Prostate cancer detection kit, detection system, detection method and application

Abstract

The invention provides a prostate cancer detection kit, a detection system, a detection method and application, the kit simultaneously detects Ct values of PCA3 and PSA in a urine sample, namely CtPCA3 and CtPSA; the kit comprises a first specific amplification primer and a probe group aiming at a PCA3 gene, and a second specific amplification primer and a probe group aiming at a PSA gene, the kit interprets the detection result according to the delta Ct value, and delta Ct = CtPCA3-CtPSA. The detection kit and the detection system have the advantages of simple operation process, short time consumption, simple result interpretation method, good result repeatability and specificity, and high coincidence rate with clinical evaluation indexes.

Description

Technical Field

[0001] This invention relates to the fields of biomedicine, molecular genetics and detection technology, and in particular to detection technology, detection products and applications for the detection of human prostate cancer. Background Technology

[0002] Prostate cancer is a malignant tumor that seriously threatens men's health, ranking second in global cancer incidence and fifth in mortality. It is also the fastest-growing malignant tumor in men. In the early stages of prostate cancer, because the tumor has an insidious onset and grows slowly, most prostate cancer patients have no obvious symptoms. As the tumor grows, prostate cancer can manifest as lower urinary tract obstruction symptoms, such as urinary frequency, urgency, slow urination, difficulty urinating, and even urinary retention or incontinence. When bone metastasis occurs, it can cause symptoms such as bone pain, spinal cord compression, and pathological fractures.

[0003] Currently, common methods for prostate cancer screening include prostate biopsy and serum PSA testing. The first method is the gold standard for clinical diagnosis of prostate cancer; however, prostate biopsy itself causes physical trauma and psychological burden on patients, is expensive, and carries a high risk of postoperative complications such as infection, hematuria, and rectal bleeding. The second method is serum PSA testing, which uses prostate-specific antigen (PSA) as a marker. Elevated serum PSA suggests the possibility of prostate cancer, requiring a prostate biopsy for definitive diagnosis. However, PSA is a prostate-specific antibody, not a prostate cancer antibody, and elevated serum PSA is often caused by other prostate diseases, resulting in low specificity for serum PSA testing. Especially in the gray area of ​​serum PSA concentration (4-10 ng / mL), the proportion of prostate cancer positivity confirmed by prostate biopsy is less than 30%, indicating very poor specificity. Statistics show that more than 75% of patients worldwide undergoing prostate biopsy each year receive unnecessary procedures, causing them pain and suffering.

[0004] In recent years, a novel tumor marker for prostate cancer, prostate cancer antigen 3 (PCA3), has been discovered. The PCA3 gene is a prostate cancer-specific non-coding RNA fragment located on chromosome 9 (9q21-22), approximately 25kb in length, containing 4 exons and 3 introns. It is specifically expressed in prostate tissue and overexpressed in 95% of prostate tumors. Using the prostate cancer-specific target PCA3 as a next-generation biomarker, a new auxiliary diagnostic method for prostate cancer can be developed. This method can provide a safe, effective, and convenient diagnostic approach for early diagnosis and treatment of prostate cancer, ultimately aiming to reduce prostate cancer mortality.

[0005] The PCA3 / PSA-based urine test kit developed by HOLOGIC Gen-Probe, a San Diego-based company, uses transcription-mediated amplification (TMA) to detect the PCA3 and PSA genes and assesses prostate cancer risk by calculating a PCA3 score (PCA3 score = (PCA3 mRNA) / (PSA mRNA) × 1000). However, this test kit requires two separate reaction tubes to detect both genes, and the experimental method is relatively complex, cumbersome, and time-consuming. Furthermore, its compatible instruments are incompatible with conventional quantitative PCR instruments, requiring the purchase of proprietary equipment. This limits its application and prevents it from effectively serving as an auxiliary diagnostic tool.

[0006] There are other methods in the existing technology that detect PCA3 and PSA genes separately, but most of them have problems such as complex detection or discrimination methods.

[0007] Therefore, there is a need for a detection method that is more accurate and easier to detect and distinguish. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to provide a prostate cancer detection kit based on the fluorescent RT-PCR method, which has a simple operation process, short operation time, easy result interpretation method, good repeatability and specificity of results, and high consistency with clinical evaluation indicators.

[0009] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows:

[0010] In a first aspect, the present invention provides a prostate cancer detection kit, which can simultaneously detect the Ct values ​​of PCA3 and PSA in a urine sample, i.e., Ct PCA3 and Ct PSA ;

[0011] The kit includes a first set of primers and probes for specific amplification of the PCA3 gene, and a second set of primers and probes for specific amplification of the PSA gene.

[0012] in,

[0013] The first specific amplification primer and probe set is selected from at least one of combination A, combination B, or combination C:

[0014] Combination A:

[0015] SEQ NO.1: PCA3-F1:ACATGTTTTTGCACATTTCCAG,

[0016] SEQ NO.2: PCA3-R1: GCTTGTGAGGGAAGGACATTAG,

[0017] SEQ NO.7: PCA3-P:AAAGGAAGCACAGAGATCCCT(FAM-MGB);

[0018] Combination B:

[0019] SEQ NO.3: PCA3-F2:ACAATATAATGTCTAAGTAGTGAC,

[0020] SEQ NO.4: PCA3-R2: TTGGGTCATCGATGAGCCT,

[0021] SEQ NO.7: PCA3-P:AAAGGAAGCACAGAGATCCCT(FAM-MGB);

[0022] Combination C:

[0023] SEQ NO.5: PCA3-F3: CACTAGAAACAGCAAGATGAC,

[0024] SEQ NO.6: PCA3-R3: CTGGGAGAAATGCCCGG,

[0025] SEQ NO.7: PCA3-P:AAAGGAAGCACAGAGATCCCT(FAM-MGB);

[0026] The second specific amplification primer and probe set is selected from at least one of combination D, combination E, or combination F:

[0027] Combination D:

[0028] SEQ NO.8: PSA-F1: GCGCAAGTTCACCCTC,

[0029] SEQ NO.9: PSA-R1: CAAGGTATCACGTCATGGG,

[0030] SEQ NO.14: PSA-P:AAGCACCTGCTCGGGGT(VIC-MGB);

[0031] Combination E:

[0032] SEQ NO.10: PSA-F2: TGACCAAGTTCATGCTGTGT,

[0033] SEQ NO.11: PSA-R2: TGCCCTGCCCGAAAGGC,

[0034] SEQ NO.14: PSA-P:AAGCACCTGCTCGGGGT(VIC-MGB);

[0035] Combination F:

[0036] SEQ NO.12: PSA-F3: TTGTGTGCTGGACGCTGG,

[0037] SEQ NO.13: PSA-R3: CTTCCCTGTACACCAAGGT,

[0038] SEQ NO.14: PSA-P:AAGCACCTGCTCGGGGT(VIC-MGB);

[0039] The kit interprets the test results based on the ΔCt value, where ΔCt = Ct. PCA3 -Ct PSA .

[0040] Preferably, the first specific amplification primer and probe set is combination A, and the second specific amplification primer and probe set is combination E.

[0041] Further, the final concentration of the first specific amplification primer and probe set is 0.15-0.20 μM, and the final concentration of the first specific amplification primer and probe set is 0.05-0.10 μM; preferably, the final concentration of the first specific amplification primer and probe set is 0.2 μM, and the final concentration of the first specific amplification primer and probe set is 0.1 μM.

[0042] Furthermore, when using this kit for detection, the total volume of the PCR amplification reaction system is 20–30 μL, the amount of cDNA template added is 5–10 μL, and the annealing temperature is 55–60 °C; preferably, the total volume of the PCR amplification reaction system is 30 μL, the amount of cDNA template added is 10 μL, and the annealing temperature is 60 °C.

[0043] Furthermore, it also includes a reverse transcription reagent, wherein the final concentration of the reverse transcription reagent is 1.00–1.25x, and the reverse transcription reaction conditions are 35–37°C for 22–25 min; 80–85°C for 12–15 s; preferably, the final concentration of the reverse transcription reagent is 1.00x, and the reverse transcription reaction conditions are 35°C for 25 min; 85°C for 15 s.

[0044] Furthermore, it also includes PCR amplification reagents, wherein the final concentration of the PCR amplification reagents is 1.00 to 1.25x; preferably, the final concentration of the PCR amplification reagents is 1.00x.

[0045] Secondly, the present invention provides a prostate cancer detection system, the detection system comprising the reagent kit described in the first aspect, and further comprising a urine sample preservation solution, the urine sample preservation solution comprising the following components:

[0046] 0.5–2M guanidine isothiocyanate,

[0047] PEG8000 with a mass fraction of 15-25%,

[0048] 55-65mM DTT,

[0049] Triton X-100 with a mass fraction of 0.3% to 0.8%,

[0050] pH 7–8, 0.05–0.15 M Tris-HCl,

[0051] DEPC in parts by weight of 0.05 to 0.15%.

[0052] Preferably, it comprises the following components:

[0053] 1M guanidine isothiocyanate,

[0054] PEG8000 with a mass fraction of 20%,

[0055] 60mM DTT,

[0056] Triton X-100 with a mass fraction of 0.5%,

[0057] pH 7–8, 0.1 M Tris-HCl,

[0058] DEPC in parts by weight 0.1.

[0059] Thirdly, the present invention provides a prostate cancer detection system, the detection system comprising the kit described in the first aspect, and further comprising a lysis buffer for urine RNA extraction, the lysis buffer for urine RNA extraction comprising the following components:

[0060] 2-4M guanidine isothiocyanate,

[0061] 1-2M guanidine hydrochloride,

[0062] 25-35mM DTT,

[0063] pH 7–9, 0.5–1.5 M Tris-HCl,

[0064] pH7~9, 0.1~0.5M EDTA-2Na,

[0065] Proteinase K at concentrations of 0.1–0.3 mg / mL

[0066] 0.1–0.3 M NaCl.

[0067] Preferably, it comprises the following components:

[0068] 3M's guanidine isothiocyanate

[0069] 2M guanidine hydrochloride,

[0070] 30mM DTT,

[0071] pH 8.0, 1M Tris-HCl,

[0072] pH 8.0, 0.3M EDTA-2Na,

[0073] 0.2 mg / mL proteinase K,

[0074] 0.2M NaCl.

[0075] Fourthly, the present invention provides a method for detecting prostate cancer, wherein the method uses the reagent kit described in the first aspect, or the detection system described in the second or third aspect, and includes the following steps:

[0076] (1) Sample processing: Take freshly collected urine samples or urine samples preserved with urine sample preservation solution and extract RNA from the urine samples;

[0077] (2) Reverse transcription reaction: The extracted RNA is reverse transcribed into cDNA using a reverse transcription reagent;

[0078] (3) PCR amplification: The cDNA was mixed with PCR amplification reagents, specific primers and probes, and PCR amplification was performed. The results were then read using a kit. PCA3 and Ct PSA value;

[0079] (4) Result interpretation: Calculate the value of ΔCt, ΔCt=Ct PCA3 -Ct PSA The test result of the sample is determined to be negative or positive based on the comparison between the ΔCt value and the threshold.

[0080] Furthermore, the specific steps for extracting RNA from the urine sample are as follows:

[0081] (1) Take a urine sample and centrifuge it, leaving the precipitate;

[0082] (2) Add the lysis buffer and shake thoroughly to mix well. Resuspend the urine sediment and transfer the solution to a centrifuge tube.

[0083] (3) Place the centrifuge tube from the previous step in a metal bath and decompose at room temperature;

[0084] (4) After adsorbing the magnetic beads 1-3 times, remove the supernatant and dry at room temperature with the lid off.

[0085] (5) Add elution buffer, shake thoroughly to disperse the magnetic beads, and incubate for elution;

[0086] (6) After elution, the centrifuge tube is centrifuged instantly and allowed to stand for 1 minute to be magnetically attracted. After the magnetic beads are completely attracted, the supernatant is transferred to a new centrifuge tube using a pipette, which is the extracted nucleic acid solution.

[0087] Fifthly, the present invention provides the application of the prostate cancer detection kit described in the first aspect, or the prostate cancer detection system described in the second or third aspect, or the prostate cancer detection method described in the fourth aspect, in the preparation of prostate cancer auxiliary diagnostic products.

[0088] The beneficial effects of this invention are:

[0089] 1. The prostate cancer detection kit of the present invention contains a combination of primers and probes specific to the PCA3 and PSA genes, which has good amplification performance and high detection sensitivity and specificity. It can be combined with standard diagnostic methods as an auxiliary diagnostic indicator for whether a biopsy is required, thereby reducing the number of unnecessary biopsies and reducing the burden caused by overdiagnosis.

[0090] 2. The prostate cancer detection kit of this invention uses a two-step method: first, the extracted RNA is reverse transcribed to obtain cDNA, and then the cDNA is amplified to obtain the detection result. This method has high detection sensitivity and good accuracy, and can effectively avoid interference from impurities contained in the RNA to the amplification reaction, making the detection results more accurate.

[0091] 3. The prostate cancer detection kit of the present invention interprets the results as ΔCt (ΔCt = Ct). PCA3 -Ct PSA The positive and negative values ​​of samples are determined using this method, which exhibits high sensitivity and specificity. Furthermore, this method is simple, convenient, and easy to understand, greatly improving the ease of result analysis. Attached Figure Description

[0092] Figure 1 This is a schematic diagram of the PCA3 gene.

[0093] Figure 2 This is a schematic diagram of the PSA gene. Detailed Implementation

[0094] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be described in detail, clearly, and completely below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are merely some embodiments of the present invention, and not all embodiments. Furthermore, based on the embodiments of the present invention, any modifications, equivalent substitutions, improvements, etc., made by those skilled in the art to all other embodiments obtained without creative effort should be included within the protection scope of the present invention.

[0095] Example 1: Design and screening of primers and probes.

[0096] See attached document Figure 1 and attached Figure 2 This embodiment provides the design and screening process for primers and probes for amplifying the PCA3 and PSA genes.

[0097] For the PCA3 and PSA genes, the complete mRNA sequences of the PCA3 and PSA genes were found in NCBI nucleic acid data. The PCA3 gene contains four exons, and the PCA3 site highly associated with prostate cancer is located between exon 3 and exon 4, with its gene pattern... Figure 1 As shown; the PSA gene contains 5 exons, gene pattern Figure 2 As shown.

[0098] To accurately detect the expression of the two gene mRNAs and eliminate interference from genomic DNA in the sample, a trans-intronic design method was chosen for primer design. Trans-intronic design effectively eliminates interference from genomic DNA, improves the specificity of primer combinations, and makes detection more accurate. With the assistance of the primer design software Premier 5.0, three sets of upstream and downstream primer combinations and one common probe were designed for each gene, according to the primer and probe design principles. The primer and probe sequences are shown in Table 1 below.

[0099] Using six concentration gradients of PCA3 and PSA pseudoviruses as templates, the reverse transcription reagent PrimeScript manufactured by TAKARA was used. TM The 1st Strand cDNA Synthesis Kit (catalog number TKR-6210A) was used for reverse transcription of RNA, and PCR amplification reagent Ex from TAKARA Corporation was used. (Mg 2+The free buffer (catalog number TKR-RR01AM) was used to amplify the reverse-transcribed cDNA. The reaction system and conditions were prepared according to the recommendations in the instructions for both reagent products. The prepared reaction system was placed on a real-time PCR instrument for amplification. Based on the Ct values ​​of the detection results, the amplification efficiency of each of the three primer and probe combinations for the two genes was calculated to select the primer and probe combination with the optimal amplification efficiency.

[0100] The amplification results are shown in Tables 2 and 3. The primer and probe combinations with the highest amplification efficiency were selected from these results. It can be seen that PCA3 primer and probe combination 1 has the best amplification efficiency, while PSA primer and probe combination 2 has the best amplification efficiency. Therefore, PCA3 primer and probe combination 1 and PSA primer and probe combination 2 were ultimately selected as the primer and probe combinations for the detection of the two genes. The final primer and probe sequences for the two genes are shown in Table 4 below. The selected primers and probes together constitute the detection kit of this invention.

[0101] Table 1 Primer and probe sequences

[0102]

[0103]

[0104] Table 2 Ct values ​​and amplification efficiency of PCA3 gene amplification

[0105] Template Name PCA3 primer and probe combination 1 PCA3 primer and probe combination 2 PCA3 primer and probe combination 3 L1 19.85 19.83 19.88 L2 22.77 22.7 22.74 L3 26.81 26.81 26.81 L4 29.84 30.04 30.02 L5 33.82 34.97 34.01 L6 36.95 36.8 37.31 Amplification efficiency 93％ 90.7％ 91.4％

[0106] Table 3. Ct values ​​and amplification efficiency of PSA gene amplification

[0107] Template Name PSA primer and probe combination 1 PSA primer and probe combination 2 PSA primer and probe combination 3 L1 20.13 20.25 19.96 L2 23.15 23.27 22.94 L3 27.1 27.25 27.02 L4 30.25 30.46 30.21 L5 34.57 34.18 34.33 L6 37.8 36.8 37.21 Amplification efficiency 89.6％ 97.2％ 91.9％

[0108] Table 4 Optimal primer and probe sequences for PCA3 and PSA genes

[0109]

[0110] Example 2: Optimization of the reaction system.

[0111] This embodiment explores optimization strategies for the reaction system based on Example 1.

[0112] 1. Primer and probe concentration optimization

[0113] 1.1 Optimization of PCA3 primer and probe concentrations

[0114] The primer and probe concentrations for the PCA3 gene were set to 0.1 μM, 0.2 μM, and 0.3 μM, respectively, while the primer and probe concentration for the PSA gene was set to 0.2 μM. Using six concentration gradients of PCA3 and PSA pseudoviruses as templates, the reverse transcription reagent PrimeScript (TAKARA) was used. TM The 1st Strand cDNA Synthesis Kit (catalog number TKR-6210A) was used for reverse transcription of RNA, and PCR amplification reagent Ex from TAKARA Corporation was used. (Mg 2+ The PCA3 gene-free buffer (catalog number TKR-RR01AM) was used to amplify the reverse-transcribed cDNA. The reaction system and conditions were prepared according to the instructions of both reagent products. The prepared reaction system was then placed on a real-time PCR instrument for amplification. The effect of different PCA3 gene primer and probe concentrations on the amplification efficiency was verified to determine the optimal PCA3 gene primer and probe concentrations.

[0115] The amplification results are shown in Table 5 below. It can be seen that the amplification efficiency of each reaction system is basically similar to the Ct value. To ensure the stability of the amplification efficiency of the reaction system, an intermediate concentration level was selected as the concentration of PCA3 gene primers and probes. Therefore, the final concentration of PCA3 primers and probes was determined to be 0.2 μM.

[0116] Table 5. Ct values ​​and amplification efficiency of PCA3 gene amplification

[0117] Template Name Primer and probe concentrations (0.1 μM) Primer and probe concentrations (0.2 μM) Primer and probe concentrations (0.3 μM) L1 20 19.53 18.91 L2 23.51 23.04 22.47 L3 26.9 26.44 25.87 L4 30.14 29.73 29.18 L5 33.3 32.77 32.57 L6 36.02 36.19 34.67 Amplification efficiency 100.6％ 104.4％ 104.8％

[0118] 1.2 Optimization of PSA primer and probe concentrations

[0119] The primer and probe concentrations for the PSA gene were set to 0.1 μM, 0.2 μM, and 0.3 μM, respectively, while the primer and probe concentrations for the PCA3 gene were set to 0.2 μM. Using six concentration gradients of PCA3 and PSA pseudoviruses as templates, the reverse transcription reagent PrimeScript (Takara) was used. TM The 1st Strand cDNA Synthesis Kit (catalog number TKR-6210A) was used for reverse transcription of RNA, and PCR amplification reagent Ex from TAKARA Corporation was used. (Mg 2+The free buffer (catalog number TKR-RR01AM) was used to amplify the reverse-transcribed cDNA. The reaction system and conditions were prepared according to the recommendations in the instructions for both products. The prepared reaction system was then placed on a real-time PCR instrument for amplification. The effect of different PSA gene primer and probe concentrations on the amplification efficiency was verified to determine the optimal PSA gene primer and probe concentrations.

[0120] The amplification results are shown in Table 6 below. It can be seen that the amplification efficiency of each reaction system is high and the Ct values ​​are basically similar. From the perspective of saving, the final PSA primer and probe concentration is determined to be 0.1 μM.

[0121] Table 6. Ct values ​​and amplification efficiency of PSA gene amplification

[0122] Template Name Primer and probe concentrations (0.1 μM) Primer and probe concentrations (0.2 μM) Primer and probe concentrations (0.3 μM) L1 19.36 19.94 20.39 L2 22.6 23.14 23.61 L3 25.87 26.44 26.88 L4 29.26 29.76 29.95 L5 32.49 32.8 32.69 L6 34.65 35.74 34.05 Amplification efficiency 108.7％ 106.3％ 126.4％

[0123] In summary, the final concentrations of primers and probes for the PCA3 gene were determined to be 0.2 μM, and the final concentrations of primers and probes for the PSA gene were determined to be 0.1 μM.

[0124] 2. Optimization of reverse transcription reagent concentration

[0125] Setting up the reverse transcription reagent PrimeScript TM The final concentrations of the 1st Strand cDNA Synthesis Kit (catalog number TKR-6210A) were 1.25x, 1x, and 0.75x. The final concentrations of primers and probes for the PCA3 gene were set to 0.2 μM, and those for the PSA gene to 0.1 μM. Using six concentration gradients of PCA3 and PSA pseudoviruses as templates, PCR amplification was performed using TAKARA's Ex PCR reagent. (Mg 2+ The reverse transcribed cDNA was amplified using a free buffer (catalog number TKR-RR01AM). The amplification reaction system and conditions were prepared according to the product instructions. The prepared reaction system was then placed on a real-time PCR instrument for amplification. The effect of different concentrations of reverse transcription reagent on the amplification efficiency was verified to determine the optimal concentration of the reverse transcription reagent.

[0126] The amplification results are shown in Table 7 below. It can be seen that when the final concentrations of the reverse transcription reagent are 1.25x and 1x, the amplification efficiency and Ct value are basically similar. However, the amplification efficiency is lower and the Ct value is higher when the final concentration is 0.75x, indicating a lower overall amplification efficiency. Therefore, considering both detection performance and cost-effectiveness, the final concentration of the reverse transcription reagent was ultimately determined to be 1x.

[0127] Table 7. Amplification Ct values ​​and amplification efficiency

[0128]

[0129] 3. Optimization of PCR amplification reagent concentration

[0130] Set up PCR amplification reagent Ex (Mg 2+ The final concentrations of the free buffer (catalog number TKR-RR01AM) were 1.25x, 1x, and 0.75x. The final concentrations of primers and probes for the PCA3 gene were set to 0.2 μM, and the final concentrations of primers and probes for the PSA gene were set to 0.1 μM. The reverse transcription reagent PrimeScript was used. TM The 1st Strand cDNA Synthesis Kit (catalog number TKR-6210A) was 1x. Using six concentration gradients of PCA3 and PSA pseudoviruses as templates, the selected reverse transcription reagent PrimeScript was used. TM The 1st Strand cDNA Synthesis Kit (catalog number TKR-6210A) was used for reverse transcription of RNA, and PCR amplification reagent Ex was used. (Mg 2+ The free buffer (catalog number TKR-RR01AM) was used to amplify the reverse-transcribed cDNA. The prepared reaction system was placed on a real-time PCR instrument for amplification to verify the effect of different concentrations of PCR amplification reagent on the amplification efficiency of the reaction system, thereby determining the optimal concentration of PCR amplification reagent.

[0131] The amplification results are shown in Table 8 below. It can be seen that when the final concentrations of the PCR amplification reagent are 1.25x and 1.0x, the amplification efficiency and Ct value are basically similar. However, the amplification efficiency is lower and the Ct value is higher when the final concentration is 0.75x, indicating a lower overall amplification efficiency. Therefore, considering both detection performance and cost-effectiveness, the final concentration of the PCR amplification reagent was ultimately determined to be 1x.

[0132] Table 8. Amplification Ct values ​​and amplification efficiency

[0133]

[0134] 4. Optimization of template addition amount and PCR amplification reaction system volume

[0135] Different PCR amplification reaction volumes and cDNA template addition volumes were set, as detailed in Table 9 below. The final concentrations of primers and probes for the PCA3 gene were set to 0.2 μM, and those for the PSA gene to 0.1 μM. The reverse transcription reagent PrimeScript was used.TM The final concentration of the 1st Strand cDNA Synthesis Kit (catalog number TKR-6210A) is 1x, and the PCR amplification reagent Ex... (Mg 2+ The final concentration of the free buffer (catalog number TKR-RR01AM) was 1x. Using 6 urine samples as templates, the prepared reaction system was placed on a real-time PCR instrument for amplification to verify the effects of different PCR amplification reaction system volumes and different cDNA template addition amounts on the PCR reaction, thereby determining the optimal PCR amplification reaction system volume and cDNA template addition volume.

[0136] The amplification results are shown in Table 10 below. Increasing the cDNA addition from 5 μL to 10 μL and the PCR amplification reaction volume from 20 μL to 30 μL significantly reduced the Ct values ​​of the PSA and PCA3 genes in all six samples, indicating better amplification of these two genes. The amplification results in group 2 were significantly better than those in group 1. Therefore, the final determined cDNA template addition amount was 10 μL, and the total PCR amplification reaction volume was 30 μL.

[0137] Table 9 Template addition volume and PCR amplification reaction system volume

[0138] Group cDNA template addition volume (μL) PCR amplification reaction volume (μL) 1 5 20 2 10 30

[0139] Table 10 Amplification Results

[0140]

[0141] Example 3: Optimization of reaction conditions.

[0142] This embodiment further optimizes the reaction conditions for the reaction system finally determined in Example 2.

[0143] 1. Optimization of reverse transcription reaction time

[0144] Different reverse transcription reaction times were set, as shown in Table 11 below. Using six urine samples as templates, the prepared reaction system was placed on a real-time PCR instrument for amplification to verify the effect of different reverse transcription reaction times on the PCR amplification results, thereby determining the optimal reverse transcription reaction time.

[0145] The amplification results are shown in Table 12 below. The results show that group 4 had the best amplification results. The Ct values ​​of the PSA and PCA3 genes in all six samples were lower than those in the other groups, indicating better amplification of these two genes. The optimal reverse transcription reaction time was 25 min. Therefore, the final determined reverse transcription reaction conditions are: 37℃, 25 min; 85℃, 15 s.

[0146] Table 11 Reverse transcription reaction time settings

[0147]

[0148] Table 12 Amplification Results

[0149]

[0150]

[0151] 2. Annealing temperature optimization

[0152] Different annealing temperatures for PCR reactions were set, as shown in Table 13 below. Using six urine samples as templates, the prepared reaction system was amplified on a real-time PCR instrument to verify the effect of different annealing temperatures on the PCR amplification results, thereby determining the optimal PCR annealing temperature.

[0153] The amplification results are shown in Table 14 below. The results show that group 2 had the best amplification results; the Ct values ​​of the PSA and PCA3 genes in all six samples were lower than those in the other groups, indicating better amplification of these two genes. Therefore, the optimal annealing temperature was 60℃. The final determined PCR amplification reaction conditions are shown in Table 15 below.

[0154] Table 13 PCR reaction annealing temperature settings

[0155]

[0156] Table 14 Amplification Results

[0157]

[0158] Table 15 PCR amplification reaction conditions

[0159]

[0160] Example 4: A urine sample preservation solution.

[0161] This embodiment provides a urine sample preservation solution. The urine sample preservation solution provided in this embodiment, together with the reagent kits and reaction systems described in Examples 1 to 3, constitute the detection system of this invention. This embodiment also provides verification of the effectiveness of the urine sample preservation solution.

[0162] In this invention, freshly collected urine samples can be used. If immediate testing is not possible, a urine sample preservation solution must be used. Freshly collected urine samples should be immediately mixed with a urine sample preservation solution containing guanidine isothiocyanate to inhibit RNase activity in the urine sample, maintain the stability of RNA in the urine, preserve the integrity of exfoliated cells in the urine, and prevent the release of intracellular nucleic acids. Before further processing, the samples should be stored at 2–30°C and / or transported for no more than 5 days.

[0163] Three urine sample preservation solution formulations were prepared, as shown in Table 16 below. Five urine samples were stored for five days using each of these three formulations at temperatures ranging from 2 to 30°C. After storage, the five samples were tested using a detection kit determined through the three examples described above to verify the sample preservation effect. The test results for the five samples are shown in Table 17 below. The results show that formulation 2 of the urine sample preservation solution had the best preservation effect on urine samples. The Ct values ​​of the PSA and PCA3 genes in the five samples were lower than those in the other groups, indicating better amplification of these two genes.

[0164] Therefore, Formula 2 was used as the sample preservation solution for subsequent experiments.

[0165] Table 16 Urine Sample Preservation Solution Formula

[0166]

[0167] Table 17 Test Results

[0168]

[0169] Example 5: A lysis buffer and extraction method for a urine RNA extraction reagent.

[0170] This embodiment provides a lysis buffer for urine RNA extraction reagent. The lysis buffer provided in this embodiment, together with the kits and reaction systems described in Examples 1 to 3 and the urine sample preservation solution provided in Example 4, constitute the detection system of this invention.

[0171] The lysis buffer initially selected in this embodiment includes three formulations as shown in Table 18 below.

[0172] Table 18 Urine Sample Preservation Solution Formula

[0173]

[0174]

[0175] The method for extracting RNA from urine is as follows:

[0176] (1) Take 10-40 mL of urine sample into a 50 mL centrifuge tube and centrifuge at 8000 rpm for 15 min.

[0177] (2) With the sediment facing your palm, pour out the supernatant and keep the sediment.

[0178] (3) Add 1 mL of lysis buffer, shake well to mix, resuspend the urine sediment, and transfer all the liquid to a 1.5 mL centrifuge tube.

[0179] (4) Place the centrifuge tube from the previous step in a metal bath at 55°C for 5 minutes to lyse, then lyse at room temperature for 5 minutes, vortexing for 5 seconds every 2 minutes during this period.

[0180] (5) Insert the centrifuge tube into the magnetic rack, invert it 10 times, and let it stand for 1 minute to attract the magnetic beads. After the magnetic beads are completely attracted, use a pipette to remove the supernatant.

[0181] (6) Remove the centrifuge tube from the magnetic rack, add 600 μL of cleaning solution, shake well to mix, resuspend the magnetic beads, and let stand for 1 min.

[0182] (7) Insert the centrifuge tube into the magnetic rack, invert it 10 times, and let it stand for 1 minute to attract the magnetic beads. After the magnetic beads are completely attracted, use a pipette to remove the supernatant.

[0183] (8) Repeat steps (6) to (7) once.

[0184] (9) Dry at room temperature with the lid off for 3 minutes.

[0185] (10) Add 50 μL of elution buffer preheated at 65℃, shake to disperse the magnetic beads, and incubate at 65℃ for 5 min, vortexing for 5 s every 2 min during this period.

[0186] (11) Centrifuge the centrifuge tube briefly for 3 seconds on a hand centrifuge, insert it into a magnetic rack and let it stand for 1 minute to be magnetically attracted. After the magnetic beads are completely attracted, use a pipette to transfer the supernatant into a new centrifuge tube. This is the extracted nucleic acid solution.

[0187] RNA was extracted from five urine samples using the lysis buffers formulated in the three examples described above. The concentration of the extracted RNA was determined, and PCR detection was performed using the detection kit determined in the three examples to verify its extraction performance.

[0188] The RNA concentration results of the 5 samples are shown in Table 19 below, and the PCR detection results are shown in Table 20 below. The results show that the lysis buffer of Formula 2 has the best extraction effect on urine samples, yielding the highest RNA concentration. The Ct values ​​of the PSA and PCA3 gene amplification results are also lower than those of the other groups, indicating better amplification of these two genes. Therefore, Formula 2 was used as the lysis buffer for subsequent experiments.

[0189] Table 19. RNA Concentration Measurement Results

[0190]

[0191] Table 20 Test Results

[0192]

[0193] Example 6: Establishment and validation of positive cutoff values ​​for prostate cancer detection kits.

[0194] To confirm the interpretation rules of this invention, the prostate cancer detection kit and detection system determined in the above embodiments were used to detect urine samples from 322 patients (164 patients with prostate cancer confirmed by puncture biopsy and 158 patients without prostate cancer) after digital rectal examination from the First Affiliated Hospital of Zhejiang University School of Medicine. The detection results were analyzed using 10 analytical models, and their sensitivity and specificity were statistically analyzed. The statistical results are shown in Table 21 below.

[0195] As can be seen from Table 21, the final determination of the interpretation method based on the ΔCt value (ΔCt = Ct) is based on the 10 models established. PCA3 -Ct PSA The method for interpreting sample positivity and positivity using ΔCt values ​​yielded the best sensitivity and specificity. The ultimately selected positive cutoff value was 3.26, meaning that "when ΔCt > 3.26, the sample result is negative; when ΔCt ≤ 3.26, the sample result is positive." At this positive cutoff value, the kit's sensitivity was 79.88 and its specificity was 74.05.

[0196] Table 21 Statistical results of sensitivity and specificity of different analytical models

[0197] Model Number Model Name Sensitivity Specificity Overall compliance rate 1 Tree 73.78％ 77.22％ 75.47％ 2 Linear discrimination 73.78％ 63.92％ 68.94％ 3 Logistic Regression 70.73％ 63.92％ 67.39％ 4 Naive Bayes 62.20％ 61.39％ 61.80％ 5 SVM 55.49％ 81.65％ 68.32％ 6 nuclear 68.90％ 70.25％ 69.57％ 7 Neural Networks 69.51％ 79.11％ 74.22％ 8 integrated 71.34％ 63.29％ 67.39％ 9 PCA3 rating 72.63％ 66.26％ 69.45％ 10 ΔCt value 79.88％ 74.05％ 77.02％

[0198] To confirm the detection efficacy of this invention, the prostate cancer detection kit and method determined in the above embodiments were used to test urine samples from 272 patients (153 with prostate cancer confirmed by biopsy and 119 without prostate cancer) after digital rectal examination at the First Affiliated Hospital of Zhejiang University School of Medicine. The selected positive cutoff value was used to interpret the samples as positive or negative, thereby verifying the positive cutoff value of this kit. The detection results are shown in Table 22 below. As can be seen from Table 22, using pathological results as the gold standard, the positive concordance rate of the kit was 83.01%, the negative concordance rate was 78.99%, and the overall concordance rate was 81.25%.

[0199] Table 22: Validation of Positive Judgment Values

[0200]

[0201] Example 7: The impact of cross-intron primer design method on the detection performance of the kit.

[0202] To further verify the special effects of the primers designed by the trans-intron design method in this invention, this embodiment verifies different primers and probes.

[0203] The optimal cross-intron design primer and probe combination for PCA3 and PSA, selected in Example 1, was used. Simultaneously, a set of primer and probe combinations without cross-intron design was designed for both the PCA3 and PSA genes. The sequences of the two sets of primer and probe combinations are shown in Table 23 below, where group 1 is the cross-intron design PCA3 and PSA primer and probe combination selected in Example 1, and group 2 is the PCA3 and PSA primer and probe combination without cross-intron design. Using both sets of primer and probe combinations, urine samples from 100 patients (45 patients with prostate cancer confirmed by biopsy and 55 patients without prostate cancer) after digital rectal examination from the First Affiliated Hospital of Zhejiang University School of Medicine were simultaneously tested. The optimal reaction system selected in Example 2 and the optimal reaction conditions selected in Example 3 were used.

[0204] Using the clinical gold standard (puncture biopsy pathology) results as a control, the positive and negative concordance rates of the two primer and probe combinations were statistically analyzed. The results are shown in Tables 24 and 25 below. It can be seen that the positive concordance rate of combination 1 was 88.89%, the negative concordance rate was 85.45%, and the overall concordance rate was 87.00%; the positive concordance rate of combination 2 was 66.67%, the negative concordance rate was 65.45%, and the overall concordance rate was 66%. Compared with combination 2, combination 1 showed significantly improved detection sensitivity and specificity, indicating that the trans-intron primer design method can effectively eliminate interference from genomic DNA, improve the specificity of primer combinations, and make detection more accurate.

[0205] Table 23 shows the optimal primer and probe sequences for the PCA3 and PSA genes.

[0206]

[0207] Table 24: Statistics of Verification Results for Group 1

[0208]

[0209] Table 25: Statistical Analysis of Validation Results for Group 2

[0210]

[0211] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A prostate cancer detection kit, characterized in that, The kit is configured to simultaneously detect the Ct values ​​of PCA3 and PSA in urine samples, i.e., Ct PCA3 and Ct PSA ; The kit includes a first set of primers and probes for specific amplification of the PCA3 gene, and a second set of primers and probes for specific amplification of the PSA gene. in, The first specific amplification primer and probe set is selected from at least one of combination A, combination B, or combination C: Combination A: SEQ NO.1: PCA3-F1:ACATGTTTTTGCACATTTCCAG, SEQ NO.2: PCA3-R1: GCTTGTGAGGGAAGGACATTAG, SEQ NO.7: PCA3-P:AAAGGAAGCACAGAGATCCCT(FAM-MGB); Combination B: SEQ NO.3: PCA3-F2:ACAATATAATGTCTAAGTAGTGAC, SEQ NO.4: PCA3-R2: TTGGGTCATCGATGAGCCT, SEQ NO.7: PCA3-P:AAAGGAAGCACAGAGATCCCT(FAM-MGB); Combination C: SEQ NO.5: PCA3-F3: CACTAGAAACAGCAAGATGAC, SEQ NO.6: PCA3-R3: CTGGGAGAAATGCCCGG, SEQ NO.7: PCA3-P:AAAGGAAGCACAGAGATCCCT(FAM-MGB); The second specific amplification primer and probe set is selected from at least one of combination D, combination E, or combination F: Combination D: SEQ NO.8: PSA-F1: GCGCAAGTTCACCCTC, SEQ NO.9: PSA-R1: CAAGGTATCACGTCATGGG, SEQ NO.14: PSA-P:AAGCACCTGCTCGGGGT(VIC-MGB); Combination E: SEQ NO.10: PSA-F2: TGACCAAGTTCATGCTGTGT, SEQ NO.11: PSA-R2: TGCCCTGCCCGAAAGGC, SEQ NO.14: PSA-P:AAGCACCTGCTCGGGGT(VIC-MGB); Combination F: SEQ NO.12: PSA-F3: TTGTGTGCTGGACGCTGG, SEQ NO.13: PSA-R3: CTTCCCTGTACACCAAGGT, SEQ NO.14: PSA-P:AAGCACCTGCTCGGGGT(VIC-MGB); The kit interprets the test results based on the ΔCt value, where ΔCt = Ct. PCA3 -Ct PSA .

2. The prostate cancer detection kit according to claim 1, characterized in that, The final concentration of the first specific amplification primer and probe set is 0.15–0.20 μM, and the final concentration of the first specific amplification primer and probe set is 0.05–0.10 μM.

3. The prostate cancer detection kit according to claim 1, characterized in that, When using this kit for detection, the total volume of the PCR amplification reaction system should be 20–30 μL, the amount of cDNA template added should be 5–10 μL, and the annealing temperature should be 55–60℃.

4. The prostate cancer detection kit according to claim 1, characterized in that, It also includes a reverse transcription reagent, the final concentration of which is 1.00–1.25x, and the reverse transcription reaction conditions are 35–37°C for 22–25 min; or 80–85°C for 12–15 s.

5. A prostate cancer detection kit according to claim 1, characterized in that, It also includes PCR amplification reagents, wherein the final concentration of the PCR amplification reagents is 1.00 to 1.25x.

6. A prostate cancer detection system, characterized in that, The kit comprising any one of claims 1 to 5 further comprises a urine sample preservation solution, the urine sample preservation solution comprising the following components: 0.5–2M guanidine isothiocyanate, PEG8000 with a mass fraction of 15-25%, 55-65mM DTT, Triton X-100 with a mass fraction of 0.3% to 0.8%, pH 7–8, 0.05–0.15 M Tris-HCl, DEPC in parts by weight of 0.05 to 0.15%.

7. A prostate cancer detection system, characterized in that, The kit comprising any one of claims 1 to 5 further comprises a lysis buffer for urine RNA extraction, the lysis buffer comprising the following components: 2-4M guanidine isothiocyanate, 1-2M guanidine hydrochloride, 25-35mM DTT, pH 7–9, 0.5–1.5 M Tris-HCl, pH7~9, 0.1~0.5M EDTA-2Na, Proteinase K at concentrations of 0.1–0.3 mg / mL 0.1–0.3 M NaCl.

8. A method for detecting prostate cancer, characterized in that, Using the kit according to any one of claims 1 to 5, or the detection system according to claim 6 or 7, and comprising the following steps: (1) Sample processing: Take freshly collected urine samples or urine samples preserved with urine sample preservation solution and extract RNA from the urine samples; (2) Reverse transcription reaction: The extracted RNA is reverse transcribed into cDNA using a reverse transcription reagent; (3) PCR amplification: The cDNA was mixed with PCR amplification reagents, specific primers and probes, and PCR amplification was performed. The results were then read using a kit. PCA3 and Ct PSA value; (4) Result interpretation: Calculate the value of ΔCt, ΔCt=Ct PCA3 -Ct PSA The test result of the sample is determined to be negative or positive based on the comparison between the ΔCt value and the threshold.

9. A method for detecting prostate cancer according to claim 8, characterized in that, The specific steps for extracting RNA from urine samples are as follows: (1) Take a urine sample and centrifuge it, leaving the precipitate; (2) Add the lysis buffer and shake thoroughly to mix well. Resuspend the urine sediment and transfer the solution to a centrifuge tube. (3) Place the centrifuge tube from the previous step in a metal bath and decompose at room temperature; (4) After adsorbing the magnetic beads 1-3 times, remove the supernatant and dry at room temperature with the lid off. (5) Add elution buffer, shake thoroughly to disperse the magnetic beads, and incubate for elution; (6) After elution, the centrifuge tube is centrifuged instantly and allowed to stand for 1 minute to be magnetically attracted. After the magnetic beads are completely attracted, the supernatant is transferred to a new centrifuge tube using a pipette, which is the extracted nucleic acid solution.

10. The application of a prostate cancer detection kit according to any one of claims 1 to 5, or a prostate cancer detection system according to any one of claims 6 or 7, or a prostate cancer detection method according to any one of claims 6 or 7 in the preparation of prostate cancer auxiliary diagnostic products.

Images