Fine positioning molecular marker closely linked with rape grain weight major QTL-qSW.A3 and application of fine positioning molecular marker

Abstract

The invention belongs to the field of plant biotechnology breeding, and particularly relates to a fine positioning molecular marker closely linked with rape grain weight main effect QTL-qSW.A3 and application of the fine positioning molecular marker. According to the present invention, the rape grain weight QTL-qSW.A3 is finely positioned through the molecular marker, the PARMS marker is adopted to transform and identify the genotype, and the QTL-qSW.A3 explains the average 10% phenotypic variance, and can be used for the genetic improvement of the rape grain weight and the yield;

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology breeding, specifically involving a finely mapped molecular marker closely linked to the major QTL-qSW.A3 of rapeseed grain weight and its application. Background Technology

[0002] Under the same planting density, rapeseed yield depends on yield per plant, which is directly determined by three components: number of pods per plant, number of seeds per pod, and thousand-seed weight. Studies have shown that these three components of rapeseed yield per plant exhibit varying degrees of negative correlation, but the correlation coefficients are often small (Gupta et al., 2006). This suggests that yield can be increased by improving individual yield components, such as seed weight. Statistical analysis shows that the average thousand-seed weight of nationally approved rapeseed varieties is only about 3.6 grams (Hu et al., 2017), while the seed weight variation in rapeseed germplasm resources is 2-8 grams (Cai Dongfang, 2013; Chen Wei et al., 2013). This indicates that there is still considerable room for improvement in the seed weight of existing rapeseed varieties. Therefore, increasing seed weight is an effective way to improve rapeseed yield, which depends on the discovery and utilization of its important regulatory sites and functional genes.

[0003] Grain weight in rapeseed is a typical quantitative trait, with a continuous phenotypic distribution and susceptibility to environmental conditions, controlled by numerous quantitative trait loci (QTLs). With the development of molecular marker technology, over thirty studies using linkage or association analysis have reported more than 600 grain weight QTLs, with nearly 100 projecting onto the reference genome (Bilgrami et al., 2023). Grain weight QTLs are distributed on every chromosome in rapeseed, but only a few major-effect QTLs have been detected on chromosomes A7 (Basunanda et al., 2010; Fan et al., 2010; Shi et al., 2009) and A9 (Li et al., 2014; Qi et al., 2014; Yang et al., 2012; Zhu Hengxing et al., 2012). This strongly suggests that rapeseed grain weight is a quantitative trait controlled by multiple genes, with a highly complex genetic basis.

[0004] The inventors previously used genetic linkage maps and phenotypic data from four environments of the BnaZN-F2 population constructed from rapeseed varieties Shuang 11 and No. 73290 to repeatedly locate a grain weight QTL between the SSR markers Ol11B05 and BoSF2915 (physical and genetic distances of approximately 3.7 Mb and 13.5 cM, respectively) on the A3 linkage group (Li et al., 2014). Using phenotypic data from five environments of the BnaZN-RIL population constructed from the above two parents (Li et al., 2014), this grain weight QTL was also repeatedly located between the rapeseed A3 chromosome SNP markers Bn-A03-p8483706 and Bn-A03-p11751694 (physical and genetic distances of approximately 3.6 Mb and 14.0 cM, respectively). The additive effect and contribution rate of this QTL to the thousand-grain weight averaged approximately 0.2 g and 10%, respectively, and it was named qSW.A3.

[0005] The initial mapping interval for this locus is too large. Using current flanking molecular markers for assisted selection would result in recombination in up to 7% of individual plants, leading to selection errors. Therefore, there is an urgent need to develop tightly linked markers to improve selection accuracy, which relies on fine mapping of this locus. Since qSW.A3 is not a single gene for a qualitative trait but a QTL with moderate effects, fine mapping is a complex and extremely difficult process (Yang et al., 2012; Spain et al., 2015). First, high-generation (usually more than 6 backcrosses) near-isogenic lines must be constructed to eliminate interference from genetic background. Then, a large-scale near-isogenic segregating population (usually close to 10,000 plants) needs to be developed, and recombinant plants are screened using molecular markers developed within this segment. Finally, progeny testing of these recombinant plants (usually requiring more than 30 plants of each genotype) is necessary to gradually narrow down the interval. The fine mapping process typically requires 2-3 rounds to narrow the interval to within 100 kb. Of the nearly one hundred grain weight QTLs located in rapeseed, only a few major effect QTLs have been finely mapped, such as qSLW.A9 (Liu et al.,2015; Shi et al., 2019; Shen et al., 2019), qSW.C9 (Zhang et al., 2021), cqSW.A03-2 (Wang et al., 2020), and qSW-A03 (Meng et al., 2025). There are no cases of fine mapping of intermediate effect grain weight QTLs.

[0006] This invention utilizes a high-generation NIL segregating population of rapeseed to precisely locate this site, and develops PARMS markers using peak SNP markers for molecular improvement of rapeseed grain weight and yield. Summary of the Invention

[0007] The purpose of this invention is to provide a reagent for detecting the 10,884,386th base on chromosome A03 of Brassica napus for use in screening breeding for grain weight and / or yield of Brassica napus.

[0008] Another objective of this invention is to provide the application of a reagent for detecting bases at positions 10,884,386 on chromosome A03 of Brassica napus in the preparation of a screening kit for grain weight and / or yield of Brassica napus.

[0009] The final objective of this invention is to provide a method for screening breeding of Brassica napus grain weight and / or yield.

[0010] To achieve the above objectives, the present invention employs the following technical measures:

[0011] Obtaining the major-effect QTL-qSW.A3 tightly linked PARMS marker for seed weight in Brassica napus:

[0012] (1) Our team previously constructed F2, F23 and RIL populations using rapeseed sequencing varieties Shuang 11 and No. 73290 (Li et al., 2014; 2019). High-density genetic linkage maps were constructed using SSR markers and SNP microarray analysis, respectively. Multi-environment thousand-grain weight data were obtained through multi-year, multi-location field trials and phenotypic identification. Using QTLCart2.5 software, a QTL site regulating grain weight, qSW.A3, was repeatedly located on chromosome A3, which can explain an average of 10% of the phenotypic variance.

[0013] (2) High-generation QTL-NILs were constructed by backcrossing hybrid F1 (Zhongshuang 11 × No. 73290) and Zhongshuang 11 for multiple generations. Recombinant single plants were screened from the NIL segregating population using PARMS markers developed on both sides of the qSW.A3 segment. Combined with the progeny test results, they were locked to the 39Kb segment, and the peak SNP marker was Bn-A03-p10313368.

[0014] (3) Extract 100bp sequences upstream and downstream of the 10th, 884th, and 386th bases of chromosome Bn-A03-p10313368, the peak SNP marker of qSW.A3, and obtain PARMS detection primer sequences according to primer design principles: A3-1088F: ATTCTATGGTCTCCGCATGATC; A3-1088 Rt: GAAGGTGACCAAGTTCATGCT CTAGTCGGATATTGGCCGGT;A3-1088Rc: GAAGGTCGGAGTCAACGGATT GTCGGATATTGGCCGGC.

[0015] (4) Field trials and phenotypic studies were conducted on the high-generation NIL of qSW.A3 to clarify that the genetic effects of the above-mentioned PARMS markers on grain weight and yield per plant are as high as about 15%, and can be used for the genetic improvement of rapeseed grain weight and yield.

[0016] The scope of protection of this invention includes:

[0017] Application of reagents for detecting bases at positions 10,884,386 on chromosome A03 of Brassica napus in screening breeding for grain weight and / or yield of Brassica napus.

[0018] Application of reagents for detecting bases at positions 10,884,386 on chromosome A03 of Brassica napus in the preparation of screening kits for grain weight and / or yield of Brassica napus.

[0019] If the above-described application detects that the base at position 10,884,386 on chromosome A03 of Brassica napus is A, it indicates that the variety has high grain weight and / or high yield.

[0020] If the above-described application detects a G at position 10,884,386 on chromosome A03 of Brassica napus, it indicates that the variety has low grain weight and / or low yield.

[0021] The reagents described above are preferably primers.

[0022] The primers described above are preferably PARMS detection primers.

[0023] The primers described above, more preferably, are the primers provided by this invention: A3-1088F: ATTCTATGGTCTCCGCATGATC, A3-1088 Rt: GAAGGTGACCAAGTTCATGCT CTAGTCGGATATTGGCCGGT and A3-1088Rc: GAAGGTCGGAGTCAACGGATT GTCGGATATTGGCCGGC.

[0024] A method for screening and breeding of rapeseed grain weight and / or yield, comprising detecting the 10,884,386th base on the A03 chromosome of rapeseed, wherein the method includes, but is not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method or mass spectrometry method.

[0025] A screening kit for grain weight and / or yield of Brassica napus, comprising reagents for detecting bases at positions 10,884,386 on chromosome A03 of Brassica napus.

[0026] The version number of the rapeseed genome used in this invention is ZS11.v0, which can be downloaded from https: / / yanglab.hzau.edu.cn / BnIR / germplasm_info?id=ZS11.v0. In this invention, it may be referred to as the rapeseed ZS11_V0 reference genome.

[0027] Compared with the prior art, the present invention has the following advantages:

[0028] This invention obtained a stable QTL site qSW.A3 that regulates rapeseed grain weight, and it can be repeatedly detected, explaining an average of 10% of the phenotypic variance.

[0029] This invention yields a PARMS marker closely linked to qSW.A3. The detection method is simple and inexpensive, and it has a significant genetic effect on rapeseed grain weight and yield, which can improve selection efficiency and accuracy. Attached Figure Description

[0030] Figure 1 This is a detailed positioning diagram of qSW.A3.

[0031] Figure 2 Showing a comparison of NIL-qSW.A3 and Zhongshuang 11 in terms of number of siliques (A), number of seeds per silique (B), weight of 1000 seeds (C), and yield of main inflorescence (D);

[0032] ns, *, **, and *** represent insignificant and significant differences at the P<0.05, P<0.01, and P<0.001 levels, respectively. Detailed Implementation

[0033] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field; unless otherwise specified, the reagents or materials described are all from commercial sources.

[0034] The version number of the rapeseed genome used in this invention is ZS11.v0, which can be downloaded from https: / / yanglab.hzau.edu.cn / BnIR / germplasm_info?id=ZS11.v0. In this invention, it may be referred to as the rapeseed ZS11_V0 reference genome.

[0035] Example 1: Preliminary localization of the qSW.A3 site

[0036] Li et al. (2014) previously used phenotypic data from F2 and family populations constructed from rapeseed varieties Shuang 11 and No. 73290 in four environments (W09F2, W10F2:3, W11F2:3, and X11F2:3) to repeatedly detect a major QTL-qSW.A3 controlling rapeseed grain weight on chromosome A3. The contribution rate of this QTL to grain weight ranged from 9.9% to 13.4% in the four environments, with a mean of 11.6% (Table 1). Li et al. (2019) previously used phenotypic data from five environments (W12, W13, W14, Z13, Z14) of a RIL population constructed from rapeseed varieties Shuang 11 and No. 73290. They also repeatedly detected a major-effect QTL, qSW.A3, controlling rapeseed grain weight at the same location on chromosome A3. The contribution rate of this QTL to grain weight ranged from 8.1% to 15.8% across the five environments, with a mean of 10.8%. Therefore, this locus is a reproducible major-effect site regulating rapeseed grain weight.

[0037] Table 1. Information on qSW.A3 loci co-located in multiple environments from two populations.

[0038]

[0039] Example 2: Fine positioning of qSW.A3

[0040] High-generation NIL construction: To finely map qSW.A3, 10 generations of backcrosses were performed using the hybrid F1 (Zhongshuang 11 × No. 73290) and the recurrent parent Zhongshuang 11. During this period, PARMS molecular markers A3-P03 and A3-P17, transformed from SNPs flanking the target QTL, were used for genetic prospecting. Heterozygous single plants were selected for continuous backcrossing in the BC10F1 generation. One SNP selected from each rapeseed chromosome (Bn-A01-p10636637, Bn-A02-p22375400, Bn-A03-p25365003, Bn-A04-p7488675, Bn-A05-p5102120, Bn-A06-p26135022, Bn-A07-p13485321) was used. Bn-A08-p16039755, Bn-A09-p26532740, Bn-A10-p7346569, Bn-scaff_15838_1-p1917196, Bn-scaff_15712_6-p346069, Bn-scaff_16352_1-p287559, Bn-scaff_18505_1-p85179, Bn-scaff_16082_1-p278210, Bn-scaff_15818_1-p678205, Bn-scaff_16514_1-p124745, Bn-scaff_16361_1-p318925, Genetic background screening was performed using PARMS markers transformed from Bn-scaff_15650_1-p754414. Several BC10F1 plants that were heterozygous for the foreground selection marker and had the same background selection marker as Zhongshuang 11 were selected and self-crossed to obtain BC10F2 generation NIL-qSW.A3 seeds.

[0041] The first round of fine mapping: Genotyping of the BC10F2 generation NIL-qSW.A3 segregating population was performed using flanking PARMS markers A3-P03 and A3-P17 to screen recombinant individuals. Five new PARMS markers (A3-P05, A3-P09, A3-P11, A3-110, and A3-P165) were developed for the target QTL region, and genotyping and densification were performed on the aforementioned recombinant individuals. Using the genotypic 1000-grain weight data of the progeny of these 15 recombinant individuals, they were finely mapped to the region between A3-P11 and A3-110, corresponding to a physical distance of 300 kb from the genome of the double 11 gene. Figure 1 (B)

[0042] The second round of fine mapping: Genotyping of the BC10F23 generation NIL-qSW.A3 population was performed using the PARMS markers A3-P11 and A3-110 to screen for new recombinant single plants. Eight molecular markers (A3-1074, A3-1075, A3-1077, A3-1078, A3-1080, A3-1084, A3-1085, and A3-1088) were developed and refined; these were then finely mapped to the molecular markers A3-1084 to A3-1088, corresponding to a physical distance of 39 kb from the BC10F23 generation NIL-qSW.A3 population. Figure 1 (C). Its peak SNP marker Bn-A03-p10313368 (named A3-1088) is located at base position 10,884,386 (A or G) on chromosome A03 of the rapeseed ZS11_V0 reference genome.

[0043] Example 3: Obtaining the qSW.A3 tightly linked PARMS marker

[0044] Using rapeseed SNP chips to detect large quantities of intermediate breeding materials is costly. Therefore, it is necessary to convert this method into a simple and low-cost PCR amplification-based detection method, such as PARMS (Penta-primer Amplification Refractory Mutation System). This labeling system includes a pair of universal fluorescent primers (FAM and HEX as reporter fluorescence), a pair of SNP allele-specific primers, and a reverse common primer, enabling rapid and simple SNP allele detection.

[0045] (1) For the peak SNP marker Bn-A03-p10313368 (named A3-1088) associated with qSW.A3, 100 bp sequences were extracted upstream and downstream of chromosomes A03 of the rapeseed ZS11_V0 reference genome at positions 10, 884, and 386. The PARMS marker detection primer sequences obtained according to primer design principles were: A3-1088F: ATTCTATGGTCTCCGCATGATC; A3-1088Rt: GAAGGTGACCAAGTTCATGCT CTAGTCGGATATTGGCCGGT;A3-1088Rc: GAAGGTCGGAGTCAACG GATT GTCGGATATTGGCCGGC.

[0046] (2) Using the genomic DNA of the rapeseed-related population as a template, the above primers were used to perform real-time PCR amplification. The FAM and HEX signals were scanned using a Tecan F200 and the results were output. Finally, the genotype was converted.

[0047] Using the primers described above, the sequence amplified in the rapeseed variety Shuang 11 is as follows: CTAGTCGGATATTGGCCGGT GGAAATATTTACGAGCTTAGCT GATCATGCGGAGACCATAGAAT ;

[0048] The amplified sequence in rapeseed variety No. 73290 is as follows: GTCGGATATTGGCCGGC GGAAATATTTACGAGCTTAGCT GATCATGCGGAGACCATAGAAT。

[0049] Example 4: Effects of PARMS molecular marker A3-1088 on rapeseed grain weight and yield

[0050] To further clarify the effect of the PARMS molecular marker A3-1088 on rapeseed grain weight and yield, Zhongshuang 11 and NIL-qSW.A3 were planted at the Yangluo base in September 2023, and 68 progeny main branches were obtained in July 2024 for seed testing. During this period, the PARMS molecular marker A3-1088 and detection method provided in Example 3 were used to screen and determine the genotypes of these individual plants. Genotypes identical to the parent Zhongshuang 11 were classified as A, and genotypes identical to the parent No. 73290 were classified as B. The main sequence yield and its three constituent factors of the two genotypes were statistically compared. Figure 2 As shown, plants with genotype A had significantly higher thousand-grain weight and main inflorescence yield than plants with genotype B, with increases of 14.1% and 17.1%, respectively, but there were no significant differences in the number of siliques and the number of grains per silique. These results indicate that the PARMS molecular marker A3-1088 has a significant genetic effect on rapeseed grain weight and yield, and can be used for genetic improvement of these two traits.

[0051] Example 5: Application of PARMS molecular marker A3-1088 in rapeseed thousand-grain weight screening (universal applicability)

[0052] In the 331 materials from the associated population (Li et al., 2020), the PARMS marker A3-1088 from Example 3 was used for detection. 77 materials were identified as having the AA genotype, and 234 materials were identified as having the GG genotype (Table 2). The thousand-grain weight of the two genotypes reached a significant level in all six environments. The mean difference in thousand-grain weight between the AA and GG genotypes ranged from 0.20 to 0.28 grams, with an average of 0.24 grams.

[0053] Table 2. Comparison of 1000-grain weight in associated populations and environments for the two PARMS marker A3-1088 genotypes.

[0054]

[0055] * and ** represent significance levels of P<0.05 and 0.01, respectively.

Claims

1. Application of reagents for detecting bases at positions 10,884,386 on chromosome A03 of Brassica napus in screening breeding for grain weight and / or yield of Brassica napus.

2. Application of reagents for detecting bases at positions 10,884,386 on chromosome A03 of Brassica napus in the preparation of screening kits for grain weight and / or yield of Brassica napus.

3. The method for determining the application process according to claim 1 or 2 is as follows: if the base at position 10,884,386 on chromosome A03 of Brassica napus is detected to be A, it indicates that the variety has high grain weight and / or high yield.

4. The method for determining the application process according to claim 1 or 2 is as follows: if the base at position 10,884,386 on chromosome A03 of Brassica napus is detected to be G, it indicates that the grain weight and / or yield of the variety is low.

5. The application according to claim 1 or 2, wherein the reagent is a primer.

6. The application according to claim 5, wherein the primers are: A3-1088F: ATTCTATGGTCTCCGCATGATC, A3-1088 Rt: GAAGGTGACCAAGTTCATGCTCTAGTCGGATATTGGCCGGT and A3-1088Rc: GAAGGTCGGAGTCAACGGATTGTCGGATATTGGCCGGC.

7. A method for screening and breeding of rapeseed grain weight and / or yield, comprising detecting the 10,884,386th base on the A03 chromosome of rapeseed, wherein the method is: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry method.

8. A screening kit for grain weight and / or yield of Brassica napus, comprising a reagent for detecting bases at positions 10,884,386 on chromosome A03 of Brassica napus.

Images