A molecular marker related to watermelon disease resistance and application thereof

By developing the microsatellite marker WM-08, which is closely linked to watermelon resistance to Fusarium wilt, and combining it with PCR amplification and gel electrophoresis typing, the problems of long breeding cycles, large environmental interferences, and high detection costs in watermelon breeding have been solved. This has enabled rapid and accurate breeding of disease-resistant varieties, improving breeding efficiency and disease resistance stability.

CN121294729BActive Publication Date: 2026-02-06WEIFANG UNIV OF SCI & TECH +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511873961.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-12
Publication Date
2026-02-06
Estimated Expiration
2045-12-12

AI Technical Summary

Technical Problem

Existing technologies for breeding watermelon wilt resistance suffer from problems such as long breeding cycles, significant interference from environmental factors, a negative correlation between disease resistance and quality traits, and high testing costs, making it difficult to achieve rapid and accurate breeding of disease-resistant varieties.

Method used

We developed a microsatellite marker, WM-08, which is closely linked to watermelon resistance to Fusarium wilt. Through PCR amplification and gel electrophoresis typing, we screened watermelon plants with a CT repeat of 4 that were resistant to the disease. We then used this molecular marker for marker-assisted selection breeding.

Benefits of technology

It significantly shortens the breeding cycle, improves breeding efficiency, and ensures that the selected plants maintain stable resistance under disease pressure, reducing the damage caused by Fusarium wilt and achieving synergistic improvement of disease resistance and quality traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294729B_ABST
    Figure CN121294729B_ABST
Patent Text Reader

Abstract

The application provides a molecular marker related to watermelon disease resistance and application thereof, the difference of disease resistance traits of a high-resistance watermelon population and a high-susceptibility watermelon population is analyzed, a molecular marker linked to the disease resistance traits is screened, and the molecular marker is used for screening parents for genetic breeding of watermelons. The method for screening the disease-resistant watermelon plants provided by the application is a method for screening the parents with the genotype of the sequence of SEQ ID NO:1. The microsatellite marker linked to the disease resistance traits of watermelons is obtained by analyzing the amplification products of different watermelon varieties, the microsatellite marker is used for screening the watermelon plants with disease resistance potential, and thus effective molecular markers are provided for the disease resistance breeding operation of watermelons.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of crop genetic breeding, and particularly relates to a molecular marker related to watermelon disease resistance and application thereof. BACKGROUND

[0002] Watermelon (Citrullus lanatus) is an important economic crop worldwide, and its production has been seriously threatened by soil-borne diseases for a long time. Among them, the fusarium wilt caused by Fusarium oxysporum f. sp. niveum is particularly prominent. This pathogen can survive in the soil for more than 10 years, and it can invade the vascular bundle through the root system, leading to systemic wilting and death of the plant. According to the disease monitoring data of the Chinese Academy of Agricultural Sciences from 2020 to 2023, the incidence of this disease in continuous cropping areas is as high as 60-90%, causing a yield loss of 30-80%, and seriously restricting the sustainable development of the watermelon industry.

[0003] Current disease resistance breeding mainly relies on traditional phenotype selection techniques, which have three major bottlenecks: first, phenotype identification requires artificial inoculation of pathogenic bacteria and observation for 2-3 months, and only one round of screening can be completed in a single growing season, resulting in a breeding cycle of 5-6 years; second, environmental factors have a significant impact, and the disease index of the same genotype can fluctuate by 25-40% under different soil types, temperature and humidity conditions, causing selection errors; third, disease resistance is negatively correlated with quality traits, and high-resistance materials generally have small fruits and low sugar content, making it difficult to achieve multi-trait improvement through conventional hybridization.

[0004] Molecular marker-assisted selection (MAS) technology provides a new direction for breaking through the above bottlenecks. Although the reported SNP markers (such as Chr02:18,736,492) are associated with disease resistance, their detection relies on high-throughput sequencing or chip platforms, which have high costs for single sample detection, and require precise instruments for field application, making it difficult to promote in grassroots breeding units. Microsatellite markers (SSR) have the advantages of high polymorphism, good stability, and convenient PCR detection, but the existing SSR markers (such as BVWS001, MCPI-15) in the public database have low linkage strength (R²<0.35) with disease resistance traits, which cannot meet the needs of precision breeding.

[0005] Therefore, developing new SSR markers that are closely linked to watermelon fusarium wilt resistance and suitable for rapid field detection is urgently needed to accelerate the breeding of disease-resistant varieties. SUMMARY

[0006] The purpose of the present application is to provide a molecular marker related to watermelon disease resistance and its application, by analyzing the differences in disease resistance traits between high-resistance and high-susceptibility watermelon populations, screening molecular markers linked to disease resistance traits, and using the molecular markers to screen parents for genetic breeding of watermelon.

[0007] The present application provides a microsatellite site WM-08 related to watermelon disease resistance, and the nucleotide sequence is as follows:

[0008] GTACAAGTGCTGCGTACAAGTTCCGGCCAGGATAATTGGGAAAGATCAAACCAATTTGAACCGCTCACATCACAGTAGTAGTAGCGTAAAGGCCGTAAGTCGGGGGGCGGCCATAACATAAGGCTATTACTTTCACAT(CT) n ATCTTTAGATATCTAGAGAGAGAGATCCGCTGCGTGAGCAACCCGACTGTGCCTTACATGTACTCTACAGGCCGCACTCCATCTTTCTTCCCAACGAGCCCATTTTTCTTTTGATTTGGAAGACGGGCGTTGCGTTCGAAAG; wherein n is a natural number of 4-6;

[0009] The microsatellite site provided by the present application is used for breeding watermelon plants with fusarium wilt resistance.

[0010] Another aspect of the present application provides a method for screening disease-resistant watermelon plants, which is to screen individuals with 4 CT repeats of the microsatellite marker.

[0011] The method is to amplify the nucleic acid sample of the watermelon plant to be tested by PCR, and determine the genotype of the plant to be tested after gel electrophoresis typing of the PCR product.

[0012] The PCR amplification method, wherein the sequence information of the primers used is as follows:

[0013] F: 5'-CCGGCCAGGATAATTGGGAA-3' (SEQ ID NO: 2),

[0014] R: 5'-GGGCTCGTTGGGAAGAAAGA-3' (SEQ ID NO: 3);

[0015] The gel electrophoresis typing, wherein the disease resistance of the plant with genotype 225 / 225 is significantly higher than that of other individuals (p<0.01), and the sequence of the genotype is as follows:

[0016] CCGGCCAGGATAATTGGGAAAGATCAAACCAATTTGAACCGCTCACATCACAGTAGTAGTAGCGTAAAGGCCGTAAGTCGGGGGGCGGCCATAACATAAGGCTATTACTTTCACATCTCTCTCTATCTTTAGATATCTAGAGAGAGAGATCCGCTGCGTGAGCAACCCGACTGTGCCTTACATGTACTCTACAGGCCGCACTCCATCTTTCTTCCCAACGAGCCC (SEQ ID NO: 1).

[0017] The present application obtains microsatellite markers linked to the disease resistance traits of watermelon by analyzing the amplification products of different disease resistance watermelon varieties, and uses the microsatellite markers to screen watermelon plants with disease resistance potential, thereby providing effective molecular markers for disease resistance breeding operations of watermelon. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 : Capillary electrophoresis map of microsatellite site;

[0019] Figure 2 : Parent and offspring disease resistance performance data graph. DETAILED DESCRIPTION

[0020] The present application will be described in detail below in conjunction with specific examples and drawings.

[0021] Example 1: Disease resistance phenotype identification

[0022] From April 2023 to August 2024, disease resistance phenotype identification was carried out in the experimental base. A continuous cropping disease heavy area with flat terrain and convenient irrigation and drainage was selected as the test field, and the previous crop was watermelon. 72 watermelon germplasms (48 cultivated varieties + 24 wild materials) were uniformly grown in March, and planted in April, using a double row planting mode, with a plant spacing of 0.8 meters and a row spacing of 2 meters, and 30 plants were planted for each material. Fusarium oxysporum f. sp. was inoculated during the flowering period of the plants:

[0023] Fusarium oxysporum f. sp. (FON-Race2) was isolated and purified from diseased plants, and PDA medium was cultured at 28°C for 5 days, then spore suspension (1×10 6 CFU / mL) was prepared with sterile water,

[0024] A small hole with a depth of 10 cm was dug at 5 cm from the main root of the plant, 20 mL of spore suspension was poured into each hole, and the soil was covered after normal field management.

[0025] The plants were rated 21 days after inoculation according to the following criteria: 0: no disease; 1: 1-2 lower leaves wilted; 3: half of the leaves yellow; 5: plant dwarf, upper leaves wilted; 7: whole plant dead.

[0026] Each material was randomly investigated for 20 plants, and the disease index was calculated: disease index =∑(disease grade x plant number) / (the highest disease grade x total plant number) x 100. 25 high-resistant materials with a disease index <20 and 25 high-susceptible materials with a disease index >80 were screened out (Table 1).

[0027] Table 1: Results of the identification of the resistance of the watermelon population

[0028] Population type Material parts Disease index range Average disease index High resistance group 25 12.3-19.8 16.5±2.7 High susceptible group 25 81.5-92.6 86.3±4.9

[0029] Example 2: Screening and verification of microsatellite markers

[0030] 25 young leaf samples were taken from the high-resistant group and the high-susceptible group, and the genomic DNA of the watermelon leaves was extracted by using the improved CTAB method. The specific operation was as follows: 100 mg of young leaves were ground into fine powder in liquid nitrogen, 800 μL of preheated lysis buffer (containing 2% CTAB, 1.4 M NaCl, 20 mM EDTA, 100 mM Tris-HCl pH 8.0, and 1% β-mercaptoethanol) was added, and the mixture was incubated at 65°C for 1 hour. After extraction with chloroform:isopropyl alcohol (24:1), the supernatant was added with 0.7 times the volume of -20°C pre-cooled isopropanol to precipitate the DNA, and the DNA was washed twice with 70% ethanol containing 10 mM NH4Ac, and finally dissolved with TE buffer. The quality of the DNA was detected by Nanodrop (A260 / A280 = 1.8-2.0) and quantified by Qubit (≥50 ng / μL), which met the requirements of subsequent experiments.

[0031] In view of the interference characteristics of plant polysaccharides and polyphenols, the SSR-PCR reaction system was optimized: 10 μL of 2x PCR Mix for plants (PC201) was used, 0.6 μL of 10 μM forward / reverse primer (synthesized by Shanghai Generay Biotech Co., Ltd.) was added, 100 ng of template DNA was added, 0.5 μL of BSA (10 mg / mL, Sigma B9000S) was added, and DEPC water was added to 20 μL. The amplification program was set as follows: 94°C pre-denaturation for 5 minutes; 35 cycles of 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 45 seconds; and 72°C for 10 minutes of final extension.

[0032] The amplified products were separated by 8% non-denaturing PAGE gel (acrylamide: methylene = 37.5:1), 1x TBE as the electrophoresis buffer, 180V constant voltage 4°C cold water circulation electrophoresis for 1.5 hours. Color development was performed by three-step silver staining method: 10% ethanol + 0.5% glacial acetic acid fixation for 10 minutes, 0.2% AgNO3+ 0.056% formaldehyde staining for 15 minutes, 3% Na2CO3+ 0.056% formaldehyde development until the bands were clear.

[0033] The WM-08 site was screened from 15 SSR sites significantly associated with disease resistance, and part of the microsatellite sites are shown in Table 2. Through population genetics analysis and phenotype-genotype correlation verification, it was determined that the WM-08 site was significantly related to watermelon fusarium wilt resistance: chi-square test showed that the genotype distribution was significantly deviated from random (χ²=58.37, p<0.001); the frequency of 225 / 225 genotype in the resistant group reached 84.0%, which was significantly higher than that in the susceptible group (Table 3).

[0034] Table 2: Information table of part of watermelon microsatellite primers

[0035] Molecular marker site Primer sequence Repetitive element Amplification fragment (bp) Annealing temperature (°C) PIC value WM-01 F: TCAAATTGTGATCCGTACTC T: CACCATTACAAAACATCACCT (GA) n ]] 150-180 55 0.62 WM-03 F: CTCATAAGTACCCCTGTGCTA R: AATACCCACGTAACATTTCTG (AAAGT) n ]]> 140-180 57 0.58 WM-05 F: AACTGTGTCAAATGGTGATTC R: GGCC TATATGGTGTATGTTGT (AT) n ]] 140-170 58 0.71 WM-08 F: CCGGCCAGGATAATTGGGAA R: GGGCTCGTTGGGAAGAAAGA (CT) n ]]> 220-230 58 0.82 WM-10 F: AGAACATGCCATAAGCATAAC R: CACCTAGGCACATTGTAGTTC (GTT) n ]] 180-210 60 0.65 WM-12 F: TAAAGAAAACCGAACACAGTT R: TTTTCAGGAATTTACAACAGG (GACA) n ]]> 140-155 56 0.74 WM-15 F: GTCCTCTGTTTCTGTTTCTCC R: CAGAAGGTTCTGAAGAAGTACC (GGC) n ]]> 140-155 59 0.68

[0036] Table 3: Data of WM-08 site associated with watermelon fusarium wilt phenotype

[0037] Genotype High resistance group (25) High susceptible group (25) Average disease index 225 / 225 21(84.0%) 1(4.0%) 15.3±2.1 225 / 227 3(12.0%) 6(24.0%) 43.5±3.8 227 / 227 1(4.0%) 18(72.0%) 82.7±5.3

[0038] The WM-08 site was sequenced, and it was found that the 225bp allele contained (CT)4 repeats. The repeats were located in the 1.2kb regulatory region upstream of the disease resistance gene Cla97C10G195200. Bioinformatics prediction showed that (CT)4 formed a special secondary structure, which enhanced the binding ability of WRKY transcription factor.

[0039] The microsatellite site WM-08 was screened, and the dominant gene related to watermelon and fusarium oxysporum resistance was found. The nucleotide sequence of the microsatellite site WM-08 is as follows:

[0040] GTACAAGTGCTGCGTACAAGTTCCGGCCAGGATAATTGGGAAAGATCAAACCAATTTGAACCGCTCACATCACAGTAGTAGTAGCGTAAAGGCCGTAAGTCGGGGGGCGGCCATAACATAAGGCTATTACTTTCACAT(CT) nATCTTTAGATATCTAGAGAGAGAGATCCGCTGCGTGAGCAACCCGACTGTGCCTTACATGTACTCTACAGGCCGCACTCCATCTTTCTTCCCAACGAGCCCATTTTTCTTTTGATTTGGAAGACGGGCGTTGCGTTCGAAAG;

[0041] The primer pair sequence used in the satellite point position is as follows:

[0042] Forward primer F: CCGGCCAGGATAATTGGGAA (SEQ ID NO: 2),

[0043] Reverse primer R: GGGCTCGTTGGGAAGAAAGA (SEQ ID NO: 3).

[0044] Its core repeat unit is (CT)n, that is, using the upstream and downstream primers of SEQ ID NO: 2 and SEQ ID NO: 3 for amplification, there are three genotypes of 225 / 225, 225 / 227 and 227 / 227, among which 225 / 225 is the dominant gene, and the specific band amplified is 225bp.

[0045] Example 3: Application of molecular marker assisted breeding

[0046] In March 2024, molecular marker assisted breeding research was carried out in the watermelon breeding base. The diseased variety (genotype 227 / 227) was used as the female parent, and the highly resistant germplasm "Resistance Source No. 8" (genotype 225 / 225) was used as the male parent to construct a F2 separation population of 560 strains. Young leaves were taken at the three-leaf stage to extract genomic DNA, and the method in the example was used for amplification. The results showed that the 225 / 225 homozygous type accounted for 24.6%, the 225 / 227 heterozygous type accounted for 50.4%, and the 227 / 227 homozygous type accounted for 25.0% (Table 4 and Figure 1 ).

[0047] In the Fusarium wilt resurgence area, the screening group (225 / 225 type) and the ordinary plant group (227 / 227 type) were inoculated with Fusarium oxysporum for verification. At the flowering stage, the root was inoculated with spore suspension (1×10 6 CFU / mL) by wound irrigation method. Twenty-one days after inoculation, it was found that the vascular bundle of the screening group plant only slightly browned, the disease index was 18.7±3.1, and the death rate was 1.8%; while the ordinary group appeared serious vascular necrosis, the disease index reached 77.8±6.4, and the death rate was as high as 62.1% (Table 5 and Figure 2The defense enzyme activity detection shows that the POD, SOD and PAL enzyme activities of the screening group 7 days after inoculation (Table 6) are 362.5 U / g, 285.4 U / g and 12.8 μmol / g / h respectively, which are more than 95% higher than those of the common group.

[0048] The 138 strains of 225 / 225 type plants screened are self-crossed in an isolation area to obtain a 200-strain offspring population. Gene detection screens the 225 / 225 genotype. Under the same disease pressure, the disease index (Table 5) of the offspring population is 19.3±3.2, and the death rate is 2.1%, which has no significant difference (p>0.05) with the parent population. Continuous two-generation tracking shows that the disease resistance is stably inherited, and the disease index of the second-generation offspring maintains at 18.9±2.8.

[0049] Table 4: Genotype distribution table of WM-08 site of F2 population

[0050] Genotype Plant number Proportion (%) 225 / 225 138 24.6 225 / 227 282 50.4 227 / 227 140 25

[0051] Table 5: Comparison table of disease resistance performance 21 days after inoculation

[0052] Generation Disease index Vascular browning rate (%) Mortality rate (%) Parent generation 18.7±3.1 16.3±3.5 1.8 Offspring one generation 19.3±3.2 17.8±3.1 2.1 Offspring two generation 18.9±2.8 16.9±2.7 1.9

[0053] Table 6: Defense enzyme activity table

[0054] Enzyme activity index Screening group Common group Promotion range POD (U / g FW) 362.5±28.7 185.3±22.4 95.60% SOD (U / g FW) 285.4±21.6 142.8±18.9 99.90% PAL (μmol / g FW / h) 12.8±1.2 6.3±0.9 103.20%

[0055] In summary, the present application realizes precise and efficient breeding of disease-resistant watermelon plants based on the WM-08 molecular marker, significantly shortens the breeding cycle, and the screened plants and their offspring can continuously maintain stable resistance in heavy disease areas, and greatly reduce the damage of fusarium wilt.

Claims

1. A microsatellite molecular marker associated with watermelon resistance to Fusarium wilt, characterized in that, The nucleotide sequence of the microsatellite molecular marker is as follows: GTACAAGTGCTGCGTACAAGTTCCGGCCAGGATAATTGGGAAAGATCAAACCAATTTGAACCGCTCACATCACAGTAGTAGTAGCGTAAAGGCCGTAAGTCGGGGGGCGGCCATAACATAAGGCTATTACTTTCACAT(CT) n ATCTTTAGATATCTAGAGAGAGAGATCCGCTGCGTGAGCAACCCGACTGTGCCTTACATGTACTCTACAGGCCGCACTCCATCTTTCTTCCCAACGAGCCCATTTTTCTTTTGATTTGGAAGACGGGCGTTGCGTTCGAAAG; wherein n is a natural number from 4 to 6, n equal to 4 is the anti-wilt phenotype.

2. Use of the microsatellite molecular marker of claim 1 in breeding a watermelon parent with resistance to fusarium wilt, wherein n is equal to 4, and the plant is resistant to fusarium wilt.

3. A method of screening for a Fusarium wilt resistant watermelon parent, characterized by, The method is to screen individuals with 4 CT repeats of the microsatellite site of claim 1.

4. The method of claim 3, wherein, The method is to amplify the nucleic acid sample of the watermelon plant to be tested by PCR, and the genotype of the plant to be tested is determined after gel electrophoresis typing of the PCR product.

5. The method of claim 4, wherein, The sequence of the primer used in the PCR amplification is SEQ ID NO: 2 and SEQ ID NO:

3.

6. The method of claim 5, wherein, The gel electrophoresis typing selects plants with a band size of 225 / 225.

7. The method of claim 6, wherein, The plant with a band size of 225 / 225 has a microsatellite molecular marker sequence of SEQ ID NO: 1.

Citation Information

Patent Citations

  • Method for cultivating watermelon variety with high resistance to fusarium wilt

    CN110622852A

  • Combining fusarium 2 resistance gene (FON2) and red flesh in watermelon

    US20150101072A1