Method for inhibiting colorectal cancer progression by naringenin through targeting Gankyrin / PI3K / AKT / GSK-3beta / beta-catenin signaling pathway

Abstract

The invention belongs to the technical field of medicines, and discloses naringenin for inhibiting colorectal cancer progression through a targeted Gankyrin / PI3K / AKT / GSK-3beta / beta-catenin signal channel. The invention discloses an application of naringenin in preparation of a medicine for preventing or treating colorectal cancer. The treatment potential of NAR and related molecular pathways thereof in colorectal cancer CRC is evaluated through a bioinformatics method. Subsequently, the anti-CRC characteristic and the molecular mechanism of the NAR are verified in in-vivo and in-vitro experiments by adopting a gene interference technology and a molecular biology means. Research results show that the NAR inhibits CRC cell proliferation, migration and invasion ability and promotes cell apoptosis by regulating and controlling a Gankyrin / PI3K / AKT / GSK-3beta / beta-catenin signal channel, and the NAR has great potential as a medicine for treating colorectal cancer.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to naringenin inhibiting the progression of colorectal cancer by targeting the Gankyrin / PI3K / AKT / GSK-3β / β-catenin signaling pathway. Background Technology

[0002] Colorectal cancer (CRC) is the third most common malignancy and the second leading cause of cancer-related death worldwide, and has received increasing attention in recent years. Despite progress in early detection and prevention strategies, CRC remains a significant public health challenge. Notably, while the overall incidence of CRC has declined in older adults, a worrying increase has occurred in people under 50 years of age, with an average annual growth rate of 1.5% in the United States from 2014 to 2018, indicating a growing trend towards early-onset CRC. For patients diagnosed at an early stage, surgical resection can be curative; however, most cases are diagnosed at an advanced stage, characterized by lymph node involvement (stage III) or distant metastasis (stage IV). In these cases, treatment typically involves adjuvant or palliative chemotherapy and radiation therapy, particularly for locally advanced rectal cancer, aimed at improving survival. Nevertheless, chemotherapy is often hampered by significant challenges, including drug resistance, systemic toxicity, and adverse side effects, all of which reduce treatment effectiveness and decrease patients' quality of life. These limitations underscore the urgent need to develop innovative treatment strategies that enhance efficacy and reduce toxicity.

[0003] In recent years, natural products and phytochemicals from Traditional Chinese Medicine (TCM) have emerged as alternatives to or complements to traditional chemotherapy, offering potential advantages such as multi-target activity and reduced side effects. Among the many TCM plants, aged Citrus reticulata “Chachi” (known as Guangchenpi in China) has attracted attention due to its broad range of pharmacological properties. Many of the bioactivities of Guangchenpi are attributed primarily to its rich composition of bioactive flavonoids, alkaloids, essential oils, and polysaccharides. Specifically, flavonoids such as naringin, hesperidin, coumarin, tangeretin, and nobiletin have been identified as key contributors to the traditional bioactivities of aged Guangchenpi, including the treatment of functional dyspepsia and the enhancement of spleen function. Furthermore, flavonoid-rich extracts from Citrus reticulata peel have shown anti-inflammatory, antioxidant, anti-proliferative, anti-metastatic, and pro-apoptotic activities in various preclinical models. However, the multifaceted, multi-component, and multi-target nature of TCM formulations, coupled with the complexity of host biological systems, presents significant challenges in elucidating the precise molecular mechanisms of individual compounds.

[0004] Naringenin (NAR) is a well-known flavonoid compound found in citrus peel and has been identified as an important bioactive compound with a variety of pharmacological activities. The molecular formula of naringenin is C2. 15 H 12 O5, CAS NO: 480-41-1. It is known for its anti-inflammatory, anti-infective, neuroprotective, antioxidant, and significant anti-cancer activities.

[0005] Gankyrin, encoded by the PSMD10 gene, is a regulatory subunit of the 26S proteasome complex. It plays a crucial role in protein degradation, cell cycle progression, and apoptosis regulation. Studies have shown that overexpression of Gankyrin in various malignant tumors activates oncogene function, promoting cell proliferation, inhibiting apoptosis, and enhancing metastatic potential. However, in the context of colorectal cancer, the potential interaction between NAR and Gankyrin remains to be explored. Summary of the Invention

[0006] The first aspect of this invention aims to provide the use of naringenin in the preparation of medicaments for the prevention or treatment of colorectal cancer.

[0007] A second aspect of this invention aims to provide the use of naringenin in the in vitro inhibition of Gankyrin expression or in the preparation of Gankyrin inhibitors.

[0008] A third aspect of the present invention is to provide a drug.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0010] A first aspect of the present invention provides the use of naringenin in the preparation of medicaments for the prevention or treatment of colorectal cancer.

[0011] In some embodiments of the present invention, the naringenin achieves the purpose of preventing and / or treating colorectal cancer by inhibiting the proliferation, growth, invasion and / or migration of colorectal cancer cells.

[0012] In some embodiments of the present invention, the naringenin achieves the purpose of preventing and / or treating colorectal cancer by targeting and regulating the Gankyrin / PI3K / AKT / GSK-3β / β-catenin signaling pathway.

[0013] In some embodiments of the present invention, the naringenin achieves the purpose of preventing and / or treating colorectal cancer by promoting apoptosis of colorectal cancer cells.

[0014] In some embodiments of the present invention, the naringenin regulates the Gankyrin / PI3K / AKT / GSK-3β / β-catenin signaling pathway by downregulating the expression of Gankyrin and β-catenin, upregulating the expression of PTEN, and downregulating the phosphorylation levels of AKT^Ser473, AKT^Thr308, and GSK-3β^Ser9.

[0015] In some embodiments of the present invention, the effective dose of naringenin in the drug is 2-40 μM or 40-60 mg / kg; preferably 5-20 μM or 40-50 mg / kg.

[0016] A second aspect of the present invention provides the use of naringenin in the in vitro inhibition of Gankyrin expression or in the preparation of Gankyrin inhibitors.

[0017] In some embodiments of the present invention, the effective dose of naringenin to inhibit Gankyrin expression is 2–40 μM; preferably 5–20 μM.

[0018] A third aspect of the present invention provides a medicament in which the active ingredients comprise naringenin and a Gankyrin inhibitor.

[0019] In some embodiments of the present invention, the Gankyrin inhibitor includes siRNA, dsRNA, miRNA, ribozyme, or shRNA that target and downregulate Gankyrin expression.

[0020] In some embodiments of the present invention, the drug is used to inhibit the proliferation, growth, invasion and / or migration of colorectal cancer cells.

[0021] In some embodiments of the present invention, the drug is used to prevent or treat colorectal cancer.

[0022] In some embodiments of the present invention, the medicament further includes pharmaceutically acceptable excipients.

[0023] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one selected from fillers, disintegrants, diluents, dispersants, excipients, stabilizers, lubricants, binders, humectants, flavoring agents, solubilizers, suspending agents, solvents, sustained-release agents, emulsifiers, absorption enhancers, surfactants, preservatives, pigments, fragrances, and solvents.

[0024] In some embodiments of the present invention, the filler is selected from starch, sucrose, lactose, mannitol, sorbitol, xylitol, microcrystalline cellulose, or glucose, etc.; the binder is selected from cellulose derivatives, alginate, starch, water, dextrin, gelatin, or polyvinylpyrrolidone, etc.; the disintegrant is selected from microcrystalline cellulose, sodium carboxymethyl starch, croscarmellose, low-substituted hydroxypropyl cellulose, or croscarmellose sodium; the lubricant is selected from stearic acid, polyethylene glycol, calcium carbonate, sodium bicarbonate, microcrystalline silica, talc, or magnesium stearate; and the suspending agent is selected from microcrystalline silica, beeswax, cellulose, solid polyethylene glycol, etc. Alcohol: The wetting agent is selected from glycerin, Tween-80, hydrogenated castor oil, or lecithin; the solvent is selected from ethanol, liquid polyethylene glycol, isopropanol, Tween-80, glycerin, propylene glycol, or vegetable oil, wherein the vegetable oil is selected from soybean oil, castor oil, peanut oil, blended oil, etc.; the surfactant is selected from sodium dodecylbenzenesulfonate, stearic acid, polyoxyethylene-polyoxypropylene copolymer, fatty acid sorbitan, or polysorbate (Tween), etc.; the flavoring agent is selected from aspartame, sucralose, flavoring, stevia, acesulfame potassium, citric acid, or sodium saccharin; the preservative is selected from at least one of methylparaben or propylparaben.

[0025] In some preferred embodiments of the present invention, the dosage form of the drug includes a gastrointestinal dosage form or a non-gastrointestinal dosage form.

[0026] In some embodiments of the present invention, the gastrointestinal dosage form includes at least one of powder, tablet, granule, capsule, sustained-release, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drops, and chewable tablet.

[0027] In some embodiments of the present invention, the gastrointestinal dosage forms include, but are not limited to, enteric-coated tablets, coated tablets, film-coated tablets, sugar-coated tablets, dispersible tablets, sucking tablets, chewable tablets, effervescent tablets, scratch tablets, sustained-release and controlled-release dosage forms, sustained-release tablets, sustained-release coated tablets, controlled-release tablets, orally disintegrating tablets, lozenges, and oral patches.

[0028] In some embodiments of the present invention, the non-gastrointestinal drug delivery dosage form includes at least one of injection dosage form, respiratory dosage form, skin dosage form, mucosal dosage form, and cavity dosage form.

[0029] In some embodiments of the present invention, the injectable dosage forms include, but are not limited to, injection solutions, solutions for injection, injection solutions for intravenous infusion, suspensions for injection, sterile powders for injection, intravenous injections, water injections, emulsions for injection, powder injections, injections, sterile powder injections, lyophilized powder injections, etc.

[0030] The beneficial effects of this invention are:

[0031] This invention first evaluated the therapeutic potential of NAR and its related molecular pathways in colorectal cancer (CRC) using bioinformatics methods. Subsequently, gene interference technology and molecular biology techniques were employed to verify the anti-CRC properties and molecular mechanisms of NAR in in vivo and in vitro experiments. The results showed that NAR inhibits CRC cell proliferation, migration, and invasion by regulating the Gankyrin / PI3K / AKT / GSK-3β / β-catenin signaling pathway, while simultaneously promoting apoptosis. These findings reveal a novel regulatory mechanism of NAR and highlight its significant potential as a therapeutic agent for colorectal cancer. Attached Figure Description

[0032] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0033] Figure 1 Network pharmacology and molecular docking analysis of NAR in colorectal cancer. A is a Venn diagram showing target overlap associated with NAR and CRC, identifying 95 shared targets. B is a compound-target-disease interaction network of NAR and CRC-related targets. C is a PPI network of 95 common targets derived from STRING. D identifies the top 21 genes exhibiting the highest centrality in the PPI network. E is cluster analysis highlighting key modules centered on AKT1. F is visualization of the PPI network in Cytoscape, where node size and color intensity correspond to degree values. G is GO enrichment analysis describing biological processes (BP), cellular components (CC), and molecular functions (MF) associated with NAR targets. H is KEGG pathway analysis showing significant enrichment in cancer-related pathways, with particular focus on the PI3K / AKT signaling pathway. I is molecular docking of NAR with AKT1, with a Vina score of -6.3. J is the GSEA analysis results of the PI3K / AKT pathway. K is the molecular structure of NAR.

[0034] Figure 2 NAR was used to inhibit the proliferation of CRC cells, induce apoptosis, and suppress their invasion and migration. A shows the cell viability of HT29 and HCT116 cells after treatment with 0, 5, 10, and 20 μM NAR using the CCK-8 assay. B shows the clonogenic potential of CRC cells assessed by a clonogenic assay, with quantitative results shown in a dendrogram. C shows the apoptosis of CRC cells analyzed by flow cytometry. D and E show the invasion (D) and migration (E) abilities of CRC cells, respectively, tested by transwell invasion and migration assays. * represents p < 0.005; *** represents p < 0.001.

[0035] Figure 3NAR inhibited the Gankyrin / PI3K / AKT / GSK-3β / β-catenin signaling pathway in a dose-dependent manner. Representative bands from Western blot and quantitative analysis show the protein expression of Gankyrin, p-AKT^Ser473, p-AKT^Thr308, p-GSK-3β^Ser9, β-catenin, and PTEN in CRC cells. ns indicates no statistical significance, ** represents p<0.01, and *** represents p<0.001.

[0036] Figure 4 The results of NAR treatment on CRC cells show that the antitumor effect depends on Gankyrin. HT29 and HCT116 cells with altered Gankyrin expression (knockdown or overexpression) were treated with NAR for 72 hours. A shows the cell viability assessed using the CCK-8 assay. B shows the clonal potential of cells assessed using a colony formation assay. C shows the apoptosis results analyzed by flow cytometry. D and E show the invasion (D) and migration (E) abilities of CRC cells assessed using Transwell assays. ns indicates not significant; ** indicates p < 0.01, *** indicates p < 0.001.

[0037] Figure 5 Gankyrin is involved in the regulation of the AKT / GSK-3β / β-catenin pathway in colorectal cancer cells. Western blot and quantitative analysis were used to investigate the expression of Gankyrin, p-AKT^Ser473, p-AKT^Thr308, p-GSK-3β^Ser9, β-catenin, and PTEN proteins in Gankyrin knockdown (sh-G) and overexpression (oe-G) colorectal cancer cells. ns indicates no statistical significance, ** represents p<0.01, *** represents p<0.001.

[0038] Figure 6 This demonstrates that NAR inhibits tumor growth in vivo without systemic toxicity. In this diagram, A shows representative images and quantitative results of tumor volume in a CRC xenograft model treated with naloxone or control. B shows representative H&E staining images of heart, liver, spleen, lung, and kidney tissues. *** indicates p < 0.001.

[0039] Figure 7 This is a schematic diagram illustrating the mechanism by which NAR inhibits CRC cell proliferation by suppressing the AKT / GSK-3β / β-catenin signaling pathway. NAR increases PTEN levels by downregulating Gankyrin, then blocks the phosphorylation of AKT and GSK-3β, leading to β-catenin degradation and inhibiting cell proliferation. Detailed Implementation

[0040] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0041] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0042] Ethical Statement: Informed consent was obtained from all patients. All procedures were approved by the Institutional Research Ethics Committee of Jiangmen Central Hospital (Approval No. JXY202349). All methods of this invention were performed in accordance with relevant guidelines and regulations (Declaration of Helsink). Laboratory animals were purchased from the Laboratory Animal Center of Wuyi University. The purchase, use, and ethical review of laboratory animals were approved by the Laboratory Animal Ethics Committee of Wuyi University (Approval No. CN2021024).

[0043] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0044] Example

[0045] Experimental methods

[0046] 1. Network pharmacology analysis

[0047] The chemical structure data of naringenin (NAR) was obtained from the PubChem database (https: / / pubchem.ncbi.nlm.nih.gov). Target information related to NAR was extracted from platforms including the Swiss Target Prediction System (http: / / www.swisstargetprediction.ch / ), the SEA platform (https: / / sea.bkslab.org / ), the STITCH tool (http: / / stitch.embl.de / ), the SuperPred prediction system (https: / / prediction.charite.de / ), and the TCMSP database (https: / / old.tcmsp-e.com / tcmsp.php), with duplicate results filtered out. Targets related to colorectal cancer were collected from the OMIM genetic database (https: / / www.omim.org / ), the GeneCards gene card library (https: / / www.genecards.org / ), and the DrugBank drug database (https: / / go.drugbank.com / ). These targets were cross-referenced using the Venny 2.1 tool (https: / / bioinfogp.cnb.csic.es / tools / venny / ) to identify common targets.

[0048] The protein-protein interaction (PPI) network was constructed using the STRING database (https: / / string-db.org / ), visualized using Cytoscape 3.9.1, and further hub gene identification and cluster analysis were performed. Enrichment analysis using Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) was conducted using the R language ClusterProfiler package (v4.2.1), with a significance threshold set at p<0.05. Pathway involvement was verified using Gene Set Enrichment Analysis (GSEA). Molecular docking between NAR and AKT1 was studied using AutoDock Vina, and visualization was achieved using PyMOL and LigPlot+.

[0049] 2. Reagents and cell lines

[0050] Naringenin (NAR, purity ≥98%) was purchased from McKinsey Biochemical Co., Ltd. (Shanghai, China) and dissolved in dimethyl sulfoxide (DMSO). Human colorectal cancer cell lines HT29 and HCT116 were purchased from ATCC and cultured in DMEM containing 10% fetal bovine serum and 1% penicillin / streptomycin at 37°C and 5% CO2.

[0051] 3. Cell viability and proliferation assays

[0052] Cell viability was assessed using the Cell Counting Kit-8 (CCK-8, Dojindo, Japan), following the instructions. A simplified procedure is as follows: HT29 and HCT116 cells were counted at 3 × 10⁶ cells per well. 3 The cells were seeded at a density of [number] cells / wells in 96-well plates, and treated with NAR solution at concentrations of 0, 5, 10, and 20 μM, respectively. After treatment, samples were taken at 0, 24, 48, and 72 hours, and 10 μL of CCK-8 solution was added to each well. The plates were then incubated at 37°C for 2 hours. Finally, the absorbance was measured at 450 nm using a microplate reader (BioTek, USA).

[0053] In the colony formation assay, cells were seeded at a density of 500 cells per well in 6-well plates and treated with NAR as described above. After 14 days of incubation, colonies were fixed with 4% paraformaldehyde (Biosharp, China) for 20 minutes, followed by staining with 0.5% crystal violet (Solarbio, China) for 15 minutes. Finally, colonies with more than 50 cells were manually counted under a microscope (Olympus, Japan).

[0054] 4. Apoptosis detection

[0055] Apoptosis was detected using the Annexin V-FITC / PI apoptosis assay kit (BD Biosciences, USA). HT29 and HCT116 cells were collected after NAR treatment for 48 hours and resuspended in 1× binding buffer. Cells were then incubated for 15 minutes at room temperature in the dark with Annexin V-FITC (5 μL) and propidium iodide (5 μL). Apoptosis rates were analyzed by flow cytometry (BDAccr C6 system), and data were processed using FlowJo software (v10.8, Tree Star, USA).

[0056] 5. Migration and Invasion Experiments

[0057] Transwell experiments were performed using 24-well Transwell chambers equipped with inserts with an 8-micron pore size (Corning, New York, USA). For migration assays, cells (5 × 10⁴) were suspended in 200 μL of serum-free medium and added to the upper chamber; 600 μL of medium containing 10% fetal bovine serum was added to the lower chamber as a chemotactic agent. For invasion assays, the inserts were pre-diluted with Matrigel (Corning, New York, USA) to serum-free medium at a 1:8 ratio and incubated at 37°C for 1 hour before cell seeding. After incubation at 37°C for 48 hours, non-migrated or non-invaded cells on the upper surface of the membrane were gently removed with a swab. Cells on the lower surface were fixed with 4% formaldehyde, stained with 0.5% crystal violet, imaged under a microscope, and quantified using ImageJ software.

[0058] 6. In vivo xenotransplantation model

[0059] All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Wuyi University and conducted in accordance with the institution's ethical standards. Female BALB / c nude mice, aged 6 weeks and weighing 16–18 grams, were purchased from Beijing Viton River Laboratory Animal Technology Co., Ltd. (China, License No. SCXK 2021-0006). HCT116 cells (5 × 10⁻⁶) were used. 6 Each mouse was injected subcutaneously into the right abdomen with a 1:1 mixture of Matrigel and 100 μL PBS. The tumor volume was increased to approximately 100 mm². 3 Mice were randomly assigned to two groups (n=5 in each group): a solvent control group and a NAR treatment group.

[0060] NAR was dissolved in a mixture of 10% DMSO and 90% corn oil and administered via intraperitoneal injection at a dose of 50 mg / kg every two days for 3 weeks. Tumor length (L) and width (W) were measured every 2–3 days using calipers and calculated using the formula V = (L × W) 2 The tumor volume was calculated as () / 2. At the endpoint, mice were euthanized with CO2, and tumors and major organs (heart, liver, spleen, lungs, and kidneys) were collected for further analysis.

[0061] 7. Histological analysis

[0062] Harvested tissues were fixed in 10% neutral buffered formalin (Solarbio, China) for 24 hours, followed by dehydration, paraffin embedding, and sectioning to a thickness of 4 μm. Tissue sections were stained with hematoxylin and eosin (H&E) according to standard procedures. Sections were examined using an optical microscope (Olympus, Japan) to assess potential pathological changes and systemic toxicity.

[0063] 8. Western blot analysis

[0064] Cells were lysed using RIPA lysis buffer (Beyotime, China) with the addition of a protease inhibitor mixture (Roche, Switzerland) and a phosphatase inhibitor mixture (Beyotime, China). Protein concentration was determined using a BCA protein assay kit (Thermo Fisher Scientific, USA). Equal volumes of protein were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5% nonfat milk and incubated overnight at 4°C with the following primary antibodies: Gankyrin (Proteintech, Cat#14702-1-AP, 1:1000), PTEN (Cell). Signaling Technology (Cat#9188, 1:1000), AKT (CST, Cat#9272, 1:1000), p-AKT^Ser473 (CST, Cat#4060, 1:1000), p-AKT^Thr308 (CST, Cat#13038, 1:1000), p-GSK-3β^Ser9 (CST, Cat#5558, 1:1000), β-catenin (Abcam, Cat#ab32572, 1:1000), and β-actin (Proteintech, Cat#60008-1-Ig, 1:5000). After washing, the membrane was incubated at room temperature for 1 hour with HRP-conjugated secondary antibody (goat anti-rabbit or goat anti-mouse IgG, ZSGB-BIO, China). Protein bands were visualized using an enhanced chemiluminescence (ECL) reagent (Thermo Fisher Scientific, Cat#32106) and a chemiluminescence imaging system (e.g., Bio-Rad ChemiDoc). TM Imaging was performed. Density measurements were conducted using ImageJ software (NIH, USA), and relative expression levels were normalized to β-actin.

[0065] 9. Gene silencing and overexpression using lentiviral vectors

[0066] Stable Gankyrin knockout and overexpression were established using lentiviral vectors. Short hairpin RNAs targeting Gankyrin (sh-Gankyrin, Gankyrin-shRNA-up: CCGGCAGGTTGGTCTCCTCTCATACTCGAGTATGAAGAGGAGACCAACCTGTTTTTG (SEQ ID NO:1); Gankyrin-shRNA-dn: AATTCAAAAAACAGGTTGGTCTCCTCTTCATACTCGAGTATGAAGAGGAGACCAACC TG (SEQ ID NO:2)) were cloned into the pLKO.1 vector, and full-length Gankyrin cDNA (Gankyrin-up: CATGTTACTGGAAGGCGGGG (SEQ ID NO:3); Gankyrin-dn: AGGAGTGTTACCCTCAGTGTCT (SEQ ID NO:4)) were inserted into the pLVX-Puro vector (both from Addgene, USA). Lentiviral cells were produced in HEK293T cells using a standard three-plasmid packaging system (psPAX2 and pMD2.G; Addgene). Forty-eight hours post-transfection, the virus-containing supernatant was collected, filtered, and used to infect HT29 and HCT116 cells in the presence of 8 μg / mL polybrene (Sigma-Aldrich). Forty-eight hours after infection, cells were selected for 7 days with puromycin (2 μg / mL) (InvivoGen, USA). Knockout and overexpression efficiencies were validated by Western blotting.

[0067] 10. Statistical Analysis

[0068] All experiments were repeated three times unless otherwise stated. Data are expressed as mean ± standard deviation (SD). Statistical significance was determined using one-way ANOVA, followed by Tukey's post-hoc test or an unpaired t-test, as appropriate. p < 0.05 was considered statistically significant. GraphPad Prism 9 was used for statistical analysis and graphing.

[0069] Experimental results

[0070] 1. Network pharmacology analysis of the potential mechanism by which naringenin inhibits the development of colorectal cancer (CRC).

[0071] To explore the potential molecular mechanisms of naringenin (NAR) in the prevention and control of CRC, the inventors used the DrugBank and GeneCards databases to identify overlapping targets. A total of 104 NAR-related target genes and 2003 CRC-related target genes were identified, and the intersection of these datasets revealed 95 overlapping target genes. Figure 1 (A). Compound-target-disease network constructed using Cytoscape ( Figure 1 (B) shows multiple targets in the NAR-regulated CRC. This is achieved through STRING ( Figure 1 (C) and Cytoscape ( Figure 1 Protein-protein interaction (PPI) network analysis conducted by the NAR-CRC network identified AKT1 as the central hub, exhibiting the highest degree value, followed by SRC, HSP90AA1, and BCL2. Further topology and cluster analysis confirmed that AKT1 is a key regulator within the NAR-CRC network. Figure 1 (D and E).

[0072] Functional enrichment analysis showed that NAR-related targets were significantly enriched in processes associated with phosphorylation, apoptosis regulation, and growth factor receptor signaling pathways. Figure 1 G and J). KEGG pathway analysis highlighted PI3K / AKT signaling as the main pathway for NAR regulation ( Figure 1 The presence of H+ suggests that this regulation may be involved in inhibiting the occurrence and development of colorectal cancer. Molecular docking analysis (…) Figure 1 A strong binding affinity (Vina score -6.3) was established between NAR and AKT1, involving hydrogen bonding and hydrophobic interactions of TYR-138, ALA-140, and LYS-149, indicating a potential regulatory effect on AKT1 activity. The chemical structure of NAR (…) Figure 1 (K) was obtained from PubChem and exhibited its flavonoid skeleton with hydroxyl groups, which contributes to its bioactivity.

[0073] In summary, the combined results of network pharmacology, PPI analysis, functional enrichment, and molecular docking suggest that NAR may exert its anti-colorectal cancer effect by targeting AKT1 and modulating the PI3K / AKT signaling pathway, providing a potential therapeutic strategy for the treatment of colorectal cancer.

[0074] 2. NAR inhibits CRC cell proliferation, induces apoptosis, and inhibits in vitro metastasis.

[0075] To evaluate the antitumor effect of NAR on CRC cells (colorectal cancer cells), HT29 and HCT116 cells were exposed to different concentrations of NAR. CCK-8 assay results showed that NAR significantly inhibited the proliferation of CRC cells, and this inhibitory effect was dose- and time-dependent. Figure 2 Similarly, clonogenic assays showed that NAR significantly reduced the clonogenic ability of HT29 and HCT116 cells. Figure 2 (B), which further emphasizes its significant anti-proliferative properties.

[0076] To determine whether growth inhibition was related to apoptosis, flow cytometry analysis was performed. NAR treatment resulted in a dose-dependent increase in the percentage of apoptotic cells in the HT29 and HCT116 cell lines. Figure 2 The results (C) indicate that NAR effectively induced apoptosis in CRC cells.

[0077] In addition, transwell assays were performed to assess the effect of NAR on cell migration. Figure 2 As shown in Figures D and E, NAR significantly inhibited the invasion and migration abilities of HT29 and HCT116 cells, and this inhibitory effect was concentration-dependent. Quantitative analysis confirmed that the number of invading and migrating cells decreased consistently and significantly with increasing NAR concentration.

[0078] 3. NAR inhibits the Gankyrin / PI3K / AKT signaling pathway in a dose-dependent manner.

[0079] To further investigate the regulatory role of NAR on the Gankyrin / PI3K / AKT signaling axis, colorectal cancer cells were treated with different concentrations of NAR (5, 10, and 20 μM), and the expression of key pathway components was assessed by Western blot. Figure 3 As shown, NAR treatment led to a dose-dependent decrease in Gankyrin protein levels, while PTEN expression gradually increased. In contrast, total AKT expression remained unchanged, while phosphorylation levels of AKT^Ser473 (serine 473 of AKT), AKT^Thr308, and GSK-3β^Ser9 were significantly inhibited, and this inhibition increased with increasing concentration. Furthermore, β-catenin expression was also significantly reduced after NAR treatment. These findings suggest that NAR inhibits the activation of the AKT / GSK-3β / β-catenin pathway by downregulating Gankyrin and upregulating PTEN, thereby impairing downstream oncogenic signaling. The dose-response pattern further supports the direct mechanistic link between NAR exposure and this tumor axis inhibition in CRC cells.

[0080] 4. Gankyrin-mediated antitumor effect of NAR in CRC cells

[0081] To further elucidate the role of Gankyrin in mediating the anticancer effect of NAR, CRC cells were treated with Gankyrin knockdown (sh-G) or Gankyrin overexpression (oe-G), and experiments were conducted with and without NAR treatment. CCK-8 assay (…) Figure 4 The results in section A) showed that Gankyrin knockout significantly inhibited cell proliferation, an effect further enhanced by NAR. Conversely, Gankyrin overexpression restored cell proliferation and attenuated the inhibitory effect of NAR.

[0082] Cloning experiment ( Figure 4 The results in (B) show that NAR significantly reduced the clonogenic ability of Gankyrin knockout cells, while Gankyrin overexpression restored clonogenicity even under NAR treatment, suggesting that Gankyrin may have counteracted the inhibitory effect of NAR on CRC cell growth.

[0083] Flow cytometry analysis ( Figure 4 The results (C) showed that Gankyrin knockout significantly increased the apoptosis rate of CRC cells, an effect further enhanced by NAR. However, Gankyrin overexpression reduced apoptosis and attenuated the pro-apoptotic effect of NAR.

[0084] Transwell invasion and migration experiments ( Figure 4 The results (D and E) indicate that Gankyrin knockout inhibits the invasion and migration of CRC cells, with the effect being more pronounced when used in combination with NAR. Conversely, Gankyrin overexpression reverses these effects, maintaining enhanced invasion and migration even after NAR treatment.

[0085] 5. Gankyrin regulates the AKT / GSK-3β / β-catenin axis in NAR-treated CRC cells.

[0086] Rescue experiments were conducted in CRC cells using either silencing or overexpression of Gankyrin, regardless of the presence or absence of NAR treatment, to investigate whether NAR-induced Gankyrin inhibition affects the AKT / GSK-3β / β-catenin signaling axis. Western blot analysis showed that Gankyrin knockdown (sh-G) significantly reduced phosphorylation levels of AKT^Ser473, AKT^Thr308, and GSK-3β^Ser9, accompanied by upregulation of PTEN and downregulation of β-catenin. These changes were significantly reversed in Gankyrin-overexpressing (oe-G) cells, indicating that Gankyrin overexpression promotes activation of the PI3K / AKT signaling cascade. Figure 5 Importantly, concurrent NAR treatment (oe-G+NAR) in Gankyrin-overexpressing cells partially reversed the Gankyrin-induced effects, leading to decreased levels of p-AKT, p-GSK-3β, and β-catenin, and increased PTEN expression, without affecting total AKT levels. These results suggest that Gankyrin may play a role in regulating oncogenic signaling mediated by the AKT / GSK-3β / β-catenin pathway, a role that can be inhibited by NAR in CRC cells.

[0087] 6. NAR inhibits CRC tumor growth in vivo without causing systemic toxicity.

[0088] To further confirm the antitumor efficacy and safety of NAR, a subcutaneous xenograft model was established using CRC cells. Mice received either NAR or solvent control treatment, and tumor size was monitored. Figure 6 As shown in Figure A, compared with the control group, NAR treatment significantly reduced tumor volume, indicating that NAR exhibits strong anti-tumor activity in vivo.

[0089] To assess potential systemic toxicity, histological examinations were performed on vital organs including the heart, liver, spleen, lungs, and kidneys. Hematoxylin and eosin (H&E) staining was performed. Figure 6 The results (B) showed that no significant pathological changes were found in any organ in the NAR treatment group, indicating that NAR did not cause observable organ toxicity during treatment.

[0090] Experimental conclusions

[0091] Colorectal cancer (CRC) is considered the second leading cause of cancer-related death and the third most common cancer in both men and women. Its incidence is relatively low in developing countries, a difference attributed to the integration of Western lifestyles, which increase risk factors. Genetic variants associated with CRC are heterogeneous and respond differently to treatment strategies. From a molecular perspective, mutations in APC (adenomatous polyposis colon), KARS (Clenketella mouse sarcoma virus oncogene homolog), and TP53 (tumor protein p53) may contribute to CRC progression and invasion. Furthermore, the microsatellite instability (MSI) pathway also plays a crucial role in CRC development, with high MSI-CRC showing a significant response to PD-1 immune checkpoint inhibitors. However, conventional surgical resection has limited effectiveness in advanced stages. While chemotherapy and targeted therapy are important treatment strategies for CRC, drug resistance remains a key challenge affecting efficacy. Therefore, novel treatment approaches are crucial for CRC patients.

[0092] In this invention, network pharmacology was applied to predict that AKT1 is a key target for NAR inhibition of CRC. Serine / threonine kinase AKT is also known as protein kinase B (PKB). Abnormalities in AKT1, as an isoform of AKT, have been reported to initiate cancer development in gastric, thyroid, breast, and ovarian cancers. Upstream regulators of AKT include PTEN and PI3K. Akt recruitment to the cell membrane depends entirely on a phospholipid produced by PI3K, namely phosphatidylinositol-3,4,5-triphosphate (PIP3), which binds to the PH domain of Akt, leading to a conformational change in Akt and phosphorylation of Thr308. PIP3 is dephosphorylated by PTEN, thereby negatively regulating PI3K signaling. As a core node in many signaling pathways, Akt signaling promotes cancer cell proliferation, survival, migration, invasion, and drug resistance by activating its downstream effectors such as tuberous sclerosis complex 2 (TSC2), GSK-3β, B-cell lymphoma protein 2-associated apoptosis inducer (BAD), forkhead box O (FOXO), and mouse microbeta 2 homolog (MDM2). AKT1 has been reported to activate the mTOR pathway via phosphorylation of TSC2, one of the most frequently altered pathways in human cancer. Previous studies have found that various flavonoids extracted from natural plants, such as matrine, myricetin, and apigenin, have anticancer effects by inhibiting the PI3K / AKT / mTOR pathway. GSK-3β is another downstream target of the PI3K / AKT pathway and can be activated by AKT-mediated phosphorylation. GSK-3β affects various biochemical processes in cancer by activating β-catenin. Chen Jingsong et al. demonstrated that PIK3CD-activated AKT / GSK-3β / β-catenin signaling induces cell growth and invasion in CRC cells. In this invention, the inventors also confirmed that NAR inhibits CRC cell proliferation by downregulating Gankyrin expression and suppressing PI3K / AKT / GSK-3β / β-catenin signaling.

[0093] In the study of this invention, dose-dependent experiments showed that with increasing NAR concentration, CRC cell proliferation decreased, while the proportion of apoptotic cells gradually increased, and the invasive and migratory abilities of tumor cells were significantly reduced. These results indicate that NAR exerts its anticancer effect by inhibiting tumor cell proliferation, inducing apoptosis, and inhibiting tumor cell migration and invasion. In fact, NAR can induce programmed cell death in tumor cells by upregulating the expression of the pro-apoptotic protein Bax and downregulating the expression of the anti-apoptotic protein Bcl-2. Furthermore, NAR can inhibit tumor cell migration and invasion by downregulating the expression of matrix metalloproteinases MMP-2 and MMP-9. Dan Wang et al. demonstrated that NAR activates AMP kinase (AMPK) phosphorylation and mitochondrial fusion in CRC, and when used in combination with 5-fluorouracil, it significantly reduced the cardiotoxicity and liver damage induced by 5-fluorouracil in nude mice carrying subcutaneous CRC tumors, further confirming the significant effects of NAR in CRC progression and treatment.

[0094] Furthermore, this invention analyzed the role of Gankyrin in the development of colorectal cancer, finding that Gankyrin knockdown was associated with increased apoptosis and decreased proliferation, colony formation, invasion, and migration levels, while phosphorylation expression of Akt, GSK-3β, and β-catenin was also reduced, whereas Gankyrin overexpression showed different results. NADPH oxidase (NAR) further reduced proliferation, invasion, and migration levels and increased the number of apoptotic cells, showing a dose-dependent effect to some extent. Gankyrin is highly expressed in CRC, promoting tumor cell proliferation, epithelial-mesenchymal transition (EMT), invasion, and metastasis. Inhibition of Gankyrin has been shown to increase the sensitivity of CRC cells to chemotherapy and reduce tumor cell viability. By activating the β-catenin signaling pathway, Gankyrin may enhance the stemness of CRC cells and contribute to chemotherapy resistance. Recent studies have shown that silencing Gankyrin expression using siRNA or shRNA can significantly inhibit tumor cell proliferation and improve the efficacy of chemotherapeutic drugs—these findings are consistent with our observations. Furthermore, Gankyrin also plays a role in modulating immunosuppression in the tumor microenvironment, suggesting that combining its inhibition with immune checkpoint blockade (such as PD-1 / PD-L1 antibodies) may represent a novel therapeutic strategy.

[0095] Several limitations remain in this study. This invention does not explore certain mechanisms of immune response, inflammation, and gut microbiota in colorectal cancer progression, which may interact with apoptosis and the AKT / GSK-3β / β-catenin pathway. Further animal models are needed to address these issues and validate the results of this invention.

[0096] In summary, this study demonstrates that NAR reduces the proliferation, migration, invasion, and apoptosis of colorectal cancer cells via the Gankyrin / PI3K / AKT / GSK-3β / β-catenin pathway. Figure 7 This study revealed NAR as a potential component against colorectal cancer and its molecular mechanism in the progression of colorectal cancer, providing potential targets for further clinical treatment.

[0097] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, unless otherwise specified, the embodiments of the present invention and the features thereof can be combined with each other.

Claims

1. The application of naringenin in the preparation of drugs for the prevention or treatment of colorectal cancer.

2. The application according to claim 1, characterized in that, The naringenin aims to prevent and / or treat colorectal cancer by inhibiting the proliferation, growth, invasion, and / or migration of colorectal cancer cells; and / or, the naringenin aims to prevent and / or treat colorectal cancer by promoting apoptosis of colorectal cancer cells.

3. The application according to claim 1, characterized in that, The naringenin aims to prevent and / or treat colorectal cancer by targeting and regulating the Gankyrin / PI3K / AKT / GSK-3β / β-catenin signaling pathway.

4. The application according to claim 3, characterized in that, The naringenin regulates the Gankyrin / PI3K / AKT / GSK-3β / β-catenin signaling pathway by downregulating the expression of Gankyrin and β-catenin, upregulating the expression of PTEN, and downregulating the phosphorylation levels of AKT^Ser473, AKT^Thr308, and GSK-3β^Ser9.

5. Application of naringenin in the in vitro inhibition of Gankyrin expression or in the preparation of Gankyrin inhibitors.

6. The application according to claim 5, characterized in that, The effective dose of naringenin to inhibit Gankyrin expression is 2–40 μM.

7. A drug, characterized in that, The active ingredients of the drug include naringenin and Gankyrin inhibitors.

8. The medicament according to claim 7, characterized in that, The Gankyrin inhibitors include siRNA, dsRNA, miRNA, ribozymes, or shRNA that target and downregulate Gankyrin expression.

9. The drug according to claim 7, characterized in that, The drug also includes pharmaceutically acceptable excipients.

10. The medicament according to claim 9, characterized in that, The pharmaceutically acceptable excipients include at least one of the following: fillers, disintegrants, diluents, dispersants, excipients, stabilizers, lubricants, binders, humectants, flavoring agents, solubilizers, suspending agents, solvents, sustained-release agents, emulsifiers, absorption enhancers, surfactants, preservatives, colorants, fragrances, and solvents.

Images