region; wherein the probe region has affinity to the aptamer-target unit, the capture binding region has recognition binding force to the capture element, the probe region and the capture binding region are independently selected from one or a combination of natural nucleic acid sequence, unnatural nucleic acid sequence, peptide nucleic acid, antigen, antibody, hapten, enzyme, nanoenzyme, aptamer, monosaccharide, polysaccharide, affibody, antibody mimetic, cell receptor, ligand, lipid, biotin, avidin, streptavidin, neutravidin, Traptavidin, metal, and histidine, preferably selected from one or a combination of peptide nucleic acid, natural nucleic acid sequence, unnatural nucleic acid sequence, antigen, antibody, aptamer, and biotin, more preferably selected from one or a combination of peptide nucleic acid, natural nucleic acid sequence, unnatural nucleic acid sequence, and biotin; Further more preferably, the mediator probe further comprises an intermediate connecting region; wherein the intermediate connecting region is selected from one or a combination of nucleoside, peptide chain, peptide nucleic acid chain, monosaccharide, polysaccharide, PEG chain, high molecular polymer, short chain chemical linker, and chain segment.

10. A kit for the addressable detection of a nucleic acid target, characterized in that, The kit comprises a primer set for amplification of the aptamer-target unit, a label, a solid support, a capture element, and optionally an instruction of detection method; The primer set comprises primers for amplification of one or more nucleic acid targets and the 5' end of the primers further comprises an aptamer coding sequence, or the primer set comprises primers for amplification of one or more nucleic acid targets and primers for amplification of one or more aptamers; The aptamer-target unit is formed by variable temperature amplification or isothermal amplification; the label has a detectable signal after binding to the aptamer-target unit; the capture element is immobilized on the surface or inside of the solid support and can specifically capture the aptamer-target unit.

11. The kit of claim 10, wherein The aptamer and the nucleic acid target are located on the same nucleic acid chain after amplification; preferably, the aptamer and the nucleic acid target are directly connected, the aptamer and the nucleic acid target are operably linked by one or more nucleotide sequences, or the aptamer and the nucleic acid target comprise one or more shared nucleotide sequences; Alternatively, the aptamer and the nucleic acid target are not located on the same nucleic acid chain after amplification; preferably, the nucleic acid chain where the aptamer is located and the nucleic acid chain where the nucleic acid target is located are independently amplified in the same system or are amplified in different systems and then mixed; more preferably, the nucleic acid chain where the aptamer is located and the nucleic acid chain where the nucleic acid target is located are combined by affinity or covalent bond, or the nucleic acid chain where the aptamer is located and the nucleic acid chain where the nucleic acid target is located are combined by base complementary pairing and hybridization.

12. The kit of claim 10, wherein The aptamer is selected from a DNA aptamer or an RNA aptamer; Preferably, when the aptamer is a DNA aptamer, the aptamer is a non-G-quadruplex; More preferably, the length of the aptamer is 10-500 nt, preferably 10-300 nt, more preferably 10-250 nt, further more preferably 10-200 nt, most preferably 10-100 nt; Further more preferably, the aptamer is selected from one or a combination of Pepper or its mutant, Clivias or its mutant, Mango or its mutant, Spinach or its mutant, Broccoli or its mutant, BiRhoBAST or its mutant, biSiRA or its mutant, Riboglow RNA tags or its mutant, Chili or its mutant, o-Coral or its mutant, DIR2s-apt or its mutant, 13-2min or its mutant, and MGA or its mutant, Okra or its mutant.

13. The kit of claim 10, wherein The label comprises a ligand that specifically recognizes and / or binds to the aptamer-target unit; Preferably, the label further comprises a reporter group connected to the ligand, and the reporter group is selected from one or a combination of dyes, nanoparticles, microspheres, redox molecules, luminescent molecules, radioactive labels, electrochemical functional groups, enzymes, and enzymes plus detectable enzyme substrates.

14. The kit of claim 10, wherein the detectable signal of the label before binding with the aptamer-target unit is different from the detectable signal of the label after binding with the aptamer-target unit; more preferably, when the detectable signal is a fluorescent signal, the fluorescent signal of the label after binding with the aptamer-target unit is enhanced by more than 5 times, preferably by more than 10 times, or the excitation wavelength shift is more than 10 nm or the emission wavelength shift is more than 10 nm, more preferably the fluorescent signal of the label after binding with the aptamer-target unit is enhanced by more than 20 times, or the excitation wavelength shift is more than 20 nm or the emission wavelength shift is more than 20 nm, further preferably the fluorescent signal of the label after binding with the aptamer-target unit is enhanced by more than 50 times, or the excitation wavelength shift is more than 50 nm or the emission wavelength shift is more than 50 nm, compared to the fluorescent signal of the label before binding with the aptamer-target unit; more preferably, the label forms a covalent or non-covalent complex with the aptamer-target unit; when the label forms a non-covalent complex with the aptamer-target unit, the dissociation constant (Kd) between the label and the aptamer-target unit is selected from the range of about 0.001 nM to about 100 μM, preferably from the range of about 0.01 nM to about 1 μM, more preferably from the range of about 0.01 nM to about 10 nM; most preferably, the complex formed by the label and the aptamer-target unit is selected from one or a combination of Pepper485, Pepper497, Pepper508, Pepper514, Pepper525, Pepper530, Pepper599, Pepper620, Clivia580, Clivia577, Clivia581, Clivia582, Clivia590, Clivia600, Clivia624, Clivia565, Clivia570, Clivia571, Clivia574, Clivia578, Clivia595, Clivia618, Chili-DMHBI-Imi and Chili-DMHBO.

15. The kit of claim 10, wherein the capture element is selected from one or a combination of natural nucleic acid sequence, unnatural nucleic acid sequence, morpholino backbone nucleic acid, peptide nucleic acid, antigen, antibody, hapten, enzyme, nanoenzyme, aptamer, monosaccharide, polysaccharide, affibody, antibody mimetic, cell receptor, ligand, lipid, biotin, avidin, streptavidin, neutravidin, Traptavidin, metal and histidine; preferably one or a combination of natural nucleic acid sequence, unnatural nucleic acid sequence, antigen, antibody, aptamer or biotin; more preferably one or a combination of natural nucleic acid sequence, unnatural nucleic acid sequence or biotin; more preferably, when the capture element is a nucleic acid sequence, the nucleic acid sequence comprises at least one modification, and the modification is independently at one or more selected from ribose position, deoxyribose position, phosphate position and base position; Further more preferably, the modification occurs at a phosphate position of the aptamer, and the modification is a modification conferring resistance to nuclease activity, the modification being selected from one or a combination of phosphorothioate linkage, alkyl phosphorotriester linkage, aryl phosphorotriester linkage, alkyl phosphorothioate linkage, aryl phosphorothioate linkage, hydrogen phosphorothioate linkage, and alkyl phosphoramidate linkage; or the modification occurs at a ribose position of the aptamer, and the modification is selected from one or a combination of 2'-position sugar modification, 2'-amino (2'-NH2), 2'-fluoro (2'-F), 2'-methoxy (2'-OMe), 2'-ethoxy (2'-OEt), 2'-O-aminopropyl modification, 2'-O-alkyl modification, 2'-O-allyl modification, 2'-O-butyl modification, 1-(4'-thio-PD-ribofuranose) modification, 2-O-4-C modification, L-DNA, and a nucleic acid analogue of a mirror body; or the modification occurs at a base position of the aptamer, and the modification is selected from one or a combination of 5'-position pyrimidine modification, 8'-position purine modification, cytosine exocyclic modification, substitution of 5'-bromouracil, substitution of 5'-bromodeoxyuridine, substitution of 5-bromodeoxycytidine, backbone modification, methylation, 2'-methoxy ethylene (2'-MOE), 3' cap, and 5' cap.

16. The kit of claim 10, wherein The kit further comprises a mediator probe, the mediator probe comprising a probe region and a capture binding region; wherein the probe region has affinity for the aptamer-target unit, the capture binding region has a recognition binding force for the capture element, the probe region and the capture binding region are independently selected from one or a combination of natural nucleic acid sequence, unnatural nucleic acid sequence, peptide nucleic acid, antigen, antibody, hapten, enzyme, nanoenzyme, aptamer, monosaccharide, polysaccharide, affibody, antibody mimetic, cell receptor, ligand, lipid, biotin, avidin, streptavidin, exavidin, neutravidin, Traptavidin, metal, and histidine, preferably one or a combination of peptide nucleic acid, natural nucleic acid sequence, unnatural nucleic acid sequence, antigen, antibody, aptamer, and biotin; more preferably one or a combination of peptide nucleic acid, natural nucleic acid sequence, unnatural nucleic acid sequence, and biotin; More preferably, the mediator probe further comprises an intermediate linking region; wherein the intermediate linking region is selected from one or a combination of nucleoside, peptide chain, peptide nucleic acid chain, monosaccharide, polysaccharide, PEG chain, high molecular polymer, short chain chemical linking group, and chain segment.

17. An aptamer-target unit for addressable detection of a nucleic acid target, characterized in that, The aptamer-target unit comprises one or more aptamers and one or more nucleic acid targets bound to the one or more aptamers.

18. The aptamer-target unit of claim 17, wherein, The aptamer and the nucleic acid target are located on the same nucleic acid strand; preferably, the aptamer and the nucleic acid target are directly connected, the aptamer and the nucleic acid target are operably linked by one or more nucleotide sequences, or the aptamer and the nucleic acid target comprise one or more shared nucleotide sequences; Alternatively, the aptamer and the nucleic acid target are not on the same nucleic acid strand; preferably, the nucleic acid strand where the aptamer is located and the nucleic acid strand where the nucleic acid target is located are bound by affinity or covalent bond, or the nucleic acid strand where the aptamer is located and the nucleic acid strand where the nucleic acid target is located are bound by base complementary pairing hybridization.

19. The aptamer-target unit of claim 17, wherein, The aptamer is selected from a DNA aptamer or an RNA aptamer; Preferably, when the aptamer is a DNA aptamer, the aptamer is a non-G-quadruplex; More preferably, the length of the aptamer is 10-500 nt, preferably 10-300 nt, more preferably 10-250 nt, further more preferably 10-200 nt, most preferably 10-100 nt; Further more preferably, the aptamer is selected from one or a combination of Pepper or its mutants, Clivias or its mutants, Mango or its mutants, Spinach or its mutants, Broccoli or its mutants, BiRhoBAST or its mutants, biSiRA or its mutants, Riboglow RNA tags or its mutants, Chili or its mutants, o-Coral or its mutants, DIR2s-apt or its mutants, 13-2min or its mutants, and MGA or its mutants, Okra or its mutants.

20. Use of the aptamer-target unit of claims 17-19 or the kit of claims 10-16 in the detection of addressability of a nucleic acid target.