SV molecular marker for identifying Pleurotus eryngii variety Zhongnongchuan apricot No.1 and application thereof

By developing SV molecular markers and primer sets, combined with PCR amplification and electrophoresis detection, the problem of accurate identification of King Oyster Mushroom No. 1 (Zhongnong Chuanxing 1) was solved, realizing efficient and low-cost variety identification and promoting the development of King Oyster Mushroom industrialization.

CN121294732APending Publication Date: 2026-01-09INST OF URBAN AGRI CHINESE ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511883212.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-15
Publication Date
2026-01-09

AI Technical Summary

Technical Problem

The lack of specific molecular markers for the Zhongnong Chuanxing No. 1 king oyster mushroom in existing technologies makes it difficult to accurately identify this variety, which has become a key obstacle restricting its factory cultivation and industrial promotion.

Method used

A method based on SV molecular markers was developed to accurately identify Zhongnongchuanxing No. 1 using a specific primer set and kit, through PCR amplification and electrophoresis detection. The method includes DNA extraction, PCR amplification and agarose gel electrophoresis, simplifying the process and reducing detection costs.

Benefits of technology

It has enabled accurate identification of Zhongnong Chuanxing No. 1, reduced testing costs, improved identification efficiency, adapted to large-scale sample testing, avoided false positives of traditional methods, ensured the reliability of results and met the demand for high throughput, and promoted the controllability of varieties and the protection of rights in the industrialized production of king oyster mushrooms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121294732A_ABST
    Figure CN121294732A_ABST
Patent Text Reader

Abstract

The invention discloses an SV molecular marker for identifying a Pleurotus eryngii variety Zhongnongchuan apricot No.1 and application thereof, and relates to the technical field of molecular markers. The nucleotide sequence of the SV molecular marker is as shown in SEQ ID NO: 1. According to the method, the Nong chuan apricot No.1 and other varieties in the pleurotus eryngii can be accurately identified, the problem of mixed use of strains in popularization is effectively solved, the detection cost is low, the flux is high, a direct technical basis is provided for variety identification, and the industrial industry of the pleurotus eryngii is promoted to develop towards the directions of controllable varieties and guaranteed rights and interests.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology. More specifically, this invention relates to an SV molecular marker for identifying the Pleurotus ostreatus variety Nongchuanxing 1 and its application. Background Technology

[0002] King oyster mushroom, also known as eryngii oyster mushroom, has fruiting bodies that grow singly or in clusters. Its flesh is thick, crisp, and tender, with a unique flavor reminiscent of almonds and abalone, hence its nickname "almond abalone mushroom." It is also known as the "King of Oyster Mushrooms" and "Delicious Boletus of the Grasslands." Nutritionally and health-wise, king oyster mushrooms are rich in essential amino acids, trace elements, and active ingredients, possessing antioxidant and antiviral properties, making them promising for applications in food processing and the health industry.

[0003] The cultivation of king oyster mushrooms has gradually upgraded from traditional seasonal open-field cultivation to intensive, factory-style cultivation. Factory-style cultivation, through precise control of environmental conditions such as temperature, humidity, light, and carbon dioxide concentration, makes the yield and quality of king oyster mushrooms more stable, and has become the mainstream development direction of the current king oyster mushroom industry. However, factory-style cultivation places stringent requirements on the characteristics of varieties, requiring varieties to have short cultivation cycles, high and stable yields, strong resistance to adverse conditions, and high marketability. Currently, the king oyster mushroom varieties used in domestic factory-style cultivation are highly dependent on imports, mainly the Japanese-imported "Nihon-indori 1," while domestically bred high-quality varieties suitable for factory-style production are extremely scarce, severely restricting the independent and controllable development of my country's king oyster mushroom industry.

[0004] To overcome the bottleneck of reliance on the aforementioned varieties, Chengdu Zhongyan Mushroom Industry Co., Ltd. (Address: No. 300, Group 5, Zhanqi Village, Tangchang Town, Pidu District, Chengdu) conducted research on hybrid self-pollination breeding of Pleurotus eryngii. Using Pleurotus eryngii strain Pe006 as the parent, a new generation strain, Zhongnongchuanxing No. 1 (Pe042), was bred through multi-spore self-pollination technology. This strain, verified through two consecutive rounds of two-point industrial cultivation trials, exhibits stable genetic traits, high yield, and excellent commercial quality, demonstrating significant value for industrial application. However, the current technology lacks specific molecular markers for Zhongnongchuanxing No. 1, making accurate identification of this variety difficult and becoming a key technical obstacle restricting its industrial promotion. Summary of the Invention

[0005] This invention provides an SV molecular marker for identifying the King Oyster Mushroom variety Zhongnongchuanxing 1 and its application. It can accurately identify King Oyster Mushroom Zhongnongchuanxing 1 from other varieties, effectively solve the problem of mixed use of strains during promotion, and has low detection cost and high throughput. It provides direct technical basis for variety identification and promotes the development of the King Oyster Mushroom industrialization industry towards variety control and the protection of rights and interests.

[0006] To achieve these objectives and other advantages according to the present invention, an SV molecular marker for identifying Pleurotus ostreatus strain Zhongnongchuanxing 1 is provided, the nucleotide sequence of which is shown in SEQ ID NO.1. If the SV molecular marker is not detected in the Pleurotus ostreatus to be tested, then the Pleurotus ostreatus is Zhongnongchuanxing 1.

[0007] Preferably, the SV molecular marker is used in the *Elaeoselinum* variety of *Pleurotus eryngii* (…). Pleurotus eryngii var . elaeoselini In the genome assembly of strain CCMJ2131, GCA_029874175.1, it is located in the interval from 9067982bp to 9068069bp in SPUP01000003.1.

[0008] The primer set used to identify the Nongchuanxing 1 strain of Pleurotus ostreatus is designed based on the SV molecular marker and includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3.

[0009] A kit for identifying the Nongchuanxing 1 strain of Pleurotus ostreatus, the kit comprising the aforementioned primer set.

[0010] The application of the SV molecular marker, the primer set, or the kit in identifying the Nongchuanxing 1 strain of Pleurotus ostreatus.

[0011] The application of the SV molecular marker, the primer set, or the kit in the breeding or variety protection of the Pleurotus ostreatus strain Nongchuanxing 1.

[0012] The identification method for the Pleurotus eryngii strain Nongchuanxing No. 1 includes the following steps: a) Extract genomic DNA from the *Pleurotus eryngii* strain or fruiting body to be tested; b) Using the DNA extracted in step a) as a template, perform PCR amplification using the primer set or the kit described above; c) Electrophoretic detection of PCR amplification products; d) Determine whether the sample to be tested is strain Zhongnong Chuanxing No. 1 based on the electrophoresis band results.

[0013] Preferably, the judgment criteria are as follows: if a specific band appears in the electrophoresis result, the sample is determined to be strain Zhongnong Chuanxing No. 1; if the specific band does not appear, it is determined to be strain other than Zhongnong Chuanxing No. 1.

[0014] Preferably, the PCR amplification system includes: 2×Rapid Taq Master Mix, forward primer, reverse primer, Pleurotus ostreatus DNA to be tested, and ddH2O; The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 minutes; 30 cycles: 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds; and finally 72℃ extension for 5 minutes.

[0015] The present invention has at least the following beneficial effects: First, the SV molecular marker of this invention is developed based on the unique SV site of Pe042, which is highly specific and only identifies Pe042. It can accurately distinguish it from other king oyster mushroom varieties such as Riyin No. 1, solving the problem that traditional morphological identification is difficult to quickly distinguish and providing traceability evidence for variety infringement.

[0016] Secondly, the primer set of this invention is highly matched with the Pe042-specific SV site, producing specific bands only for Pe042 (without cross-reaction), avoiding false positives of traditional markers, ensuring reliable results, and meeting the high-throughput requirements of breeding screening and production verification.

[0017] Third, the kit of the present invention integrates dedicated primers and PCR reagents, which simplifies the process, reduces human error, has strong stability, high repeatability of test results, is suitable for conventional laboratories and production sites, and can be operated without professional training, thus lowering the technical threshold.

[0018] Fourth, the application of this invention covers identification, breeding, and variety protection. Breeding can screen for Pe042 homozygous strains, batch verification can prevent variety mixing, and it can serve as a traceability basis in case of infringement. Moreover, it does not rely on imported technology and equipment, thus promoting the industrialization of king oyster mushrooms towards the direction of controllable varieties and protected rights.

[0019] Fifth, the identification method of the present invention only requires three steps: DNA extraction, PCR amplification, and agarose gel electrophoresis. It is low in cost, high in throughput, and highly specific. The results are based on specific bands, making them intuitive and easy to read, avoiding subjective errors, and suitable for large-scale sample detection.

[0020] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0021] Figure 1 This is an electrophoresis detection result according to an embodiment of the present invention. Detailed Implementation

[0022] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description. It should be noted that, unless otherwise specified, the experimental methods described in the following embodiments are conventional methods, and the reagents and materials described are commercially available unless otherwise specified, and therefore should not be construed as limiting the present invention.

[0023] Structural variation (SV) molecular marker technology, as a novel molecular marker technology, can systematically identify large fragment variations (including insertions, deletions, inversions, translocations, and copy number variations) in the genome with a length ≥50 bp based on whole-genome resequencing or de novo assembly. Its technical principle is as follows: by comparing the genome sequences of different individuals, large DNA regions with differences in length or location are directly identified, and then specific detection primers are designed based on these differing regions; subsequently, through PCR amplification, sequencing analysis, and other steps, combined with electrophoresis detection or bioinformatics analysis, the polymorphism of the sample can be determined based on banding patterns or genotype data. Therefore, this invention focuses on developing specific molecular markers for Zhongnongchuanxing No. 1 (Pe042) based on SV technology. Specifically, this invention uses published Pleurotus eryngii genome data (Elaeoselinum variant)... Pleurotus eryngii var . elaeoselini Using the genome assembly of strain CCMJ2131 (GCA_029874175.1) as a reference, high-throughput sequencing technology was used to obtain the whole genome data of the strain to be tested. Based on the reference genome, a set of specific primers were designed and synthesized to establish a method for specific identification of Pe042. The effectiveness of the established method was evaluated.

[0024] Example 1: Obtaining the SV molecular marker for identifying Nongchuanxing 1 strain of Pleurotus ostreatus. Using the Pleurotus eryngii strain Pe006 (official variety registration name IUA-Pe20) as the parent, a new generation strain, Zhongnongchuanxing No. 1 (Pe042), was bred through multispore self-pollination technology, yielding Pleurotus eryngii mycelial samples of this strain. This variety has been officially recognized in accordance with the relevant provisions of the "Sichuan Province Crop Seed Management Regulations" and the "Sichuan Province Non-Major Crop Variety Identification Measures." Variety origin: self-pollination of IUA-Pe20.

[0025] The obtained Pleurotus eryngii mycelial samples were commissioned to Wuhan Hope Group Biotechnology Co., Ltd. for second-generation genome library construction and sequencing. After the sequencing data were quality controlled by FastQC software, they were compared one by one with the Pleurotus eryngii reference genome using BWA (Burrows-Wheeler Aligner) software. Then, the variant information was screened and filtered using GATK (Genome Analysis Toolkit, 4.2.6.1) software to remove variant sites with low confidence. Finally, the unique heterozygous variant site of Pe042 that distinguishes it from other Pleurotus eryngii, as well as the variant sites of other Pleurotus eryngii, were identified using the visualization software IGV (Integrative Genomics Viewer, 2.6.3). Its nucleotide sequence is shown in SEQ ID NO:1.

[0026] The SV molecular marker of this invention is developed based on the unique SV site of Pe042. It has extremely high specificity, only recognizing Pe042, and can accurately distinguish it from other Pleurotus eryngii varieties such as Riyin No. 1. It solves the problem that traditional morphological identification is difficult to quickly distinguish and provides traceability evidence for variety infringement.

[0027] Example 2: Primer set and kit for identifying Pleurotus ostreatus strain Nongchuanxing 1 This embodiment provides a primer set for identifying the *Pleurotus eryngii* strain Nongchuanxing 1. Using Pe042, primers were applied to the *Elaeoselinum* variety (…). Pleurotus eryngii var . elaeoselini Primers were developed from the SV site located at positions 9067982 bp to 9068069 bp in SPUP01000003.1 of the genome assembly GCA_029874175.1 of strain CCMJ2131. The primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:3. The specific primer set is as follows: F:5'-TAATGTAGACCACTCGGAAC-3' R: 5'-GCTGGAGATAAAATTGACTCAG-3' The primer set of this invention is highly matched with the Pe042-specific SV site, producing specific bands only for Pe042 (without cross-reactivity), avoiding false positives of traditional markers, ensuring reliable results, and meeting the high-throughput requirements of breeding screening and production verification.

[0028] This embodiment also provides a kit for identifying the *Pleurotus eryngii* strain Nongchuanxing 1. The kit includes the primer set described above. The kit also includes standard reagents for PCR amplification. The PCR amplification system includes: 2×RapidTaq Master Mix, forward primers, reverse primers, *Pleurotus eryngii* DNA to be tested, and ddH2O.

[0029] The kit of this invention integrates dedicated primers and PCR reagents, simplifying the process, reducing human error, exhibiting strong stability and high repeatability of test results, and is suitable for routine laboratories and production sites. It can be operated without professional training, thus lowering the technical threshold.

[0030] Example 3: Identification method of Pleurotus ostreatus strain Nongchuanxing No. 1 This embodiment provides a method for identifying the Nongchuanxing No. 1 strain of Pleurotus ostreatus, including the following steps: a) Extraction of genomic DNA from the sample to be tested. The sample to be tested was Pleurotus eryngii mycelium, which was cultured for 8 days. The mycelium was collected and total DNA was extracted using a modified CTAB method.

[0031] b) The primer set designed in Example 2 was used to perform PCR amplification on the extracted genomic DNA of the sample to be tested. The PCR amplification system is as follows: PCR system: 2×Mix 20μL, forward primer 2μL, reverse primer 2μL, ddH2O 25μL, DNA 1μL.

[0032] PCR program: Preheat at 95℃ for 3 min; 30 cycles: 95℃ for 15 s, 55℃ for 15 s, 72℃ for 30 s; final extension at 72℃ for 5 min.

[0033] c) PCR amplification products were detected by electrophoresis using a 3% agarose gel. The electrophoresis procedure is as follows: 3% agarose, constant voltage mode, 100V, 80mA, 40min.

[0034] d) Based on the electrophoresis band results, use a gel imaging system to determine whether the sample to be tested is the Zhongnong Chuanxing No. 1 strain. If a specific band appears in the electrophoresis results, the sample is determined to be the Zhongnong Chuanxing No. 1 strain; if there is no specific band, it is determined to be a non-Zhongnong Chuanxing No. 1 strain.

[0035] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO:4, and bases 257-344 from the 5' end (i.e., the front end) are the SV molecular marker fragment shown in SEQ ID NO:1, then the tested Pleurotus eryngii carries this SV molecular marker, and the tested Pleurotus eryngii is not the Zhongnong Chuanxing No. 1 strain Pe042; otherwise, the tested Pleurotus eryngii does not have the detected SV molecular marker, that is, the genome of the tested Pleurotus eryngii is in the Elaeoselinum variant (Erycibe). Pleurotus eryngii var . elaeoselini A large deletion occurred in the genome assembly of strain CCMJ2131, specifically in the sequence GCA 029874175.1, between 9067982bp and 9068069bp in SPUP 01000003.1. The tested Pleurotus ostreatus was identified as strain Pe042 of Zhongnong Chuanxing No. 1.

[0036] The identification method of this invention only requires three steps: DNA extraction, PCR amplification, and agarose gel electrophoresis. It is simple to operate, low in cost, high in throughput, and highly specific. The results are based on specific bands, making them intuitive and easy to read, avoiding subjective errors, and suitable for large-scale sample detection.

[0037] Example 4: Detection and Validation of SV Molecular Markers in Pleurotus eryngii Strains Nongchuanxing No. 1 To verify the practicality of the SV molecular marker, the method of Example 3 was used to determine whether the SV molecular marker was carried by PCR amplification.

[0038] The results of the gel imaging system are as follows Figure 1 As shown, the left side represents the DNA molecular weight standard, with the marker containing six bands: 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. The right side represents the PCR product bands of various *Pleurotus eryngii* strains. Using the dedicated primers provided in this invention to identify the *Pleurotus eryngii* strains, the results showed that Pe042 exhibited a significant deletion compared to other *Pleurotus eryngii* strains. Only the PCR amplification product of Pe042 showed a specific band, while the PCR amplification products of other *Pleurotus eryngii* strains (such as Pe006) did not show specific bands. This indicates that the primers designed in this invention can amplify and distinguish the specific gene fragment of Pe042.

[0039] In summary, this invention uses published Pleurotus eryngii genome data as a reference and employs high-throughput sequencing technology to obtain the whole genome data of the strain to be tested. Based on this reference genome, a set of specific primers was designed and synthesized to establish a method for specific identification of Pe042. The effectiveness of the established method was evaluated through experiments.

[0040] This invention employs high-throughput sequencing technology to sequence the tested *Pleurotus eryngii* strains. By comparing the sequences of these strains with a reference genome, a specific molecular marker was identified. Primers were developed using this specific molecular marker to perform PCR amplification on total DNA extracted from different *Pleurotus eryngii* strains. The PCR products were then subjected to agarose gel electrophoresis to identify a specific band that could be used to specifically identify Pe042.

[0041] The specialized primers provided by this invention can be used for the rapid identification and detection of Pe042. These primers not only provide more accurate identification results than conventional morphological methods, but also offer shorter detection times and higher accuracy compared to other detection methods. The detection time is only 3 hours (compared to 3-4 months for fruiting trials). They can serve as a complementary protection for the Pe042 strain, addressing common issues such as strain mixing and intellectual property disputes during the promotion of edible fungi.

[0042] The nucleotide sequence of the SV molecular marker is shown in SEQ ID NO:1: GATCACCCAGGTAGCGGAGTTACAATGTATCAATAAACACATCAAAGCGGAGTTATACATTGTATTGATAGGAACAGTCCGCTATGTG The nucleotide sequence of the upstream primer is shown in SEQ ID NO:2: TAATGTAGACCACTCGGAAC The nucleotide sequence of the downstream primer is shown in SEQ ID NO:3: GCTGGAGATAAAATTGACTCAG The reference genome nucleotide sequence of Pleurotus eryngii carrying the SV molecular marker is shown in SEQ ID NO:4: AAGGCAGGGGTGCTGAGAGTGATTCGTAATGTAGACCACTCGGAACTCACAGCGTATCTGCGAGGCAAACCGACACAGTTTGAACGGCGCGATAAAGAGGAAGGGGATCGCACCTGATGGCCTACTGCATCCC GTGGCATTCTTGATTCTGCGGCAGGCGGTCATCTTCTTCAGGATTGCAGAGGAGCATCTTGCAGGCGGCTGTACCTAGTGCGAGGGATATGTTGCCCGATAGGTATTTACGTGGTCGAAGATGATCACCCAGGTA GCGGAGTTACAATGTATCAATAAACACATCAAAGCGGAGTTATACATTGTATTGATAGGAACAGTCCGCTATGTGGATCACCACCCAGCGGGGAGAAACCTTGACAGAAACTGAGTACTGGATTCTGAATAGCTT ATGCGGGTGACGGTGGCTACGAGGGGATCATGTCAGCACCCGTTCACACACCATGAAATCATGCTACTCACTAAATAAGTGACAACAAACAAGCTAGCTGGAGATAAAATTGACTCAGTGGACATTAGCCGGCCT The number of devices and processing scale described herein are for the purpose of simplifying the description of the invention. Applications, modifications, and variations of the invention will be readily apparent to those skilled in the art.

[0043] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. An SV molecular marker for identifying Nongchuanxing 1 strain of Pleurotus ostreatus, characterized in that, The nucleotide sequence of the SV molecular marker is shown in SEQ ID NO.

1. If the SV molecular marker is not detected in the tested Pleurotus eryngii, then the Pleurotus eryngii is Zhongnong Chuanxing No.

1.

2. The SV molecular marker as described in claim 1, characterized in that, The SV molecular marker is found in the Elaeoselinum variety of Pleurotus eryngii ( Pleurotus eryngii var elaeoselini In the genome assembly of strain CCMJ2131, GCA_029874175.1, it is located in the interval from 9067982bp to 9068069bp in SPUP01000003.

1.

3. A primer set for identifying the *Pleurotus eryngii* strain Nongchuanxing 1, characterized in that, The primer set is designed according to the SV molecular marker according to claim 1 or 2, and includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO:2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

3.

4. A kit for identifying Nongchuanxing No. 1 strain of Pleurotus eryngii, characterized in that, The kit includes the primer set as described in claim 3.

5. The application of the SV molecular marker as described in claim 1 or 2, the primer set as described in claim 3, or the kit as described in claim 4 in the identification of Nongchuanxing 1 strain of Pleurotus ostreatus.

6. The application of the SV molecular marker as described in claim 1 or 2, the primer set as described in claim 3, or the kit as described in claim 4 in the breeding or variety protection of the Pleurotus ostreatus strain Nongchuanxing 1.

7. A method for identifying the *Pleurotus eryngii* strain Nongchuanxing No. 1, characterized in that... Includes the following steps: a) Extract genomic DNA from the *Pleurotus eryngii* strain or fruiting body to be tested; b) Using the DNA extracted in step a) as a template, perform PCR amplification using the primer set described in claim 3 or the kit described in claim 4; c) Electrophoretic detection of PCR amplification products; d) Determine whether the sample to be tested is strain Zhongnong Chuanxing No. 1 based on the electrophoresis band results.

8. The identification method according to claim 7, characterized in that, The criteria for judgment are as follows: if a specific band appears in the electrophoresis result, the sample is determined to be strain Zhongnong Chuanxing No. 1; if the specific band does not appear, it is determined to be strain other than Zhongnong Chuanxing No.

1.

9. The identification method according to claim 7, characterized in that, The PCR amplification system includes: 2×Rapid TaqMaster Mix, forward primers, reverse primers, Pleurotus ostreatus DNA to be tested, and ddH2O; The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 minutes; 30 cycles: 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, 72℃ extension for 30 seconds; and finally 72℃ extension for 5 minutes.

Citation Information

Patent Citations

  • Primer group for identifying difference between pleurotus eryngii strains and application of primer group

    CN120574977A

  • Method for identifying strain of mushroom belonging to genus pleurotus, marker for identifying strain and method for producing marker

    JP2005261228A