A SNP molecular marker related to cotton oil content and application thereof
By applying the SNP molecular marker D01_20813280 in cotton breeding, the problem of efficiently screening high-oil-content varieties was solved, achieving an efficient and accurate breeding process while reducing costs and time requirements.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-13
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies make it difficult to efficiently screen for high oil content varieties in cotton breeding. Due to time and environmental factors, breeding costs are high and efficiency is low.
We developed the SNP molecular marker D01_20813280, which is associated with the oil content of cotton and is located on chromosome D1 of the cotton genome, for direct detection of seed and leaf DNA. We then used the marker to detect cotton plants with the AA genotype for breeding.
It significantly improved the breeding efficiency of high-oil cotton varieties, reduced the workload of field trials and phenotypic identification, lowered breeding costs, and improved the accuracy and efficiency of breeding.
Smart Images

Figure CN121272096B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of cotton biotechnology, and in particular to a SNP molecular marker related to the oil content of cotton and its application. Background Technology
[0002] Cotton is the world's most important natural fiber crop and a vital economic crop in my country, significantly impacting national economic development and farmers' income. Fiber accounts for 13.3% of cotton's total biomass, cottonseed for 20%, and cotton stalks for 66.7%. Cottonseed oil is rich in unsaturated fatty acids such as linoleic acid and linolenic acid, which help lower cholesterol levels. Cottonseed meal and cotton stalks are rich in crude protein and minerals such as calcium and iron, with nutritional components superior to wheat, rice, and corn stalks, making them excellent feed sources. Therefore, fully exploring and utilizing the added value of cottonseed and cotton stalks will not only significantly increase cotton production value but also alleviate the pressure of my country's ever-increasing demand for high-quality edible oil and feed. With the adjustment of the planting structure, the cultivation of high-oil and other specialized cotton varieties has become an important task to meet the needs of diversified industrial development.
[0003] Statistics show that my country's annual cotton planting area is approximately 45 million mu (about 3 million hectares), producing over 8 million tons of cottonseed and 2 million tons of cottonseed oil annually, providing abundant vegetable oil resources. Research has found that cotton kernels can have an oil content exceeding 40%, while the oil content of mainstream cotton varieties is typically below 30%, indicating significant room for improvement. High-oil-content varieties are relatively rare. Furthermore, cottonseed oil is rich in oleic acid, linoleic acid, and palmitic acid, with oleic acid and linoleic acid content approaching 80%, and linoleic acid content reaching as high as 50%, exhibiting significant health benefits. Developing high-oil-content cotton varieties to increase cottonseed oil yield and utilization will significantly alleviate the pressure of insufficient self-sufficiency in high-quality edible oil in my country, yielding substantial social benefits.
[0004] In the study of the molecular mechanisms of cottonseed oil content, genes such as Gh13LPAAT5, GhPEPC2, GhACCase, GhWRI1a, GhGAPT, and GhCIPK are involved in cottonseed oil synthesis, while GhPRXR is involved in cottonseed oil accumulation. Regarding variety breeding, there are currently no dedicated regional experimental groups for high-oil-content varieties in China. Our team, through hybridization, created 22 progeny materials with oil content exceeding 30% and good overall traits, providing a material basis for high-oil-content cotton breeding.
[0005] The development of molecular markers is beneficial for genetic selection of traits at the chromosome level, especially single nucleotide polymorphism (SNP) markers, which are numerous and highly polymorphic. In recent years, with the continuous advancement of sequencing technology, the detection cost, reliability, and timeliness of SNPs have been developing in a way that is conducive to research, making it possible for breeding technology to break gene linkage and simultaneously improve multiple traits. Summary of the Invention
[0006] The purpose of this invention is to provide a SNP molecular marker related to the oil content of cotton and its application, thereby addressing the problems existing in the prior art. The method provided by this invention directly detects seed and leaf DNA, is not limited by time or environmental factors, reduces the amount of planting material in the field, saves time and investment in oil content screening and identification, and lowers the breeding cost of high-oil cotton.
[0007] To achieve the above objectives, the present invention provides the following solution:
[0008] One of the technical solutions of the present invention is an SNP molecular marker related to the oil content of cotton. The SNP molecular marker is located on chromosome D1 of the cotton genome. The SNP molecular marker is D01_20813280, located at position 51 of the nucleotide sequence shown in SEQ ID NO.1, and has a base polymorphism site A / G.
[0009] The second technical solution of the present invention is the application of the SNP molecular marker in the breeding of cotton with high oil content, wherein the cotton includes Jifeng 914, Shizao 1, or offspring bred from the two as parents.
[0010] The third technical solution of this invention is a method for breeding cotton varieties with high oil content, which involves extracting genomic DNA from the cotton to be tested, detecting the genotype of the SNP molecular marker, and selecting cotton plants with the genotype AA for breeding.
[0011] The fourth technical solution of the present invention is a method for identifying the oil content of cotton using the SNP molecular marker. The method involves extracting genomic DNA from the cotton to be tested, detecting the genotype of the SNP molecular marker, and finding that the oil content of cotton with the genotype AA is significantly higher than that of individuals with the genotype GG.
[0012] Based on the above technical solution, the present invention has the following technical effects:
[0013] This invention discloses a SNP molecular marker associated with cotton oil content, and experiments have confirmed that the SNP molecular marker D01_20813280 exhibits significant application effects in screening for high oil content traits in cotton. In the F2 segregating population, significant differences in oil content were observed among different genotypes (AA, AG, GG) of this marker. The average oil content of the AA genotype population reached 28.84%, significantly higher than the 26.90% of the GG genotype population, a difference of 1.94 percentage points. Further validation in 265 lines showed that the oil content of the AA genotype population remained significantly better than that of the GG population, with stable and reliable results. This marker can be directly used for marker-assisted selection, significantly improving the breeding efficiency of high-oil cotton varieties, reducing the workload of field trials and phenotypic identification, and lowering breeding costs, demonstrating good application prospects and promotional value. Attached Figure Description
[0014] Figure 1 The difference in oil content among different genotypes of the D01_20813280 strain. Detailed Implementation
[0015] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.
[0016] This invention provides an SNP molecular marker related to the oil content of cotton. The SNP molecular marker is located on chromosome D1 of the cotton genome. The SNP molecular marker is D01_20813280, located at position 51 of the nucleotide sequence shown in SEQ ID NO.1, and has a base polymorphism site A / G.
[0017] This invention also provides the application of the SNP molecular marker in the breeding of high oil content cotton lines, wherein the cotton includes Jifeng 914, Shizao 1, or offspring bred from the two as parents.
[0018] This invention also provides a method for breeding high oil content cotton lines, which involves extracting genomic DNA from the cotton to be tested, detecting the genotype of the SNP molecular marker, and selecting cotton plants with the genotype AA for breeding.
[0019] In some specific implementations, the cotton includes Jifeng 914, Shizao 1, or offspring bred from either of these as parents.
[0020] This invention also provides a method for identifying the oil content of cotton using the SNP molecular marker. Genomic DNA of the cotton to be tested is extracted, and the genotype of the SNP molecular marker is detected. The oil content of cotton with genotype AA is significantly higher than that of individuals with genotype GG.
[0021] In some specific implementations, the cotton includes Jifeng 914, Shizao 1, or offspring bred from either of these as parents.
[0022] Example 1
[0023] The discovery of SNPs
[0024] 1. A cotton F2 segregating population (experimental population) was constructed using Jifeng 914 as the female parent and Shizao 1 as the male parent, with 465 individual plants. The oil content of the parents and 465 F3 seeds (seeds harvested from F2 individual plants) was investigated using nuclear magnetic resonance.
[0025] 2. Extract DNA from 200 cotton seedlings and analyze it using the CTAB method (Paterson AH, Brubaker CL, Wendel J F. A rapid method for extraction of cotton (Gossypiums pp.) genomie DNA suitable for RFLP and PCR analysis. Plant MOl Rep, 1993, 11: 122-127).
[0026] 3. Development of SNP tags using GBTS. Following the method of Xu et al. (Xu Y, Yang QN, Zheng HJ, et al. Genotyping by target sequencing (GBTS) and its applications [J]. Sci AgricSin, 2020, 53: 2983-3004.), SNP detection was performed on DNA.
[0027] 4. Construct a high-density genetic map. Select SNPs with polymorphism among parents and in the population, and construct a genetic map using MSTMap (the minimum spanning tree map, version update 2015) software, with LOD values ranging from 4.0 to 20.0.
[0028] 5. QTL localization. Combining genetic maps and seed oil content data, QTLs were located using the ICIM program of QTLIciMapping 4.0 software with parameters Step=1cM, PIN=0.001, and LOD values determined by 1000 iterations.
[0029] 6. Identification of key SNPs. Based on QTL mapping results, loci with high LOD values and good contribution rates were selected. The genotypes of SNPs within these loci in the parents and population were determined, and significant differences between different genotypes were analyzed in conjunction with seed oil content data.
[0030] 7. A high-density genetic map containing 7635 SNPs was constructed. An oil content QTL qOC-D1-1 was located at position 91.2-91.9 cM on chromosome D1. This QTL contributed 16.81% to the phenotypic variation, and the enhancing gene was derived from the maternal parent Jifeng 914 (Table 1).
[0031] Table 1. Information related to the located oil content QTL
[0032]
[0033] 8. One SNP marker, D01_20813280, was found in the located QTL interval. It is located at position 51 of the nucleotide sequence shown in SEQ ID NO.1, and the base at this position is A or G. The genotype of the parent Jifeng 914 is AA, and the genotype of the parent Shizao 1 is GG.
[0034] SEQ ID NO. 1: AGTTAGAGTTGGGCCCCTTGTTACCGCTACTGGACTGCAGCCATGTGTCGG[A]CTATGGTAAACGCTATCAGGATGAGTGTTGGAGAAAGACTGGGGTGGGCT.
[0035] Table 2 Base types of SNP sites in parents
[0036]
[0037] 9. The genotype of the SNP marker in Jifeng 914 was designated AA, and the genotype in Shizao 1 was designated GG. Based on the parental genotypes of these two markers, the population was divided into three groups: the homozygous genotype AA group (genotype of SNP marker in Jifeng 914) and the GG group (genotype of SNP marker in Shizao 1), and the heterozygous genotype AG group. The phenotypic differences among the three groups were analyzed (Table 3). Figure 1 It can be seen that the oil content of group AA is significantly higher than that of group GG (by about 1.9%). This indicates that the SNP marker (D01_20813280) in the qOC-D1-1 interval is effective in identifying oil content.
[0038] Table 3. Differences in oil content among different genotypes
[0039]
[0040] Note: a, b, and c are significant at the 0.05 level.
[0041] Example 2
[0042] 1. Verification of SNPs:
[0043] DNA was extracted from the remaining 265 lines in the F3 population. SNP markers were developed using GBTS technology, and the SNP genotypes at the D01_20813280 locus were statistically analyzed. The plants were then grouped according to genotype, and the significant differences in oil content among different genotypes were analyzed. The results showed that among the remaining 265 individual plants, 68 lines were homozygous AA at the D01_20813280 locus, 63 were homozygous GG, 130 were heterozygous AG, and 4 had base deletions. Analysis of the oil content data for the three genotypes revealed that the oil content of the homozygous AA genotype population was significantly higher than that of the homozygous GG genotype population (Table 4), similar to the results in Table 3, demonstrating that D01_20813280 plays a significant role in identifying oil content.
[0044] Table 4. Significance analysis of the validation data of SNPs
[0045]
[0046] 2. The Value of SNPs. Improving oil content is a pressing goal in cotton breeding and production, and it represents a bottleneck technology in existing breeding methods. D01_20813280 can assist in identifying oil content levels, possessing significant application value and playing a crucial role in accelerating the breeding of new high-oil cotton varieties and improving the economic benefits of cotton.
[0047] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. The use of reagents for detecting SNP molecular markers in the breeding of high-oil content lines of cotton, characterized in that, The cotton varieties include Jifeng 914, Shizao 1, or offspring bred from these two varieties. The SNP molecular marker is located on chromosome D1 of the cotton genome. The SNP molecular marker is D01_20813280, located at position 51 of the nucleotide sequence shown in SEQ ID NO.1, and has a base polymorphism site A / G. Cotton with genotype AA has a significantly higher oil content than cotton with genotype GG.
2. A method for breeding a high oil cotton line, comprising the steps of, Genomic DNA was extracted from the cotton plants to be tested, the genotypes of SNP molecular markers were detected, and cotton plants with the genotype AA were selected for breeding. The SNP molecular marker is located on chromosome D1 of the cotton genome. The SNP molecular marker is D01_20813280, located at position 51 of the nucleotide sequence shown in SEQ ID NO.1, and has a base polymorphism site A / G. The cotton varieties include Jifeng 914, Shizao 1, or offspring bred from either of these two varieties.
3. A method of identifying cotton having oil content, characterized by, Genomic DNA was extracted from the cotton samples and the genotypes of SNP molecular markers were detected. The oil content of cotton with genotype AA was significantly higher than that of individuals with genotype GG. The SNP molecular marker is located on chromosome D1 of the cotton genome. The SNP molecular marker is D01_20813280, located at position 51 of the nucleotide sequence shown in SEQ ID NO.1, and has a base polymorphism site A / G. The cotton varieties include Jifeng 914, Shizao 1, or offspring bred from either of these two varieties.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker associated with cotton seed oil content of upland cotton and application of SNP molecular marker
CN117512182A