Application of amino acylase-1 to improvement of nitrogen utilization efficiency of plants
By overexpressing aminoacylase-1 in plants, especially the ZmACY-1 gene in maize, the problem of low nitrogen fertilizer utilization has been solved, the efficiency of nitrogen absorption and utilization by plants has been improved, plant growth and nitrogen accumulation have been promoted, and sustainable agricultural development has been achieved.
Patent Information
- Application Number
- CN202410732083.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-06
- Publication Date
- 2026-01-13
AI Technical Summary
The low nitrogen fertilizer utilization rate in existing technologies leads to environmental pollution and resource waste. Improving the efficiency of nitrogen utilization by plants has become an important challenge for sustainable agricultural development.
By overexpressing aminoacylase-1 in plants, especially the ZmACY-1 gene in maize, the efficiency of nitrogen absorption and utilization in plants can be improved. The gene overexpression was achieved by introducing a recombinant vector into plants and transforming it with Agrobacterium.
It significantly improved the plant's ability to absorb and utilize nitrogen, enhanced its ability to cope with different nitrogen concentration stresses, and promoted plant growth, development, and nitrogen accumulation.
Smart Images

Figure CN121320408A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of functional analysis technology of aminoacylase-1 in plants, and specifically relates to the use of aminoacylase-1 to improve the nitrogen use efficiency of plants. Background Technology
[0002] Aminoacylase-1 (ACY-1, N-acyl-L-amino-acid amidohydrolase) is a member of the aminoacylase family, belonging to the zinc peptidase superfamily and the M20 aminoacylase-1 subfamily. It primarily participates in a specific step of protein metabolism: the deacylation of amino acids. This enzyme acts on amino acid residues of synthesized and potentially degraded proteins, releasing the amino acids from aminoacyl compounds, thereby participating in amino acid recycling and metabolism (Biagini and Puigserver, 2001). The specific role of aminoacylase-1 (ACY-1) in plants has not been thoroughly studied; most research on ACY-1 has focused on animals and microorganisms. Further research into its function in plants is essential.
[0003] Nitrogen (N) is an essential macronutrient for crop growth, playing a crucial role in regulating normal growth and development, yield, and quality formation. Crops have a high demand for nitrogen; however, excessive application of nitrogen fertilizer typically leads to increased nitrogen loss, decreased utilization efficiency, and a series of environmental problems. It is reported that 85 to 90 million tons of nitrogen fertilizer are added to soil globally each year. Despite attempts to achieve high crop yields through the extensive use of nitrogen fertilizer, only 30% to 40% of the nitrogen is absorbed by plants (Good et al., 2004). The remaining nitrogen is released into the environment, causing a series of environmental problems such as soil acidification, soil hardening, and eutrophication (Pandey et al., 2023). Excessive nitrogen fertilizer application not only leads to nitrogen pollution in water and groundwater, threatening water quality, but also increases greenhouse gas emissions, exacerbating global climate change. It also causes soil acidification, soil depletion, and ecosystem damage, affecting soil biological activity and sustainable productivity. Soil acidification limits crop nutrient uptake, thereby reducing yield and quality (Gutiérrez, 2012).
[0004] Therefore, it is urgent to address how to improve the effective utilization rate of nitrogen fertilizer and maintain normal crop growth under conditions of low nitrogen. Studying the response mechanisms of crops under low nitrogen stress is crucial for solving these problems. Improving the efficiency of nitrogen fertilizer use and limiting its excessive application is a significant challenge for agriculture that aims to protect the environment and improve sustainable production. This will help reduce environmental pollution and resource waste, and promote sustainable agricultural development.
[0005] In view of this, the present invention is hereby proposed.
[0006] References
[0007] 1.Biagini A,Puigserver A.Sequence analysis of the aminoacylase-1family.Anew proposed signature for metalloexopeptidases[J].ComparativeBiochemistry And Physiology.Part B,Biochemistry&Molecular Biology,2001,128(3):469-481.
[0008] 2.Good AG,Shrawat AK,Muench D G.Can less yield more? Is reducing nutrient input into the environment compatible with maintaining cropproduction? [J].Trends in Plant Science,2004,9(12):597-605.
[0009] 3. Pandey A, Eldridge SM, Weatherley A, et al. High fertilizer nitrogen input increases nitrogen mining in sandy paddy soils[J]. Nutrient Cycling in Agroecosystems, 2023, 125(1):77-88.
[0010] 4. Gutiérrez R A. Systems biology for enhanced plant nitrogen nutrition [J]. Science (New York, NY), 2012, 336(6089): 1673-1675. Summary of the Invention
[0011] To address the shortcomings of existing technologies, one objective of this invention is to provide an application of aminoacylase-1 to improve the efficiency of nitrogen use in plants. Experiments conducted according to this invention have demonstrated that overexpression of aminoacylase-1 can enhance the absorption and efficient utilization of nitrogen or nitrogen fertilizer from the soil by plants, particularly maize.
[0012] The second objective of this invention is to provide a method for improving the efficiency of nitrogen use in plants.
[0013] To achieve the above objectives, the present invention adopts the following technical solution:
[0014] The first aspect of the present invention provides the use of aminoacylase-1 in improving nitrogen use efficiency in plants.
[0015] The aminoacylase-1 described in this invention can be an aminoacylase-1 derived from any plant, or it can be a modified derivative protein that still retains the activity of aminoacylase-1. In some embodiments, the aminoacylase-1 is corn aminoacylase-1.
[0016] In some embodiments, the aminoacylase-1 is a protein as described in (1) or (2):
[0017] (1) The amino acid sequence is shown in SEQ ID NO.1.
[0018] (2) A protein derived from (1) whose amino acid sequence as shown in SEQ ID NO.1 has been substituted, deleted or added with one or more amino acids and has aminoacylase-1 activity.
[0019] In some embodiments, the nucleic acid sequence encoding the aminoacylase-1 is shown in SEQ ID NO.2.
[0020] In some embodiments, the plant is corn.
[0021] The nitrogen described in this invention refers to any form of nitrogen that plants can absorb and utilize. In some embodiments, the nitrogen is derived from ammonium nitrogen, nitrate nitrogen, and organic nitrogen. These nitrogen sources can be nitrogen-containing substances present in the soil surrounding the plant, externally applied to the soil around the plant, or externally applied to the culture medium for cultivating the plant. For ammonium nitrogen, root hairs on the surface of plant roots release rhizosphere acidifying substances, reducing nitrate to ammonia. Then, ammonia ions are adsorbed onto the surface of the root hairs by oxidoreductases and enter the plant cells via transport proteins. For nitrate nitrogen, nitrifying bacteria around the plant roots reduce nitrate to nitrite, which is then further oxidized to nitrate. Plants adsorb nitrate onto the surface of root hairs by oxidoreductases and then enter the plant cells via transport proteins. Plants absorb organic nitrogen through the decomposition of organic nitrogen into inorganic nitrogen (ammonium nitrogen or nitrate nitrogen) by soil microorganisms, followed by ammonification or nitrification, which is then absorbed by the plant.
[0022] In this invention, overexpression of aminoacylase-1 in plants can significantly improve nitrogen uptake and utilization. Preferably, overexpression of maize aminoacylase-1 in maize improves nitrogen uptake and utilization in maize.
[0023] A second aspect of the invention provides a method for improving nitrogen use efficiency in plants, the method comprising introducing an expression cassette capable of expressing aminoacylase-1 into the plant, thereby causing overexpression of aminoacylase-1 in the plant.
[0024] In some embodiments, the expression cassette includes at least a promoter, a nucleic acid sequence encoding aminoacylase-1, and a terminator.
[0025] Preferably, the expression cassette capable of expressing aminoacylase-1 is introduced into the plant via a plant recombinant vector.
[0026] Furthermore, the recombinant vector is formed by introducing an expression cassette capable of expressing aminoacylase-1 into the plant expression vector pCAMBIA1300, thereby forming a plant recombinant vector containing an expression cassette capable of expressing aminoacylase-1.
[0027] The plant recombinant vector can be introduced into plants using conventional methods such as Agrobacterium-mediated transformation and gene gun transformation.
[0028] In some embodiments, the aminoacylase-1 is corn aminoacylase-1.
[0029] In some embodiments, the aminoacylase-1 is a protein as described in (1) or (2):
[0030] (1) The amino acid sequence is shown in SEQ ID NO.1.
[0031] (2) A protein derived from (1) whose amino acid sequence as shown in SEQ ID NO.1 has been substituted, deleted or added with one or more amino acids and has aminoacylase-1 activity.
[0032] In some embodiments, the nucleic acid sequence encoding the aminoacylase-1 is shown in SEQ ID NO.2.
[0033] In some embodiments, the plant is corn.
[0034] Aminoacylase-1 (ACY-1) is a zinc-binding homodimer enzyme that catalyzes the hydrolysis of N-α-acylated amino acids. Most research on ACY-1 has focused on animals and microorganisms. In animals, it plays an important role in multiple biochemical processes, including amino acid metabolism, regulation of protein synthesis and breakdown, participation in detoxification, influence on energy metabolism, and potential involvement in neurotransmitter synthesis. However, research on it in plants is limited. This study functionally analyzed the overexpression and silencing of the ZmACY-1 gene in maize. The results showed that:
[0035] Under different nitrogen concentrations, overexpression of the ZmACY-1 gene promoted plant growth and development and the absorption of nitrates from the external environment, while affecting nitrogen accumulation. Overexpressing lines showed higher nitrogen accumulation than wild-type and knockout lines. Regardless of whether the treatment was low or high nitrogen, maize lines overexpressing the ZmACY-1 gene were superior to wild-type and ZmACY-1 knockout lines in terms of root length, root number, plant height, stem diameter, aboveground fresh weight, and underground fresh weight.
[0036] In summary, overexpression of the ZmACY-1 gene in maize enhances its ability to cope with different nitrogen concentration stresses, while knockout of the ZmACY-1 gene inhibits the growth and development of maize, resulting in weak growth and nitrogen accumulation under different nitrogen concentration stresses. Attached Figure Description
[0037] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. Wherein:
[0038] Figure 1 Gel images of PrimerSTAR Max DNA Polymerase amplification of the ZmACY-1 gene, including:
[0039] M: Takara DL 2000 DNA marker; Lanes 1-4: ZmACY-1 gene amplification results.
[0040] Figure 2Gel photographs (A) for PCR identification of pMD19T-ZmACY-1 plasmid colonies and (B) for double enzyme digestion verification, wherein: lanes M1 and M2: Takara DL 2000 DNA marker; lanes 1-7: PCR identification of pMD19T-ZmACY-1 plasmid colonies; lanes 8-11: double enzyme digestion verification of pMD19T-ZmACY-1 plasmid.
[0041] Figure 3 Gel images showing the results of PCR identification (A) and double enzyme digestion (B) of the plant expression vector pCAMBIA1300-ACY-1 plasmid. Lane M1: Takara DL 2000 DNA marker; Lane M2: Takara DL15000 DNA marker; Lanes 1-6: PCR results of screened positive clones; Lanes 7-9: Double enzyme digestion results of recombinant plasmid.
[0042] Figure 4 The graph shows the relative expression levels of the ZmACY-1 gene in various overexpressing maize lines. WT represents wild-type maize, while OE1, OE2, and OE3 represent overexpressing maize lines.
[0043] Figure 5 The mutation status of ZmACY-1 gene knockout lines was analyzed. Among them, A: target one primer design gene amplification electrophoresis band; B: target two primer design gene amplification electrophoresis band; M: D2000 plus DNA mark; 1-8: PCR identification of eight different knockout lines; 9-10: wild-type B104 PCR identification.
[0044] Figure 6 The sequencing results of the original PCR solutions for different target sites in the ZmACY-1 gene knockout strain are shown in Figure 1. A: Sequencing results of the original PCR solutions for target site one amplification, with the sample number 2 named KO1, the sample number 4 named KO2, the sample number 5 named KO3, and the sample number 6 named KO4. B: Sequencing results of the original PCR solutions for target site two amplification.
[0045] Figure 7 Amino acid changes in zmacy-1 knockout maize lines.
[0046] Figure 8 This is a comparison of the growth of three maize lines after 12 days of cultivation with normal nitrogen, low nitrogen, and high nitrogen. In this figure, NN represents normal nitrogen, LN represents low nitrogen, and HN represents high nitrogen.
[0047] Figure 9The results show the determination of relevant indicators of three maize lines under normal nitrogen, low nitrogen and high nitrogen culture for 12 days. Among them, A is plant height, B is stem diameter, C is aboveground fresh weight, D is underground fresh weight, E is SPAD value and F is aboveground nitrogen content.
[0048] In the figure, "*" indicates P < 0.05, and "**" indicates P < 0.01. Detailed Implementation
[0049] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Those skilled in the art should understand that the embodiments described are merely for the purpose of aiding understanding of this invention and should not be considered as specific limitations on this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Process parameters in the following embodiments that are not specifically specified are generally performed under conventional conditions.
[0050] The endpoints and any values of the ranges disclosed in this invention are not limited to the precise ranges or values, which should be understood to include ranges or values close to them. The term "about" as used in this invention means that the number it modifies may fluctuate within ±20%, ±15%, ±10%, ±5%, or ±2%. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this invention.
[0051] Unless otherwise specified, the experimental methods used in the following examples are generally performed under conventional conditions, such as those described in Molecular Cloning: A Laboratory Manual (2nd Edition, by J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), or as recommended by the manufacturer.
[0052] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0053] The materials used in this invention and the methods for obtaining them are described below.
[0054] Materials and their acquisition methods
[0055] The maize inbred line B104 (wild-type maize line) used in the embodiments of this invention is a commercially available variety or provided by the Crop Breeding Laboratory of Qingdao Agricultural University.
[0056] Maize lines overexpressing aminoacylase-1 were obtained by introducing the plant recombinant expression vector pCAMBIA1300-ACY-1 into the maize inbred line B104 and then screening them from the regenerated plants.
[0057] Maize lines with the ZmACY-1 gene knocked out and rendered nonfunctional were selected from regenerated plants by introducing a CRISPR / Cas9 gene-editing recombinant vector containing an sgRNA expression cassette for mutation targeting sequences into maize.
[0058] The specific method for obtaining maize lines overexpressing aminoacylase-1 is as follows:
[0059] I. Construction of the intermediate vector pMD19T-ZmACY-1
[0060] (a) RNA extraction: Total RNA was extracted from the leaf tissue of Zheng 58 maize according to the instructions provided by the Takara Plant RNA Extraction Kit.
[0061] (ii) RNA quality detection: The concentration of the extracted RNA was detected by spectrophotometer to determine the purity and concentration of the RNA, and then detected by agarose gel electrophoresis.
[0062] (III) cDNA template synthesis: Prepare the reverse transcription system on ice. The specific steps are as follows: add 2.0 μL of Master mix, 2.0-4.0 μL of Total RNA (<500 ng), and RNase-free water to bring the reaction volume to 10 μL. Add the reaction solution according to the reaction volume and mix thoroughly. Perform the reaction in a PCR instrument. The reaction program is: 37℃ for 15 min, 85℃ for 5 s, and store at 4℃.
[0063] (IV) High-fidelity enzyme amplification of the ZmACY-1 gene: RNA was extracted from leaves and reverse transcribed. Using the total cDNA obtained from the RNA reverse transcription in step (III) as a template, the ZmACY-1 gene was amplified using a high-fidelity enzyme (PrimerSTAR Max DNA Polymerase). The Takara system consisted of: 25 μL of Takara PrimerSTAR Max DNA Polymerase, 1 μL of ZmACY-1-F (Table 1), 1 μL of ZmACY-1-R (Table 1), 2 μL of cDNA, and RNase-free water to a final volume of 50 μL. The PCR reaction steps were: denaturation at 98℃ for 10 s; annealing at 58℃ for 30 s; extension at 72℃ for 15 s; cycle number 35; storage at 4℃.
[0064] Get as Figure 1 The result shows a single band of approximately 1320 bp. The results indicate good primer specificity, and the amplified fragment is clear with a band size consistent with the target gene size, allowing for further cloning experiments.
[0065] The amino acid sequence of the sequencing results was aligned using DNAMAN software, and a phylogenetic tree analysis of the gene was performed using MEGA 5.1 software. Sequence analysis of the cloned ZmACY-1 gene was conducted using Bioxm software, showing that the open reading frame (excluding the stop codon) encoded by this gene is 1317 bp in length, encoding 439 amino acids, as shown in SEQ ID NO.1.
[0066] (V) Recovery and A-tailing of amplified products
[0067] The PCR product was purified and recovered according to the gel extraction kit (Nanjing Novizan Biotechnology Co., Ltd., model DC301-01). Then, 14.5 μL of PCR product was taken, and 2 μL of Taq Buffer, 3 μL of dNTPs and 0.5 μL of Taq enzyme were added. The reaction was carried out at 72℃ for 30 min. After further purification and recovery, the PCR product with A tail was obtained.
[0068] (vi) Construction of intermediate vector pMD19T-ZmACY-1
[0069] (1) The PCR product with the A tail was ligated into the linear pMD19-T vector, and then the ligation product was transformed into Escherichia coli competent cells BL21(DE3). After blue-white screening, white single colonies were picked, and finally positive recombinant plasmids were screened by bacterial PCR.
[0070] (2) Enzyme digestion verification: The positive plasmid was identified by double digestion with restriction endonucleases BamHI and HindIII. The digestion system of pMD19T-ZmACY-1 plasmid was as follows: 10×K Buffer 5μL; BamHI 1μL; HindIII 1μL; Plasmid 15μL; RNase free water was added to 50μL of the system.
[0071] The results of PCR identification of pMD19T-ZmACY-1 plasmid colonies are as follows: Figure 2 As shown in Figure A, a single band of approximately 1320 bp was amplified. The results of double enzyme digestion of plasmids extracted from correctly PCR-positive transformants are as follows. Figure 2As shown in B. The identified positive clones were sent to Qingdao Qingke Zixi Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the portion of the PCR product related to the coding sequence was identical to SEQ ID NO.2, indicating successful cloning.
[0072] Table 1 Primer sequences
[0073] Primers Primer sequence (5'-3') name use ZmACY-1-F ATGCCGCCGCCGCCTCTCCGCTGT SEQ ID NO.3 Gene cloning ZmACY-1-R TCAGCCTTGGAACGAGCTTAGTGC SEQ ID NO.4 qRT-ZmACY-1-F AAGACATCGAGCAGATCAAGC SEQ ID NO.5 Real-time PCR qRT-ZmACY-1-R TCGCTGTGGATACGGGAC SEQ ID NO.6 qRT-Actin-F GTCCATGAGGCCACGTACAA SEQ ID NO.7 Internal reference gene qRT-Actin-R CCGGACCAGTTTCGTCATA SEQ ID NO.8 ZmACY-1-XbaI-F GCTCTAGAATGCCGCCGCCGCCTCTCCGCTGT SEQ ID NO.9 Gene amplification ZmACY-1-BamHI-R CGGGATCCTCAGCCTTGGAACGAGCTTAGTGC SEQ ID NO.10 OE-ZmACY-1-F ATGTGATATCTCCACTGACGTAAGGG SEQ ID NO.11 Gene amplification OE-ZmACY-1-R TCAGCCTTGGAACGAGCTTAGT SEQ ID NO.12 KO-zmacy-1-F-1 GAGGTCGCTGCGCATCTACC SEQ ID NO.13 Target fragment amplification KO-zmacy-1-R-1 GATGCGGAGGTATTCCTGGAA SEQ ID NO.14 KO-zmacy-1-F-2 GAGCACTGGGCGCACCCT SEQ ID NO.15 Target fragment amplification KO-zmacy-1-R-2 ATGTGGATGGTGCGGGCG SEQ ID NO.16
[0074] II. Construction of the plant expression vector pCAMBIA1300-ZmACY-1
[0075] Using PMD19-ACY-1 as a template, and ZmACY-1-XbaI-F (as shown in Table 1) and ZmACY-1-BamHI-R (as shown in Table 1) as primers, high-fidelity enzymes were used for PCR amplification, and the target fragment was recovered. The pCAMBIA1300 expression vector and the recovered target fragment were digested with XbaI and BamHI, respectively. The digestion products were ligated to obtain the recombinant plasmid pCAMBIA1300-ZmACY-1.
[0076] The recombinant plasmid was transformed into *E. coli* DH5α and cultured overnight at 37°C in LB medium containing kanamycin (50 μg / mL). The plasmid was then extracted and subjected to enzyme digestion for identification. PCR identification and enzyme digestion patterns are shown below. Figure 3 As shown, the plant expression vector pCAMBIA1300-ZmACY-1 was successfully constructed. The positive plasmid was sent to Qingdao Qingke Zixi Biotechnology Co., Ltd. for sequencing, which verified the correctness of the vector construction.
[0077] III. Genetic transformation of maize inbred line B104 with the ZmACY-1 gene
[0078] (a) The expression vector plasmid pCambia1300-ZmACY-1 was transformed into Agrobacterium LBA4404, and the successfully transformed positive recombinant bacteria were obtained after screening and identification.
[0079] (II) Transformation of maize inbred line B104 using the leaf disc method
[0080] 1. Inoculate 200 μL of the positive recombinant bacteria into 10 mL LYEB liquid medium (50 mg / L Kan + 20 mg / L LRif) and incubate overnight (>16 h) with shaking to activate the strain.
[0081] 2. After activation, the bacterial culture was added to YEB liquid medium (50 mg / L Kan) at a volume ratio of 1:50 and cultured overnight. Then, the culture was collected by centrifugation (7,000 rpm for 3 min).
[0082] 3. In a clean bench, resuspend the bacterial suspension in a 1 / 2 medium (excluding agar) containing 5% sucrose (OD200). 600 Value: 0.6-0.8), soak the leaves of the maize inbred line B104 in the resuspension solution for 5-10 minutes. After soaking, dry them on filter paper, and then transfer the leaves to a co-culture medium (MS + 3 mg / L 6BA + 0.2 mg / L NAA + 150 μmol / L acetylsyl syringone, pH = 5.8) covered with two layers of filter paper and co-culture in the dark for 3 days.
[0083] 4. After co-culturing for 3 days, the maize leaves were transferred to callus induction medium (MS + 3 mg / L 6BA + 0.2 mg / L NAA + 25 mg / L Hyg + 250 mg / L Cef, pH = 5.8) supplemented with hygromycin and cephalosporin for selection culture (25℃, 16h light). The medium was changed once a week.
[0084] 5. After adventitious buds grow from the callus tissue, cut off the buds in a clean bench and transfer them to a budding medium (MS + 20 mg / L Hyg + 200 mg / L Cef, pH = 5.8) for selection. When the buds form seedlings of 3-5 cm, cut off the plants and transfer them to a rooting selection medium (1 / 2 MS + 15 mg / L Hyg + 150 mg / L Cef, pH = 5.6) for culture.
[0085] 6. After the selected seedlings have grown roots, open the cap of the tissue culture bottle, replace the sealing film, and make several slits in the sealing film with a scalpel to harden the seedlings. Two days later, gently remove the tissue culture seedlings with tweezers and rinse their roots with clean water until the culture medium is completely washed away. Then, transplant them into sterilized soil to obtain T0 generation plants.
[0086] IV. Detection of maize lines overexpressing aminoacylase-1
[0087] (I) PCR Amplification and Detection: Genomic DNA was extracted from leaves of wild-type maize B104 and T0 generation plants, respectively. Using the genomic DNA as a template, the ZmACY-1 gene was amplified. The PCR reaction system consisted of: 10 μL of 2×SuperNover PCR Mix (Dye), 1 μL of OE-ZmACY-1-F (Table 1), 1 μL of OE-ZmACY-1-R (Table 1), 1 μL of DNA, and sterile water added to a final volume of 20 μL. The PCR reaction steps were: denaturation at 98℃ for 10 s; annealing at 58℃ for 30 s; extension at 72℃ for 15 s; cycle number 35; storage at 4℃.
[0088] After electrophoresis of the PCR products, three T0 generation ZmACY-1 positive seedlings were obtained, all of which were successfully transformed. These three lines were named OE1, OE2 and OE3, respectively, as materials for subsequent experiments.
[0089] (II) Real-time quantitative PCR: Three-leaf stage maize leaves of homozygous T3 generation overexpressing maize lines OE1, OE2 and OE3 were selected, and total RNA was extracted from them. Then, it was reverse transcribed into cDNA for real-time quantitative PCR analysis. Wild-type maize B104 material was used as a control and maize endogenous genes were used as internal reference genes to detect the expression level of ZmACY-1 gene in transgenic maize.
[0090] The expression of ZmACY-1 in maize was detected by real-time PCR using a universal high-sensitivity dye-based quantitative PCR kit. The primer sequences for the internal reference gene are shown in Table 1 (qRT-Actin-F and qRT-Actin-R). The relative expression level of ZmACY-1 at the transcriptional level was determined (using qRT-ZmACY-1-F and qRT-ZmACY-1-R as primers, see Table 1). The real-time PCR reaction system was as follows: 12.5 μL of 2×ChamQ Universal SYBR qPCR; 0.5 μL of upstream primer; 0.5 μL of downstream primer; 2.0 μL of reverse-transcribed cDNA; and RNase-free water to 25 μL. The real-time PCR reaction steps were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 55-60℃ annealing for 30 s; 72℃ extension for 30 s; 40 cycles.
[0091] Use 2 -△△Ct A relative quantitative analysis method was used to calculate the relative expression level. Microsoft Excel 2007 was used to organize the data and perform graph analysis.
[0092] The results are as follows Figure 4 As shown, the expression levels of the ZmACY-1 gene were significantly higher than those of wild-type maize, proving that OE1, OE2, and OE3 can be used for subsequent experiments.
[0093] Specific methods for obtaining maize lines that lose function by knocking out the ZmACY-1 gene.
[0094] I. Obtaining the CRIPSR / Cas9 gene editing target sequence of the ZmACY-1 gene
[0095] The target sequence was designed based on the nucleotide sequence of the ZmACY-1 gene shown in Sequence 2 of the sequence listing, as follows:
[0096] Target sequence 1: 5'-CCCTTCACGGCTCTCGAGTCTGA-3' (SEQ ID NO.17);
[0097] Target sequence 2: 5'-TCCCCGTCCAGTACCTCGAGGCGATCCGG-3' (SEQ ID NO.18).
[0098] II. Construction of the CRISPR / Cas9 gene editing vector for the ZmACY-1 gene. The gene editing vector was constructed using the Baige CRISPR / Cas vector construction kit. All reagents used below are from the kit.
[0099] 1. Design primers based on target sequence:
[0100] (1) Primers designed for target sequence 1:
[0101] ZmACY-1-sgRNA-1F: 5'-ATTGGCCCTTCACGGCTCTCGAGTCTGA-3' (SEQ ID NO.19)
[0102] ZmACY-1-sgRNA-1R: 5'-AAACGTCAGACTCGAGAGCCGTGAAGGG-3' (SEQ ID NO. 20)
[0103] (2) Primers designed for target sequence 2:
[0104] ZmACY-1-sgRNA-2F: 5'-ATTGGTCCCCGTCCAGTACCTCGAGGCGATCCGG-3' (SEQ IDNO.21)
[0105] ZmACY-1-sgRNA-2R: 5'-AAACGCCGGATCGCCTCGAGGTACTGGACGGGGA-3' (SEQ IDNO.22)
[0106] 2. Prepare Oligo dimers based on the primer pairs designed above.
[0107] Oligo dimer 1 was prepared using ZmACY-1-sgRNA-1F and ZmACY-1-sgRNA-1R: The synthetic primers were dissolved in water to 10 μM, then mixed in the following reaction system, heated at 95 °C for 3 minutes, and then slowly cooled to 20 °C at approximately 0.2 °C / second (using a PCR instrument). The reaction system consisted of 1 μL each of ZmACY-1-sgRNA-1F and ZmACY-1-sgRNA-1R, and 18 μL of Buffer Aneal, for a total of 20 μL.
[0108] Oligo dimer 2 was prepared using ZmACY-1-sgRNA-2F and ZmACY-1-sgRNA-2R: The synthetic primers were dissolved in water to 10 μM, then mixed in the following reaction system, heated at 95 °C for 3 minutes, and then slowly cooled to 20 °C at approximately 0.2 °C / second (using a PCR instrument). The reaction system consisted of 1 μL each of ZmACY-1-sgRNA-2F and ZmACY-1-sgRNA-2R, and 18 μL of Buffer Aneal, for a total of 20 μL.
[0109] 3. Oligo dimers 1 and 2 were constructed into CRISPR / Cas vectors, respectively.
[0110] Mix the components on ice according to the following reaction system, and react at room temperature (20°C, PCR instrument) for 1 hour. The reaction system is as follows: H2O 6μl, CRISPR / Cas Vector 2μl, Oligo dimer 1μl, Enzyme Mix 1μl, total 10μl.
[0111] 4. Conversion of DH5α
[0112] Mix 5 μl of the ligation product from step 3 with 20 μl of competent E. coli cells, incubate on ice for 25 min, heat shock at 42°C for 45 s, incubate on ice for 2 min, add 100 μl of antibiotic-free LB, shake at 37°C and 200 rpm for 1 h, plate, incubate with LB + Kana at 37°C for one day. After one day, pick single colonies and place them in 2 ml sterile EP tubes, add 1 ml of LB + Kana beforehand, shake overnight, and extract plasmids using a plasmid miniprep kit the next day.
[0113] The two recombinant plasmids obtained have been sequenced and verified.
[0114] III. For the transformation of Agrobacterium tumefaciens with recombinant plasmids and the acquisition of T0 generation regenerated plants, please refer to Part III of the specific methods for obtaining maize lines overexpressing aminoacylase-1.
[0115] IV. Detection of ZmACY-1 gene mutant materials
[0116] (I) PCR Amplification and Detection: Genomic DNA was extracted from the leaves of wild-type maize B104 and T0 generation plants at the three-leaf stage. Primers were designed for each of the two target sites, each approximately 100bp-250bp upstream and downstream, for gene amplification. Using genomic DNA as a template, the target gene was amplified. The PCR reaction system consisted of: 10μL of 2×SuperNover PCRMix (Dye), 1μL of KO-zmacy-1-F-1 (Table 1), 1μL of KO-zmacy-1-R-1 (Table 1), 1μL of DNA, and sterile water to a final volume of 20μL. The PCR reaction steps were: denaturation at 98℃ for 10s; annealing at 58℃ for 30s; extension at 72℃ for 15s; cycle number 35; storage at 4℃. When detecting mutations at the second target site, the primers in the above system were replaced with KO-zmacy-1-F-2 (Table 1).
[0117] The electrophoretic gel analysis results of the PCR amplification products are as follows: Figure 5 As shown, the PCR products of each plant were the same size as the target fragment and the bands were clear single bands. The PCR products were sent to the company for sequencing, and the sequencing results were compared with those of wild-type plants.
[0118] By comparing the sequencing results of the two targets, such as Figure 6 and 7 As shown, four lines were found to have base deletions at target site one, with corresponding changes in the amino acid sequence. No mutations were observed at target site two. Furthermore, a sequence search of the ZmACY-1 gene on the NCBI website revealed that the mutation target was located at the first exon, indicating that the gene mutation was effective. The four knockout lines were named KO1, KO2, KO3, and KO4, with KO1, KO2, and KO3 selected for subsequent experiments.
[0119] Experimental Example: An experiment on the effect of the ZmACY-1 gene on nitrogen uptake and utilization efficiency in maize plants, i.e., a study of nitrogen stress response. I. Plant Cultivation
[0120] Wild-type maize seeds (B104), overexpression maize seeds (OE1, OE2, OE3), and knockout maize seeds (KO1, KO2, KO3) with full, uniform grains were wrapped in gauze and rinsed under running water for 10 minutes to remove impurities and germination inhibitors. The seeds were then immersed in 0.2% mercuric chloride solution for 10 minutes to sterilize the seed surface and prevent bacterial contamination. After soaking, the seeds were rinsed three times with sterile water. The seeds were placed in a petri dish between two layers of filter paper, ensuring the filter paper was completely saturated with sterile water. The petri dish was placed in an incubator set to 28°C and cultured in the dark for 3-4 days. Once the seeds germinated and the sprouts reached 1-2 cm in length, they were gently removed from the petri dish and transferred to sterilized coarse silica sand for further cultivation. The temperature was set to 28°C / 22°C, and the light / dark cycle was set to 14h / 10h, ensuring the coarse silica sand remained consistently moist. Once the corn has grown to 1-2 visible leaves, gently remove the corn endosperm and transfer it to a hydroponic container to continue growing. During this period, the hydroponic container needs to be continuously aerated with an air pump to provide oxygen. Change the nutrient solution every 3 days, and set the culture cycle to 12 days. The experiment was repeated 3 times, with 3 plants per experiment.
[0121] The experiment set up three nitrogen levels: normal nitrogen (NN) with a nitrogen source of 2 mmol / L Ca(NO3)2·4H2O, high nitrogen (HN) with a nitrogen source of 4 mmol / L Ca(NO3)2·4H2O, and low nitrogen (LN) with a nitrogen source of 0.02 mmol / L Ca(NO3)2·4H2O. 2+ Supplement with CaCl2 if necessary. First, prepare a stock solution of nutrient solution, then dilute it to the required concentration according to the nutrient solution formula, and adjust the pH to 6.0.
[0122] The formulations of the three treatment nutrient solutions are shown in Tables 2 to 4.
[0123] Table 2 Normal Nitrogen Nutrient Solution Formula
[0124]
[0125] Table 3 Low-nitrogen nutrient solution formulation
[0126]
[0127] Table 4. High-nitrogen nutrient solution formula
[0128]
[0129] II. Methods for determining physiological response parameters of wild-type maize, overexpression maize lines, and knockout maize lines under nitrogen stress
[0130] Maize seedlings cultured in nutrient solution at three nitrogen concentration levels were continuously grown until day 12. The aboveground parts and roots of the maize plants were then harvested, at which point each plant had six visible leaves. Plant height, stem diameter, aboveground fresh weight, underground fresh weight, nitrogen content, and SPAD value were measured. The aboveground and underground parts were washed three times with deionized water and then placed in an oven for initial blanching at 105℃ for 30 minutes, followed by drying at 75℃ to constant weight. The dry weight was then measured. The plant roots were washed three times with deionized water, quickly wrapped in aluminum foil, placed in liquid nitrogen, and stored at -80℃ for subsequent RNA extraction.
[0131] 1. Determination of SPAD value
[0132] On day 12, the relative chlorophyll content (SPAD) of maize plants cultured in hydroponic containers with nutrient solution was measured using a SPAD-502 instrument (Konika Minolta Sensing Inc., Japan). Measurements were taken on the newly unfolded leaves of the plants, with three measurements taken per leaf and the average value calculated. The average value from three seedlings was used as one biological replicate, with three replicates for each treatment.
[0133] 2. Determination of nitrogen content in aboveground parts
[0134] The nitrogen content of plants was determined using the Kjeldahl method, and the specific procedure is as follows:
[0135] (1) The above-ground parts dried to constant weight are ground into powder. Take 0.3-0.5g of the above-ground parts, weigh the sample and put it directly into the bottom of a 75mL digestion tube. Add 5mL of concentrated sulfuric acid and place it on a digestion furnace at 380℃ for 90min.
[0136] (2) After the digestion is completed, remove the digestion tube and cool it in a fume hood. After cooling to room temperature, transfer it to a micro Kjeldahl nitrogen analyzer for distillation and absorption.
[0137] III. Results
[0138] 1. Phenotypic characteristics of maize seedlings under different nitrogen concentration treatments
[0139] Wild-type maize B104, overexpression lines OE1, OE2, OE3, and knockout lines KO1, KO2, and KO3 were cultured in nutrient solution and divided into three treatments: normal nitrogen (NN), low nitrogen (LN), and high nitrogen (HN). Samples were collected after 12 days of culture, and the results are as follows: Figure 8 As shown, under nutrient solution culture with normal nitrogen concentration, the plant height and root length of OE1, OE2, and OE3 were significantly greater than those of KO1, KO2, and KO3. Under low nitrogen culture, maize plants were shorter than those under normal nitrogen treatment, and the roots of overexpressing maize lines were longer, while the roots of knockout lines were slightly shorter. Under high nitrogen culture, maize plants had darker green leaves and larger leaf area than the plants in the other two treatments.
[0140] 2. Physiological responses of wild-type maize, overexpressing maize lines, and knockout maize lines under different nitrogen concentration treatments.
[0141] Based on these phenotypes, plant height, stem diameter, aboveground fresh weight, underground fresh weight, SPAD value, and aboveground nitrogen content of wild-type maize, overexpression lines, and knockout lines were measured under normal nitrogen concentration, low nitrogen concentration, and high nitrogen concentration nutrient solution culture.
[0142] The results are as follows Figure 9 As shown, it presents a significant difference analysis between overexpressing maize lines, knockout maize lines, and wild-type lines in plant height, stem diameter, aboveground fresh weight, underground fresh weight, SPAD value, and aboveground nitrogen content. Figure 9 A shows that under low-nitrogen and normal-nitrogen nutrient solutions, the plant height of all three overexpressing maize lines was significantly higher than that of the knockout maize lines and the wild-type lines. Under high-nitrogen conditions, only two overexpressing maize lines had significantly higher plant heights than the wild-type lines. Meanwhile, two of the three knockout maize lines had plant heights close to those of the wild-type lines, while one line had a significantly lower plant height than the wild-type lines. Figure 9 B shows that under low-nitrogen and high-nitrogen nutrient solutions, the stem diameters of the three overexpressing maize lines were significantly greater than those of the knockout maize lines and the wild-type lines. Furthermore, the stem diameters of the knockout maize lines were significantly different from those of the wild-type lines, with the knockout lines showing significantly lower stem diameters. Figure 9 As can be seen from C, regardless of whether the nutrient solution was low-nitrogen, normal-nitrogen, or high-nitrogen, the aboveground fresh weight of the three overexpressing maize lines was significantly higher than that of the knockout maize lines and the wild-type lines; from Figure 9 As can be seen from D, in the high-nitrogen nutrient solution, the underground parts of the three overexpressing maize lines were significantly higher than those of the knockout maize lines and the wild-type lines; from Figure 9 E shows that under normal nitrogen and high nitrogen culture, maize plants grow faster in the short term, with dark green leaves and higher SPAD values than wild type.
[0143] By measuring the nitrogen content in the aboveground parts, it was found that... (See also...) Figure 9 In F, the nitrogen accumulation in overexpressing lines was significantly higher than that in knockout lines and wild-type lines, and the nitrogen accumulation in wild-type lines was significantly higher than that in knockout maize lines. This indicates that overexpression of the ZmACY-1 gene promotes the absorption of external nitrogen elements by plants, thereby promoting plant growth and development.
[0144] As is known from common technical knowledge, this invention can be implemented through other embodiments that do not depart from its spirit or essential characteristics. Therefore, the disclosed embodiments described above are merely illustrative in all respects and are not the only ones. All modifications within the scope of this invention or its equivalents are included in this invention.
Claims
1. Uses of aminoacylase-1 in improving nitrogen use efficiency in plants.
2. The use according to claim 1, characterized in that, The aminoacylase-1 is corn aminoacylase-1.
3. The use according to claim 1, characterized in that, The aminoacylase-1 is a protein that is either (1) or (2) as follows: (1) The amino acid sequence is shown in SEQ ID NO.
1. (2) A protein derived from (1) whose amino acid sequence as shown in SEQ ID NO.1 has been substituted, deleted or added with one or more amino acids and has aminoacylase-1 activity.
4. The use according to any one of claims 1-3, characterized in that, The encoding nucleic acid sequence of the aminoacylase-1 is shown in SEQ ID NO.
2.
5. The use according to claim 1, characterized in that, The plant in question is corn.
6. A method for improving nitrogen use efficiency in plants, characterized in that, The method includes introducing an expression cassette capable of expressing aminoacylase-1 into a plant, thereby causing overexpression of aminoacylase-1 in the plant.
7. The method according to claim 6, characterized in that, The expression cassette capable of expressing aminoacylase-1 was introduced into plants via a plant recombinant vector.
8. The method according to claim 6, characterized in that, The aminoacylase-1 is maize aminoacylase-1, and the plant is maize.
9. The method according to claim 6, characterized in that, The aminoacylase-1 is a protein that is either (1) or (2) as follows: (1) The amino acid sequence is shown in SEQ ID NO.
1. (2) A protein derived from (1) whose amino acid sequence as shown in SEQ ID NO.1 has been substituted, deleted or added with one or more amino acids and has aminoacylase-1 activity.
10. The method according to claim 6, characterized in that, The encoding nucleic acid sequence of the aminoacylase-1 is shown in SEQ ID NO.2.