Marker and probe composition for ovarian cancer and application of marker and probe composition
The detection of LYPLAL1-DT, a DNA methylation marker, by a probe composition has solved the problems of sensitivity and specificity in the early diagnosis of ovarian cancer, providing a non-invasive and accurate screening method that improves treatment outcomes and patient compliance.
Patent Information
- Application Number
- CN202311521149.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-15
- Publication Date
- 2026-01-09
AI Technical Summary
Existing technologies make it difficult to detect ovarian cancer in its early stages, and traditional detection methods have low sensitivity and specificity, resulting in a high rate of late-stage diagnosis. Invasive testing causes harm to patients and has low compliance.
Using the DNA methylation marker LYPLAL1-DT, a non-invasive screening method was developed to detect the methylation status of cell-free DNA in peripheral blood through a probe composition. By hybridizing hypermethylated and hypomethylated probes with bisulfite-transformed DNA regions, the accuracy and sensitivity of the detection were improved.
It achieves high sensitivity and high specificity in early screening for ovarian cancer, reduces patient suffering and the risks of invasive testing, and improves treatment outcomes and survival rates.
Smart Images

Figure BDA0004551784880000181 
Figure BDA0004551784880000191 
Figure BDA0004551784880000201
Abstract
Description
Technical Field
[0001] This application relates to the field of biotechnology, and more particularly to a biomarker, probe composition and its application for ovarian cancer. Background Technology
[0002] Ovarian cancer, also known as malignant ovarian tumors, is one of the most common tumors of the female reproductive organs, ranking third in incidence after cervical cancer and endometrial cancer. However, ovarian cancer is the leading cause of death among all gynecological cancers, posing a serious threat to women's lives. The etiology of ovarian cancer is still unclear, but its onset may be related to age, childbirth, blood type, psychological factors, and environment.
[0003] Because the ovaries are located deep in the pelvis, are small in size, and lack typical symptoms, early detection is difficult, and 60%-70% of cases are already in advanced stages at the time of diagnosis. The 5-year survival rate for stage I ovarian cancer can be as high as 90%, stage II about 80%, and stage III / IV patients have a 5-year survival rate of only 30%-40%, with most patients dying from tumor recurrence and drug resistance. Early diagnosis of ovarian cancer is extremely difficult. Malignant ovarian tumors include various pathological types, the most common being epithelial carcinoma, accounting for about 80% of all ovarian malignancies, followed by malignant germ cell tumors and sex cord-stromal tumors, accounting for approximately 10% and 5% respectively. Currently, serum carbohydrate antigen 125 (CA125) is the most widely used biomarker for the diagnosis and recurrence monitoring of epithelial ovarian cancer in clinical practice. However, in early-stage ovarian cancer patients, its sensitivity is less than 50%, and its specificity is not high. Therefore, finding reliable biomarkers for ovarian cancer detection is of great significance.
[0004] DNA methylation, as an important epigenetic modification, has been proven to be useful for the early detection of tumors and is tissue-specific, allowing the primary tumor site to be traced based on the methylation characteristics of circulating tumor DNA (ctDNA). Currently, there are no effective early screening methods for ovarian cancer; therefore, developing a technology to aid in the diagnosis of ovarian cancer is essential. Summary of the Invention
[0005] The purpose of this application is to provide a biomarker, probe composition, and application for ovarian cancer, which can be used for early screening of ovarian cancer. The biomarker is used in a non-invasive manner for screening asymptomatic individuals and for prognostic detection of cancer patients, reducing the harm caused by invasive detection and having higher sensitivity and accuracy.
[0006] The specific technical solution of this application is as follows:
[0007] 1. A biomarker for early diagnosis of ovarian cancer, wherein the biomarker is LYPLAL1-DT.
[0008] 2. The biomarker according to claim 1, wherein the target sequence of the LYPLAL1-DT gene is shown as any one of SEQ ID NO:1-SEQ ID NO:6, or the target sequence of the LYPLAL1-DT gene includes any one of SEQ ID NO:1-SEQ ID NO:6.
[0009] 3. A probe composition, wherein the probe composition comprises a probe targeting the methylation of the marker described in item 1 or 2.
[0010] 4. The probe composition according to claim 3, wherein the probe composition comprises a hypermethylated first probe composition and a hypomethylated second probe composition, the first probe composition being used for hybridization with a hypermethylated region of CG converted by bisulfite, and the second probe composition being used for hybridization with a hypomethylated region of CG converted by bisulfite.
[0011] 5. The probe composition according to claim 4, wherein the first probe composition comprises n probes that hybridize with each nucleotide of the sense and / or antisense strand of the CG hypermethylated region converted by bisulfite, preferably, the second probe composition comprises m probes that hybridize with each nucleotide of the sense and / or antisense strand of the CG hypomethylated region converted by bisulfite, and more preferably, n and m are both any integers from 1 to 10.
[0012] 6. The probe composition according to item 5, wherein there is an x1 nucleotide overlap between the (n-1)th probe and the nth probe, preferably, x1 is any integer from 0 to 100;
[0013] Preferably, there is an overlap of x2 nucleotides between the (m-1)th probe and the mth probe, where x2 is any integer from 0 to 100;
[0014] More preferably, the first probe composition comprises a nucleotide sequence as shown in SEQ ID NO:7-8; and the second probe composition comprises a nucleotide sequence as shown in SEQ ID NO:9-10.
[0015] 7. Use of nucleic acid for detecting a biomarker in the preparation of a kit for early diagnosis of ovarian cancer, wherein the biomarker is LYPLAL1-DT.
[0016] 8. The use according to item 7, wherein the target sequence of the marker is shown as any one of SEQ ID NO:1-SEQ ID NO:6, or the target sequence of the marker includes any one of SEQ ID NO:1-SEQ ID NO:6.
[0017] 9. The use according to item 7 or 8, wherein the nucleic acid is used to target a methylated biomarker for ovarian cancer.
[0018] 10. The use according to any one of items 7-9, wherein the nucleic acid is a probe composition according to any one of items 3-6.
[0019] 11. The use according to any one of items 7-9, wherein the nucleic acid comprises:
[0020] Primers, wherein the primers are fragments of at least 9 nucleotides in the target sequence of the LYPLAL1-DT, the fragments containing at least one CpG dinucleotide sequence;
[0021] Preferably, the nucleic acid further includes:
[0022] The probe is designed to hybridize with at least 15 nucleotide fragments in the target sequence of the LYPLAL1-DT under moderately or strictly controlled conditions, the fragments containing at least one CpG dinucleotide sequence.
[0023] 12. The use according to any one of items 7-11, wherein the nucleic acid further comprises:
[0024] Blockers that preferentially bind to target sequences in an unmethylated state.
[0025] 13. A composition for ovarian cancer detection, wherein the composition comprises nucleic acids for detecting LYPLAL1-DT methylation.
[0026] 14. The composition according to claim 13, wherein the target sequence of the LYPLAL1-DT gene is shown as any one of SEQ ID NO:1-SEQ ID NO:6, or the target sequence of the LYPLAL1-DT gene includes any one of SEQ ID NO:1-SEQ ID NO:6.
[0027] 15. The composition according to item 13 or 14, wherein the nucleic acid comprises the probe composition of any one of items 4-7.
[0028] 16. The composition according to claim 13 or 14, wherein the nucleic acid comprises:
[0029] Primers, wherein the primers are fragments of at least 9 nucleotides in the target sequence of the marker, the fragments containing at least one CpG dinucleotide sequence.
[0030] 17. The composition according to claim 16, wherein the nucleic acid further comprises:
[0031] A probe that hybridizes to at least 15 nucleotide fragments in the target sequence of the marker under moderately or strictly controlled conditions, the fragments containing at least one CpG dinucleotide sequence.
[0032] 18. The composition according to any one of claims 13-17, further comprising an agent for converting the 5-position unmethylated cytosine base of the target sequence of LYPLAL1-DT into uracil.
[0033] 19. The composition according to any one of claims 13-18, wherein the nucleic acid further comprises:
[0034] Blockers that preferentially bind to target sequences in an unmethylated state.
[0035] 20. The use of the target sequence of the LYPLAL1-DT gene in the preparation of a kit for early diagnosis of ovarian cancer.
[0036] 21. The use according to item 20, wherein the target sequence of the LYPLAL1-DT is any one of SEQ ID NO:1-SEQ ID NO:6 or contains any one of the sequences shown in SEQ ID NOs:1-6.
[0037] 22. A kit comprising a reagent for detecting the marker described in item 1 or 2, a probe composition described in any one of items 3-6, or a composition described in any one of items 13-19.
[0038] 23. A chip comprising a reagent for detecting the marker described in item 1 or 2, a probe composition described in any one of items 3-6, or a composition described in any one of items 13-19.
[0039] The inventors of this application used epigenomics and bioinformatics techniques to analyze whole-genome methylation data of ovarian cancer, identified a methylation gene associated with ovarian cancer, and determined the target sequence for abnormal methylation of the ovarian cancer methylation gene. Furthermore, through the target sequence of this methylation gene, the methylation status of the gene can be detected sensitively and specifically, which can then be used for the detection of cell-free DNA in peripheral blood.
[0040] This application utilizes DNA methylation marker detection technology to detect and diagnose ovarian cancer at an early stage. Because DNA methylation markers can change in the early stages of ovarian cancer, this improves the accuracy and sensitivity of early ovarian cancer screening. Furthermore, early-stage ovarian cancer is more easily cured; therefore, early detection can prevent disease progression and metastasis, effectively improving treatment outcomes and survival rates.
[0041] This application uses a 10ml blood sample, which, compared to traditional multiple sampling methods, eliminates the need for patients to undergo multiple samplings, greatly reducing their pain and burden. Furthermore, compared to highly invasive examination methods, this application does not cause excessive harm or risk to patients, nor does it affect their lives or work. Therefore, it requires lower patient compliance and is more easily accepted by patients. In addition, this invention has high sensitivity and specificity, effectively solving the problem of low sensitivity in traditional methods. By detecting DNA methylation markers, ovarian cancer can be detected early and accurately diagnosed, improving treatment outcomes and survival rates. Compared to traditional detection methods, this application has higher accuracy and a lower misdiagnosis rate, effectively reducing the risk of missed diagnoses and misdiagnoses. Detailed Implementation
[0042] The present application will now be described in detail. While specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.
[0043] It should be noted that certain terms are used in the specification and claims to refer to specific components. Those skilled in the art will understand that different terms may be used to refer to the same component. This specification and claims do not distinguish components based on differences in terminology, but rather on differences in function. The terms "comprising" or "including" used throughout the specification and claims are open-ended and should be interpreted as "comprising but not limited to." The following descriptions in the specification are preferred embodiments for carrying out this application; however, these descriptions are for the purpose of understanding the general principles of the specification and are not intended to limit the scope of this application. The scope of protection of this application shall be determined by the appended claims.
[0044] The methylation described in this application refers to the methylation process occurring at the 5th carbon atom of cytosine in CpG dinucleotides. As a relatively stable modification state, it can be inherited by newly generated daughter DNA during DNA replication under the action of DNA methyltransferases, and is an important epigenetic mechanism. During DNA methylation, methylation of the gene promoter region can lead to transcriptional silencing of tumor suppressor genes, thus it is closely related to tumorigenesis. Abnormal methylation includes hypermethylation of tumor suppressor genes and DNA repair genes, hypomethylation of repetitive DNA sequences, and loss of imprinting of certain genes, all of which are associated with the development of various tumors. This is usually (but not necessarily) in the case of CpG (cytosine followed by guanine) dinucleotides. As used herein, “increased methylation” or “significant methylation” refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancer cell or tissue sample or a DNA sample treated to methylate DNA residues) is unmethylated. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.
[0045] The methylation described in this application can be methylation level, methylation degree, or methylation state. When analyzing the methylation of such target sequences, those skilled in the art can use quantitative determination methods to determine the methylation.
[0046] The terms "homology," "identity," and "similarity" are used interchangeably in this application to indicate the sequence similarity between two nucleic acid molecules. "Homology," "identity," or "similarity" can be determined by comparing positions in each sequence, and the sequences can be aligned for comparison purposes. When equivalent positions in the compared sequences are occupied by the same bases, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid residues (e.g., similar in spatial or electrical properties), the molecules can be considered homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the number of identical or similar amino acids at shared positions in the compared sequences. "Irrelevant" or "non-homologous" sequences share less than 40% identity with the sequences of this application, preferably less than 25%. The absence or presence of extra residues (amino acids or nucleic acids) also reduces identity and homology / similarity when comparing two sequences. In specific implementations, for two or more sequences or subsequences, determined by using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below, or by manual alignment and visual inspection provided online, for example, by the National Center for Biotechnology Information (NCBI), if their sequences are approximately 60% identical, or approximately 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher, when compared and aligned for maximum correspondence in a comparison window or specified region, they can be considered substantially or significantly homologous, similar, or identical. This definition also relates to or can be used to test sequence complements. Therefore, to the extent permitted by the context of this paper, for example, if a nucleotide sequence can be predicted to be naturally present in a DNA duplex, or can be naturally present as one or both of the complementary strands, then a nucleotide sequence complementary to the specified target sequence or a variant thereof is itself considered "similar" to the target sequence, and when "similar" nucleic acid sequences are involved, this includes single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Similarity must be limited to analyses of single nucleic acid strand sequences, which may include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In the implementation scheme, identity or similarity may be in regions of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25 or more nucleotides, or in regions of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or more nucleotides.
[0047] In this application, "sensitivity" refers to the proportion of cancer detected in a certain cancer sample, and its calculation formula is: Sensitivity = (detected cancers / all cancers), while "specificity" refers to the proportion of normal samples detected in a certain normal sample, and its calculation formula is: Specificity = (detected negatives / total negatives).
[0048] This application provides a biomarker for ovarian cancer, wherein the biomarker is LYPLAL1-DT. In some embodiments, the target sequence of the LYPLAL1-DT gene is as shown in one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or the target sequence of the LYPLAL1-DT gene includes any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.
[0049] SEQ ID NO:1 is the nucleotide sequence of the LYPLAL1-DT gene:
[0050] CTCCTCAGAGAGCGGGCCAGCAGCGCTGCGCATGCGCGCCTCCCG GGCGTGCTCCCGCGCGTGCCTGCGTATTTGCGTGCGCG
[0051] SEQ ID NO:2 is the complementary sequence of the nucleotide sequence of the LYPLAL1-DT gene.
[0052] CGCGCACGCAAATACGCAGGCACGCGCGGGAGCACGCCCGGGAG CGCGCATGCGCAGCGCTGCTGGCCCGCTCTCTGAGGAG
[0053] SEQ ID NO:3 is an extreme case of the hypermethylation state of the LYPLAL1-DT gene:
[0054] TTTTTTAGAGAGCGGGTTAGTAGCGTTGCGTATGCGCGTTTTCGG GCGTGTTTTCGCGCGTGTTTGCGTATTTGCGTGCGCG
[0055] SEQ ID NO:4 is the sequence of the hypermethylated state of the complementary strand of the LYPLAL1-DT gene:
[0056] CGCGTACGTAAATACGTAGGTACGCGCGGGAGTACGTTCGGGAG CGCGTATGCGTAGCGTTGTTGGTTCGTTTTTTGAGGAG
[0057] SEQ ID NO:5 is an extreme case of the hypomethylation state of the LYPLAL1-DT gene:
[0058] TTTTTTAGAGAGTGGGTTAGTAGTGTTGTGTATGTGTGTTTTTGGG TGTGTTTTTGTGTGTGTTTGTGTATTTGTGTGTGTG
[0059] SEQ ID NO:6 is the sequence of the hypomethylated state of the complementary strand of the LYPLAL1-DT gene:
[0060] TGTGTATGTAAATATGTAGGTATGTGTGGGAGTATGTTTGGGAGT GTGTATGTGTAGTGTTGTTGGTTTGTTTTTTGAGGAG
[0061] Those skilled in the art will understand that the target sequence of LYPLAL1-DT is not limited to the specific sequences listed above. The target sequence of the LYPLAL1-DT gene should encompass sequences containing one, two, or three or more nucleotide mutations compared to any of the sequences shown in SEQ ID NO:1-6, but still substantially functionally identical, and also sequences having 95%, 96%, 97%, 98%, or 99% sequence identity compared to any of the sequences shown in SEQ ID NO:1-6. This application provides a probe composition comprising a probe targeting the methylation of the aforementioned markers.
[0062] In this application, the probe is a single-stranded or double-stranded DNA with a length ranging from tens to hundreds or even thousands of base pairs. Utilizing the denaturation, renaturation, and high precision of base pairing, it can bind (hybridize) with complementary unlabeled single-stranded DNA or RNA in the test sample via hydrogen bonds, forming a double-stranded complex (hybrid). After washing away the unpaired probes, the hybridization reaction result can be detected using autoradiography or enzyme-linked reactions. In this application, the region complementary to the probe or hybridizing with it is a specific target region, and multiple probes are combined to form a probe composition.
[0063] In one embodiment, the probe composition comprises a hypermethylated first probe composition and a hypomethylated second probe composition, the first probe composition being used to hybridize with hypermethylated regions of bisulfite-converted CG, and the second probe composition being used to hybridize with hypomethylated regions of bisulfite-converted CG.
[0064] Regions of high CG methylation refer to areas of the target sequence where methylation is abundant. Since methylation status varies from person to person, extremely high CG methylation regions refer to areas where all CG molecules in the target sequence are methylated.
[0065] Regions of CG hypomethylation refer to regions of the target sequence where methylation is minimal. In this application, regions of extreme CG hypomethylation refer to regions of the target sequence where no CG is methylated.
[0066] The region of CG hypermethylation after bisulfite conversion refers to the target sequence where the base C is converted to the base T after bisulfite conversion. However, if it is the base CG, the C in CG will not be converted because the 5-methylcytosine residue (5mC) is resistant to it, so the base C remains unchanged.
[0067] The hypomethylated region of CG after bisulfite conversion refers to the region where, after bisulfite conversion, all or most of the CG bases on the target sequence are not methylated, and therefore all or most of the C bases are converted to T bases.
[0068] Because the methylation state varies from person to person, the sequence obtained after bisulfite conversion also differs. An extreme case of this marker is shown here, where all CGs in this segment are in a hypermethylated state, and the hypermethylated sequence of its complementary strand is also shown:
[0069] An extreme case of the hypermethylated state of SEQ ID NO:1 is shown in SEQ ID NO:3.
[0070] The sequence of the hypermethylated state of the complementary strand of SEQ ID NO:1 is shown in SEQ ID NO:4.
[0071] Similarly, since the methylation state of each person is different, an extreme case is shown here, in which all CGs are in a hypomethylated state, and the hypomethylated state sequence of their complementary strand is also shown.
[0072] An extreme case of the hypomethylated state of SEQ ID NO:1 is shown in SEQ ID NO:5.
[0073] The sequence of the hypomethylated state of the complementary strand of SEQ ID NO:1 is shown in SEQ ID NO:6.
[0074] In some embodiments, the first probe composition comprises n probes that hybridize to each nucleotide of the sense and antisense strands of the CG hypermethylated region converted from bisulfite.
[0075] The second probe composition comprises m probes that hybridize to each nucleotide of the sense and / or antisense strand of the hypomethylated region of CG converted by bisulfite.
[0076] This application does not impose any restrictions on the number of probes in the first probe composition and the second probe composition. Those skilled in the art can select them as needed. For example, m and n can be any integer from 1 to 10, and m and n can be the same or different.
[0077] For example, m and n can be any integers of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, preferably m = n = 2.
[0078] In one implementation, there is an x1 nucleotide overlap between the (n-1)th probe and the nth probe, preferably, x1 is any integer from 0 to 100;
[0079] Preferably, there is an overlap of x2 nucleotides between the (m-1)th probe and the mth probe, where x2 is any integer from 0 to 100.
[0080] x1 and x2 can be the same or different. When x1 is 0, it means that the tail of the (n-1)th probe is connected to the head of the nth probe. Similarly, when x2 is 0, it means that the tail of the (m-1)th probe is connected to the head of the mth probe.
[0081] This application hybridizes a probe composition with a target sequence that has undergone bisulfite conversion, wherein a first probe composition with high methylation hybridizes with a region of high CG methylation and a second probe composition with low methylation hybridizes with a region of low CG methylation, thereby enabling efficient and accurate detection of the methylation level of the target sequence, which can then be used for early screening of ovarian cancer.
[0082] In one embodiment, the hypermethylated first probe composition comprises one or two of the nucleotide sequences shown in SEQ ID NO:7-8.
[0083] The hypomethylated second probe composition includes one or both of SEQ ID NO:9-10.
[0084] The nucleotide sequence shown in SEQ ID NO:7 is as follows:
[0085] CTACGTTACCGCGCGAAACCGCGCACGCAAATACGCAAACACGCGCGAAAACACGCCCGAAAACGCGCATACGCAACGCTACTAACCCGCTCTCTAAAAAACTTTCAATACTTTAAAATC
[0086] The nucleotide sequence shown in SEQ ID NO:8 is as follows:
[0087] AACCCCAAAATATTAAAAACTCCTCAAAAAACGAACCAACAACGCTACGCATACGCGCTCCCGAACGTACTCCCGCGCGTACCTACGTATTTACGTACGCGACCCCGCGCGACAACGCAA
[0088] The nucleotide sequence shown in SEQ ID NO:9 is as follows:
[0089] CTACATTACCACACAAAACCACACACACAAATACACAAACACACACAAAAACACACCCAAAAACACACATACACAACACTACTAACCCACTCTCTAAAAAAACTTTCAATACTTTAAAATC
[0090] The nucleotide sequence shown in SEQ ID NO:10 is as follows:
[0091] AACCCCAAAATATTAAAAACTCCTCAAAAAACAAACCAACAACACTACACATACACACTCCCAAACATACTCCCACACATACCTACATATTTACATACACAACCCCACACAACACACAA
[0092] Specifically, the first probe composition comprises the nucleotide sequences shown in SEQ ID NO:7-8 for hybridization with the methylated sequence of the LYPLAL1-DT gene;
[0093] The second probe composition comprises the nucleotide sequence shown in SEQ ID NO:9-10 for hybridization with the methylated sequence of the LYPLAL1-DT gene;
[0094] This application provides the use of a nucleic acid for detecting a biomarker in the preparation of a kit for early diagnosis of ovarian cancer, wherein the biomarker is LYPLAL1-DT. In some embodiments, the nucleotide sequence of the biomarker is shown in any one of SEQ ID NO:1-SEQ ID NO:6. In some embodiments, the nucleic acid is used to target a methylated biomarker of ovarian cancer. In some embodiments, the nucleic acid is the probe composition described above.
[0095] In some embodiments, the nucleic acid includes:
[0096] Primers, wherein the primers are fragments of at least 9 nucleotides in the target sequence of the LYPLAL1-DT, the fragments containing at least one CpG dinucleotide sequence;
[0097] Preferably, the nucleic acid further includes:
[0098] The probe is designed to hybridize with at least 15 nucleotide fragments in the target sequence of the LYPLAL1-DT under moderately or strictly controlled conditions, the fragments containing at least one CpG dinucleotide sequence.
[0099] In this application, when the nucleic acid includes primers and probes, if bisulfite is used to transform the NDA of the test sample, the nucleic acid includes a fragment of at least 9 nucleotides in the sequence after bisulfite transformation of the target sequence of LYPLAL1-DT, said fragment containing at least one CpG dinucleotide sequence.
[0100] In some embodiments, the nucleic acid further includes:
[0101] Blockers that preferentially bind to target sequences in an unmethylated state.
[0102] The blocking agent is designed to improve the amplification specificity of PCR primers. The 5' end of the blocking agent's nucleotide sequence overlaps with the 3' end of the forward or reverse primer by 5 nucleotides or more. The blocking agent is complementary to the target DNA strand of the forward or reverse primer. The melting temperature of the blocking agent is 5°C higher than that of the forward or reverse primer. The nucleotide sequence of the blocking agent contains at least one CpG dinucleotide sequence and is complementary to the unmethylated target DNA sequence after bisulfite conversion. Therefore, when the genomic DNA of the biological sample to be tested is a mixture of methylated and unmethylated states, especially when the methylated DNA is far less than the unmethylated DNA, the unmethylated DNA, after bisulfite conversion, will preferentially bind to the blocking agent, thereby inhibiting the binding of the DNA template to the PCR primer and thus preventing PCR amplification. The methylated DNA, however, does not bind to the blocking agent and therefore binds to the primer, resulting in PCR amplification. The fragments obtained through amplification can then be detected directly or indirectly.
[0103] This application provides a composition for ovarian cancer detection, wherein the composition comprises a nucleic acid for detecting LYPLAL1-DT methylation. In some embodiments, the nucleotide sequence of LYPLAL1-DT is shown in any one of SEQ ID NO:1-SEQ ID NO:6. In some embodiments, the nucleic acid comprises the probe composition described above.
[0104] In some embodiments, the nucleic acid includes:
[0105] Primers, wherein the primers are fragments of at least 9 nucleotides from the target sequence of the LYPLAL1-DT, the fragments containing at least one CpG dinucleotide sequence. In some embodiments, the nucleic acid further includes:
[0106] The probe is designed to hybridize with at least 15 nucleotide fragments in the target sequence of the LYPLAL1-DT under moderately or strictly controlled conditions, the fragments containing at least one CpG dinucleotide sequence.
[0107] In some embodiments, the composition further includes an agent for converting the 5-position unmethylated cytosine base of the target sequence of LYPLAL1-DT into uracil.
[0108] In this application, the 5-position unmethylated cytosine base refers to the fact that the fifth carbon of cytosine does not accept a methyl group, that is, cytosine has not undergone methylation modification.
[0109] In this application, the reagent may be, for example, bisulfite.
[0110] In some embodiments, the nucleic acid further includes:
[0111] Blockers that preferentially bind to target sequences in an unmethylated state.
[0112] In this application, the target sequence of the LYPLAL1-DT gene is used in the preparation of a kit for ovarian cancer.
[0113] In this application, the target sequence of LYPLAL1-DT is any one of SEQ ID NO:1-SEQ ID NO:6 or contains any one of the sequences shown in SEQ ID NOs:1-6.
[0114] This application provides a kit comprising reagents for detecting the aforementioned biomarkers, the aforementioned probe composition, or the aforementioned composition. In some embodiments, the kit further comprises a container for containing a biological sample from a subject. In some embodiments, the kit further comprises instructions for using and interpreting the test results.
[0115] In this application, the biological sample may be, for example, peripheral blood, whole blood, plasma, or serum.
[0116] This application does not impose any limitations on the method for detecting target sequence methylation levels using the kit described above. Those skilled in the art can choose according to their needs. For example, this application provides a method for detecting biomarker target sequence methylation levels using the kit described above, which includes the following steps:
[0117] Collect samples from test subjects;
[0118] Extract and purify DNA from the sample;
[0119] Construct DNA libraries for sequencing from purified DNA samples;
[0120] The constructed DNA library was transformed with bisulfite;
[0121] The bisulfite-converted DNA library was amplified by pre-PCR.
[0122] Hybridization capture of pre-PCR amplified samples was performed using probe compositions;
[0123] The product captured by hybridization was amplified by PCR.
[0124] High-throughput next-generation sequencing was performed on the PCR-amplified and hybridized capture products.
[0125] Sequencing data are analyzed to determine the methylation level of the samples;
[0126] The threshold for each biomarker is calculated based on the methylation status of existing samples. The patient's disease status is determined based on the methylation level of a certain biomarker in the sample. If the methylation level of a certain biomarker in the sample exceeds the threshold, it is a cancer sample; if it is below the threshold, it is a healthy sample.
[0127] For example, this application provides a method for detecting the target sequence methylation level of a biomarker using the kit described above, comprising the following steps:
[0128] (1) Collect peripheral blood from the subject and separate plasma or serum;
[0129] (2) Extracting cell-free DNA from plasma or serum;
[0130] (3) Use reagents to treat the free DNA obtained in step (2) to convert the 5-position unmethylated cytosine base to uracil or other bases. That is, the 5-position unmethylated cytosine base of the target sequence of the marker is converted to uracil or other bases. The converted bases are different from the 5-position unmethylated cytosine bases in terms of hybridization performance and are detectable.
[0131] (4) The free DNA treated in step (3) is contacted with DNA polymerase and primers for the target sequence of the marker, so that the target sequence of the treated marker is amplified to produce an amplification product or is not amplified; if the target sequence of the treated marker undergoes DNA polymerization, an amplification product will be produced; if the target sequence of the treated marker does not undergo DNA polymerization, it will not be amplified.
[0132] (5) Detect the amplification products using probes;
[0133] (6) Based on the presence or absence of the amplification product, determine the methylation status of at least one CpG dinucleotide of the target sequence of the marker, thereby determining the methylation level of the target sequence of the marker.
[0134] This application provides a chip comprising a world for detecting the markers described above, or the probe composition described above, or the composition described above.
[0135] The chip, also known as a gene chip, uses a hybridization sequencing method. This method involves determining the nucleic acid sequence by hybridizing with a set of nucleic acid probes with known sequences. Probes with known target nucleotide sequences are immobilized on the surface of a substrate. When a fluorescently labeled nucleic acid sequence in solution achieves complementary matching with the corresponding nucleic acid probe on the gene chip, the position of the probe with the strongest fluorescence intensity is determined to obtain a set of probe sequences that are completely complementary.
[0136] The chip is mainly fabricated using glass or silicon wafers as carriers, and oligonucleotide fragments or cDNA are arranged sequentially on the carriers using in-situ synthesis and micro-matrix methods.
[0137] The chip described in this application is based on signal detection of DNA sequence hybridization after bisulfite treatment. Bisulfite treatment converts unmethylated cytosine into uracil, while methylated cytosine remains unchanged. Then, uracil is converted into thymine, and finally, chip hybridization is performed. Finally, the type of added base is determined based on the fluorescence color, thereby determining whether the site is methylated.
[0138] This application provides a method for ovarian cancer screening, comprising:
[0139] The methylation level of the detection marker, and
[0140] The risk of a subject developing ovarian cancer is determined based on the methylation level, and the biomarker is LYPLAL1-DT.
[0141] Example
[0142] This application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. Reagents or instruments used, unless otherwise specified, are all commercially available conventional reagent products.
[0143] Example 1: Screening Markers
[0144] 1) Sample collection:
[0145] Regarding the collection of ovarian cancer samples: A total of 54 plasma samples from ovarian cancer patients were collected from cooperating hospitals, and 70 plasma samples from healthy individuals were also collected for whole-genome methylation sequencing.
[0146] 2) Candidate biomarker analysis:
[0147] Analysis of biomarkers for ovarian cancer: Differential methylation sites obtained from sequencing data were analyzed using DSS software between healthy individuals and ovarian cancer patients. Filtering criteria: P < 0.05, difference between the means of the two groups greater than 0.1. A total of 43 differentially methylated regions were identified.
[0148] 3) Marker verification:
[0149] Validation of biomarkers for ovarian cancer: Probes were designed to capture the 43 differentially methylated regions mentioned above. Validation was performed using data from Borcheng plasma samples (72 ovarian cancer samples and 88 healthy samples), ultimately yielding one biomarker capable of distinguishing between ovarian cancer and healthy individuals. Its target sequence is shown in SEQ ID NO:1.
[0150] Based on the obtained target sequence region, a custom probe composition (panel) is prepared, comprising a highly methylated first probe composition and a low-methylated second probe composition, wherein the first probe composition comprises two probes, respectively, as shown in SEQ ID NO:7-8, and the second probe composition comprises two probes, respectively, as shown in SEQ ID NO:9-10.
[0151] Then it was validated in plasma samples, using Qiagen in the experiment. cfDNA was prepared using the Circulating NucleicAcid Kit (catalog number 55114). Library preparation was performed using the IDT xGen Methyl-Seq Lib KIT (catalog number 10009824), and the experimental detection methods are as follows:
[0152] 1.1.cfDNA Extraction and Purification
[0153] 1.1.1. Plasma sample preparation:
[0154] Centrifuge the blood sample at 2000g for 10 minutes at 4℃, and transfer the plasma to a new centrifuge tube. Centrifuge the plasma sample at 16000g for 10 minutes at 4℃. Proceed to the next step depending on the type of collection tube used; in this experiment, an "other" type of collection tube was used.
[0155] 1.1.2. Fracturing and Binding
[0156] 1.1.2.1. Pipette 100 μl, 200 μl, 300 μl, 400 μl, and 500 μl of QIAGEN proteinase K into 50 ml centrifuge tubes, respectively.
[0157] 1.1.2.2. Add 1 ml, 2 ml, 3 ml, 4 ml, and 5 ml of plasma or serum to the above 50 ml centrifuge tubes respectively.
[0158] 1.1.2.3. Add 0.8 ml, 1.6 ml, 2.4 ml, 3.2 ml, and 4.0 ml of Buffer ACL (containing 1.0 μg carrier RNA) respectively, cap and vortex for 30 seconds; Note: Mix thoroughly to ensure complete lysis; proceed to the next step immediately.
[0159] 1.1.2.4. Incubate at 60℃ for 30 min.
[0160] 1.1.2.5. Take out the centrifuge tubes and place them on the test bench, then unscrew the caps.
[0161] 1.1.2.6. Add 1.8 ml, 3.6 ml, 5.4 ml, 7.2 ml, and 9.0 ml of BufferACB to 50 ml centrifuge tubes respectively; cap the tubes and mix for 15-30 seconds.
[0162] 1.1.2.7. Incubate the lysis mixture on ice for 5 min.
[0163] 1.1.2.8. Insert the QIAamp Mini column into the vacuum pump connector adapter and insert the 20ml tube extender into the column; Note: Ensure the tube extender is securely inserted into the QIAamp Mini column to prevent sample leakage.
[0164] 1.1.2.9. Carefully add the lysate-buffered ACB mixture from 1.1.2.7 to the tube extender of the QIAamp Minicolumn and turn on the vacuum pump; once all the lysate has been completely extracted from the Mini column, turn off the vacuum pump and release the pressure to 0 mbar; carefully remove and discard the extender.
[0165] 1.1.3. Washing
[0166] 1.1.3.1. Add 600 μl of Buffer ACW1 to the Mini column with the cap open and turn on the vacuum pump; after all liquid has passed through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.
[0167] 1.1.3.2. Add 750 μl of BufferACW2 to the Mini column, with the cap open, and turn on the vacuum pump; after all the liquid has passed through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.
[0168] 1.1.3.3. Add 750 μl of ethanol (96-100%) to the Mini column with the cap open and turn on the vacuum pump; after all the liquid has passed through the membrane, turn off the vacuum pump and release the pressure to 0 mbar.
[0169] 1.1.3.4. Replace the cap on the QIAamp Mini column, remove it from the adapter, and discard the VacConnector. Place the QIAamp Mini column into a clean 2ml collection tube and centrifuge at high speed (20000g; 14000rpm) for 3 minutes.
[0170] 1.1.3.5. Place the QIAamp Mini column into a new 2ml collection tube. Open the tube cap and incubate at room temperature for 5 minutes to allow the membrane to dry completely.
[0171] 1.1.4. Elution of cfDNA
[0172] 1.1.4.1. Place the QIAamp Mini column into a 1.5 ml elution tube and discard the 2 ml collection tube from step 1.1.3.5. Add 20-150 μl of BufferAVE to the center of the Mini membrane; cap the tube and incubate at room temperature for 3 min.
[0173] 1.1.4.2. Centrifuge at full speed (20000g; 14000rpm) for 1 min to elute nucleic acids.
[0174] For cfDNA samples, Agilent 2100 was used for fragment detection, and the Qubit was directly used for subsequent experiments.
[0175] 1.2. Bisulfite transformation and purification:
[0176] 1.2.1. Prepare CT Conversion Reagent:
[0177] 1.2.1.1. Add 700 μl NF water, 300 μl M-Dilution Buffer and 50 μl M-Dissolving Buffer to a tube of CT conversion reagent, mix well at room temperature, and vortex or shake frequently for 10 min.
[0178] 1.2.1.2. After mixing, dispense the mixture into portions, preparing 10 reaction portions at a time.
[0179] 1.2.2. Perform bisulfite conversion on the DNA library and prepare the reaction system according to the table below.
[0180] Table 1
[0181] Components High concentration sample volume (1ng-2μg) The sample after the previous reaction is completed 40μl CT Conversion Reagent 110μl Total volume 150μl
[0182] 1.2.3. Adjust the pipette to 100 μl, gently pipette and mix 6 times, then divide into two tubes and place them on the PCR instrument.
[0183] 1.2.4. Set the following program to perform the reaction on the PCR instrument: hot lid temperature 105℃.
[0184] Table 2
[0185] temperature time 98℃ 10min 64℃ 2.5h 4℃ ∞
[0186] 1.2.5. Take a new 1.5ml centrifuge tube and add 600μl of M-Binding Buffer.
[0187] 1.2.6. After PCR, briefly centrifuge the two identical samples and transfer them to the corresponding 1.5ml centrifuge tubes, then mix well.
[0188] 1.2.7. Add the above-mixed sample to Zymo-Spin TM In the IC column, invert and mix thoroughly, then centrifuge at 10,000 x g for 30 s.
[0189] 1.2.8. Add 100 μl of M-Wash Buffer to the column and centrifuge at 10,000 x g for 30 s.
[0190] 1.2.9. Add 200 μl of M-Desulphonation Buffer to the column, let stand at room temperature for 15-20 min, and centrifuge at 10,000 x g for 30 s.
[0191] 1.2.10. Add 200 μl of M-Wash Buffer to the column and centrifuge at 10,000 x g for 30 s.
[0192] 1.2.11. Repeat the previous step once.
[0193] 1.2.12. Place the column into a new collection tube and centrifuge again at 10,000 x g for 30 s.
[0194] 1.2.13. Place the recovery column into a new 1.5 ml EP tube, add 15 μl of LOW EDTA buffer to the center of the column membrane, and centrifuge at 10,000 x g for 30 s.
[0195] 1.3. Transgender:
[0196] 1.3.1. Preheat the PCR instrument to 95°C.
[0197] 1.3.2. Set the following program to perform the reaction on the PCR instrument: hot lid temperature 105℃.
[0198] Table 3
[0199] temperature time 95℃ ∞ 95℃ 2min 95℃ ∞
[0200] 1.3.3. After incubation, immediately place the test tube on ice for 2 minutes.
[0201] 1.4. Connector connection and purification:
[0202] 1.4.1. Configure the reaction system according to the table below:
[0203] Table 4
[0204] Components volume Low EDTA TE 11.5μl Buffer G1 4μl Reagent G2 4μl Reagent G3 2.5μl Enzyme G4 1μl Enzyme G5 1μl Enzyme G6 1μl DNA 15μl Total Volume 40μl
[0205] 1.4.2. Set the following program to perform the reaction on the PCR instrument: hot lid temperature 105℃.
[0206] Table 5
[0207] temperature time 37℃ ∞ 37℃ 15min 95℃ 2min 4℃ ∞
[0208] 1.5. Sample extension and purification:
[0209] 1.5.1. Configure the reaction system according to the table below:
[0210] Table 6
[0211] Components volume Reagent Y1 2μl Enzyme Y2 42μl totalVolume 44μl
[0212] 1.5.2. Set the following program to perform the reaction on the PCR instrument: hot lid temperature 105℃.
[0213] Table 7
[0214] temperature time 98℃ ∞ 98℃ 1min 62℃ 2min 65℃ 5min 4℃ ∞
[0215] 1.5.3. DNA protection buffer turns the liquid blue upon addition. Gently pipette to mix, then divide into two tubes and place them on the PCR instrument.
[0216] 1.5.4. Set the following program and run it: Heat cover 105℃.
[0217] Table 8
[0218] temperature time 95℃ 5min 60℃ 10min 95℃ 5min 60℃ 10min 4℃ ∞
[0219] 1.5.5. Prepare the purification system according to the table below:
[0220] Table 9
[0221] Input reaction volume Magnetic bead quantity volume 200bp (SeqCap Epi) 84μl 101 μl (ratio: 1.2) 15μl
[0222] 1.5.6. Add the magnetic beads in the above proportion to each sample for recovery, shake to mix and then briefly separate.
[0223] 1.5.7. Incubate at room temperature for 5 minutes.
[0224] 1.5.8. Shake to mix, then centrifuge briefly and place on a magnetic rack to adsorb until the solution is clear (~2 min). After the solution is clear, aspirate the supernatant.
[0225] 1.5.9. Add 200 μl of 80% ethanol to wash the magnetic beads for 30 seconds, discard the supernatant, and carefully remove all remaining ethanol from the inner wall of the dropper.
[0226] 1.5.10. Repeat the above steps.
[0227] 1.5.11. Add the optimal volume of low EDTA TE buffer for elution, then vortex to mix.
[0228] 1.5.12. Incubate at room temperature for 2 minutes.
[0229] 1.5.13. Place on a magnetic rack for adsorption until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.
[0230] 1.5.14. Transfer the entire eluent to a new 0.2 mL PCR tube, ensuring that the eluent does not contain magnetic beads.
[0231] 1.6. Connector connection and purification:
[0232] 1.6.1. Prepare the library reaction system according to the table below:
[0233] Table 10
[0234]
[0235]
[0236] 1.6.2. Set the following program and run it: Hot lid 0℃:
[0237] Table 11
[0238] temperature time 25℃ ∞ 25℃ 15min 4℃ ∞
[0239] 1.6.3. Prepare the purification system according to the table below:
[0240] Table 12
[0241] Input reaction volume Magnetic bead quantity volume 200bp (SeqCap Epi) 30μl 36μl (ratio: 1.2) 20μl
[0242] 1.6.4. Add the magnetic beads in the above proportion to each sample for recovery, shake to mix and then briefly separate.
[0243] 1.6.5. Incubate at room temperature for 5 minutes.
[0244] 1.6.6. Shake to mix, then centrifuge briefly and place on a magnetic rack to adsorb until the solution is clear (~2 min). After the solution is clear, aspirate the supernatant.
[0245] 1.6.7. Add 200 μl of 80% ethanol to wash the magnetic beads for 30 seconds, discard the supernatant, and carefully remove all remaining ethanol from the inner wall of the dropper.
[0246] 1.6.8. Repeat the above steps.
[0247] 1.6.9. Add the optimal volume of low EDTA TE buffer for elution, then vortex to mix.
[0248] 1.6.10. Incubate at room temperature for 2 minutes.
[0249] 1.6.11. Place on a magnetic rack for adsorption until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.
[0250] 1.6.12. Transfer the entire eluent to a new 0.2 mL PCR tube, ensuring that the eluent does not contain magnetic beads.
[0251] 1.7. Library amplification and purification:
[0252] 1.7.1. Prepare the library reaction system according to the table below:
[0253] Table 13
[0254] Components volume The above reaction DNA 20μl KAPA HiFi HotStart Uracil+ReadyMix(2x) 25μl index(U001-U024) 5μl Total volume 50μl
[0255] 1.7.2. Set the following program and run it: Heat cover 105℃:
[0256] Table 14
[0257]
[0258] 1.7.3. Recommended loop count is shown in the table below:
[0259] Table 15
[0260] Input Recommended number of loops 20ng cfDNA 10-11 100ng gDNA 9-10 20ng gDNA 11-12
[0261] 1.7.4. Prepare the purification system according to the table below:
[0262] Table 16
[0263] Input reaction volume Magnetic bead quantity volume 200bp (SeqCap Epi) 50μl 60μl (ratio: 1.2) 22μl
[0264] 1.7.5. Transfer the PCR product into a 1.5 ml centrifuge tube.
[0265] 1.7.6. Add the magnetic beads in the above proportion to each sample for recovery, shake to mix and then briefly separate.
[0266] 1.7.7. Incubate at room temperature for 5 minutes.
[0267] 1.7.8. Shake to mix, then centrifuge briefly and place on a magnetic rack to adsorb until the solution is clear (~2 min). After the solution is clear, aspirate the supernatant.
[0268] 1.7.9. Add 500 μl of 80% ethanol to wash the magnetic beads for 30 seconds, discard the supernatant, and carefully remove all remaining ethanol from the inner wall of the dropper.
[0269] 1.7.10. Repeat the above steps.
[0270] 1.7.11. Place on the magnetic rack for 5-10 minutes until the beads are dry (avoid over-drying, as this may reduce DNA recovery rate).
[0271] 1.7.12. Add the optimal volume of low EDTA TE buffer for elution, then vortex to mix.
[0272] 1.7.13. Incubate at room temperature for 2 minutes.
[0273] 1.7.14. Place on a magnetic rack to adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.
[0274] 1.7.15. Transfer the entire eluent to a new 0.2 mL PCR tube, ensuring that the eluent does not contain magnetic beads.
[0275] 1.7.16. Aspirate 1 μl for qubit calibration and perform 2100 quality control.
[0276] 1.8. Sample-probe hybridization:
[0277] 1.8.1. Mixed Samples:
[0278] 1.8.1.1. Refer to the table below for the amount of DNA library used. The total amount can exceed 1500 ng, but not more than 4 μg.
[0279] Table 17
[0280] Mixed sample size Usage per library Total amount of each reaction library 1 500ng 500ng 2 500ng 1000ng 3 500ng 1500ng 4 375ng 1500ng 8 187.5ng 1500ng
[0281] 1.8.1.2. Calculate the amount of different samples and mix them thoroughly in centrifuge tubes.
[0282] 1.8.1.3. Add the following prehybridization reagents to the mixed sample, mix well, and try to avoid generating air bubbles.
[0283] Table 18
[0284] Components volume Twist probe panel 4μl general sealant 8μl Sealing agent solution 5μl Methylation Enhancer 2μl
[0285] 1.8.1.4. Dry the prehybridization reagent mixture at room temperature in a vacuum concentrator (if heating is required, use a low temperature).
[0286] 1.8.2. Hybridization:
[0287] 1.8.2.1. Incubate the Fast Hybridization Mix at 65°C for 10 min or until all precipitates are dissolved. Quickly vortex and add 20 μl to the lyophilized sample from the previous step to resuspend the sample (do not allow the hybridization solution to return to room temperature). Gently tap the sample with your fingertip to mix, avoiding the formation of air bubbles.
[0288] 1.8.2.2. Quickly centrifuge to remove air bubbles, and add 30 μl of Hybridization Enhancer to the surface of the above reagents.
[0289] 1.8.2.3. Place the PCR tube into a preheated PCR instrument for hybridization.
[0290] 1.8.2.4. Set the following program and run it: Heat cover 85°C.
[0291] Table 19
[0292] temperature time 95℃ ∞ 95℃ 5min 60℃ 15min-4h
[0293] 1.8.3. Combination:
[0294] 1.8.3.1. Shake the pre-equilibrated streptavidin magnetic beads until completely mixed, then add 100 μl of magnetic beads to a 1.5 ml centrifuge tube.
[0295] 1.8.3.2. Add 200 μl of binding buffer and mix by pipetting.
[0296] 1.8.3.3. Place the centrifuge tube on a magnetic rack for 1 minute or until the solution becomes clear. Discard the supernatant and remove the centrifuge tube.
[0297] 1.8.3.4. Repeat the above washing steps twice, for a total of three times.
[0298] 1.8.3.5. After the final wash, add 200 μl of binding buffer and vortex to resuspend and mix thoroughly.
[0299] 1.8.3.6. After hybridization, open the PCR instrument lid and quickly transfer all the hybridization solution to the balanced magnetic beads.
[0300] 1.8.3.7. Mix the magnetic beads with the hybridization solution on a shaker, rocker, or rotator at room temperature for 30 minutes.
[0301] 1.8.3.8. Remove the centrifuge tube from the mixer, centrifuge quickly, place it on a magnetic rack for 1 minute, discard the supernatant, and remove the tube.
[0302] 1.8.3.9. Add 200 μl of preheated FastWash Buffer 1 and mix well.
[0303] 1.8.3.10. Incubate at 63℃ or 65℃ for 5 minutes.
[0304] 1.8.3.11. Place the centrifuge tube on the magnetic rack for 1 minute, remove the supernatant, and take off the tube.
[0305] 1.8.3.12. Repeat the above steps, add 200 μl of preheated washing solution 1 again, and mix well.
[0306] 1.8.3.13. Incubate at 63℃ or 65℃ for 5 minutes.
[0307] 1.8.3.14. Transfer the liquid to a new tube; place on a magnetic rack for 1 minute, discard the supernatant, and remove the tube.
[0308] 1.8.3.15. Add 200 μl of preheated washbuffer2 and mix with the pipette tip.
[0309] 1.8.3.16.48℃ incubate for 5 min.
[0310] 1.8.3.17. Place on the magnetic rack for 1 minute, remove the supernatant, and remove the tube.
[0311] 1.8.3.18. Repeat steps 3.15-3.17 twice, for a total of three times.
[0312] 1.8.3.19. Finally, use a 10μl pipette tip to aspirate the remaining washing solution.
[0313] 1.8.3.20. Add 45 μl of water, mix well, and incubate the solution on ice.
[0314] 1.8.4. Post-capture PCR amplification, purification, and quality control:
[0315] 1.8.4.1. Set the following program and run it: Heat cover 105℃.
[0316] Table 20
[0317]
[0318]
[0319] 1.8.4.2. Mix the magnetic bead mixture from step 1.8.3.20 and pipette 22.5 μl into a 0.2 ml PCR tube.
[0320] 1.8.4.3. Add 2.5 μl of amplification primers and 25 μl of KAPA HiFi HotStartReadyMix to a 0.2 ml PCR tube, for a total reaction volume of 50 μl.
[0321] 1.8.4.4. Gently mix with pipette tip, centrifuge quickly, and then place in PCR instrument to begin amplification.
[0322] 1.8.4.5. Vortex thoroughly to mix the pre-equilibrated DNA purification magnetic beads.
[0323] 1.8.4.6. Add 90 μl (1.8*) DNA purification magnetic beads to the amplified PCR product and vortex thoroughly.
[0324] 1.8.4.7. Incubate at room temperature for 5 minutes.
[0325] 1.8.4.8. Place the centrifuge tube on a magnetic rack for 1 minute, and discard the supernatant after the solution has clarified.
[0326] 1.8.4.9. Without removing the centrifuge tube from the magnetic rack, add 200 μl of freshly prepared 80% ethanol, incubate for 1 min, and discard the supernatant; repeat the 80% ethanol washing once (total 2 times), keeping the centrifuge tube on the magnetic rack.
[0327] 1.8.4.10. Carefully remove residual ethanol with a 10 μl pipette tip, and let stand at room temperature for 5-10 minutes or until the magnetic beads are dry. Please be careful not to let the magnetic beads become too dry.
[0328] 1.8.4.11. Remove the tube from the magnetic rack and add 32 μl of water. Mix thoroughly by pipetting with a pipette tip and incubate at room temperature for 2 min.
[0329] 1.8.4.12. Place the centrifuge tube on a magnetic rack for 3 minutes or until the solution becomes clear.
[0330] 1.8.4.13. Transfer 30 μl of supernatant to a clean 0.2 ml centrifuge tube.
[0331] 1.8.4.14. Take 1 μl of the library and use Qubit to quantify it, and record the library concentration.
[0332] 1.8.4.15. Take 1 μl of sample and use an Agilent 2100 to determine the length of the library fragment.
[0333] 1.9. Methylation Bioinformatics Analysis Workflow. The general process is as follows: FastP quality control software is used to check sequencing quality and remove low-quality reads. Then, Bismark alignment software is used to align the clean, quality-controlled data to the reference genome. Bismark_methylation_extractor software is used to extract the corresponding methylation sites. Finally, the methylation level of the target region is calculated. If the result exceeds a threshold, it is interpreted as cancer; if it is below the threshold, it is interpreted as normal.
[0334] 1.10. Based on the training set of 54 ovarian cancer samples and 70 normal human samples, the above-mentioned methylation library construction method was used to screen out biomarkers related to ovarian cancer by using the differences in methylation levels in different groups (ovarian cancer and normal). The site data were validated in independent datasets in normal and ovarian cancer samples, and one DNA fragment (SEQ ID NO:1) that most significantly distinguished normal and ovarian cancer samples was selected. The methylation biomarker (hereinafter referred to as site or marker) and the discrimination threshold are shown in Table 21.
[0335] The methylation level threshold is calculated as follows: An ROC curve is plotted based on the dataset (containing the type and methylation level of each sample). The confusion matrix corresponding to the optimal threshold point on the ROC curve is used to calculate sensitivity, specificity, and accuracy. Typically, the Youden index is used for selection. The Youden index, also known as the correctness index, is the sum of sensitivity and specificity minus 1: Youden index = Sensitivity + Specificity - 1. The Youden index ranges from 0 to 1, representing the classification model's overall ability to distinguish between true patients and non-patients. A higher Youden index indicates better classification model performance.
[0336] Table 21 Specific performance data of methylation markers
[0337] SEQ ID threshold Specificity Sensitivity AUC SEQ ID NO.1 0.1215 0.958 0.989 0.97
[0338] Example 2
[0339] Six human samples (S1-3 were healthy samples, S4-6 were ovarian cancer patient samples) were collected using the methylation biomarker detection method of this application, following the method in Example 1. A library was constructed, and sequencing was performed using the Illumina platform. The sequencing data underwent the aforementioned bioinformatics analysis process to obtain the methylation level of the biomarker. Based on the biomarker threshold, the patient's disease status was predicted. Samples below the threshold were considered healthy, while samples exceeding the threshold were considered ovarian cancer samples. The specific results are shown in the table below.
[0340] The interpretation results are categorized as follows: 0 represents normal (i.e., healthy); 1 represents abnormal (i.e., ovarian cancer).
[0341] Table 22
[0342]
[0343] As can be seen from the table above, the sequence shown in SEQ ID NO.1 can specifically target ovarian cancer patient samples.
[0344] In summary, the inventors of this application have obtained methylation genes associated with ovarian cancer and identified target sequences for abnormal methylation of ovarian cancer methylation genes. Furthermore, through the target sequence of this methylation gene, the methylation status of the gene can be detected sensitively and specifically, thereby enabling its use in the detection of cell-free DNA in peripheral blood. Moreover, the composition described in this application enables real-time monitoring with higher sensitivity and accuracy.
[0345] The above description is merely a preferred embodiment of this application and is not intended to limit the application in any other way. Any person skilled in the art may make changes or modifications to the disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of this application without departing from the scope of the technical solution of this application shall still fall within the protection scope of this application.
Claims
1. A biomarker for ovarian cancer, wherein, The marker is LYPLAL1-DT.
2. The marker according to claim 1, wherein, The target sequence of the LYPLAL1-DT gene is shown as any one of SEQ ID NO:1-SEQ ID NO:6, or the target sequence of the LYPLAL1-DT gene includes any one of SEQ ID NO:1-SEQ ID NO:
6.
3. A probe composition, wherein, The probe composition comprises a probe that targets the methylation of the marker of claim 1 or 2.
4. The probe composition according to claim 3, wherein, The probe composition comprises a hypermethylated first probe composition and a hypomethylated second probe composition, the first probe composition being used to hybridize with hypermethylated regions of CG converted from bisulfite, and the second probe composition being used to hybridize with hypomethylated regions of CG converted from bisulfite.
5. The probe composition according to claim 4, wherein, The first probe composition comprises n probes that hybridize with each nucleotide of the sense and / or antisense strand of the CG hypermethylated region converted by bisulfite. Preferably, the second probe composition comprises m probes that hybridize with each nucleotide of the sense and / or antisense strand of the CG hypomethylated region converted by bisulfite. More preferably, n and m are both any integers from 1 to 10.
6. The use of nucleic acids for detecting biomarkers in the preparation of kits for ovarian cancer, wherein, The marker is LYPLAL1-DT.
7. A composition for ovarian cancer detection, wherein, The composition contains nucleic acids for detecting LYPLAL1-DT methylation.
8. The use of the target sequence of the LYPLAL1-DT gene in the preparation of a kit for early diagnosis of ovarian cancer.
9. A kit comprising a reagent for detecting the marker of claim 1 or 2, a probe composition of any one of claims 3-5, or a composition of claim 7.
10. A chip comprising a reagent for detecting the marker of claim 1 or 2, a probe composition of any one of claims 3-5, or a composition of claim 7.