A method of preparing a sandwiched antibacterial hemostatic dressing

Abstract

This invention relates to the field of hemostatic dressings, and more particularly to a method for preparing a sandwich-type antibacterial hemostatic dressing. Collagen mutants are obtained through site-directed mutagenesis, and the mutants with better effects are screened to prepare a sandwich-type antibacterial hemostatic dressing. This dressing can significantly increase its hemostatic ability and reduce wound adhesion, while also possessing good antibacterial effects, showing great promise for application in biological hemostatic materials.

Description

Technical Field

[0001] This invention relates to the field of hemostatic dressings, and more particularly to a method for preparing a sandwich-type antibacterial hemostatic dressing. Background Technology

[0002] In daily life, the incidence of high-energy injuries, including those from high altitudes and high speeds, as well as complex combat trauma, is increasing year by year. Rapid hemostasis after various traumas is challenging, especially bleeding from large arteries and veins, which is often projectile and difficult to control. This rapid blood loss poses a life-threatening risk, with bleeding volume frequently exceeding the danger threshold within ten minutes. Rapid and safe hemostasis remains a medical challenge. Simultaneously, wound infection is a significant factor affecting the prognosis and repair of bleeding sites. Therefore, effectively controlling bleeding in the early stages of injury, maximizing the inhibition of bacterial growth, and promoting wound healing are of paramount importance. Currently, traditional hemostatic dressings such as cotton and gauze generally suffer from poor rapid hemostasis, severe wound dehydration, easy adhesion to the wound, poor absorption of tissue fluid and blood, prolonged wound healing time, and easy bacterial penetration, leading to infection. While upgraded antibacterial dressings such as silver foam dressings have better bactericidal capabilities, they generally have poor hemostatic effects and poor exudate absorption.

[0003] Silk fibroin, a natural protein extracted from silkworm cocoons, possesses adjustable mechanical strength, low immunogenicity, and good biocompatibility, and has been widely used in regenerative medicine. In hemostasis, silk fibroin can bind to fibrinogen and platelets, promoting the body's coagulation response, and studies have shown that it can promote tissue regeneration. However, its lack of effective antibacterial activity limits its further application in hemostasis and wound healing. Chitosan, a naturally occurring alkaline polysaccharide, is a primary derivative of deacetylated chitin. The positively charged surface of chitosan accelerates the adsorption of negatively charged coagulation factors through electrostatic interactions, thus accelerating coagulation. It also has good antibacterial properties, inhibiting the growth of common bacteria and fungi on wound surfaces. Currently, chitosan-coated hemostatic sponges and gauze are used in emergency hemostasis and surgical procedures, but chitosan itself has limited swelling capacity and cannot fully absorb water.

[0004] The principle behind collagen's effective hemostasis lies in its ability to induce platelet adhesion and activate clotting factors in the blood, thereby achieving hemostasis. Currently, gelatin sponges and sodium alginate are commonly used in the medical field, but their hemostatic effects are not very good because of their low hydrophilicity. In contrast, collagen sponges or dressings made from collagen have advantages such as high hemostatic efficiency, fewer side effects, and ease of use.

[0005] Therefore, developing a dressing that can quickly stop bleeding, has good antibacterial properties, efficiently absorbs secretions, and promotes wound healing is of great significance for the clinical application of rapid wound hemostasis and recovery. Summary of the Invention

[0006] The first objective of this invention is to provide an engineered bacterium containing a collagen recombinant vector, wherein the engineered bacterium is introduced with a collagen mutant to construct a recombinant Escherichia coli with the ability to secrete collagen.

[0007] The amino acid sequence of the collagen is shown in SEQ ID NO. 1.

[0008] 1 GPSGKPGNRG DPGPVGPVGP AGAFGPRGLA GPQGPRGEKG EHGDKGHRGL PGLKGHNGLQGLPGLAGQHG

[0009] 71 DQGPPGNNGP AGPRGPHGPS GPHGKDGRNG LPGPIGPAGV RGSHGSQGPA GPPGPPGPPGPPGPNGGGYE

[0010] 141 VGFDAEYYRA DQPSLRPKDY EVDATLKTLN NQIETLLTPE GSKKNPARTC RDLRLSHPEWSSGFSWIAPN

[0011] 211 HGCTADAIRA YCDFATGETC IHASLEIIPT KTWYVSKNPK DKKHIWFGET INGGTQFEYNGEGVTTKDMA

[0012] 281 TQLAFMRLLA NHAPQNITYH CKNSIAYMDE ETGNLKKAVI LQGSNDVELR AEGNSRFTFSVLVDGCSKKN

[0013] 351 NKWGKTIIEY RTNKPSRLPI LDIAPLDIGG ADQEFGLHIG PVCFK.

[0014] The preferred collagen nucleotides are codon-optimized, with the sequence shown in SEQ ID NO. 2, and have a Usp45 signal peptide and a His tag added.

[0015] Preferably, the engineered bacteria are infused with a collagen mutant that has one or more amino acid mutations, which can increase the hemostatic ability of collagen and reduce the degree of wound adhesion.

[0016] The preferred dressing increases hemostatic ability by a percentage of 5% or more, or 10% or more, or 20% or more.

[0017] The preferred type can increase the antibacterial ability of hemostatic dressings.

[0018] More preferably, the bacteria or fungi it targets include one or more of Escherichia coli, Staphylococcus aureus, and Candida albicans;

[0019] More preferably, the antibacterial effect of the hemostatic dressing is above 90%;

[0020] The optimal hemostatic dressing has an antibacterial effect of over 95%;

[0021] The preferred mutation sites for collagen are one or more of G121D, P209K, and C346L.

[0022] The preferred mutation sites for collagen are G121D, C346L, or a combination thereof.

[0023] A more preferred mutation site is G121D / C346L.

[0024] The preferred amino acid sequences of the mutated collagen are shown in SEQ ID NO: 3-5.

[0025] A more preferred amino acid sequence of the mutated collagen is shown in SEQ ID NO: 3.

[0026] The preferred amino acid sequence of the mutant G121D / C346L is SEQ ID NO: 3:

[0027] 1 GPSGKPGNRG DPGPVGPVGP AGAFGPRGLA GPQGPRGEKG EHGDKGHRGL PGLKGHNGLQGLPGLAGQHG

[0028] 71 DQGPPGNNGP AGPRGPHGPS GPHGKDGRNG LPGPIGPAGV RGSHGSQGPA DPPGPPGPPGPPGPNGGGYE

[0029] 141 VGFDAEYYRA DQPSLRPKDY EVDATLKTLN NQIETLLTPE GSKKNPARTC RDLRLSHPEWSSGFSWIAPN

[0030] 211 HGCTADAIRA YCDFATGETC IHASLEIIPT KTWYVSKNPK DKKHIWFGET INGGTQFEYNGEGVTTKDMA

[0031] 281 TQLAFMRLLA NHAPQNITYH CKNSIAYMDE ETGNLKKAVI LQGSNDVELR AEGNSRFTFSVLVDGLSKKN

[0032] 351 NKWGKTIIEY RTNKPSRLPI LDIAPLDIGG ADQEFGLHIG PVCFK.

[0033] The amino acid sequence of the more preferred mutant G121D is shown in SEQ ID NO: 4;

[0034] The amino acid sequence of the more preferred mutant C346L is shown in SEQ ID NO: 5.

[0035] Another object of the present invention is to provide a method for constructing the above-mentioned engineered bacteria, which includes the following steps:

[0036] (1) Design of collagen gene and construction of recombinant vector

[0037] Using the collagen gene (SEQ ID NO:2) as a template, PCR amplification was performed using the above primers with the GeneMorph II random mutation PCR kit (Stratagene). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector that had been digested with the same enzymes. The resulting product was then transformed into Escherichia coli BL21(DE3).

[0038] Recombinant plasmids can be identified using conventional methods, such as PCR amplification followed by gel electrophoresis or sequencing.

[0039] (2) Select single colonies and spread them on LB+Amp plates. Incubate at 37°C with the plates upside down. After the transformants appear, pick them one by one with a toothpick and transfer them to a 96-well plate. Add 150 μL of LB+Amp medium containing 0.1 mM IPTG to each well. Incubate at 37°C and 220 rpm for about 6 hours. Centrifuge and discard the supernatant. Resuspend the cells in buffer and repeatedly freeze and thaw to break the cell walls to obtain Escherichia coli cell lysate containing collagen.

[0040] The third objective of this invention is to provide a sandwich-type antibacterial and hemostatic dressing and its preparation method, which comprises phosphorylated chitosan, alginate, and silk fibroin, among other components.

[0041] A preferred method for preparing a sandwich-type antibacterial hemostatic dressing includes the following steps:

[0042] ① Chitosan was protonated with 75% acetic acid (diluted with ethanol) in a non-aqueous system at a ratio of 5:4. The reaction was carried out at room temperature for 4 hours, and then unreacted acid was washed away with ethanol until neutral. Subsequently, shape-stable acidified chitosan nanoparticles were obtained by using a poor solvent method combined with microfluidic processing technology.

[0043] ② Chitosan, alginate, and collagen composite nanoparticle hemostatic material was obtained by in-situ uniform blending technology. The ratio of acidified chitosan, alginate, and collagen was (3:7):(1:3):(2:5).

[0044] ③ Freeze-dried regenerated silk fibroin was dissolved in hexafluoroisopropanol (HFIP) to prepare a 25% (w / v, g / mL) silk fibroin solution. The silk fibroin was then processed into a nonwoven dressing using electrospinning. Specific electrospinning parameters were as follows: positive pressure: 12.5 kV, negative pressure: 3 kV, needle-to-receiver distance: 15 cm, and pushing speed: 0.2 mm / min. After spinning, the electrospun fibers were immersed in anhydrous ethanol solution to denature the silk fibroin, and then dried to obtain the silk fibroin dressing.

[0045] ④ Wrap the composite nanoparticle hemostatic material with two layers of silk fibroin dressing, cast methylacylated silk fibroin and irradiate it with 365 nm ultraviolet light for 5 min to form a gel, encapsulate the hemostatic particles in the dressing, freeze at -20℃ for 12 h, and then freeze-dry for 24 h to obtain a dry sandwich antibacterial hemostatic dressing.

[0046] In step ②, the preferred ratio of acidified chitosan, alginate, and collagen is 7:1:2.

[0047] The fourth objective of this invention is to provide the application of the sandwich-type antibacterial hemostatic dressing, which uses genetically engineered bacteria to efficiently express collagen, and prepares the collagen with corresponding materials into a sandwich-type hemostatic material, which can significantly increase its hemostasis and reduce the degree of wound adhesion, while also increasing its antibacterial effect.

[0048] Among the preferred candidates, the collagen G121D / C346L mutant dressing reduced bleeding by 19.3% and hemostasis time by 35.5% compared to the wild type.

[0049] More preferably, the antibacterial effect of the hemostatic dressing is above 90%.

[0050] The beneficial effects of this invention are:

[0051] (1) Collagen is expressed through genetic engineering, which is simple, efficient, and has high purity;

[0052] (2) By mutation and screening, protein mutants that increase hemostatic properties are obtained. The prepared sandwich antibacterial hemostatic dressing can significantly increase hemostasis and reduce adhesion during wound healing. It has a good application prospect in biological hemostatic materials.

[0053] (3) The sandwich-type antibacterial and hemostatic dressing of the present invention has a good antibacterial effect, with an antibacterial effect of more than 90% against common pathogens such as Escherichia coli, Staphylococcus aureus and Candida albicans. Attached Figure Description

[0054] Figure 1 Collagen SDS-PAGE image;

[0055] Figure 2 This application includes a photograph of the sandwich-type antibacterial and hemostatic dressing.

[0056] Figure 3 : Hemostasis time of sandwich-type antibacterial hemostatic dressing;

[0057] Figure 4 Sandwich-type antibacterial hemostatic dressing to control bleeding volume;

[0058] Figure 5 The condition of wound adhesion after hemostasis;

[0059] Figure 6 The antibacterial effect of sandwich-type antibacterial and hemostatic granules. Detailed Implementation

[0060] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0061] In the following embodiments, all processes and methods not described in detail are conventional methods known in the art. The source, trade name, and components of the reagents used are indicated upon their first appearance unless otherwise specified. Subsequent use of the same reagents will be based on the same information as initially stated. Unless otherwise specified, all reagents and materials involved are commercially available.

[0062] Example 1: Gene design and construction of recombinant cloning vector

[0063] In order to improve or alter the performance of wild-type collagen (GenBank: AAA51615.1, amino acid sequence SEQ ID NO: 1, encoding nucleotide sequence SEQ ID NO: 2), the applicant screened for a large number of mutations in this amino acid using directed evolution technology.

[0064] The PCR primers are designed as follows:

[0065] F: GGC AATTCT GGCCTGAAAGGCCATAACGG (The underlined part is the EcoRI restriction enzyme recognition site, SEQ ID NO: 6);

[0066] R: ATA GCGGCCGC ATATCCAGAATCGGCAGGCG (The underlined part is the NotI restriction enzyme recognition site, SEQ ID NO: 7).

[0067] Using the collagen gene (SEQ ID NO:2) as a template, PCR amplification was performed using the GeneMorph II random mutagenesis PCR kit (Stratagene) with the above primers. The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The transformed product was then transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation and discarding the supernatant, the cells were resuspended in buffer and repeatedly freeze-thawed to break the cell walls, obtaining E. coli cell lysate containing collagen.

[0068] Example 2 Construction of collagen mutants and recombinant strains

[0069] Based on the amino acid profile, a group of amino acid mutants that may affect the spatial structure of collagen were screened. The nucleotides of the mutants were all synthesized by Sangon Biotech (Shanghai) Co., Ltd. The wt and its variants were successfully cloned into the plasmid pET-30a(+). During the construction of the expression plasmid, six His tags were added to the N-terminus of the gene. The successfully constructed recombinant plasmids were transformed into E. coli BL21(DE3) cells and named E. coli BL21(DE3) / pET-30a(+)-WT, E. coli BL21(DE3) / pET-30a(+)-mutG121D / C346L, E. coli BL21(DE3) / pET-30a(+)-mutG121D, and E. coli BL21(DE3) / pET-30a(+)-mutC346L. Single colonies of recombinants were selected, cultured in culture medium, and identified by colony PCR. After enzyme digestion identification, sequencing verification was performed, and wild-type and mutant engineered bacteria were selected for preservation.

[0070] Example 3: Collagen content of recombinant engineered bacteria reached [amount missing].

[0071] Three strains of each type were selected and cultured in liquid LB medium (containing 5 μg / mL erythromycin) overnight at 30°C. The next day, they were inoculated at a 5% inoculum volume into 100 mL of LB liquid medium (containing 5 μg / mL erythromycin) and cultured at 30°C until the OD600 reached approximately 0.5. Then, 100 μL of filtered and sterilized 0.3 M CuSO4 was added in a clean bench and cultured at 30°C for 4 hours, followed by incubation at 16°C for 24 hours. 90 μL of the supernatant from the cell disruption of each recombinant strain was taken and mixed with 30 μL of 4× Protein Loading Buffer, and boiled at 100°C for 10 min. The mixture was then centrifuged at 12,000 rpm for 5 min at 4°C, and the sample was collected and purified by ion exchange chromatography.

[0072] Specifically, 10.0 mL of concentrated collagen and its mutant solutions were passed through a HiTrap Q HP anion exchange column pre-equilibrated with 10 mmol / L Tris-HCl (pH 8.0), and then eluted using a linear gradient with 10 mmol / L Tris-HCl (pH 8.0) containing 1 mol / L NaCl. Enzyme activity was detected by colorimetry, and the purity of the gradient-eluted protein solution was determined by SDS-PAGE gel electrophoresis.

[0073] like Figure 1 As shown, SDS-PAGE of collagen yielded a clear and bright band of approximately 41.5 kDa, indicating that the mutants were successfully expressed with high purity.

[0074] Example 4: Preparation of Sandwich-Type Antibacterial and Hemostatic Dressing

[0075] A method for preparing a sandwich-type antibacterial hemostatic dressing includes the following steps:

[0076] ① Chitosan was protonated with 75% acetic acid (diluted with ethanol) in a non-aqueous system at a ratio of 5:4. The reaction was carried out at room temperature for 4 hours, and then unreacted acid was washed away with ethanol until neutral. Subsequently, shape-stable acidified chitosan nanoparticles were obtained by using a poor solvent method combined with microfluidic processing technology.

[0077] ② A chitosan-algin-collagen composite nanoparticle hemostatic material was obtained using in-situ uniform blending technology, with the ratio of acidified chitosan, alginate, and collagen being 7:1:2.

[0078] ③ Freeze-dried regenerated silk fibroin was dissolved in hexafluoroisopropanol (HFIP) to prepare a 25% (w / v, g / mL) silk fibroin solution. The silk fibroin was then processed into a nonwoven dressing using electrospinning. Specific electrospinning parameters were as follows: positive pressure: 12.5 kV, negative pressure: 3 kV, needle-to-receiver distance: 15 cm, and pushing speed: 0.2 mm / min. After spinning, the electrospun fibers were immersed in anhydrous ethanol solution to denature the silk fibroin, and then dried to obtain the silk fibroin dressing.

[0079] ④ Wrap the composite nanoparticle hemostatic material with two layers of silk fibroin dressing, cast methylacylated silk fibroin and irradiate it with 365 nm ultraviolet light for 5 min to form a gel, encapsulate the hemostatic particles in the dressing, freeze at -20℃ for 12 h, and then freeze-dry for 24 h to obtain a dry sandwich antibacterial hemostatic dressing.

[0080] The sandwich-type antibacterial and hemostatic dressing 1 contains wild-type collagen;

[0081] Sandwich-type antibacterial hemostatic dressing 2 contains collagen mutant 1, namely G121D / C346L

[0082] Sandwich-type antibacterial hemostatic dressing 3 contains collagen mutant 2, namely G121D

[0083] Sandwich-type antibacterial hemostatic dressing 4 contains collagen mutant 3, namely C346L

[0084] Example 5: Evaluation of Hemostatic Effect

[0085] Seventy-two SD rats were randomly divided into six groups: a sham-operated group, a model control group, and groups 1-4 (using a sandwich-type antibacterial hemostatic dressing), with 12 rats in each group. After successful anesthesia, the rats were injected intraperitoneally with 0.35 ml / 100 g of 10% chloral hydrate. The rats were then fixed, their abdominal cavity was shaved, and routine disinfection was performed. A 2-3 cm incision was made in the midline below the xiphoid process to expose the liver. The middle lobe of the liver was carefully freed outside the abdominal cavity, which was padded with a gauze pad (already weighed), using a cotton swab. A 2×2 cm layer of tissue was then removed from the surface of the liver using a pathological scalpel. Expelled blood was wiped away, and a 2.5×2.5 cm sandwich-type antibacterial hemostatic dressing was immediately applied. The wound was gently pressed with the gauze pad placed under the liver lobe until bleeding ceased. The time to hemostasis and the amount of blood loss were recorded.

[0086] Blood loss (ml) = (weight of gauze after hemostasis - weight of gauze before hemostasis) / blood density. In the model control group, hemostasis was achieved by directly applying pressure with gauze. After hemostasis, the liver was repositioned, and the muscle layer and epidermis were sutured separately. In the sham surgery group, the liver lobe was opened and freed, and then repositioned and the abdominal cavity was closed.

[0087] Table 1 Evaluation of the hemostatic effect of different dressings on rat liver

[0088]

[0089] Where 'a' indicates p < 0.05 compared to the model group, and 'b' indicates p < 0.05 compared to other dressing groups.

[0090] Example 6: Evaluation of Postoperative Wound Adhesion

[0091] Two weeks post-surgery, six rats from each group were subjected to laparotomy to examine intra-abdominal adhesions, infection, and liver healing. The degree of adhesion was scored. The evaluation criteria were as follows:

[0092] No adhesions at all: 0 points; 1 adhesion between liver lobes or between liver lobe and abdominal wall: 1 point; 2 adhesions between liver lobes or between liver lobe and abdominal wall: 2 points; Large adhesions between liver lobes or between liver lobe and gastrointestinal tract or abdominal wall, but can be separated by force: 3 points; Liver lobe directly adhered to the abdominal wall, difficult to separate completely even by force: 4 points.

[0093] Table 2. Effects of different dressings on the degree of adhesion in rat livers after hemostasis.

[0094]

[0095] Where 'a' indicates a significant difference from other groups, p < 0.05.

[0096] Therefore, the experiments in Examples 5-6 show that the sandwich-type antibacterial hemostatic dressings prepared from the collagen mutants G121D / C346L and C346L obtained in this invention significantly improve the reduction of wound bleeding and bleeding time compared to the wild type. In particular, mutant G121D / C346L shows a significant improvement in hemostatic effect compared to both the wild type and other mutant groups. Specifically, the G121D / C346L mutant shows a 19.3% improvement in hemostatic effect and a 35.5% reduction in hemostasis time compared to the wild type. However, in reducing adhesion during wound healing, the mutants G121D / C346L and C346L showed no significant difference in effect, but both were superior to the wild type group. (See [link to relevant documentation]). Figure 3-4 .

[0097] Example 7: Antibacterial Experiment with Hemostatic Powder

[0098] Take bacterial suspensions of Escherichia coli, Staphylococcus aureus, and Candida albicans in their logarithmic growth phase and adjust to 1×10⁻⁶ with sterile PBS. 6CFU / mL. Add 5 mL of the bacterial culture medium to a 15 mL centrifuge tube, then add 20 mg of the hemostatic granules 2 prepared in Example 2 and Celox hemostatic granules, and mix thoroughly. Incubate the centrifuge tubes at 37°C with shaking for 4 h. Then, dilute the culture medium 100-fold with sterile PBS, and plate 100 μL of the diluted bacterial solution onto a plate. Incubate overnight at 37°C and count the colonies. The bacterial solution without added powder was treated similarly and used as a negative control. To ensure the accuracy of the experiment, three parallel samples were tested for each group, and the average value was calculated.

[0099] Inhibition rate % = (Control colony count - Experimental group colony count / Control colony count) * 100%

[0100] Escherichia coli (ATCC 25922), Staphylococcus aureus (ATCC 25923), Candida albicans (ATCC10231), and commercially available Celox hemostatic powder were all obtained commercially.

[0101] Experimental results are as follows Figure 6 As shown, the composite hemostatic granules 2 prepared by the present invention (i.e., collagen containing mutant 2) have a much higher antibacterial effect against Escherichia coli, Staphylococcus aureus and Candida albicans than commercially available Celox powder, with an antibacterial rate of more than 95%, demonstrating good antibacterial effect.

[0102] Based on this, the sandwich-type antibacterial hemostatic dressing prepared by the collagen mutant of this application has a promising application prospect in biological hemostatic materials.

[0103] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A recombinant collagen protein having the amino acid sequence shown in SEQ ID NO:3 or 5.

2. The recombinant collagen according to claim 1, the sequence of which is shown in SEQ ID NO:

3.

3. The method for preparing collagen according to claim 1, which is obtained by genetic engineering, includes the following steps: (1) introducing a collagen mutant gene into a plasmid vector to obtain a fusion plasmid; (2) The fusion plasmid was introduced into the host expression system and cultured in a culture medium to expand its size; (3) Isolate and purify the target protein.

4. The preparation method according to claim 3, wherein the host expression system is any one of yeast, lactic acid bacteria, and Escherichia coli.

5. A sandwich-type antibacterial hemostatic dressing, comprising the recombinant collagen as described in any one of claims 1-2 or the recombinant collagen prepared by the method described in any one of claims 3-4.

6. The sandwich-type antibacterial hemostatic dressing according to claim 5 further comprises phosphorylated chitosan, alginate, and silk fibroin.

7. A method for preparing the sandwich-type antibacterial hemostatic dressing according to any one of claims 5-6, comprising the following steps: ① Chitosan was protonated with 75% acetic acid diluted with ethanol and reacted at room temperature for 4 hours. Unreacted acid was then washed away with ethanol until neutral. Subsequently, shape-stable acidified chitosan nanoparticles were obtained by combining poor solvent method with microfluidic processing technology. ② Chitosan, alginate, and collagen composite nanoparticle hemostatic material was obtained using in-situ uniform blending technology, with the ratio of acidified chitosan, alginate, and collagen being (3:7):(1:3):(2:5). ③ The freeze-dried regenerated silk fibroin was dissolved in hexafluoroisopropanol (HFIP) and processed into nonwoven dressings by electrospinning. After spinning, the electrospinned fibers were soaked in anhydrous ethanol solution to denature the silk fibroin and then dried to obtain the silk fibroin dressing. ④ Wrap the composite nanoparticle hemostatic material with two layers of silk fibroin dressing to encapsulate the hemostatic particles in the dressing.

8. The preparation method according to claim 7, wherein in step ① the ratio of chitosan to 75% acetic acid is 5:

4.

9. The preparation method according to claim 7, wherein the electrospinning parameters in step ③ are as follows: positive pressure: 12.5 kV, negative pressure: 3 kV, distance from needle to receiver: 15 cm, pushing speed: 0.2 mm / min.

10. The use of the recombinant collagen according to any one of claims 1-2, the hemostatic dressing according to any one of claims 5-6, or the hemostatic dressing prepared by the method according to any one of claims 7-9 in the preparation of hemostatic products.

Images