Endophyte bacillus velezensis and application thereof

Abstract

The invention provides a bacillus velezensis strain and application thereof. The bacillus velezensis strain Amzn015 is firstly separated from the interior of a healthy bighead atractylodes rhizome plant, and the preservation number of the strain is CCTCC M 20252027. The bacterial strain has good antagonistic activity on Atractylodes macrocephala koidz root rot pathogen fusarium oxysporum, Fusarium oxysporum pathogen and Epicoccus catenarius, and the inhibition rates of the bacterial strain and the Fusarium oxysporum pathogen, the Fusarium oxysporum pathogen and the Epicoccus catenarius are respectively 85.75%, 76.43% and 72.11%. The bacterial strain has good antagonistic activity on Atractylodes macrocephala koidz root rot pathogen, the Fusarium oxysporum pathogen, the Fusarium oxysporum pathogen, the Fusarium oxysporum pathogen and the Epicoccus catenarius. The strain has a good treatment effect on bighead atractylodes rhizome root rot caused by fusarium oxysporum, the treatment effect is 66.2%, the strain is a potential biological agent, and the strain also has the capability of promoting plant growth. The bacillus velezensis disclosed by the invention has a wide development space and a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to an endophytic bacterium, Bacillus belye, and its applications. Background Technology

[0002] Atractylodes macrocephala is widely used for its pharmacological functions such as "strengthening the spleen and replenishing qi, resolving dampness and promoting diuresis." Its rhizomes are rich in volatile oils, sesquiterpene lactones, polysaccharides, and flavonoids, possessing multiple biological activities including anti-inflammatory, antioxidant, immunomodulatory, gastrointestinal protective, and anti-tumor effects. It is an indispensable medicinal and edible resource in traditional Chinese medicine prescriptions and health products. Atractylodes macrocephala, with its significant efficacy and wide clinical demand, constitutes an important pillar of the Chinese medicinal herb industry. However, its cultivation faces serious threats, especially root rot. This disease is caused by soil pathogens (such as Fusarium oxysporum), often leading to rhizome rot and seedling death. In some fields, the incidence rate can reach as high as 60% or higher, greatly affecting yield and quality. At the same time, continuous cultivation leads to an imbalance in soil physicochemical properties (such as pH, electrical conductivity, and exchangeable potassium), and a significant decrease in the diversity of rhizosphere and endophytic fungi, resulting in disordered fungal community structure, further exacerbating the risk of disease occurrence. Furthermore, since the cultivation of Atractylodes macrocephala relies heavily on artificial cultivation, the degradation of germplasm resources and loss of genetic diversity have reduced its disease resistance, making it particularly susceptible to diseases. While traditional methods such as chemical control and crop rotation have some local effectiveness, they have long been bottlenecks restricting the development of green industries due to residue problems, environmental pollution, and high costs. Therefore, there is an urgent need to develop new, efficient, safe, environmentally friendly, and targeted biological control strategies to ensure the sustainability of Atractylodes macrocephala cultivation and the safety and quality of medicinal materials.

[0003] The microbial agent described in Chinese patent CN115572702A contains a strain of Bacillus belye containing multiple lipopeptide antibiotic synthesis genes, which can inhibit plant pathogenic fungi and promote plant growth. However, it is mainly derived from soil or rhizosphere, and the advantages of stable colonization of endophytes and host safety are not fully considered. Summary of the Invention

[0004] Based on this, the purpose of this invention is to provide an endophytic bacterium, *Bacillus belyssima*, and its applications. The *Bacillus belyssima* provided by this invention is an endophytic bacterium of *Atractylodes macrocephala*, possessing host adaptability advantages; it also has three functions: broad-spectrum antibacterial activity, prevention and control of root rot or leaf spot diseases, and crop growth promotion. It shows application potential in *Atractylodes macrocephala*, providing a multifunctional germplasm resource for the development of biopesticides and microbial fertilizers.

[0005] The above-mentioned objective of this invention is achieved through the following technical solution: The *Bacillus belye* provided by this invention was isolated from *Atractylodes macrocephala* grown at the Pan'an *Atractylodes macrocephala* cultivation base in Jinhua, Zhejiang Province. It was deposited on September 15, 2025, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, Wuhan, China, with accession number CCTCC M20252027. It possesses the following microbiological characteristics: On LB medium, the endophytic *Bacillus belye* colonies are milky white, round (5-8 mm in diameter), with irregular edges and a dry, wrinkled surface. The above strain is typically preserved using LB medium, and for long-term preservation, 20% glycerol is used.

[0006] This invention first provides a fermentation method for Bacillus belye, which includes seed culture preparation and fermentation culture to obtain a fermentation broth. The fermentation culture conditions are: inoculum size 1% (mass ratio), culture temperature 37℃, and culture time 48h. The fermentation culture medium is (by weight percentage): tryptone 1%, yeast extract 0.5%, sodium chloride 1%, and the remainder is water, pH 7.0-7.2.

[0007] The present invention also provides a microbial agent with Bacillus belye as the active ingredient. The microbial agent can be the fermentation broth obtained by the above method, or it can be a bacterial powder prepared by further adding a carrier, or it can be various dosage forms prepared by adding different adjuvants, such as suspension, wettable powder, water-dispersible granules, etc.

[0008] The present invention also provides the application of the aforementioned Bacillus berreatus or the aforementioned microbial agent in the prevention and control of crop diseases, including root rot and leaf spot of Atractylodes macrocephala.

[0009] The present invention also provides a fermentation broth, using the aforementioned endophytic bacterium *Bacillus belye* as the fermentation bacteria, and the method for preparing the fermentation broth includes the following steps: Step 1: The endophytic bacterium Bacillus belye was cultured in LB seed medium with shaking to obtain the fermentation seed liquid of the endophytic bacillus Bacillus belye. Step 2: Take the fermentation seed liquid prepared in Step 1 and inoculate it into the fermentation medium to obtain the fermentation broth of the endophytic bacterium Bacillus belye.

[0010] Furthermore, in step 1, the shaking culture conditions are 37°C, 180 rpm, and culture for 12 h.

[0011] Further, in step 2, the fermentation seed liquid is inoculated into the fermentation medium at a volume percentage of 1%, and the fermentation conditions are 37°C, 200 rpm, and cultured for 2 days; the fermentation medium formula is characterized by the following by weight percentage: 1% tryptone, 0.5% yeast extract, 1% sodium chloride, and the remainder is water, with a pH of 7.0-7.2.

[0012] The present invention also provides a sterile fermentation filtrate, which is prepared from the above-mentioned fermentation broth. After centrifuging the above-mentioned fermentation broth, the supernatant is filtered through a 0.22μm filter to obtain the sterile fermentation filtrate.

[0013] The present invention also provides a microbial inoculant, comprising the above-mentioned endophytic Bacillus belye, and the above-mentioned fermentation broth or the above-mentioned sterile fermentation filtrate.

[0014] The present invention also provides the application of any one of the above-mentioned endophytic bacteria Bacillus belye, or the above-mentioned fermentation broth, or the above-mentioned sterile fermentation filtrate, or the above-mentioned microbial agent in the prevention and preparation of biocontrol agents for the prevention and control of root rot and wilting of Atractylodes macrocephala.

[0015] The present invention also provides the use of any one of the above-mentioned endophytic bacteria Bacillus belye, or the above-mentioned fermentation broth, or the above-mentioned sterile fermentation filtrate, or the above-mentioned microbial agent in the preparation of an agent that inhibits one or more of Fusarium oxysporum, Fusarium wilt pathogens and Pythium.

[0016] The present invention also provides the application of Bacillus belye or the above-mentioned fermentation broth or the above-mentioned fermentation filtrate in promoting plant growth.

[0017] Furthermore, the promotion of plant growth includes at least one of the following: Increase the germination rate of plant seeds; Increase the length of the sprout or root after the plant seed germinates; Increase the stem length, root length and fresh weight of plant seedlings.

[0018] Furthermore, the plant in question is Atractylodes macrocephala.

[0019] The present invention also provides the application of the aforementioned Bacillus belye or the aforementioned microbial agent in promoting the growth of Atractylodes macrocephala, wherein promoting the growth of Atractylodes macrocephala includes increasing the germination rate of Atractylodes macrocephala seeds; increasing the bud length or root length of Atractylodes macrocephala seeds after germination; and increasing the stem length or root length of Atractylodes macrocephala seedlings.

[0020] The beneficial technical effects of this application are as follows: 1. This invention isolates endophytic bacteria from Atractylodes macrocephala and ultimately screens out a strain that can prevent and control plant diseases and promote plant growth. The strain Amzn015 was identified as Bacillus velezensis by molecular biology and morphological identification.

[0021] 2. The Bacillus berreatus in this invention has a significant inhibitory effect on plant pathogens including Fusarium oxysporum tomato strain, wilt pathogen, and Pythium, and can play a clear role in the prevention and control of Atractylodes macrocephala wilt.

[0022] 3. The Bacillus belye in this invention can increase the germination rate of plant seeds; increase the root length of plant seeds after germination; increase the plant height, root length and fresh weight of plant seedlings, thereby promoting plant growth. Attached Figure Description

[0023] Figure 1 This is a colony morphology diagram of the endophytic bacterium Bacillus belye Amzn015 obtained in the preferred embodiment 1 of the present invention.

[0024] Figure 2 This is the phylogenetic tree of the endophytic bacterium Bacillus belye in the preferred embodiment 2 of the present invention.

[0025] Figure 3 The preferred embodiment of the present invention, Bacillus belyssus, shows the antagonistic effect of this bacterium against Fusarium oxysporum.

[0026] Figure 4 The preferred embodiment of the present invention, Bacillus beryl, shows the antagonistic effect of the bacterium against the wilt disease pathogen.

[0027] Figure 5 The preferred embodiment of the present invention, Bacillus beryl, shows the antagonistic effect of the fungus against Pythium.

[0028] Figure 6 The diagram shows the effect of the medium-terminus bacillus Bacillus berreatus in promoting the germination of Atractylodes macrocephala seeds in the preferred embodiment 4 of the present invention.

[0029] Figure 7 The diagram shows the growth-promoting effect of the bacterium Bacillus berreatus on Atractylodes macrocephala seedlings in the preferred embodiment 5 of the present invention.

[0030] Figure 8 The image shows the potted plant effect of the bacterium Bacillus berreatus in the preferred embodiment 6 of the present invention for controlling root rot of Atractylodes macrocephala. Detailed Implementation

[0031] To better understand and implement this invention, the technical solutions in the embodiments of this invention will be clearly and completely described and discussed below with reference to the accompanying drawings. Obviously, what is described here is only a part of the examples of this invention, not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the protection scope of this invention.

[0032] To facilitate understanding of the embodiments of the present invention, further explanations and descriptions will be provided below with reference to the accompanying drawings and specific embodiments, and these embodiments do not constitute a limitation on the embodiments of the present invention.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0034] culture medium LB medium (solid): 10 g tryptone, 5 g yeast extract, 5 g NaCl, 20 g agar, 1000 mL distilled water, pH natural.

[0035] PDA medium (solid): 200 g peeled potato, 20 g glucose, 18 g agar, 1000 mL distilled water, pH natural.

[0036] The liquid culture medium formulations corresponding to the solid culture media described above are prepared by removing the agar powder from the solid culture medium while keeping other components and concentrations unchanged. For ease of description and comparative experiments, the following endophytic bacterium, *Bacillus belyssae*, is designated Amzn015. Example 1

[0037] Example 1 provides a method for isolating the endophytic bacterium Bacillus belye Amzn015. Rhizome samples of Atractylodes macrocephala collected from a planting base in Pan'an, Zhejiang Province, were washed with tap water and sterile water, and then subjected to surface disinfection in sequence: immersion in 3% NaClO solution for 1 min, immersion in 75% ethanol solution for 3 min, followed by thorough rinsing three times with sterile water. 100 μL of the final rinse water was plated on LB agar plates to verify the disinfection effect. After disinfection, the rhizomes were ground to obtain a homogenate, which was then serially diluted 10-fold (10... -1 Up to 10 -5Three replicates were set up. 100 μL of each dilution was plated on LB agar plates and incubated at 37°C for 24 h to isolate rhizosphere microorganisms. Single colonies after isolation and purification were numbered (starting from Amzn001). One selected bacterium was named Amzn015. Single colonies of strain Amzn015 were picked and streaked continuously on LB medium (solid) for purification. The obtained strain Amzn015 was stored in 80% glycerol at -80°C. Example 2

[0038] Example 2: The 16S rRNA gene of the endophytic bacterium *Bacillus belyssiensis* Amzn015 obtained in Example 1 was sequenced using the extracted genomic DNA as a template and the bacterial 16S rRNA gene primers: Forward primer: AGAGTTTGATCCTGGCTCAG Reverse primer: CGGCTACCTTGTTACGAC PCR amplification and sequencing were performed. The sequencing results were then compared using BLAST on the NCBI website to determine the species of closely related bacteria. 16S rRNA was used as the basis for further analysis. Phylogenetic trees constructed from gene sequences, such as Figure 2 As shown, it was identified as Bacillus velezensis.

[0039] Based on the above test results, combined with morphological, cultural and biological characteristics, the endophytic bacterium Bacillus velezensis Amzn015 was identified as belonging to the genus Bacillus velezensis and named Bacillus velezensis Amzn015. It was deposited at the China Center for Type Culture Collection on September 15, 2025, with the accession number CCTCC M20252027. Example 3

[0040] Example 3 provides an antagonistic assay for the endophytic bacterium Bacillus belyssus Amzn015.

[0041] The antagonistic effect of the endophytic bacterium Bacillus Belaires Amzn015 on pathogens was determined by the plate confrontation method, using the isolated and purified endophytic bacterium Bacillus Belaires Amzn015 as the antagonistic bacterium and Fusarium oxysporum, Fusarium foetensis, and Epicoccum catenisporum as pathogen indicator bacteria.

[0042] Using a sterile punch, collect pathogenic bacterial colonies from the edge to create 8 mm diameter mycelial discs, which are then placed in the center of a new PDA plate. Add 10 μL of Amzn015 fermentation broth in a cross shape at a distance of 2 cm from the mycelial disc. Use an equal volume of LB liquid medium as a control. Each treatment is replicated three times. Incubate the plates at 28°C for 9 days or until the control pathogen has fully colonized the plate. Then measure the pathogen colony radius (Rck) on the control plate and the pathogen colony radius (Rd) on the treated plate. Using the known pathogen mycelial disc radius (Rm = 4 mm), calculate the inhibition rate (V) of each isolated strain against *Fusarium oxysporum* using the formula: inhibition rate (V) = [(Rck - Rd) / (Rck - Rm)] × 100. Where: Rck is the pathogen colony radius on the control plate, Rd is the pathogen colony radius on the treated plate, and Rm is the radius of the pathogen mycelial disc collected by the punch (mm). Figure 3-5 As shown, Figures 3 to 5 The antagonistic inhibition rates against Fusarium oxysporum were 85.75%, against Fusarium foetensis 76.43%, and against Epicoccum catenisporum 72.11%. Example 4

[0043] Example 4 provides the effect of strain Amzn015 in promoting plant growth. Healthy Atractylodes macrocephala seeds were selected, surface-sterilized with 3% NaClO for 1 min, then with 75% ethanol for 3 min, and rinsed 5 times with sterile water. The seeds were then blotted dry on sterile filter paper. Amzn015 was inoculated into LB liquid medium and cultured at 37℃ with shaking until the logarithmic growth phase. The cells were collected by centrifugation and resuspended in sterile PBS to 10⁸ CFU / mL. Sterile filter paper was placed in a petri dish, and 5 mL of the bacterial suspension (PBS was used for the control group) was added, with 15 seeds evenly distributed. The petri dishes were placed in a light incubator (25±1℃, photoperiod 16h / 8h, humidity 70%), with daily replenishment of evaporative moisture. Germination rate (GP) was calculated on day 12 as (number of germinated seeds / total number of seeds tested) × 100. Germinated seeds were transplanted into a 1:1:3 mixture of vermiculite, perlite, and sterile soil. Once the seedlings reached the two-leaf stage, the entire Atractylodes macrocephala seedling was removed. Rinse the roots with clean water, place them in water, and then straighten them. Use a ruler to measure root length and plant height. Plant height is defined as the distance from the ground to the tip of the highest leaf. Place the whole Atractylodes macrocephala plant in a sealed bag filled with distilled water to ensure the entire seedling can fully absorb water. Soak in water for 24 hours, remove excess water with filter paper, and measure fresh weight. Cut the whole Atractylodes macrocephala seedling into small pieces for dry matter measurement and place them in glass petri dishes. Then place them in a forced-air drying oven at 115±10℃ for 30 minutes. Allow the Atractylodes macrocephala seedlings to cool naturally, then place them in a 65℃ oven for 6 hours until the seedlings reach constant weight and weigh them using an electronic balance. All experiments were performed in triplicate, and data are expressed as mean ± standard deviation.

[0044] The results are as follows Figure 6-7 As shown, the experimental results for seed germination root length and seedling height are as follows: Figure 6 and 7 As shown in the figure, the germination rate and germination potential of seeds in the experimental group treated with the fermentation broth of endophytic Bacillus vesicularis Amzn015 were significantly better than those in the control group treated with sterile water. After soaking and culturing seeds in the fermentation broth of endophytic Bacillus vesicularis Amzn015 for 14 days, compared with the distilled water control group, the Amzn015 treatment increased the germination rate of Atractylodes macrocephala seeds by 22.2%; seedling growth parameters were significantly improved, with plant height increasing by 16.6%, root length by 63.5%, dry weight by 72%, and fresh weight by 40.9%. Example 5

[0045] Example 5 provides the effect of fermentation filtrate of strain Amzn015 in preventing root rot of Atractylodes macrocephala. Healthy Atractylodes macrocephala seedlings at the two-leaf stage with a growth cycle of 6 weeks were selected. F. oxysporum was inoculated into PDA medium and cultured at 28°C for 7 days. Mycelia were picked from the colony edge and transferred to PDB liquid medium, then rotated at 180 rpm at 28°C for 5 days. Cells were filtered out using 12 layers of sterile gauze, and spores resuspended in sterile PBS were determined to be at 10⁸ CFU / mL using a hemocytometer. Amzn015 was inoculated into LB solid medium and cultured at 37°C for 12 hours. Single colonies were picked and cultured in LB liquid medium, then rotated at 180 rpm at 37°C for 48 hours. The colonies were resuspended in sterile PBS to 10⁸ CFU / mL. The two-leaf stage seedlings were transplanted into a 1:1:3 mixture of vermiculite, perlite, and sterile soil. The roots were washed and divided into four equal parts, then transplanted into black pots. Seven days prior to treatment, the Amzn015 control group was drenched with a 10⁸ CFU / mL Amzn015 bacterial suspension. The co-treatment groups (Amzn015+Fo) and the infection control group (Fo) were inoculated with a 10⁸ CFU / mL F. oxysporum spore suspension via root drenching, 10 mL per pot. Once obvious symptoms appeared on the Atractylodes macrocephala leaves, the Amzn015 bacterial suspension (10 mL) was inoculated into each pot of the treatment group via root irrigation. An equal volume of PBS was used as a control in the PBS control group (CK).

[0046] Based on a scale of 0–4, the disease severity of aboveground leaves in the control and treatment groups at 65 days was reported (number of yellowing or wilting leaves / total number of leaves: 0 = 0%, 1 = 1–33%, 2 = 34–66%, 3 = 67–100%, 4 = dead plants). The disease index and control effect were calculated using the following formulas: Disease index = [∑(number of diseased plants × representative value) / (total number of plants × highest disease level representative value)] × 100%; Relative control effect = (Disease prevention index - Disease index of treatment) / (Disease prevention index) × 100%.

[0047] The results of the potted plant resistance test for root rot of Atractylodes macrocephala are as follows: Figure 8 As shown, the fermentation broth of the endophytic bacterium Bacillus vesicularis Amzn015 has a good control effect on root rot of Atractylodes macrocephala. After applying the fermentation broth of the endophytic bacterium Bacillus vesicularis Amzn015, the control effect on root rot of Atractylodes macrocephala reached 66.2%, and there were also significant differences in biomass among different treatment groups.

[0048] The technical means disclosed in this invention are not limited to those disclosed in the above embodiments, but also include technical solutions composed of any combination of the above technical features. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications are also considered within the scope of protection of this invention.

Claims

1. An endophytic Bacillus velezensis strain, with the accession number CCTCC M20252027.

2. A fermentation broth, characterized in that, Using the endophytic bacterium *Bacillus belyssioides* as described in claim 1 as the fermentation strain, the method for preparing the fermentation broth includes the following steps: Step 1: The endophytic bacterium Bacillus belye was cultured in LB seed medium with shaking to obtain the fermentation seed liquid of the endophytic bacillus Bacillus belye. Step 2: Take the fermentation seed liquid prepared in Step 1 and inoculate it into the fermentation medium to obtain the fermentation broth of the endophytic bacterium Bacillus belye.

3. The fermentation broth as described in claim 2, characterized in that, In step 1, the shaking culture conditions are 37℃, 180 rpm, and culture for 12 h.

4. The fermentation broth as described in claim 2, characterized in that, In step 2, the fermentation seed liquid is inoculated into the fermentation medium at a volume percentage of 1%, and the fermentation conditions are 37°C, 200 rpm, and cultured for 2 days. The fermentation medium is characterized by the following composition by weight percentage: 1% tryptone, 0.5% yeast extract, 1% sodium chloride, and the remainder is water, with a pH of 7.0-7.

2.

5. A sterile fermentation filtrate, characterized in that, The fermentation broth described in any one of claims 2 to 4 is prepared by centrifuging the fermentation broth described in any one of claims 2 to 4 and filtering the supernatant through a 0.22 μm filter to obtain a sterile fermentation filtrate.

6. A microbial inoculant, characterized in that, It includes the endophytic Bacillus belyssus as described in claim 1, the fermentation broth as described in any one of claims 2 to 4, or the sterile fermentation filtrate as described in claim 5.

7. The application of the endophytic bacterium Bacillus belye according to claim 1, or the fermentation broth according to any one of claims 2 to 5, or the aseptic fermentation filtrate according to claim 5, or the microbial agent according to claim 6, in the prevention and preparation of biocontrol agents for the prevention and control of root rot, wilting or leaf spot of Atractylodes macrocephala.

8. The use of any one of the endophytic bacteria Bacillus vesicularis according to claim 1, or the fermentation broth according to any one of claims 2 to 5, or the sterile fermentation filtrate according to claim 5, or the microbial agent according to claim 6, in the preparation of an agent that inhibits one or more of Fusarium oxysporum, Fusarium wilt pathogens and Pythium.

9. The application of the endophytic bacterium Bacillus belye according to claim 1, or the fermentation broth according to any one of claims 2 to 5, or the aseptic fermentation filtrate according to claim 5, or the microbial agent according to claim 6, in promoting plant growth.

10. The application according to claim 9, characterized in that, The promotion of plant growth includes at least one of the following: Increase the germination rate of plant seeds; Increase the length of the sprout or root after the plant seed germinates; Increase the stem length, root length and fresh weight of plant seedlings.

Images