Method for obtaining new varieties of leymus chinensis by self-pollination and molecular markers

Abstract

The application belongs to the technical field of molecular marker breeding, and particularly relates to a method for obtaining a new variety of Leymus chinensis self-pollination fruit setting and a molecular marker LcDUF247II-S3 and application thereof.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker breeding technology, specifically involving a method for obtaining new self-pollinating and fruiting varieties of Leymus chinensis and the molecular marker LcDUF247II-S3 and its application. Background Technology

[0002] Leymus chinensis (Trin.) Tzvel., also known as alkali grass, belongs to the genus Leymus in the family Poaceae and is one of the important dominant species in meadow steppes and arid steppes in the eastern Eurasian steppe region. Leymus chinensis possesses strong resistance to cold, drought, and salinity, and also exhibits excellent characteristics such as early greening, high nutritional value, good palatability, and the ability to be harvested for hay, making it an important forage resource. Besides its use as forage, its rhizomes have extremely strong penetrating and spreading capabilities, forming a well-developed underground rhizome network that effectively binds and stabilizes the soil, making it an excellent plant for grassland restoration and soil and water conservation. However, the "three lows" in the reproductive characteristics of Leymus chinensis—low seed setting rate, low germination rate, and low forage yield—limit its seed production, artificial grassland construction, and livestock development. As a gametophyte-type self-incompatible plant, Leymus chinensis has a low self-pollination rate, making it difficult to obtain genetically stable, high-self-pollination-rate superior strains. Therefore, analyzing the self-incompatibility mechanism of Leymus chinensis, creating self-compatibility breeding technology, and cultivating Leymus chinensis varieties with high self-pollination and seed setting rates have become urgent problems that need to be solved for the development of Leymus chinensis industry in my country.

[0003] Self-incompatibility (SI) refers to the inability of fertile, hermaphroditic plants to produce seeds during self-pollination. In Poaceae, SI is controlled by two non-linked multiple alleles, S and Z. When the S and Z genotypes of pollen and pistil match, pollen tubes cannot grow normally on the stigma surface, resulting in a self-incompatibility response. Manzanares et al., through mapping 10,177 individuals from seven perennial ryegrass populations and combining BAC sequencing and transcriptome analysis, discovered a gene encoding a protein with the DUF247 (domain of unknown function 247) domain that co-segregates with the S site. This gene is highly expressed in pollen and exhibits sequence polymorphism, suggesting it may function as a pollen S gene, and named it LpS-DUF247 (Manzanares et al., 2016). In other grasses, homologs of LpS-DUF247 have also been found to be duplicated, and these duplications may function by forming dimers. Furthermore, in all other self-compatible species, LpS-DUF247 homologs show frameshift mutations leading to premature translation termination or large deletions of predicted protein sequences (Manzanares et al., 2016). In 2023, Wang et al. used CRISPR-Cas9 editing technology to knock out the S-site pollen gene OlDUF247Ⅰ-S in self-incompatible long-stamen wild rice, altering its self-incompatibility to compatibility and enabling stable inheritance to offspring (Wang et al., 2023). Similar to previous genomic analyses of self-compatible and self-incompatible species in the Poaceae family, this result suggests that among the six candidate self-incompatibility determinants at the S and Z loci, the absence of at least one gene copy may indicate compatibility (Rohner et al., 2022).

[0004] Molecular marker-assisted selection (MMR) breeding technology achieves the goal of selecting target traits by selecting molecular markers closely linked to them. It is simple, rapid, and unaffected by environmental factors. Selecting relevant genes from germplasm resources allows for knowledge of the gene composition of each material before configuring hybridization combinations, ensuring successful hybridization and saving significant manpower, resources, and time. Summary of the Invention

[0005] This invention provides a high-stability molecular marker for Leymus chinensis (Trin.) Tzvel.

[0006] The molecular marker for the high-yielding Leymus chinensis is LcDUF247II-S3, and its nucleotide sequence is shown in SEQ ID NO.1.

[0007] This invention provides a primer pair for the molecular marker LcDUF247II-S3, wherein the forward primer is ATGAGTCAAGTTGAAGACATTATGTC (SEQ ID NO.8); and the reverse primer is TTACTTGGGATTAACATAAGACTCAAC (SEQ ID NO.9).

[0008] The molecular marker LcDUF247II-S3 and its primer pair described in this invention can be applied to marker-assisted selection of high-fruiting Leymus chinensis varieties to rapidly create new high-fruiting Leymus chinensis varieties and provide new genes and germplasm resources for improving high-fruiting seed production of Leymus chinensis.

[0009] This invention provides the following technical solution:

[0010] 1. A method for obtaining new varieties of Leymus chinensis, characterized in that Leymus chinensis carrying the molecular marker LcDUF247II-S3 is used as the parent, and the offspring are screened by the molecular marker LcDUF247II-S3, wherein the nucleotide sequence of the molecular marker LcDUF247II-S3 is shown in SEQ ID NO.1;

[0011] Preferably, the nucleotide sequence of the molecular marker LcDUF247II-S3 is a sequence with more than 76% homology to the sequence shown in SEQ ID NO.1; more preferably, it is a sequence with more than 76%, more than 80%, more than 85%, more than 90%, more than 95%, or more than 100% homology to the sequence shown in SEQ ID NO.1.

[0012] Preferably, the Lc65 strain carrying the LcDUF247II-S3 molecular marker is selected as the donor parent (father), and a variety that is widely used in production but does not carry the LcDUF247II-S3 molecular marker is selected as the recipient parent (mother). Conventional sexual hybridization is carried out to obtain the F1 generation.

[0013] 2. The method described in Project 1, characterized in that it further includes the processes of hybridization, self-crossing and / or backcrossing, and in the obtained offspring, screening out the lines carrying the molecular marker LcDUF247II-S3, the nucleotide sequence of the molecular marker LcDUF247II-S3 being shown in SEQ ID NO.1;

[0014] Preferably, the nucleotide sequence of the molecular marker LcDUF247II-S3 is a sequence with more than 76% homology to the sequence shown in SEQ ID NO.1; more preferably, it is a sequence with more than 76%, more than 80%, more than 85%, more than 90%, more than 95%, or more than 100% homology to the sequence shown in SEQ ID NO.1.

[0015] Preferably, the offspring F1 are obtained through hybridization and then backcrossed with the maternal parent.

[0016] 3. The method described in Project 1 or 2, characterized in that it further includes a step of PCR amplification using a primer pair of the molecular marker LcDUF247II-S3, wherein the nucleotide sequence of the primer pair of the molecular marker LcDUF247II-S3 is:

[0017] Forward primer: ATGAGTCAAGTTGAAGACATTATGTC (SEQ ID NO.8);

[0018] Reverse primer: TTACTTGGGATTAACATAAGACTCAAC (SEQ ID NO.9).

[0019] 4. A method for improving the self-pollination and seed setting rate of Leymus chinensis, characterized in that it includes the step of deleting positions 450 to 669 from the 5' end of the LcDUF247II gene, wherein the nucleotide sequence of the LcDUF247II gene is shown in SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.7.

[0020] 5. The method described in Project 4, wherein the improvement in the self-pollination rate of Leymus chinensis is relative to wild-type or control Leymus chinensis;

[0021] Preferably, the wild-type or control Leymus chinensis is collected from, but not limited to, Zhaodong City, Zhaoyuan County, Lanxi County, Dumeng County and Anda City in Heilongjiang Province.

[0022] 6. A gene or molecular marker for self-pollination and fruit setting in Leymus chinensis, characterized in that its nucleotide sequence is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4;

[0023] Preferably, the nucleotide sequence of the molecular marker is a sequence having more than 76% homology with the sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4; more preferably, it is a sequence having more than 76%, more than 80%, more than 85%, more than 90%, more than 95%, or more than 100% homology with the sequence shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0024] 7. A gene or molecular marker for the self-pollination and fruit setting of Leymus chinensis, characterized in that its nucleotide sequence is shown in SEQ ID NO.1.

[0025] Preferably, the nucleotide sequence of the molecular marker is a sequence having more than 76% homology with the sequence shown in SEQ ID NO.1; more preferably, it is a sequence having more than 76%, more than 80%, more than 85%, more than 90%, more than 95%, or more than 100% homology with the sequence shown in SEQ ID NO.1.

[0026] 8. Detect primer pairs for the gene or molecular markers defined in item 6 or 7.

[0027] 9. The primer pair described in Project 8, characterized in that the primer pair is:

[0028] Forward primer: ATGAGTCAAGTTGAAGACATTATGTC (SEQ ID NO.8);

[0029] Reverse primer: TTACTTGGGATTAACATAAGACTCAAC (SEQ ID NO.9).

[0030] 10. The application of a gene or molecular marker for self-pollination and / or its primer pair of Leymus chinensis in marker-assisted breeding of Leymus chinensis, characterized in that the nucleotide sequence of the gene or molecular marker for self-pollination and fruit setting of Leymus chinensis is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4; and the primer pair is:

[0031] Forward primer: ATGAGTCAAGTTGAAGACATTATGTC (SEQ ID NO.8);

[0032] Reverse primer: TTACTTGGGATTAACATAAGACTCAAC (SEQ ID NO.9).

[0033] Based on the molecular marker LcDUF247II-S3 provided by this invention, the self-incompatibility barrier of Leymus chinensis can be effectively overcome, providing a new technical means for high-fruiting breeding of Leymus chinensis through self-pollination, rapidly creating new high-fruiting Leymus chinensis varieties, and providing new genetic and germplasm resources for the development of Leymus chinensis industry in my country. Attached Figure Description

[0034] Figure 1 The images show the phenotypic diagrams of the self-pollinated high-fruiting Lc65 strain and the wild-type Lc6 strain of Leymus chinensis germplasm resources.

[0035] Figure 2Image A shows the amino acid sequence alignment of the LcDUF247II gene at the S site in the self-pollinating high-fruiting Lc65 and self-pollinating non-fruiting Lc6 lines of Leymus chinensis. The red box indicates the deleted fragment region. LcDUF247II-S1 and LcDUF247II-S2 are the amino acid sequences encoded by the S site gene in the Lc6 line, while LcDUF247II-S3 and LcDUF247II-S4 are the amino acid sequences encoded by the S site gene in the Lc65 line. Image B shows the first-generation sequencing image of the LcDUF247II-S3 sequence after PCR amplification.

[0036] Figure 3 These are electrophoresis images and phenotypic identification images of the LcDUF247II-S3 marker used to identify whether the LcDUF247II-S gene exists in the variety.

[0037] Figure 4 This is a PCR detection image of the S locus genotype of the first generation (F1) and second generation (F2) of Lc65 self-crosses.

[0038] Figure 5 This is a PCR detection image of the S locus genotype of the F1 generation of the cross between Lc65 and L6. Detailed Implementation

[0039] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0040] Example 1: Screening for high-fruiting self-pollinating lines of Leymus chinensis

[0041] The Leymus chinensis germplasm resources used were collected from Zhaodong City, Zhaoyuan County, Lanxi County, Dumeng County, and Anda City in Heilongjiang Province. High-producing self-pollination lines were selected through bagging and self-pollination. Nylon mesh bags (45×15 cm) were preferred for self-pollination. To isolate the selected spikelets from other pollen, the mesh size of the nylon mesh bags should be at least 600 mesh. Generally, healthy plants were selected for bagging and self-pollination before flowering. The specific self-pollination procedure is as follows:

[0042] 1. Select 5-10 single spikelets from each Leymus chinensis germplasm resource, using the following selection criteria:

[0043] 1) The spike-like inflorescence has fully emerged from the flag leaf, and the florets on the spike are well-developed and completely unopened (the outermost floret on the middle and lower spikelets is peeled open, and the anthers are not fully mature).

[0044] 2) Select ears of grain that are as similar in height as possible;

[0045] 3) To prevent the stems from becoming brittle and bending due to a decrease in water content later on, which would affect fruit setting, spikelets from tillers that are close together should be selected.

[0046] 2. Insert an iron rod near the selected spikelet and secure the middle of the stem to the rod. Be careful to avoid bending the stem at this point.

[0047] 3. Cover the tassel and iron rod with a nylon net bag. The top of the iron rod should be slightly higher than the top of the tassel. Support the net bag, tighten the lower drawstring, and then wrap it with tape for secondary fixation.

[0048] 4. Label the self-pollinated plant serial number, self-pollination symbol, and operation date.

[0049] After Leymus chinensis reached full maturity, seed testing was conducted, and the number of self-pollinated seeds was counted to calculate the seed setting rate. Following the above procedures, single-spike self-pollination was performed on Leymus chinensis germplasm resources. It was found that only the Lc65 line could produce seeds per spike, with a seed setting rate of 64.2 ± 0.18%. The control Lc6 did not produce seeds (seed setting rate 0%). Figure 1 The seed setting rate of other lines (Lc60, Lc80, Lc89, Lc90, Lc93, Lc109, Lc112, Lc117, Lc101, Lc108, Lc113, Lc116, Lc120) was 0 (Table 2). Thus, the Lc65 line of Leymus chinensis with high self-pollination seed setting was obtained.

[0050] Example 2: Identification of molecular markers in the self-pollinating high-fruiting Lc65 line

[0051] Leaves of the Lc65 strain of Leymus chinensis were used for third-generation genome sequencing (PacBio HiFi sequencing). The sequencing data were assembled at the contig level using Hifiasm software (https: / / github.com / chhylp123 / hifiasm) based on sequence overlap. The contigs were then mounted onto chromosomes using RagTag software (https: / / github.com / malonge / RagTag) based on their collinearity with the self-incompatible Lc6 strain of Leymus chinensis. The S and Z loci sequences of self-incompatible perennial ryegrass (Lolium perenne) and long-stamened wild rice (Oryza longistaminata) were used as reference sequences, and BLAST homology comparisons were performed with the Lc6 and Lc65 strains of Leymus chinensis (e-value < 1×10⁻⁶). -80 The results showed that self-incompatible S sites exist on chromosomes 1Xm and 2Xm of Lc65.

[0052] The pollen gene LcDUF247II and the style gene LcHPS10 at the S locus were identified. Pollen and style samples from Lc6 were collected for full-length transcriptome sequencing. After aligning the raw sequencing reads to the genome, the alignment results were visualized using Apollo software (www.github.com / GMOD / Apollo), and gene structure annotations were manually corrected based on the transcripts. The full-length transcriptome provides not only accurate gene structure but also expression levels. Quantification of the DUF247 and HPS10 genes on the Xm genome revealed that DUF247 is expressed specifically in pollen, and HPS10 is expressed specifically in style. The tissue-specific expression characteristics of these two genes are consistent with those of the DUF247 and HPS10 genes in perennial ryegrass, supporting the identification of DUF247 and HPS10 genes in Lc6 Leymus chinensis as key genes for self-incompatibility.

[0053] By comparing the LcDUF247II-S1 / S2 sequence with that of the Lc6 strain of Leymus chinensis, a small deletion was found in LcDUF247II-S3 (as shown in SEQ ID NO.1) of the Lc65 strain of Leymus chinensis. The deletion is located in the second hypervariable region HV2 of LcDUF247II-S3, specifically from position 450 to 669 at the 5' end. After PCR amplification, Sanger sequencing (Beijing Liuhe BGI Genomics Co., Ltd.) showed clear sequencing peaks on both sides of the deletion, indicating that this mutation truly exists. Figure 3 As shown. Incompatibility occurs only when the pollen S allele type corresponds to the stigma S allele type. The deletion from position 450 to 669 at the 5' end of LcDUF247II-S3 results in a 50% mismatch between the pollen gene LcDUF247II-S3 and the stigma S allele type, thus causing it to exhibit self-fertility. Therefore, LcDUF247II-S3 is a molecular marker for high self-fertility in the Lc65 line. Similarly, the same phenomenon exists in LcDUF247II-S1 (SEQ ID NO.5), LcDUF247II-S2 (SEQ ID NO.6), and LcDUF247II-S4 (SEQ ID NO.7). Mutations (deletion or premature termination) in these genes also lead to a 50% mismatch with the stigma S allele type, causing them to exhibit self-fertility. The LcDUF247II-S1, LcDUF247II-S2, and LcDUF247II-S4 genes deleted from positions 450 to 669 are shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, respectively. Similarly, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4 can also serve as molecular markers for high self-pollination and fruit setting in Leymus chinensis.

[0054] Example 3 DNA extraction and PCR detection of the LcDUF247II-S3 gene

[0055] 1. Large-scale extraction of leaf DNA was performed using the CTAB method, the specific method of which is as follows:

[0056] (1) Take fresh leaves of Leymus chinensis and put them into a 2 mL centrifuge tube. Then add two small steel balls with a diameter of 4 mm and 500 μL of CTAB (as shown in Table 1). Invert the tube to mix thoroughly. Use a high-throughput tissue homogenizer (model: MM400, Retsch) to oscillate and then place the tube in a water bath at 65°C for 1 hour. Invert the sample gently every 10-15 minutes during this time.

[0057] Table 1. Genomic DNA Extraction Buffer (CTAB) Formulation

[0058]

[0059] (2) After the liquid from the previous step has cooled to room temperature, add 500 μL of a mixture of chloroform and isoamyl alcohol (volume ratio of 24:1), gently invert and mix, and centrifuge at 12000 rpm for 10 minutes.

[0060] (3) Transfer 400 μL of supernatant to a new 1.5 mL centrifuge tube and add an equal volume of isopropanol. Mix by inverting and place in a -20 °C refrigerator for 1 hour to precipitate.

[0061] (4) Centrifuge at 13000 rpm for 10 minutes, discard the supernatant and keep the bottom precipitate.

[0062] (5) Add 1 mL of 70% ethanol to clean the tube wall and precipitate, discard the supernatant, and repeat the operation twice.

[0063] (6) Dry at room temperature to allow the ethanol to evaporate completely.

[0064] (7) Add 100 μL of sterile deionized water to dissolve the DNA and store at -20℃ for later use.

[0065] 2. PCR amplification:

[0066] PCR amplification reactions were performed on a GT9612 PCR amplification instrument (BIO-GENER).

[0067] (1) The reaction system is as follows:

[0068] The following ingredients were prepared: 10 μL of 2×Phanta Master Mix (Novizan), 1 μL of 100 μg / mL template DNA, 8 μL of ddH2O, and 10 μM primers (0.5 μL each of forward and reverse primers).

[0069] The forward primer is: ATGAGTCAAGTTGAAGACATTATGTC (SEQ ID NO.8);

[0070] The reverse primer is: TTACTTGGGATTAACATAAGACTCAAC (SEQ ID NO.9).

[0071] (2) The PCR reaction procedure is as follows: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 58℃ annealing for 15 seconds, 72℃ extension for 75 seconds, 36 cycles, 72℃ extension for 5 minutes, and storage at 4℃.

[0072] 3. PCR product detection: Take 5 μL of PCR product, electrophoresis in a 1.5% agarose gel, stain with EB, and record the experimental results using a gel imaging system.

[0073] Electrophoresis images of the PCR products of the LcDUF247II-S3 gene were obtained from multiple Leymus chinensis lines. Figure 3 As shown, the LcDUF247II-S3 gene was confirmed to be present in Lc65, while other lines (Lc6, Lc60, Lc80, Lc89, Lc90, Lc93, Lc109, Lc112, Lc117, Lc101, Lc108, Lc113, Lc116, Lc120) did not contain the LcDUF247II-S3 gene. Combined with the seed set rate data from Example 1, the self-pollination seed set rate of lines containing the LcDUF247II-S3 gene was greater than 0, indicating they could self-pollinate and produce seeds; the self-pollination seed set rate of lines without the LcDUF247II-S3 gene was 0, as shown in Table 2. The presence of the LcDUF247II-S3 gene was completely positively correlated with self-pollination seed set (r=1, p<0.001).

[0074] Table 2

[0075]

[0076] Example 4: Progeny validation of the LcDUF247II-S3 gene

[0077] The Lc65 line carrying the LcDUF247II-S3 gene was self-pollinated, and the resulting seeds were planted under suitable conditions. Fresh leaves were taken, and DNA was extracted and PCR was performed to detect the S locus genotype using the method described in Example 3. All F1 generations carried the LcDUF247II-S3 gene. Figure 4 ). The first generation of sons ( Figure 4 Seed No. 3 was planted under suitable conditions and tested using the method described in Example 3. All F2 generations carried the LcDUF247II-S3 gene ( Figure 4 Therefore, the LcDUF247II-S3 gene can be stably inherited by offspring.

[0078] Sequence alignment ( Figure 2 Compared to the self-infertile L6 line (control), the Lc65 line showed a variation in the S locus genotype involving a small deletion in LcDUF247II-S3 (e.g., Figure 2 As shown, positions 450 to 669). Plants with this missing segment can self-pollinate and produce seeds, indicating that in the L65 line, the variation that breaks self-incompatibility only occurs in the S3 haplotype.

[0079] Example 5: Breeding a new high-yielding self-pollinating line of Leymus chinensis using the molecular marker LcDUF247II-S3.

[0080] The method for breeding high-fruiting self-pollinating lines of Leymus chinensis using the molecular marker LcDUF247II-S3 may include the following steps:

[0081] (1) Hybridization

[0082] In the hybridization, the Lc65 line carrying the LcDUF247II-S3 molecular marker was selected as the donor parent (father), and the Lc6 line without the LcDUF247II-S3 molecular marker was selected as the recipient parent (mother). Conventional sexual hybridization was carried out to obtain the F1 generation.

[0083] (2) PCR identification

[0084] DNA was extracted using the method described in Example 3, and the number of F1 generation plants carrying the LcDUF247II-S3 gene was detected by PCR. Figure 5 ).

[0085] (3) Cultivation of self-pollinating high-fruiting varieties

[0086] Multiple single plants carrying the LcDUF247II-S3 gene were selected, and single-ear bagging was performed using the method described in Example 1 to breed new stable Leymus chinensis lines with a self-pollination seed setting rate of 60% or higher and a genetic background closer to the maternal parent.

[0087] Preferably, the method for using the molecular marker LcDUF247II-S3 to assist in the breeding of high-fruiting self-pollinating new lines of Leymus chinensis may further include the following steps:

[0088] a. Continuous backcrossing

[0089] The F1 plants were backcrossed continuously with the parent Lc6.

[0090] b. Cultivation of self-pollinated high-fruiting varieties

[0091] Six single plants carrying the LcDUF247II-S3 gene were selected. Figure 5 Single-ear bagging was performed on varieties 1, 2, 3, 11, 13, and 14 in Example 1 to breed new stable Leymus chinensis strains with a self-pollination seed setting rate of 60% or higher and a genetic background closer to the maternal parent.

[0092] The molecular marker LcDUF247II-S3 provided by this invention can effectively overcome the self-incompatibility barrier of Leymus chinensis, providing a new technical means for high-fruiting breeding of Leymus chinensis through self-pollination, and contributing to the development and utilization of superior Leymus chinensis germplasm resources.

[0093] References

[0094] 1. Manzanares C, Barth S, Thorogood D, Byrne SL, Yates S, Czaban A,Asp T, Yang B, Studer B (2016) A gene encoding a DUF247 domain protein cosegregates with the S self-incompatibility locus in perennial ryegrass. MolBiol Evol 33: 870-884.

[0095] 2. Wang Y, Zhao H, Zhu S, et al. Control of gametophytic self-incompatibility in the African wild rice. Research Square, 2023, doi:10.21203 / rs.3.rs-2121145 / v1.

[0096] 3. Rohner M, Manzanares C, Yates S, Thorogood D, Copetti D, Lübberstedt T, Asp T, Studer B (2023) Fine-mapping and comparative genomic analysis reveal the gene composition at the S and Z self-incompatibility lociin grasses. Mol Biol Evol 40: msar259.

[0097] 4. Yang B, Thorogood D, Armstead I, Barth S (2008) How far are we from unravelling self-incompatibility in grasses? New Phytol 178: 740-753.

[0098] Sequence Listing

[0099] SEQ ID NO:1 LcDUF247II-S3 gene

[0100]

[0101] SEQ ID NO:2 LcDUF247II-S1 gene deleted from positions 450 to 669

[0102]

[0103] SEQ ID NO:3 LcDUF247II-S2 gene deleted from positions 450 to 669

[0104]

[0105] SEQ ID NO:4 LcDUF247II-S4 gene deleted from positions 450 to 669

[0106]

[0107] SEQ ID NO:5 LcDUF247II-S1 gene

[0108]

[0109] SEQ ID NO:6 LcDUF247II-S2 gene

[0110]

[0111] SEQ ID NO:7 LcDUF247II-S4 gene

[0112]

[0113] Forward primer of molecular marker LcDUF247II-S3 (SEQ ID NO:8)

[0114] ATGAGTCAAGTTGAAGACATTATGTC

[0115] Reverse primer for SEQ ID NO:9 molecular marker LcDUF247II-S3

[0116] TTACTTGGGATTAACATAAGACTCAAC

[0117] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A method for obtaining new varieties of sheepgrass, characterized in that, Using Leymus chinensis carrying the molecular marker LcDUF247II-S3 as the parent, the offspring were screened by the molecular marker LcDUF247II-S3, the nucleotide sequence of which is shown in SEQ ID NO.

1.

2. The method according to claim 1, characterized in that, It also includes the processes of hybridization, self-crossing and / or backcrossing, and in the obtained offspring, screening out the lines carrying the molecular marker LcDUF247II-S3, the nucleotide sequence of which is shown in SEQ ID NO.

1.

3. The method according to claim 1 or 2, characterized in that, It also includes a step of PCR amplification using primer pairs with the molecular marker LcDUF247II-S3, wherein the nucleotide sequence of the primer pairs with the molecular marker LcDUF247II-S3 is: Forward primer: ATGAGTCAAGTTGAAGACATTATGTC as shown in SEQ ID NO.8; Reverse primer: TTACTTGGGATTAACATAAGACTCAAC as shown in SEQ ID NO.

9.

4. Genes or molecular markers for self-pollination and fruit setting in Leymus chinensis, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

5. The application of genes or molecular markers for self-pollination and / or their primer pairs in marker-assisted breeding of Leymus chinensis, characterized in that, The nucleotide sequence of the gene or molecular marker for the self-pollination and fruit setting of *Leymus chinensis* is shown in SEQ ID NO. 1; the primer pair is: Forward primer: ATGAGTCAAGTTGAAGACATTATGTC as shown in SEQ ID NO.8; Reverse primer: TTACTTGGGATTAACATAAGACTCAAC as shown in SEQ ID NO.9.

Images