SiRNA for inhibiting CDC20 gene expression and application thereof

Abstract

The invention discloses siRNA (small interfering Ribonucleic Acid) for inhibiting CDC20 gene expression and an application of the siRNA. Experiments prove that the siRNA designed by the invention has a remarkable inhibition effect on various tumor cells such as HepG2, sk-hep-1 and SNU387 under the concentration of 1-100nM, and RT-qPCR results prove that the expression of the CDC20 gene is remarkably inhibited and prove that the siRNA has high inhibitory activity on the CDC20 gene, so that the modified siRNA has a great application prospect in preparation of medicines for treating tumors related to high expression of the CDC20.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to an siRNA that inhibits the expression of the CDC20 gene and its applications. Background Technology

[0002] CDC20 (Cell Division Cycle 20) is closely related to the regulation of cell cycle and apoptosis. CDC20 plays a carcinogenic role in tumorigenesis and development; therefore, targeting and inhibiting CDC20 expression may be a novel strategy for treating human cancers. Currently available protease inhibitors mainly exert their effects by inhibiting the activity of the APC / CDC20 complex. This mode of action is non-specific, affecting not only CDC20 but also many other proteins. While exerting their effects, they also disrupt many downstream tumor suppressor factors, leading to adverse reactions such as fever, anemia, diarrhea, and nausea in cancer patients. Inhibitors that target CDC20 can specifically inhibit CDC20 while avoiding direct inhibition of APC activity, thus preventing toxic side effects at the source.

[0003] The discovery of siRNA began with the observation of endogenous gene silencing in organisms. Early studies showed that exogenously introduced double-stranded RNA could unexpectedly suppress the expression of endogenous homologous genes; for example, overexpression of the chalcone synthase gene in plants led to a significant decrease in its expression level. In 1998, scientists first clearly demonstrated in a nematode model that double-stranded RNA exhibited a stronger gene silencing effect than single-stranded RNA, naming this phenomenon RNA interference (RNAi). In 2001, synthetic siRNA was shown to induce RNAi in mammalian cells, marking siRNA as a tool for precisely manipulating gene expression. Subsequent research further revealed the core links of its molecular mechanism, such as the assembly of the RISC complex and the principle of siRNA-guided mRNA cleavage, laying the foundation for the artificial design of siRNA.

[0004] At the application level, the value of siRNA is mainly reflected in two major areas: gene function research and disease treatment. As a tool for gene function research, siRNA, by mimicking the role of drugs in inhibiting target genes, has become a core technology for verifying gene function and screening drug targets in the post-genomic era. Its efficiency and specificity are significantly superior to traditional methods, and it can efficiently construct gene function loss models. In the field of disease treatment, the drug potential of siRNA lies in directly intervening in the expression of pathogenic genes, such as silencing viral genes or pathological protein-related genes to treat infectious or hereditary diseases. However, early siRNA drug development faced challenges such as poor stability, low delivery efficiency, and immunogenicity, driving continuous exploration of chemical modification and targeted delivery systems, aiming to overcome technical bottlenecks to achieve clinical application. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and provide an siRNA that inhibits the expression of the CDC20 gene.

[0006] Another object of the present invention is to provide the application of the above-mentioned siRNA that inhibits CDC20 gene expression.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A siRNA that inhibits CDC20 gene expression, comprising at least one of the following:

[0009] The nucleotide sequence of the positive strand of si-CDC20 is as follows:

[0010] CAAGAAGGAACAUCAGAAA,

[0011] The antisense strand nucleotide sequence is as follows:

[0012] UUUCUGAUGUUCCUUCUUGGU;

[0013] The nucleotide sequence of the positive strand of si-CDC20-1 is as follows:

[0014] mC[ps]mA[ps]mAmGmAmAfGfGfAmAmCmAmUmCmAmGmAmAmA,

[0015] The antisense strand nucleotide sequence is as follows:

[0016] mU[ps]fU[ps]mUfCmUfGmAfUmGfUmUfCmCfUmUfCmUfUmG[ps]mG[ps]mU;

[0017] The nucleotide sequence of the positive strand of si-CDC20-2 is as follows:

[0018] mC[ps]mA[ps]mAmGmAmAmGmGfAfAfCmAmUmCmAmGmAmAmA,

[0019] The antisense strand nucleotide sequence is as follows:

[0020] mU[ps]fU[ps]mUfCmUfGmAmUmGmUmUfCmCfUmUfCmUfUmG[ps]mG[ps]mU;

[0021] The nucleotide sequence of the positive strand of si-CDC20-3 is as follows:

[0022] mC[ps]mA[ps]mAmGmAmAfGmGfAfAfCmAmUmCmAmGmAmAmAmGm C,

[0023] The antisense strand nucleotide sequence is as follows:

[0024] mG[ps]fC[ps]mUmUmUfCmUfGfAmUmGmUmUfCmCfUmUmCmUmUmG[ps]mG[ps]mU;

[0025] In the above nucleotide sequences, the prefix m represents methoxylated nucleotides, the prefix f represents fluorinated nucleotides, and [ps] represents nucleotides linked by thiophosphate groups.

[0026] Analogs of si-CDC20, si-CDC20-1, si-CDC20-1, or si-CDC20-1 that still retain the function of inhibiting CDC20 gene expression through base insertion, deletion, or substitution.

[0027] The siRNA that inhibits CDC20 gene expression can suppress the expression level of CDC20 gene after being transfected into cells using a transfection reagent.

[0028] A reagent for inhibiting CDC20 gene expression, comprising the aforementioned siRNA for inhibiting CDC20 gene expression.

[0029] The reagents for inhibiting CDC20 gene expression also include transfection reagents for transferring siRNA into cells.

[0030] The application of the siRNA and / or reagents that inhibit CDC20 gene expression in the preparation of antitumor drugs.

[0031] The tumors mentioned include at least one of liver cancer, hepatocellular carcinoma, and hepatocellular adenocarcinoma.

[0032] The present invention has the following advantages and effects compared with the prior art:

[0033] This invention provides an siRNA for inhibiting CDC20 gene expression. Experiments have shown that the siRNA designed in this invention has a significant inhibitory effect on various tumor cells such as HepG2, sk-hep-1, and SNU387 at concentrations of 1–100 nM. Furthermore, RT-qPCR results confirm that CDC20 gene expression is significantly inhibited, demonstrating that the siRNA possesses high inhibitory activity against the CDC20 gene. Therefore, the modified siRNA has great application potential in the preparation of drugs for treating tumors associated with high CDC20 expression. Attached Figure Description

[0034] Figure 1 This is a graph showing the inhibition rate of siRNA on CDC20 mRNA expression at different concentrations in Example 2. In the graph, A represents the inhibition rate of si-CDC20 on CDC20 mRNA expression in HepG2 cells; B represents the inhibition rate of si-CDC20-1 on CDC20 mRNA expression in HepG2 cells; C represents the inhibition rate of si-CDC20-1 on CDC20 mRNA expression in sk-hep-1 cells; D represents the inhibition rate of si-CDC20-1 on CDC20 mRNA expression in SNU387 cells; E represents the inhibition rate of si-CDC20-2 on CDC20 mRNA expression in HepG2 cells; and F represents the inhibition rate of si-CDC20-3 on CDC20 mRNA expression in HepG2 cells.

[0035] Figure 2 This is a graph showing the results of CCK8 assay in Example 3, which detected the inhibition of cancer cell proliferation by CDC20 siRNA.

[0036] Figure 3 This is a graph showing the cell growth curve results after CDC20 siRNA transfection in Example 4.

[0037] Figure 4 This is a graph showing the results of siRNA interference in detecting apoptosis in tumor cells in Example 5.

[0038] Figure 5 This is a graph showing the cell cycle detection results of tumor cells caused by siRNA interference in Example 6. Detailed Implementation

[0039] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0040] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0041] Example 1: Design and Modification of siRNA

[0042] 1.1 Design of siRNA

[0043] To achieve the effect of inhibiting the CDC20 gene, this invention designs a set of siRNAs specifically for inhibition based on the sequence of its target mRNA, the specific sequences of which are as follows:

[0044] si-CDC20:

[0045] Chain of Justice (5' to 3'): CAAGAAGGAACAUCAGAAA;

[0046] Antonym chain (5' to 3'): UUUCUGAUGUUCCUUCUUGGU.

[0047] 1.2 siRNA Modification

[0048] Based on the siRNA designed in 1.1, some nucleotides were modified to improve its stability. The nucleotide sequences are shown in Table 1. In this table, the prefix "m" represents methoxy-modified (2'-OMe) nucleotides, the prefix "f" represents fluorinated (2'-F) nucleotides, and "[ps]" indicates that nucleotides are linked by a thiophosphate group. si-CDC20-1 is created by replacing the 7th, 8th, and 9th positions of the siRNA's sense strand with fluorinated nucleotides, replacing the 1st, 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions with methoxy-modified nucleotides, and linking the 1st and 2nd positions, and the 2nd and 3rd positions of the siRNA's antisense strand with methoxy-modified nucleotides. Nucleotides at positions 10, 12, 14, 16, and 18 are replaced with fluorinated nucleotides, and nucleotides at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 20, and 21 are replaced with methoxylated nucleotides. Nucleotides at positions 1 and 2, 2 and 3, 19 and 20, and 20 and 21 are linked by phosphate thioester groups. The same applies to si-CDC20-2 and si-CDC20-3. Furthermore, si-CDC20-3 has a two-nucleotide GC cap added to the 5' end of the antisense strand to enhance stability.

[0049] Table 1. Chemically modified siRNAs and their sequences that inhibit the CDC20 gene.

[0050]

[0051]

[0052] Example 2: Detection of the inhibitory activity of siRNA used to inhibit the CDC20 gene

[0053] HepG2, sk-hep-1, and SNU387 cells in logarithmic growth phase were divided into groups of 4 × 10⁻⁶. 5 Incubate at a density of cells / well in 12-well plates, adding 1 mL of DMEM medium containing 10% fetal bovine serum, and incubate to approximately 60–80% confluence. Perform siRNA transfection according to the Lipofectamine 3000 transfection kit instructions, as follows:

[0054] (1) Discard the supernatant, and dilute 4 μL of Lipofectamine 3000 transfection reagent and 20 μM siRNA with serum-free Opti-MEM medium to 150 μL respectively, so that the final concentrations of siRNA are 1 nM, 10 nM and 100 nM. Add the diluted siRNA to the diluted Lipofectamine 3000 transfection reagent and mix (volume ratio 1:1). Incubate the transfection mixture at room temperature for 10 minutes.

[0055] (2) Add the transfection mixture to the cells in step (1); set up siRNA group (including unmodified si-CDC20 and three modified si-CDC20), negative control group (transfected with non-target antisense sequence si-NC), and blank group (3 replicates each), and place the cells in an incubator at 37°C and 5% CO2 for 48 h.

[0056] si-NC:

[0057] Chain of Justice: 5'-ACGCCUACGAUUCUUGUGAAA-3';

[0058] Antonym chain: 5'-UCACAAGAAUCGUAGGCGUCG-3'.

[0059] (3) Collect transfected cells, add 1 mL Trizol, homogenize, incubate at room temperature for 5 min, add 0.2 mL chloroform, mix well, incubate at room temperature for 5 min, centrifuge at 12000 rpm and 4℃ for 15 min, aspirate the colorless upper aqueous phase into a new centrifuge tube, add an equal volume of isopropanol, mix well, incubate at 4℃ for 10 min, centrifuge at 12000 rpm and 4℃ for 10 min, discard the supernatant, add 1 mL 75% ethanol, mix well, centrifuge at 7500 rpm and 4℃ for 5 min, discard the supernatant, after the precipitate has dried slightly, add 20 μL RNase-free H2O, use a Thermo Fisher spectrophotometer (Nanodrop 2000) to detect RNA concentration and purity, store at -80℃ for later use;

[0060] (4) Remove genomic gDNA. The reaction system is shown in Table 2 below. Prepare the reaction solution on ice. This step can remove genomic DNA (gDNA) from the RNA sample. Centrifuge the reaction solution at low speed for 10 seconds to mix, and then react in a PCR instrument at 42°C for 2 minutes.

[0061] Table 2. Reaction system for removing gDNA from RNA samples

[0062] reagents Added amount gDNA Clean Reagent 1μL 5×gDNA Clean buffer 2μL RNA template 1μg <![CDATA[RNase-free ddH2O]]> Add to 10 μL

[0063] (5) Reverse transcription to cDNA. Using the reagents listed in Table 3, add reverse transcription reagent to the reaction solution from the previous step to prepare a 20 μL reverse transcription reaction system. Reverse transcribe the gDNA-free RNA into cDNA. After centrifuging the reaction solution at low speed for 10 s to mix, proceed with the reverse transcription reaction. The reverse transcription program is set to 37℃ for 15 min; 85℃ for 5 s.

[0064] Table 3 Reverse transcription reaction system

[0065] reagents Added amount gDNA Clean Reagent 1μL RT Primer Mix 1μL 5x RTase Reaction Buffer Mix I 4μL RNase-free ddH2O 4μL

[0066] (6) After diluting the cDNA solution 10-fold with enzyme-free water, use the diluted cDNA solution as a template and the gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH gene) as an internal reference gene. Configure the RT-qPCR probe reaction system according to Table 4, and use the prepared RT-qPCR probe reaction system in… Quantitative real-time PCR was performed on sample 3. The reaction conditions were: 95℃ for 5 min → (95℃, 30 s; 60℃, 30 s; 72℃, 10 s) for 40 cycles → 72℃ for 10 min. The Ct values ​​of the target gene (CDC20 mRNA) and the internal reference gene (GAPDH) in the test group were obtained. The relative quantification of the target gene (CDC20 mRNA) in each test group was calculated using the Ct(ΔΔCt) method. The experimental results are shown in [Figure number missing]. Figure 1 ;

[0067] RT-qPCR primers:

[0068] CDC20-F: CGCTATATCCCCCATCGGAG;

[0069] CDC20-R:GATGTTCCTTCTTGGTGGGC;

[0070] GAPDH-F: ACGGATTTGGTCGTATTGGG;

[0071] GAPDH-R:CGCTCCTGGAAGATGGTGAT.

[0072] The calculation method for relative quantification is as follows:

[0073] ΔCt(test group) = Ct(target gene in test group) – Ct(internal reference gene in test group);

[0074] ΔCt(control group) = Ct(target gene in control group) – Ct(internal reference gene in control group);

[0075] ΔCt(test group) = ΔCt(test group) - ΔCt(control group average);

[0076] ΔCt(control group) = ΔCt(control group) - ΔCt(control group average);

[0077] When performing calculations, the expression level of CDC20 in the test group was normalized based on the control group transfected with non-target siRNA, and the expression level of CDC20 mRNA in the control group transfected with non-target siRNA was defined as 100%.

[0078] The relative expression level of CDC20 mRNA in the test group was 2. -ΔΔCt(测试组) ×100%;

[0079] Table 4 Real-time quantitative PCR reaction system

[0080] Element reaction system 2×TB Grenn Premix Ex Taq II 10μL Forward primer (10 μM) 0.8μL Reverse primer (10 μM) 0.8μL cDNA template 1μg <![CDATA[RNase-free ddH2O]]> Add to 20 μL

[0081] Test results as follows Figure 1 As shown in the figure, A represents si-CDC20, B-D represent si-CDC20-1, E represents si-CDC20-2, and F represents si-CDC20-3. The figure shows that CDC20 siRNA effectively inhibits CDC20 gene expression at the transcriptional level in various cell types. Compared with the blank control group (BLANK) and the negative control group (NC), in hepatocellular carcinoma cell lines, si-CDC20-1 exhibited high inhibitory activity against the CDC20 gene at concentrations ranging from 1 to 100 nM, while the inhibitory activities of si-CDC20, si-CDC20-2, and si-CDC20-3 at concentrations ranging from 1 to 100 nM were significantly weaker than those of si-CDC20-1.

[0082] Example 3: Detection of the inhibitory effect of siRNA interference on the proliferation of liver cancer cells.

[0083] HepG2, sk-hep-1, and SNU387 cells in logarithmic growth phase were divided into groups of 4 × 10⁻⁶. 3 The siRNA was cultured at a density of 100 μL / well in 96-well plates with 100 μL of DMEM medium containing 10% fetal bovine serum, and cultured to approximately 60%-80% confluence. A negative control group (transfected with the non-target antisense sequence si-NC) and a si-CDC20-1 group were set up. siRNA transfection was performed according to the Lipofectamine 3000 transfection kit instructions, as follows:

[0084] (1) According to the instructions of Lipofectamine 3000 transfection reagent, dilute 0.3 μL of Lipofectamine 3000 transfection reagent and 20 μM siRNA with 25 μL of serum-free Opti-MEM medium to 25 μL respectively, so that the final concentration of siRNA is 10 nM. Add the diluted siRNA to the diluted Lipofectamine 3000 transfection reagent and mix (volume ratio 1:1). Incubate at room temperature for 10 minutes to obtain the transfection mixture.

[0085] (2) Add the transfection mixture to the cells. There are 3 replicates for the siRNA group and the negative control group (non-target siRNA cells). The cells are incubated in an incubator at 37°C and 5% CO2 for 24h, 48h and 72h respectively. Then, replace the medium with DMEM medium without 10% fetal bovine serum and 1% penicillin / streptomycin. Add 10μL of CCK8 solution to each well and continue incubation for 1h.

[0086] (3) Place the plate reader of the Molecular Devices SpectraMax M5 multi-functional microplate reader and read and record the absorbance value (OD value) at a wavelength of 450 nm.

[0087] Test results as follows Figure 2 As shown in the results, siRNA inhibited the proliferation of HepG2, sk-hep-1 and SNU387 cells, indicating that CDC20siRNA can inhibit the growth of liver cancer cells.

[0088] Example 4: Growth curve of liver cancer cells after siRNA interference

[0089] HepG2 and sk-hep-1 cells in logarithmic growth phase were divided into groups of 4 × 10⁻⁶. 3 The cells / well were cultured in 96-well plates with 100 μL of DMEM medium containing 10% fetal bovine serum, and cultured to approximately 60–80% confluence. A blank control group (mock group), a negative control group (NC group, transfected with the non-target antisense sequence si-NC), a si-CDC20-1 10 nM group, and a si-CDC20-1 100 nM group were set up. siRNA transfection was performed according to the Lipofectamine 3000 transfection kit instructions, as follows:

[0090] (1) According to the instructions of Lipofectamine 3000 transfection reagent, dilute 0.3 μL of Lipofectamine 3000 transfection reagent and 20 μM siRNA with 25 μL of serum-free Opti-MEM medium to 25 μL respectively, so that the final concentrations of siRNA are 10 nM and 100 nM. Add the diluted siRNA to the diluted Lipofectamine 3000 transfection reagent and mix (volume ratio 1:1). Incubate at room temperature for 10 minutes to obtain the transfection mixture.

[0091] (2) Add the transfection mixture to the cells. There are 3 replicates each for the siRNA group, the negative control group (non-target siRNA cells), and the blank control group (untransfected siRNA). Place the cells into the cells. In the SX1 real-time live cell analyzer, images are taken every 4 hours, and the analysis is conducted continuously for 5 days.

[0092] (3) Calculate cell confluence and plot growth curves.

[0093] Test results as follows Figure 3 As shown, the results indicated that after transfection with CDC20siRNA, the cell confluence of HepG2 and sk-hep-1 cells was lower than that of the NC group and the blank group within 48h-120h, indicating that CDC20siRNA can inhibit the growth of liver cancer cells.

[0094] Example 5: Detection of Apoptosis in Tumor Cells by siRNA Interference

[0095] (1) HepG2 and sk-hep-1 cells in logarithmic growth phase were divided into groups of 1×10⁻⁶ cells. 6 The cells / well were cultured in 6-well plates at a density of [number] cells / well, with 2 mL of DMEM medium containing 10% fetal bovine serum added, and cultured to approximately 60%-80% confluence. Control groups (untransfected with siRNA), negative control groups (transfected with non-target antisense sequence si-NC), and si-CDC20-1 groups were set up. siRNA transfection was performed according to the Lipofectamine 3000 transfection kit instructions.

[0096] (2) 48 h after transfection, cells were collected and washed with pre-cooled PBS, centrifuged at 1000 rpm for 5 min, washed twice, and resuspended in 100 μL of 1×binding buffer.

[0097] (3) According to the group, add 5 μL Annexin V-FITC dye and 5 μL PI respectively, mix gently, incubate at room temperature in the dark for 15 min, add 400 μL 1×binding buffer, and use BD flow cytometer (FACS Celesta) to detect the stained cells; Annexin V / PI are live cells, and Annexin V+ / PI cells are early apoptotic cells.

[0098] Test results as follows Figure 4 As shown, the results indicated that in HepG2 cells, the proportion of apoptotic cells (early apoptosis + late apoptosis) in the si-CDC20-1 experimental group was 38.6%, while the proportions of apoptotic cells in the control group and the negative control group were 12.32% and 25.16%, respectively; in sk-hep-1 cells, the proportion of apoptotic cells (early apoptosis + late apoptosis) in the si-CDC20-1 experimental group was 13.52%, while the proportions of apoptotic cells in the control group and the negative control group were 6.28% and 7.27%, respectively.

[0099] Example 6: Cell cycle detection of tumor cells by siRNA interference

[0100] (1) HepG2 and sk-hep-1 cells in logarithmic growth phase were divided into groups of 1×10⁻⁶ cells. 6 The cells / well were cultured in 6-well plates at a density of [number] cells / well, with 2 mL of DMEM medium containing 10% fetal bovine serum added, and cultured to approximately 60%-80% confluence. A blank control group (no siRNA transfection), a negative control group (transfected with the non-target antisense sequence si-NC), and a si-CDC20-1 group were set up. siRNA transfection was performed according to the Lipofectamine 3000 transfection kit instructions.

[0101] (2) 48 h after transfection, cells were collected and washed twice with pre-cooled PBS. After centrifugation at 1000 rpm for 5 min, the supernatant was discarded. Cells were resuspended in 100 μL of 1×PBS, mixed, and fixed overnight at 4°C with 70% ethanol.

[0102] (3) Centrifuge at 1500 rpm for 5 min to precipitate the cells and discard the supernatant. Add 1 nL of pre-cooled PBS, resuspend the cells, centrifuge again, and discard the supernatant. Add 0.5 ml of propidium iodide staining solution to each cell sample tube, slowly and thoroughly resuspend the cell pellet, incubate at 37°C in the dark for 30 min, and then use a BD flow cytometer (FACS Celesta) to detect the stained cells.

[0103] Test results as follows Figure 5As shown, the results indicated that in HepG2 cells, the proportions of G0 / G1, S, and G2 / M phase cells in the negative control group were not significantly different from those in the control group. However, in the CDC20 siRNA treatment group, the proportion of G0 / G1 phase cells significantly increased, while the proportion of S phase cells decreased to 45.19%. In sk-hep-1 cells, the proportions of G0 / G1, S, and G2 / M phase cells in the negative control group were not significantly different from those in the control group. However, in the CDC20 siRNA treatment group, the proportion of G0 / G1 phase cells significantly increased, while the proportion of S phase cells decreased to 25.76%. These results suggest that CDC20 siRNA effectively inhibits the proliferation of HepG2 cells by delaying the G1 phase progression.

[0104] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An siRNA that inhibits the expression of a CDC20 gene, characterized in that at least one of the following: si-CDC20, whose sense strand nucleotide sequence is: CAAGAAGGAACAUCAGAAA, and whose antisense strand nucleotide sequence is: UUUCUGAUGUUCCUUCUUGGU; si-CDC20-1, whose sense strand nucleotide sequence is: mC[ps]mA[ps]mAmGmAmAfGfGfAmAmCmAmUmCmAmGmAmAmA, and whose antisense strand nucleotide sequence is: mU[ps]fU[ps]mUfCmUfGmAfUmGfUmUfCmCfUmUfCmUfUmG[ps]mG[ps]mU; si-CDC20-2, whose sense strand nucleotide sequence is: mC[ps]mA[ps]mAmGmAmAmGmGfAfAfCmAmUmCmAmGmAmAmA, and whose antisense strand nucleotide sequence is: mU[ps]fU[ps]mUfCmUfGmAmUmGmUmUfCmCfUmUfCmUfUmG[ps]mG[ps]mU; si-CDC20-3, whose sense strand nucleotide sequence is: mC[ps]mA[ps]mAmGmAmAfGmGfAfAfCmAmUmCmAmGmAmAmAmGmC, and whose antisense strand nucleotide sequence is: mG[ps]fC[ps]mUmUmUfCmUfGfAmUmGmUmUfCmCfUmUmCmUmUmG[ps]mG[ps]mU; In the above nucleotide sequences, the prefix m represents a methoxy-modified nucleotide, the prefix f represents a fluorine-modified nucleotide, and [ps] represents a phosphorothioate group between nucleotides; or an analogue of si-CDC20, si-CDC20-1, si-CDC20-2, or si-CDC20-3 obtained by base insertion, deletion, or substitution, which still has the function of inhibiting CDC20 gene expression.

2. The siRNA for inhibiting CDC20 gene expression according to claim 1, wherein: after the siRNA for inhibiting CDC20 gene expression is transfected into cells by a transfection reagent, the expression level of the CDC20 gene is inhibited.

3. A reagent for inhibiting CDC20 gene expression, comprising: the siRNA for inhibiting CDC20 gene expression according to claim 1 or 2.

4. The reagent for inhibiting CDC20 gene expression according to claim 3, wherein: the reagent for inhibiting CDC20 gene expression further comprises a transfection reagent for transfecting the siRNA into cells.

5. Use of the siRNA for inhibiting CDC20 gene expression and / or the reagent for inhibiting CDC20 gene expression according to claim 3 or 4 in the preparation of an antitumor drug.

6. The use according to claim 5, wherein: the tumor comprises at least one of hepatocarcinoma, hepatocellular carcinoma, and hepatoadenocarcinoma.

Images