Gene related to synthesis of amygdalin by crop seed endosperm and application thereof
By introducing key enzyme genes into the endosperm of crop seeds, constructing a multi-gene recombinant vector, and transferring it into rice, amygdalin production was achieved efficiently, solving the problems of low yield and high pollution in existing technologies, and improving storage time and production efficiency.
Patent Information
- Application Number
- CN202511790242.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-01
- Publication Date
- 2026-01-09
AI Technical Summary
Existing technologies make it difficult to efficiently produce amygdalin from crop seed endosperm, leading to pest infestation and shortened storage time. Furthermore, industrial extraction methods suffer from low yields and significant pollution.
By introducing the CYP79D16, CYP71AN24, UGT94AF3, and UGT94AF2 genes into crops, a multi-gene recombinant vector was constructed. This vector was then transferred into rice endosperm using Agrobacterium-mediated transformation, achieving efficient synthesis and accumulation of amygdalin.
It significantly increased the yield of amygdalin in crop seed endosperm, extended the seed storage period, and provided a safe and simple production route for amygdalin.
Smart Images

Figure CN121294470A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to genes and their applications related to the synthesis of amygdalin in crop seed endosperm. Background Technology
[0002] Amygdalin, also known as vitamin B17, chemically named phenylhydroxyacetonitrile-β-D-glucoside, is the main active ingredient in the traditional Chinese medicine bitter almond. It is widely found in the seeds of Rosaceae plants such as apricots, peaches, plums, and apples, with the highest content in bitter almonds (Prunus dulcis), reaching 2%–3% of the seed weight. In animals, amygdalin decomposes under the action of specific enzymes (such as β-glucosidase) to produce compounds such as hydrocyanic acid (HCN) and benzaldehyde. Hydrocyanic acid is the main active ingredient of amygdalin, and small doses can exert certain pharmacological effects. Clinically, amygdalin is used for antitussive and antiasthmatic purposes, laxative effects, anti-inflammatory and analgesic effects, immunomodulation, and has anti-tumor potential. Furthermore, amygdalin is a natural insect-repellent component in plants, exhibiting a feeding deterrent effect on insects, and has important application potential in research on the storage tolerance of crop seeds. However, a lack of amygdalin in crop seeds makes them susceptible to pest infestation during production and storage.
[0003] In almonds, the synthesis of amygdalin begins with phenylalanine, which is oxidized by cytochrome oxidase PdCYP79D16 to produce phenylacetaldehyde oxime, and then further oxidized by cytochrome oxidase PdCYP71AN24 to produce mandelinnitrile. Mandelinnitrile, under the action of uracil glycosyltransferases PdUGT94AF3 and PdUGT94AF2, combines with a glucose group provided by uridine diphosphate glucose to successively generate arbutin and amygdalin. Currently, the industrial production of amygdalin mainly involves extraction from peeled bitter almond meal, but this method faces problems such as low yield and high pollution. Therefore, using genetic engineering techniques to mass-produce amygdalin using crops as bioreactors can solve these problems. Synthesizing amygdalin in crop endosperm can also reduce yield reduction and quality degradation caused by pests, and significantly improve seed storage time. Crops are rich in phenylalanine, the precursor of amygdalin, and the functional enzymes of the amygdalin synthesis pathway have been cloned and analyzed; therefore, using crops as a substrate for amygdalin production is feasible.
[0004] Rice is an important food crop and model plant. Rice endosperm has been widely used as a bioreactor to produce bioactive metabolites, such as "Golden Rice" rich in β-carotene, "Purple Crystal Rice" rich in anthocyanins, and "Red Crystal Rice" rich in astaxanthin, earning it the name "crop molecular farm." Utilizing genetic engineering methods to increase and enhance the synthesis of specific functional substances in rice endosperm offers advantages such as high yield, low cost, simple extraction process, and high safety. Currently, there are no reports of producing amygdalin in rice endosperm. Therefore, how to efficiently produce amygdalin in endosperm through genetic engineering and synthetic biology methods is a scientific question worthy of in-depth research. Summary of the Invention
[0005] The purpose of this invention is to provide genes related to the synthesis of amygdalin in crop seed endosperm and their applications, in order to solve the problems existing in the prior art. The introduction of the CYP79D16, CYP71AN24, UGT94AF3, and UGT94AF2 genes into crops can significantly increase the yield of amygdalin in crop seed endosperm, providing an effective biological pathway and scientific basis for the production of amygdalin from crops.
[0006] To achieve the above objectives, the present invention provides the following solution:
[0007] In a first aspect, the present invention provides genes related to the synthesis of amygdalin in crop seed endosperm, said genes comprising any of the following:
[0008] (1) The CYP79D16 and CYP71AN24 genes, whose nucleotide sequences are shown in SEQ ID NO.1-2;
[0009] (2) The nucleotide sequences of the CYP79D16 gene, CYP71AN24 gene and UGT94AF3 gene are shown in SEQ ID NO. 1-3;
[0010] (3) The nucleotide sequences of the CYP79D16 gene, CYP71AN24 gene, UGT94AF3 gene and UGT94AF2 gene are shown in SEQ ID NO.1-4.
[0011] Secondly, the present invention also provides a protein encoded by the aforementioned gene.
[0012] Thirdly, the present invention also provides a recombinant vector containing the aforementioned gene.
[0013] Fourthly, the present invention also provides a recombinant bacterium containing the recombinant vector.
[0014] Fifthly, the present invention also provides a method for constructing a transgenic crop in which the seed endosperm can synthesize amygdalin using the aforementioned gene, comprising any of the following methods:
[0015] (1) The CYP79D16 gene and the CYP71AN24 gene were introduced into crops to obtain transgenic crops that synthesize amygdalin in seed endosperm.
[0016] (2) The CYP79D16 gene, CYP71AN24 gene and UGT94AF3 gene were introduced into crops to obtain transgenic crops that synthesize amygdalin in seed endosperm.
[0017] (3) Introduce the CYP79D16 gene, CYP71AN24 gene, UGT94AF3 gene and UGT94AF2 gene into crops to obtain transgenic crops that synthesize amygdalin in seed endosperm.
[0018] Preferably, the method for obtaining the transgenic crop in method (3) includes the following steps:
[0019] The CYP79D16 gene and the CYP71AN24 gene were linked by the linker peptide F2A to obtain fusion gene I. The fusion gene I was then fused with a strong expression promoter in the endosperm of the breeding crop to construct gene expression cassette I.
[0020] The UGT94AF3 and UGT94AF2 genes were linked by the linker peptide P2A to obtain fusion gene II. The fusion gene II was then fused with a strong expression promoter in the endosperm of the breeding crop to construct gene expression cassette II.
[0021] Gene expression cassette I and gene expression cassette II were transferred into an expression vector to construct a multi-gene recombinant vector containing the CYP79D16 gene, CYP71AN24 gene, UGT94AF3 gene and UGT94AF2 gene.
[0022] The multi-gene recombinant vector was introduced into crops to obtain transgenic crops in which seed endosperm synthesizes amygdalin.
[0023] Preferably, the gene sequence encoding the linker peptide F2A is shown in SEQ ID NO.5, and the gene sequence encoding the linker peptide P2A is shown in SEQ ID NO.6;
[0024] The strong expression promoter of the endosperm of the breeding crop includes Pens1 or Pens2, the nucleotide sequence of which is shown in SEQ ID NO.7 and the nucleotide sequence of which is shown in SEQ ID NO.8.
[0025] Preferably, the crop includes rice, corn, or wheat.
[0026] In a sixth aspect, the present invention also provides the application of the seed endosperm of a transgenic crop constructed by the gene, the protein, the recombinant vector, the recombinant bacteria, or the method described herein in the production of amygdalin.
[0027] In a seventh aspect, the present invention also provides a method for producing amygdalin from crop seed endosperm, comprising the steps of constructing a transgenic crop using the method, obtaining the seed endosperm of the transgenic crop, and separating and extracting amygdalin from the seed endosperm.
[0028] The present invention discloses the following technical effects:
[0029] This invention utilizes the modified pCambia1300e to construct a recombinant gene containing four key enzymes (rCYP79D16, rCYP71AN24, rUGT94AF3, and rUGT94AF2) in its T-DNA region, linked in pairs via 2A peptide coding sequences to form rCYP79D16-F2A-rCYP71AN24 and rUGT94AF3-P2A-rUGT94AF2. The rCYP79D16-F2A-rCYP71AN24 and rUGT94AF3-P2A-rUGT94AF2 genes are respectively controlled by rice endosperm-specific promoters in multi-gene vectors (binary vectors). Transgenic rice lines are obtained by transferring these multi-gene vectors, which aggregate the four target genes, into rice using Agrobacterium-mediated transformation. These four target genes are specifically expressed in the endosperm, and the transgenic rice that synthesizes and accumulates amygdalin in the endosperm with a high efficiency (up to 15.62 μg / g) can have its rice seeds directly consumed or used as raw materials for extraction and processing.
[0030] This invention marks the first successful synthesis of amygdalin in the endosperm of crops (especially rice). The product can be consumed directly or used as a raw material for amygdalin production. This transgenic crop also significantly extends the seed storage period. This invention has significant guiding significance and practical value for the breeding of novel functional crops. Furthermore, this invention enables the accumulation of useful active substances or nutrients (amygdalin) during the endosperm synthesis process in crop seeds. Therefore, this invention provides a technical method for multi-gene genetic engineering operations on important and complex biosynthetic pathways and important agronomic traits, and has significant application value. Attached Figure Description
[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0032] Figure 1 The diagram shows the structures of the multi-gene vectors p1300-C, p1300-CC, p1300-CCU, and p1300-CCUU, which contain one to four key genes in the amygdalin synthesis pathway (rCYP79D16, rCYP71AN24, rUGT94AF3, and rUGT94AF2); HPT in the T-DNA region is the hygromycin resistance gene.
[0033] Figure 2 PCR detection of four exogenous genes (ORFs) in rice transformants incorporating p1300-C, p1300-CC, p1300-CCU, and p1300-CCUU was performed. NGZ (WT) was the wild-type control genomic DNA. p1300-C#1, #2, #3, p1300-CC#1, #2, #3, p1300-CCU#1, #2, #3, and p1300-CCUU#1, #2, #3 were rice genomic DNAs carrying the four expression vectors, respectively.
[0034] Figure 3 Appearance of transgenic rice grains and brown rice of p1300-C, p1300-CC, p1300-CCU, and p1300-CCUU synthesized amygdalin or its intermediate metabolites; wild type is recipient variety Nan Guizhan; scale bar is 1 cm;
[0035] Figure 4 To detect the expression of four exogenous genes in seeds of rice transformants p1300-C, p1300-CC, p1300-CCU, and p1300-CCUU 20 days after pollination by RT-PCR; NGZ (WT) was used as the wild-type control; and rice Actin1 was used as the internal reference gene.
[0036] Figure 5 Metabolites in the endosperm of p1300-C, p1300-CC, p1300-CCU and p1300-CCUU transgenic rice seeds were detected by LC-MS.
[0037] Figure 6The values represent the contents of phenylacetaldehyde oxime (A), mandelinnitriles (B), pyruvic glycoside (C), and amygdalin (D) in the endosperm of transgenic rice seeds from NGZ (wild-type control), p1300-C (C), p1300-CC (CC), p1300-CCU (CCU), and p1300-CCUU (CCUU); ND indicates not detected.
[0038] Figure 7 This study analyzed the feeding preferences of rice weevils for p1300-C (C), p1300-CC (CC), p1300-CCU (CCU), p1300-CCUU (CCUU), and wild-type (NGZ) rice seeds during rice seed storage. Significant differences were found between the different letters (P < 0.05). Among them, A is the circular plastic container used to determine the selectivity of rice weevils to rice, B is a schematic diagram of the positions of the six types of rice placed in the circular plastic container, and C is the selection rate. Detailed Implementation
[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0040] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0041] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0042] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0043] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0044] Example 1: A transgenic breeding method for producing amygdalin in rice endosperm
[0045] This embodiment demonstrates that introducing the key recombinant genes rCYP79D16, rCYP71AN24, rUGT94AF3, and rUGT94AF2 into rice can significantly increase the yield of amygdalin in the endosperm. Specifically, a transgenic breeding method for producing amygdalin in rice endosperm is established, including the following steps:
[0046] 1. Construction of four key gene expression cassettes
[0047] 1.1 Synthesis of coding regions of four key genes (rCYP79D16, rCYP71AN24, rUGT94AF3, and rUGT94AF2)
[0048] Using the almond CYP79D16 gene (GenBank No. GU573413.1) as a template, codons were optimized using the Codon Optimization Tool based on the codon preferences of monocots and rice, and the nucleotide sequence rCYP79D16 as shown in SEQ ID NO.1 was synthesized, cloned into a plasmid vector, and sequenced to determine its sequence. Using the almond CYP71AN24 gene (GenBank No. XM_034360738.1) as a template, codons were optimized using the Codon Optimization Tool based on the codon preferences of monocots and rice, and the nucleotide sequence rCYP71AN24 as shown in SEQ ID NO.2 was synthesized, cloned into a plasmid vector, and sequenced to determine its sequence. Using the almond UGT94AF3 gene (GenBank No. MH969427.1) as a template, codons were optimized using the Codon Optimization Tool based on the codon preferences of monocots and rice, and the nucleotide sequence rCYP71AN24 as shown in SEQ ID NO.2 was synthesized. The nucleotide sequence rUGT94AF3 shown in NO.3 was cloned into a plasmid vector and its sequence was determined by sequencing. Using the almond UGT94AF2 gene (GenBank No. MH969428.1) as a template, the codons were optimized using the Codon Optimization Tool based on the codon preferences of monocotyledons and rice, and the nucleotide sequence rUGT94AF2 shown in SEQ ID NO.4 was synthesized, cloned into a plasmid vector, and its sequence was determined by sequencing.
[0049]
[0050]
[0051]
[0052]
[0053] 1.2 Synthesis of the F2A peptide coding sequence and acquisition of the rCYP79D16-F2A-rCYP71AN24 fusion gene
[0054] Based on the F2A protein sequence (GSVKQTLNFDLLKLAGDVESNPGPGS, SEQ ID NO.11), and following the codon preferences of monocotyledons and rice, codons were optimized using the Codon Optimization Tool to synthesize the F2A nucleotide sequence shown in SEQ ID NO.5. The rCYP79D16, rCYP71AN24, and F2A fragments were amplified using primers and ligated using the Gibson assembly principle to obtain the rCYP79D16-F2A-rCYP71AN24 fusion gene. The primers and amplification conditions used are as follows:
[0055] Primer F-CYP79D16 ORF: 5'-ATGGAAGCTAACGTGGGCTT-3' (SEQ ID NO.12);
[0056] Primer R-CYP79D16-2A ORF: 5'-TACTCAACGTCGCCAGCGAGCTTGAGGAGGTCGAAGTTGAGGGTCTGCTTAACGGAGCCAGTTTGGTACACGTGCGCCG-3' (SEQ ID NO. 13);
[0057] The rCYP79D16 gene and part of the F2A sequence were amplified, approximately 1.7 kb.
[0058] Primer F-2A-CYP71AN24 ORF: 5'-CAAGCTCGCTGGCGACGTTGAGTCCAATCCAGGACCGGGCTCCATGGCGCTGTTGACCTTGTT-3' (SEQ ID NO. 14);
[0059] Primer R-CYP71AN24 ORF: 5'-TCAGGGGGAGTAGGGCGTAG-3' (SEQ ID NO.15);
[0060] The rCYP71AN24 gene and part of the F2A sequence were amplified, approximately 1.6 kb.
[0061] Amplification system: 2× Phanta Max Buffer, 15 µL; 10 mM dNTP Mix, 0.6 µL; PhantaMax, 0.4 U; 10 µM F and R primer pair, 0.9 µL (final concentration 0.3 µM); ddH2O to bring the total to 30 µL.
[0062] The amplification program used was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 1 min / kb, for a total of 30 cycles; and finally 72℃ extension for 3 min.
[0063] Optimized F2A coding region sequence (SEQ ID NO.5): GGCTCCGTTAAGCAGACCCTCAACTTCGACCTCCTCAAGCTCGCTGGCGACGTTGAGTCCAATCCAGGACCGGGCTCC.
[0064] 1.3 Synthesis of the P2A peptide coding sequence P2A and acquisition of the rUGT94AF3-P2A-rUGT94AF2 fusion gene
[0065] Based on the P2A protein sequence (GSATNFSLLKQAGDVEENPGPGS, SEQ ID NO.16), and following the codon preferences of monocotyledons and rice, codons were optimized using the Codon Optimization Tool to synthesize P2A with the nucleotide sequence shown in SEQ ID NO.6. The rUGT94AF3, rUGT94AF2, and P2A fragments were amplified using primers and ligated using the Gibson assembly principle to obtain the rUGT94AF3-P2A-rUGT94AF2 fusion gene. The primers and amplification conditions used are as follows:
[0066] Primer F-UGT94AF3 ORF: 5'-ATGGATAGCAGTCAGCAAAGAAAG-3' (SEQ ID NO.17);
[0067] Primer R-UGT94AF3-2A ORF: 5'-ACGTCACCAGCCTGTTCAAGAGAGAGAAGTTAGTAGCGGAGCCCTCTTTTCTCATACAGAGCT-3' (SEQ ID NO. 18);
[0068] The rUGT94AF3 gene and part of the P2A sequence were amplified, approximately 1.4 kb.
[0069] Primer F-2A-UGT94AF2 ORF: 5'-TCTCTTGAAACAGGCTGGTGACGTTGAAGAGAACCCTGGTCCTGGCTCCATGGTGTATTCCGAGCATAAG-3' (SEQ ID NO. 19);
[0070] Primer R-UGT94AF2 ORF: 5'-TCACTTAAATGTGCTAATTTGTTTCCC-3' (SEQ ID NO.20);
[0071] The rUGT94AF2 gene and part of the P2A sequence were amplified, approximately 1.4 kb.
[0072] Amplification system: 2× Phanta Max Buffer, 15 µL; 10 mM dNTP Mix, 0.6 µL; PhantaMax, 0.4 U; 10 µM F and R primer pair, 0.9 µL (final concentration 0.3 µM); ddH2O to bring the total to 30 µL.
[0073] The amplification program used was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 1 min / kb, for a total of 30 cycles; and finally 72℃ extension for 3 min.
[0074] Optimized P2A coding region sequence (SEQ ID NO.6): GGCTCCGCTACTAACTTCTCTCTCTTGAAACAGGCTGGTGACGTTGAAGAGAACCCTGGTCCTGGCTCC.
[0075] 2. Assembly of multi-gene vectors p1300-C, p1300-CC, p1300-CCU, and p1300-CCUU for rice endosperm-specific synthesis of amygdalin and its upstream metabolites.
[0076] The multi-gene vector is a modified pCambia1300e vector containing multiple cloning sites Asc I-Swa I-Sac I-Mlu I-Pac I-Sbf I, which can be used for multi-gene expression cassette assembly; it also contains an HPT expression cassette, which can be used for crop genetic transformation screening.
[0077] 2.1 Construction of the expression vector p1300-C containing rCYP79D16
[0078] pCambia1300e was digested with the restriction endonuclease Asc I to obtain vector backbone fragment a; using rice genomic DNA as a template, the promoter Pens1 (SEQ ID NO. 7) of the rice endosperm-specific storage protein gene (GenBank No. BAC83236.1) was amplified to obtain fragment b; the rCYP79D16 gene was amplified to obtain fragment c; and the manopine synthase terminator Tmas (SEQ ID NO. 9) was amplified from plasmid pSAT3 (GenBank No. DQ005465) to obtain fragment d. Each fragment is flanked by 25 bp homologous sequences. Using the Gibson assembly principle and following a one-step multi-fragment assembly method for plasmid vectors (Zhu et al., 2014, Robust multi-type plasmid modifications based on isothermal in vitro recombination. Gene, 548: 39-42.), the vector p1300-C containing the rCYP79D16 gene expression cassette was obtained (see...). Figure 1 The primers used are as follows:
[0079] Primer F-Pens1: 5'-CAATCGCACTGGAAACATCAAGGTCTACAGGGTTCCTGCGTGAAG-3' (SEQ ID NO. 21);
[0080] Primer R-Pens1: 5'-AGCTATTTGAGGATGTTATTGGAAACT-3' (SEQ ID NO.22);
[0081] Amplify the Pens1 promoter sequence of approximately 1.5 kb, i.e. fragment b.
[0082] Primer F-Pens1-rCYP79D16: 5'-TTCCAATAACATCCTCAAATAGCTATGGAAGCTAACGTGGGCTT-3' (SEQ ID NO.23);
[0083] Primer R-rCYP79D16-Tmas: 5'-CCAAGATTTCGAGATCAGGTACGCGTTCAAGTTTGGTACACGTGCG-3' (SEQ ID NO. 24);
[0084] The coding frame of the rCYP79D16 gene, approximately 1.7 kb, was amplified, namely fragment c.
[0085] Primer F-Tmas: 5'-ACCTGATCTCGAAATCTTGG-3' (SEQ ID NO.25);
[0086] Primer R-Tmas: 5'-GCCTGCAGGTTAATTAAGGCGCGCCGATCTGATAATTTATTTGAA-3' (SEQ ID NO. 26);
[0087] Amplify the Tmas terminator sequence, approximately 0.3 kb, i.e. fragment d.
[0088] The PCR amplification reaction system and procedure are the same as described above.
[0089]
[0090] Terminator Tmas sequence (SEQ ID NO.9): acctgatctcgaaatcttggactcccatgttggcaaaggcaaccaaacaaacaatgaatgatccgctcctgcatatggggcggtttgagtatttcaactgccatttgggctgaattgaagacatgctcctgtca gaaattccgtgatcttactcaatattcagtaatctcggccaatatcctaaatgtgcgtggctttatctgtctttgtattgtttcatcaattcatgtaacgtttgcttttcttatgaattttcaaataaattatcagatc.
[0091] 2.2 Construction of the expression vector p1300-CC containing rCYP79D16 and rCYP71AN24
[0092] pCambia1300e was digested with the restriction endonuclease Asc I to obtain vector backbone fragment a; using rice genomic DNA as a template, the promoter Pens1 (SEQ ID NO. 7) of the rice endosperm-specific storage protein gene (GenBank No. BAC83236.1), approximately 1.5 kb, was amplified as fragment b; the rCYP79D16-F2A-rCYP71AN24 fusion gene was amplified as fragment c; and the manopine synthase terminator Tmas (SEQ ID NO. 9) was amplified from plasmid pSAT3 as fragment d. Each fragment was flanked by 25 bp homologous sequences. Using the principle of Gibson assembly, the vector p1300-CC containing the rCYP79D16 and rCYP71AN24 gene expression cassettes was obtained using a one-step assembly method for multiple fragments of plasmid vectors (see...). Figure 1 The primers used are as follows:
[0093] Primer F-Pens1: 5'-CAATCGCACTGGAAACATCAAGGTCTACAGGGTTCCTGCGTGAAG-3' (SEQ ID NO. 21);
[0094] Primer R-Pens1: 5'-AGCTATTTGAGGATGTTATTGGAAACT-3' (SEQ ID NO.22);
[0095] Amplify the Pens1 promoter sequence of approximately 1.5 kb, i.e. fragment b.
[0096] Primer F-Pens1-rCYP79D16: 5'-TTCCAATAACATCCTCAAATAGCTATGGAAGCTAACGTGGGCTT-3' (SEQ ID NO.23);
[0097] Primer R-rCYP71AN24-Tmas: 5'-GGAGTCCAAGATTTCGAGATCAGGTTCAGGGGGAGTAGGGCGTAG-3' (SEQ ID NO. 27);
[0098] The coding frame of the rCYP79D16-F2A-rCYP71AN24 fusion gene, approximately 3.3 kb, was amplified, namely fragment c.
[0099] Primer F-Tmas: 5'-ACCTGATCTCGAAATCTTGG-3' (SEQ ID NO.25);
[0100] Primer R-Tmas: 5'-GCCTGCAGGTTAATTAAGGCGCGCCGATCTGATAATTTATTTGAA-3' (SEQ ID NO. 26);
[0101] Amplify the Tmas terminator sequence, approximately 0.3 kb, i.e. fragment d.
[0102] 2.3 Construction of the expression vector p1300-CCU containing rCYP79D16, rCYP71AN24, and rUGT94AF3
[0103] p1300-CC was digested with restriction endonuclease Mlu I to obtain vector backbone fragment a; using rice genomic DNA as a template, the promoter Pens2 (SEQ ID NO. 8) of the rice endosperm-specific storage protein gene (GenBank No. BAC19997.1) was amplified to obtain fragment b; the rUGT94AF3 gene was amplified to obtain fragment c; and the nopaline synthase terminator Tnos (SEQ ID NO. 10) was amplified from plasmid pYLCRISPR / Cas9Pubi-H (GenBank No. KR029109.1) to obtain fragment d. Each fragment was flanked by 25 bp homologous sequences. Using the Gibson assembly principle and following the one-step assembly method of multi-fragment plasmid vectors, the vector p1300-CCU containing the rCYP79D16, rCYP71AN24, and rUGT94AF3 gene expression cassettes was obtained (see...). Figure 1 The primers used are as follows:
[0104] Primer F-Pens2: 5'-GAATTTTCAAATAAATTATCAGATCACAGATTCTTGCTACCAACAAC-3' (SEQ ID NO. 28);
[0105] Primer R-Pens2: 5'-AGCTATTTGTACTTGCTTATGG-3' (SEQ ID NO.29);
[0106] Amplify the approximately 2.4 kb sequence of the Pens2 promoter, i.e., fragment b.
[0107] Primer F-Pens2-rUGT94AF3: 5'-TTTCCATAAGCAAGTACAAATAGCTATGGATAGCAGTCAGCAAAGAAAG-3' (SEQ ID NO. 30);
[0108] Primer R-rUGT94AF3-Tnos: 5'-CTTTATTGCCAAATGTTTGAACGGCGCGCCTCACTCTTTTCTCATACAGAGCT-3' (SEQ ID NO. 31);
[0109] The coding frame of the rUGT94AF3 gene, approximately 1.4 kb, was amplified, namely fragment c.
[0110] Primer F-Tnos: 5'-CGTTCAAACATTTGGCAATAAAG-3' (SEQ ID NO. 32);
[0111] Primer R-Tnos: 5'-GTATCCTGGCCTGCAGGTTAATTAACCCGATCTAGTAACATAGATGAC-3' (SEQ ID NO. 33);
[0112] Amplify the Tnos terminator sequence of approximately 0.3 kb, i.e., fragment d.
[0113] The amplification systems described above were as follows: 2× Phanta Max Buffer, 15 µL; 10 mM dNTP Mix, 0.6 µL; Phanta Max, 0.4 U; 10 µM F and R primer pairs, 0.9 µL each (final concentration 0.3 µM); ddH2O to bring the total to 30 µL.
[0114] The amplification program used was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 1 min / kb, for a total of 30 cycles; and finally 72℃ extension for 3 min.
[0115]
[0116] Terminator Tnos sequence (SEQ ID NO.10): cgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacatgtaatgcatgacg ttatttatgagatgggtttttatgattagagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcggg.
[0117] 2.4 Construction of the expression vector p1300-CCUU containing rCYP79D16, rCYP71AN24, rUGT94AF3, and rUGT94AF2
[0118] p1300-CC was digested with restriction endonuclease Mlu I to obtain vector backbone fragment a; using rice genomic DNA as a template, the promoter Pens2 (SEQ ID NO. 8) of the rice endosperm-specific storage protein gene (GenBank No. BAC19997.1) was amplified to obtain fragment b; the rUGT94AF3-P2A-rUGT94AF2 fusion gene was amplified to obtain fragment c; and the nopaline synthase terminator Tnos was amplified from plasmid pYLCRISPR / Cas9Pubi-H (GenBank No. KR029109.1) to obtain fragment d. Each fragment was flanked by 25 bp homologous sequences. Using the Gibson assembly principle and following the one-step assembly method of multi-fragment plasmid vectors, the vector p1300-CCUU containing the gene expression cassettes rCYP79D16, rCYP71AN24, rUGT94AF3, and rUGT94AF2 was obtained (see...). Figure 1 The primers used are as follows:
[0119] Primer F-Pens2: 5'-GAATTTTCAAATAAATTATCAGATCACAGATTCTTGCTACCAACAAC-3' (SEQ ID NO. 28);
[0120] Primer R-Pens2: 5'-AGCTATTTGTACTTGCTTATGG-3' (SEQ ID NO.29);
[0121] Amplify the approximately 2.4 kb sequence of the Pens2 promoter, i.e., fragment b.
[0122] Primer F-Pens2-rUGT94AF3: 5'-TTTCCATAAGCAAGTACAAATAGCTATGGATAGCAGTCAGCAAAGAAAG-3' (SEQ ID NO. 30);
[0123] Primer R-rUGT94AF2-Tnos: 5'-CTTTATTGCCAAATGTTTGAACGTCACTTAAATGTGCTAATTTGTTTCCC-3' (SEQ ID NO. 34);
[0124] The coding frame of the rUGT94AF3-2A-rUGT94AF2 fusion gene, approximately 2.8 kb, was amplified, namely fragment c.
[0125] Primer F-Tnos: 5'-CGTTCAAACATTTGGCAATAAAG-3' (SEQ ID NO. 32);
[0126] Primer R-Tnos: 5'-GTATCCTGGCCTGCAGGTTAATTAACCCGATCTAGTAACATAGATGAC-3' (SEQ ID NO. 33);
[0127] Amplify the Tnos terminator sequence of approximately 0.3 kb, i.e., fragment d.
[0128] The amplification systems described above were as follows: 2× Phanta Max Buffer, 15 µL; 10 mM dNTP Mix, 0.6 µL; Phanta Max, 0.4 U; 10 µM F and R primer pairs, 0.9 µL each (final concentration 0.3 µM); ddH2O to bring the total to 30 µL.
[0129] The amplification program used was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 1 min / kb, for a total of 30 cycles; and finally 72℃ extension for 3 min.
[0130] 3. Transformation and detection of rice using multi-gene vectors p1300-C, p1300-CC, p1300-CCU, and p1300-CCUU
[0131] 3.1 Genetic transformation of rice
[0132] The multi-gene vectors p1300-C, p1300-CC, p1300-CCU, and p1300-CCUU plasmids were transformed into Agrobacterium EHA105 for transforming rice embryo callus. Immature or mature rice seeds were used to induce callus formation under 25°C and darkness. An appropriate amount of Agrobacterium was suspended in an infection medium containing 100 μmol / L acetylsyleugenone and cultured at 28°C with shaking (200 rpm, 0.5 h). OD was adjusted using a spectrophotometer. 550 A value of 0.3-0.4 is sufficient for callus inoculation. Select fresh, pale yellow, vigorously growing granular embryogenic callus tissue, mix it with Agrobacterium tumefaciens solution, soak for 20 min, aspirate the solution, transfer to co-culture medium, and incubate in the dark for 3 days. Then transfer to selection medium containing 50 mg / L hygromycin, subculture twice every 2 weeks. After resistance selection, transfer resistant callus with green spots to differentiation medium to differentiate into transformed plantlets.
[0133] The components and amounts of the culture medium mentioned above are as follows:
[0134] Infection medium: 10×MS macro 100 mL of stock solution, 1000 × B5 micro 1 mL of stock solution, 100×B5 vit 10 mL of stock solution, 2 mg of 2,4-D, 500 mg of hydrolyzed casein, 2 g of inositol, 30 g of sucrose, 100 μmol of acetylsuccinone, pH adjusted to 5.5, and ddH2O added to bring the total volume to 1 L.
[0135] Co-culture medium: 10×MS macro 100 mL of stock solution, 1000 × B5 micro 1 mL of stock solution, 100×B5 vit 10 mL of stock solution, 2 mg of 2,4-D, 500 mg of hydrolyzed casein, 2 g of inositol, 30 g of sucrose, 100 μmol of acetylsuccinone, 8 g of agar, pH adjusted to 5.5, and ddH2O added to bring the total volume to 1 L.
[0136] Screening medium: 10×N6 macro 100 mL of stock solution, 1000 × B5 micro 1 mL of stock solution, 100×B5 vit10 mL of stock solution, 2 mg of 2,4-D, 300 mg of hydrolyzed casein, 500 mg of L-proline, 500 mg of L-glutamine, 30 g of sucrose, 8 g of agar, pH adjusted to 5.8, ddH2O added to 1 L; after high-temperature sterilization and cooling, add 1 mL each of 1000× ceftriaxone sodium (cef), 1000× carbenicillin (carb), and 1000× hygromycin (Hm) antibiotics.
[0137] Differentiation medium: 10×N6 macro 100 mL of stock solution, 1000×MS micro 1 mL of stock solution, 100×B5 vit 10 mL of stock solution, 3 mg of BA, 1 mg of NAA, 18.2 g of sorbitol, 20 g of sucrose, 8 g of agar, pH adjusted to 5.8, and ddH2O added to bring the total volume to 1 L.
[0138] 3.2 Genomic PCR detection of transformed plants
[0139] Genomic DNA was extracted from leaves of T0 generation plants using the SDS method and used as templates. PCR amplification was then used to detect exogenous rCYP79D16, rCYP71AN24, rUGT94AF3, and rUGT94AF2 transgenes. The primers used are as follows:
[0140] Primer F-rCYP79D16: 5'-ATGGAAGCTAACGTGGGCTT-3' (SEQ ID NO.12);
[0141] Primer R-rCYP79D16: 5'-TCAAGTTTGGTACACGTGCG-3' (SEQ ID NO. 34);
[0142] The coding frame of the rCYP79D16 gene was amplified by approximately 1.6 kb.
[0143] Primer F-rCYP71AN24: 5'-ATGGCGCTGTTGACCTTGTT-3' (SEQ ID NO.35);
[0144] Primer R-rCYP71AN24: 5'-TCAGGGGGAGTAGGGCGTAG-3' (SEQ ID NO.15);
[0145] The coding frame of the rCYP71AN24 gene was amplified by approximately 1.6 kb.
[0146] Primer F-rUGT94AF3: 5'-ATGGATAGCAGTCAGCAAAGAAAG-3' (SEQ ID NO.17);
[0147] Primer R-rUGT94AF3: 5'-tcactcttttctcatacagagctgg-3' (SEQ ID NO.36);
[0148] The coding frame of the rUGT94AF3 gene was amplified by approximately 1.4 kb.
[0149] Primer F-rUGT94AF2: 5'-ATGGTGTATTCCGAGCATAAG-3' (SEQ ID NO. 37);
[0150] Primer R-rUGT94AF2: 5'-TCACTTAAATGTGCTAATTTGTTTCCC-3' (SEQ ID NO.20);
[0151] The coding frame of the rUGT94AF2 gene was amplified by approximately 1.4 kb.
[0152] The amplification program used was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 sec, 58℃ annealing for 30 sec, 72℃ extension for 2 min, for a total of 30 cycles; and finally 72℃ extension for 3 min.
[0153] The results showed that the wild-type (WT) controls could not amplify the exogenous gene, while the transgenic plants could amplify one to four of the four genes mentioned above (see...). Figure 2 ).
[0154] 3.3 Observation of the appearance of transgenic rice seeds
[0155] Compared with wild-type seeds, there was no significant difference in brown rice (hulled) from transgenic rice seeds inoculated with p1300-C, p1300-CC, p1300-CCU, and p1300-CCUU (see [link to original text]). Figure 3 This indicates that genetic modification does not affect the appearance quality of rice seeds.
[0156] 3.4 RT-PCR detection of seeds from transgenic plant T1
[0157] Seeds of the T1 generation of transgenic plants, 20 days after pollination, were ground into powder under liquid nitrogen conditions. Total RNA was extracted from the seeds using the Trizol method, and cDNA was obtained by reverse transcription using the TransScript cDNA synthesis kit. RT-PCR detection of the rCYP79D16, rCYP71AN24, rUGT94AF3, and rUGT94AF2 genes was performed using the following primers and amplification conditions, with the rice endogenous Actin 1 gene used as an internal control. The primers used are as follows:
[0158] Primer F-RT-rCYP79D16: 5'-TCCACCCTCGGTACTTCCAT-3' (SEQ ID NO.38);
[0159] Primer R-RT-rCYP79D16: 5'-CCAGCCTCGGTCAAGTCTAT-3' (SEQ ID NO.39);
[0160] Used for detecting the expression of the rCYP79D16 gene.
[0161] Primer F-RT-rCYP71AN24: 5'-GGAGAGTATGTCCAGGCCTT-3' (SEQ ID NO.40);
[0162] Primer R-RT-rCYP71AN24: 5'-GTCTCGGCCAATTTTGATCC-3' (SEQ ID NO.41);
[0163] Used for detecting the expression of the rCYP71AN24 gene.
[0164] Primer F-RT-rUGT94AF3: 5'-TGAAGCGCGATGAGATCGCT-3' (SEQ ID NO.42);
[0165] Primer R-RT-rUGT94AF3: 5'-GTCCTCCCGCTTCTTCATGT-3' (SEQ ID NO.43);
[0166] Used for detecting the expression of the rUGT94AF3 gene.
[0167] Primer F-RT-rUGT94AF2: 5'-ACGGACCGGAGAGGGAATCT-3' (SEQ ID NO. 44);
[0168] Primer R-RT-rUGT94AF2: 5'-TATCCCGGAGCTCCAATGCT-3' (SEQ ID NO.45);
[0169] Used for detecting the expression of the rUGT94AF2 gene.
[0170] The amplification program used was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 sec, 60℃ annealing for 15 sec, and 72℃ extension for 20 sec, for a total of 40 cycles.
[0171] The results showed that expression of the exogenous rCYP79D16, rCYP71AN24, rUGT94AF3, and rUGT94AF2 genes was not detected in the control wild-type seeds; while expression of one to four of these four genes was detected in the transgenic seeds (see...). Figure 4 ).
[0172] Example 2: Mass spectrometry identification and content detection of amygdalin and its intermediate metabolites in transgenic rice endosperm
[0173] 1. Extraction and identification of amygdalin from transgenic rice seeds by liquid chromatography-mass spectrometry (LC-MS)
[0174] 0.5 g of rice seeds were ground into powder under liquid nitrogen. 5 mL of 0.1% formic acid-20% methanol solution (v / v) was added. The mixture was ultrasonically vibrated in a low-temperature water bath for 30 min, then centrifuged at 12000 g for 5 min at 4℃. The supernatant was collected and thoroughly mixed. 1 mL of the liquid was filtered through a 0.22 μm organic filter membrane and injected into a 2 mL brown sample vial. The injection volume was 4 μL. Analysis was performed using a Poroshell 120EC-C18 (2.7 μm, 2.1 mm × 100 mm) column. The mobile phase was A: 0.1% formic acid-water; B: acetonitrile. The chromatographic conditions were: column temperature 40℃, flow rate 0.3 mL / min. Standard curves were plotted using phenylacetaldehyde oxime, mandelic acid nitrile, sennain, and amygdalin standards.
[0175] The results showed that the transgenic lines of vectors p1300-CC, p1300-CCU, and p1300-CCUU showed a detectable ion characteristic peak of amygdalin (456.2 m / z), while the wild-type NGZ and p1300-C transgenic plants did not (see [link to results]). Figure 5 This indicates that amygdalin was successfully synthesized in transgenic rice seeds. Further quantitative detection of the contents of phenylacetaldehyde oxime, mandelin, arbutin, and amygdalin in transgenic seeds was performed by HPLC. The results showed that phenylacetaldehyde oxime was not detected in any genotype of seeds, while mandelin, arbutin, and amygdalin were detected in the endosperm of p1300-CC, p1300-CCU, and p1300-CCUU transgenic seeds. The contents of mandelin (948.48 ng / g) and amygdalin (15.62 μg / g) in the endosperm of p1300-CCUU seeds were significantly higher than those of the other genotypes, while the content of arbutin in the endosperm of p1300-CCU seeds was relatively high (1.83 μg / g) (see...). Figure 6 These results indicate that the introduction of rCYP79D16 and rCYP71AN24 genes into rice can synthesize amygdalin in the endosperm, and the expression of rUGT94AF3 and rUGT94AF2 genes on this basis can significantly promote the synthesis of amygdalin.
[0176] Example 3: Effects of transgenic rice on the feeding preference selection of rice weevils
[0177] 1. Analysis of the feeding preferences of rice weevils for wild-type and amygdalin-containing rice
[0178] Rice is susceptible to pest infestation during storage, severely impacting its quality. The rice weevil (Sitophilus oryzae), also known as the rice worm or grain beetle, is a major pest of stored grains, primarily parasitizing grains stored for 2 to 3 years. Poor storage conditions exacerbate the infestation. Rice weevils mainly parasitize grains or processed products such as corn, rice, wheat, sorghum, and flour. Adults feed on grain kernels, while larvae bore into the grain interior. Due to their rapid growth and reproduction, and widespread damage, rice weevils are geographically distributed globally. In my country, however, they are mainly found in the south, where they have become increasingly prevalent in recent years.
[0179] To test the effect of amygdalin in rice on the feeding preferences of rice weevils, six transparent plastic boxes (4 cm in diameter and 3 cm in height) were placed evenly inside a circular plastic container (19 cm in diameter and 6 cm in height). The sides of both the circular and transparent plastic containers were coated with polytetrafluoroethylene (PTFE) to prevent rice weevils from escaping. 10 g of different types of rice were placed in each plastic box. Thirty adult rice weevils were then introduced into the center of each circular plastic container. The containers were then covered and placed in the dark. After 10 minutes, the number of rice weevils selected was recorded. Each group consisted of 30 test insects, and the experiment was repeated four times. Figure 7 The results showed that rice ethigers exhibited significant differences in their selection preferences among the six rice varieties, with the selection rates ranked as follows: p1300-C > NGZ > p1300-CCU ≈ p1300-CC ≈ p1300-CCUU#1 > p1300-CCU#2 (P < 0.05). Figure 7 This indicates that amygdalin-containing rice has a significant anti-feeding effect on rice weevils, and the anti-feeding effect is positively correlated with the amygdalin content.
[0180] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A gene associated with the synthesis of amygdalin in crop seed endosperm, characterized in that, The gene includes any of the following: (1) The CYP79D16 and CYP71AN24 genes, whose nucleotide sequences are shown in SEQ ID NO.1-2; (2) The nucleotide sequences of the CYP79D16 gene, CYP71AN24 gene and UGT94AF3 gene are shown in SEQ ID NO.1-3; (3) The nucleotide sequences of the CYP79D16 gene, CYP71AN24 gene, UGT94AF3 gene and UGT94AF2 gene are shown in SEQ ID NO.1-4.
2. A gene-encoded protein as described in claim 1.
3. A recombinant vector, characterized in that, The recombinant vector contains the gene described in claim 1.
4. A recombinant bacterium, characterized in that, The recombinant bacteria contain the recombinant vector as described in claim 3.
5. A method for constructing a transgenic crop that synthesizes amygdalin in seed endosperm using the gene described in claim 1, characterized in that, Including any of the following methods: (1) The CYP79D16 gene and the CYP71AN24 gene were introduced into crops to obtain transgenic crops that synthesize amygdalin in seed endosperm. (2) The CYP79D16 gene, CYP71AN24 gene and UGT94AF3 gene were introduced into crops to obtain transgenic crops that synthesize amygdalin in seed endosperm. (3) Introduce the CYP79D16 gene, CYP71AN24 gene, UGT94AF3 gene and UGT94AF2 gene into crops to obtain transgenic crops that synthesize amygdalin in seed endosperm.
6. The method according to claim 5, characterized in that, The method for obtaining the transgenic crop in method (3) includes the following steps: The CYP79D16 gene and the CYP71AN24 gene were linked by the linker peptide F2A to obtain fusion gene I. The fusion gene I was then fused with a strong expression promoter in the endosperm of the breeding crop to construct gene expression cassette I. The UGT94AF3 and UGT94AF2 genes were linked by the linker peptide P2A to obtain fusion gene II. The fusion gene II was then fused with a strong expression promoter in the endosperm of the breeding crop to construct gene expression cassette II. Gene expression cassette I and gene expression cassette II were transferred into an expression vector to construct a multi-gene recombinant vector containing the CYP79D16 gene, CYP71AN24 gene, UGT94AF3 gene and UGT94AF2 gene. The multi-gene recombinant vector was introduced into crops to obtain transgenic crops in which seed endosperm synthesizes amygdalin.
7. The method according to claim 6, characterized in that, The gene sequence encoding the linker peptide F2A is shown in SEQ ID NO.5, and the gene sequence encoding the linker peptide P2A is shown in SEQ ID NO.6; The strong expression promoter of the endosperm of the breeding crop includes Pens1 or Pens2, the nucleotide sequence of which is shown in SEQ ID NO.7 and the nucleotide sequence of which is shown in SEQ ID NO.
8.
8. The method according to claim 5, characterized in that, The crops include rice, corn, or wheat.
9. The use of the seed endosperm of a transgenic crop constructed by the gene of claim 1, the protein of claim 2, the recombinant vector of claim 3, the recombinant bacteria of claim 4, or the method of any one of claims 5-8, in the production of amygdalin.
10. A method for producing amygdalin using crop seed endosperm, characterized in that, The method includes the steps of constructing a transgenic crop using the method of any one of claims 5-8, obtaining the seed endosperm of the transgenic crop, and separating and extracting amygdalin from the seed endosperm.