A set of festuca sinensis ssr molecular marker primers and application thereof

By optimizing the PCR reaction system and electrophoresis method, the problems of high cost and insufficient stability of molecular marker detection for Festuca sinensis have been solved, realizing low-cost, efficient and reliable molecular marker analysis, which is suitable for germplasm resource identification, fingerprinting and genetic diversity analysis of Festuca sinensis.

CN121320631BActive Publication Date: 2026-02-17INSTITUTE OF GRASSLAND RESEARCH OF CAAS
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511893727.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-16
Publication Date
2026-02-17
Estimated Expiration
2045-12-16

AI Technical Summary

Technical Problem

Existing technologies for molecular marker detection of Festuca sinensis are costly, lack amplification specificity and stability, making it difficult to achieve large-scale application and reliable analysis.

Method used

The PCR reaction system was optimized using a four-factor, three-level orthogonal experimental design, which optimized the template DNA concentration, primer concentration, annealing temperature, and extension time, reduced the reaction volume to 10 μL, and separated the amplified products by non-denaturing polyacrylamide gel electrophoresis.

Benefits of technology

It significantly reduces detection costs, improves amplification specificity and result stability, is suitable for large-scale applications, and provides a standardized and reusable method for SSR-PCR amplification of Festuca sinensis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121320631B_ABST
    Figure CN121320631B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant molecular markers, and particularly relates to a set of Chinese sheep fescue SSR molecular marker primers and application thereof. The Chinese sheep fescue SSR molecular marker primers provided by the application include 18 pairs of specific primers. The primers are used for PCR amplification and electrophoretic detection of genomic DNA of Chinese sheep fescue samples, so that Chinese sheep fescue germplasm resource identification, genetic diversity analysis and molecular marker assisted breeding can be realized. The application successfully reduces the detection cost by optimizing the reaction system, and also has the characteristics of high specificity and good stability, and has important application value for Chinese sheep fescue germplasm resource evaluation and molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant molecular marker technology, specifically relating to a set of SSR molecular marker primers for Festuca sinensis and their applications. Background Technology

[0002] Chinese sheep fescue (Festuca sinensis) is an important germplasm resource of grasses, possessing excellent characteristics such as cold and drought resistance, and has significant value in ecological restoration and livestock development. In recent years, this grass species has been included in key research and development programs, becoming one of the key grass species for research and development. Summary of the Invention

[0003] Since there is no reference genome for *Festuca sinensis*, simple sequence repeat (SSR) molecular markers have become an ideal tool for developing molecular markers for *Festuca sinensis* due to their advantages such as high polymorphism, co-dominance, and good reproducibility. In the application of SSR molecular markers, polymerase chain reaction (PCR) is the core step, and its amplification effect directly determines the accuracy and reliability of subsequent analyses.

[0004] To address the shortcomings of existing technologies, this invention is implemented through the following solution:

[0005] This invention provides a set of SSR molecular marker primers for Chinese fescue, as shown in Table 1.

[0006] This invention provides the application of the above-mentioned SSR molecular marker primers for Chinese fescue in the identification of Chinese fescue germplasm resources.

[0007] This invention provides the application of the above-mentioned Festuca sinensis SSR molecular marker primers in fingerprint pattern construction.

[0008] This invention provides the application of the above-mentioned Festuca sinensis SSR molecular marker primers in genetic diversity analysis.

[0009] This invention provides the application of the above-mentioned SSR molecular marker primers for Chinese fescue in molecular marker-assisted breeding.

[0010] This invention also provides a method for SSR analysis of Festuca sinensis, the method comprising the following steps:

[0011] (1) Extract genomic DNA from the Chinese fescue sample to be tested;

[0012] (2) Using genomic DNA as a template, PCR amplification was performed using the above primers to obtain the amplification product;

[0013] (3) Electrophoretic separation and development of the amplified products were performed to obtain the results of SSR analysis of Festuca sinensis.

[0014] In this invention, the PCR reaction system described in step (2) includes the following components when measured in 10 μL:

[0015] 5 μL of 2× Es Taq MasterMix (Dye); 1 μL of template DNA at a concentration of 20 ng / μL; 1 μL each of forward and reverse primers at a concentration of 15 μM; 2 μL of ddH2O.

[0016] In this invention, the PCR amplification procedure in step (2) is as follows:

[0017] Pre-denaturation at 95°C for 2 minutes; 26 cycles were performed, each cycle consisting of denaturation at 94°C for 30 seconds, annealing at 58°C for 45 seconds, and extension at 72°C for 60 seconds; after the cycle, a final extension was performed at 72°C for 7 minutes; the reaction product was stored at 4°C.

[0018] Compared with existing technologies, the present invention has the following beneficial effects:

[0019] (1) The detection cost is significantly reduced, making it suitable for large-scale application.

[0020] Existing technologies mostly use a 20 μL reaction system, while this invention optimizes the system to 10 μL, reducing reagent consumption by approximately 50%. This optimization effectively saves experimental costs during large-scale germplasm resource screening, demonstrating significant economic benefits.

[0021] (2) The amplification specificity and result stability were significantly improved.

[0022] This invention innovatively employs a four-factor, three-level orthogonal experimental design (L9(3)). 4) This method synergistically optimizes four key parameters: template DNA concentration, primer concentration, annealing temperature, and extension time. It overcomes the limitations of traditional univariate optimization, efficiently screening for the optimal parameter combination and revealing the interactions between factors. This ensures amplification results with clear bands, low background, and high polymorphism under different operating conditions, greatly improving the reproducibility and reliability of the method.

[0023] (3) It provides a complete, standardized, and reusable solution.

[0024] This invention completely solves the problems of vague details and difficulty in reproduction in existing technologies. The solution has clear parameters and standardized operation, which can be directly referenced and used by those skilled in the art, and has strong operability and repeatability.

[0025] In summary, this invention, through a series of improvements such as miniaturization of the reaction system and multi-factor orthogonal optimization, successfully overcomes the shortcomings of existing technologies and forms an SSR-PCR amplification method specifically for Chinese fescue with significant advantages in terms of cost, stability, and operability. Attached Figure Description

[0026] Figure 1 For electrophoretic sample loading, the experimental sequence shown is 1~60;

[0027] Figure 2 For electrophoresis sample loading, the experimental sequence shown is 61~120;

[0028] Figure 3 For electrophoresis sample loading, the experimental sequence shown is 121~180;

[0029] Figure 4 For electrophoresis sample loading, the experimental sequence shown is 181~240;

[0030] Figure 5 For electrophoresis sample loading, the experimental sequence shown is 241~300;

[0031] Figure 6 For electrophoretic sample loading, the experimental sequence shown is 301~360;

[0032] Figure 7 Use a 50 bp Marker as a reference. Detailed Implementation

[0033] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are only used to explain the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0034] Example

[0035] 1. Establishment of the PCR reaction system

[0036] Total system volume: 10 μL.

[0037] System composition:

[0038] Core reaction solution: 2× Es Taq MasterMix (Dye), added in 5 μL.

[0039] Template DNA: 1 μL, with its concentration selected from three levels: 10 ng / μL, 20 ng / μL, and 30 ng / μL, based on orthogonal optimization results.

[0040] Amplification primers: Forward and reverse SSR primers (as shown in Table 1), 1 μL each, with concentrations selected from three levels: 5 μM, 10 μM, and 15 μM based on orthogonal optimization results.

[0041] Solvent: Ultrapure water (ddH2O), used to bring the remaining volume to 10 μL of the total system.

[0042] Mixing method: Add the above components to the PCR tube in the order and amount described above, mix well using a vortex mixer, and then briefly centrifuge to ensure that the liquid collects at the bottom of the tube.

[0043] Table 1 Primers for SSR Molecular Markers of Festuca sinensis

[0044] serial number Primer number Primer name forward primer Primer number Primer name reverse primer 1 SEQ ID NO.1 9914-16GAPB-F1 gcaatggccgcttagataaa SEQ ID NO.2 9914-16GAPB-R1 gcctcagcccagagaagtc 2 SEQ ID NO.3 9914-16GAPB-F2 gcaatggccgcttagataaa SEQ ID NO.4 9914-16GAPB-R2 aggacatcggagaaggacg 3 SEQ ID NO.5 9914-16GAPB-F4 ccaagcagagggtggactt SEQ ID NO.6 9914-16GAPB-R4 cgttgatcgccaccttcag 4 SEQ ID NO.7 9914-16GAPB-F5 ggacttcgccgacttctct SEQ ID NO.8 9914-16GAPB-R5 ttgatcgccaccttcagctt 5 SEQ ID NO.9 9914-16TCP7-F1 aacaacctaagagcagggca SEQ ID NO.10 9914-16TCP7-R1 agtggtgctgctgtcaaatg 6 SEQ ID NO.11 9914-16TCP7-F2 aacaacctaagagcagggca SEQ ID NO.12 9914-16TCP7-R2 cagtggtgctgctgtcaaat 7 SEQ ID NO.13 9914-16TCP7-F3 caacaacctaagagcagggc SEQ ID NO.14 9914-16TCP7-R3 agtggtgctgctgtcaaatg 8 SEQ ID NO.15 9914-16ABC-F1 ccccaacttgtttgggacta SEQ ID NO.16 9914-16ABC-R1 atccaacatttttgccaagc 9 SEQ ID NO.17 9914-16ABC-F2 ccccaacttgtttgggacta SEQ ID NO.18 9914-16ABC-R2 caacatttttgccaagctca 10 SEQ ID NO.19 9914-16ABC-F3 ccccaacttgtttgggacta SEQ ID NO.20 9914-16ABC-R3 gtccatccaacatttttgcc 11 SEQ ID NO.21 9914-16Hsp70-F3 gtagattctgaagggcgtgc SEQ ID NO.22 9914-16Hsp70-R3 cgcatacgagaagcaactcc 12 SEQ ID NO.23 9914-16MYB-F1 gcgacatggactactggctt SEQ ID NO.24 9914-16MYB-R1 ctctgttagcaatccctccg 13 SEQ ID NO.25 9914-16MYB-F2 gacgtcgtcttaatggagcc SEQ ID NO.26 9914-16MYB-R2 ctctgttagcaatccctccg 14 SEQ ID NO.27 9914-16MYB-F3 ttccagatcgacgagagctt SEQ ID NO.28 9914-16MYB-R3 gcgcagtgtgagagagagaa 15 SEQ ID NO.29 9914-16NFA091F accgccttcttgtcgtaggt SEQ ID NO.30 9914-16NFA091R gtgtggtcttcttctccgtctc 16 SEQ ID NO.31 9914-16NFA057F cgtccaagcccaagtaacat SEQ ID NO.32 9914-16NFA057R ctcccctcccctcctacc 17 SEQ ID NO.33 9914-16NFA099F ggaagaggaacagagcaatgac SEQ ID NO.34 9914-16NFA099R actgaaactgagcgttgagagc 18 SEQ ID NO.35 9914-16NFA024F tgcccacgaggtctatcttc SEQ ID NO.36 9914-16NFA024R agcttccccttcattccact

[0045] 2. PCR amplification reaction procedure

[0046] The amplification reaction was carried out automatically in the thermal cycler according to a preset program. The program parameters are as follows:

[0047] Pre-denaturation: Temperature 95 ℃, duration 2 minutes.

[0048] Cyclic amplification: Repeat 26 cycles, each cycle containing the following steps:

[0049] Denaturation: Temperature 94 ℃, duration 30 seconds.

[0050] Annealing: The temperature was selected from three levels, 56℃, 58℃, and 61℃, based on the orthogonal optimization results, and the duration was 45 seconds.

[0051] Extension: Temperature 72 ℃, duration selected from three levels of 60 seconds, 90 seconds, and 120 seconds based on orthogonal optimization results.

[0052] Final extension: Temperature 72 ℃, duration 7 minutes, to ensure complete DNA strand synthesis.

[0053] Storage: 4 ℃, used for temporary storage of the product after the reaction is complete.

[0054] Table 2 shows L9(3) 4 Example of orthogonal representation. In practice, the same Chinese fescue germplasm sample is replicated twice.

[0055] Table 2 L9(3) 4 Orthogonal array

[0056] Serial Number Factor A (template DNA concentration) Factor B (primer concentration) Factor C (annealing temperature) Factor D (Extended Time) 1 10 ng / μL 5 μM 56℃ 60 seconds 2 10 ng / μL 10 μM 58℃ 90 seconds 3 10 ng / μL 15 μM 61℃ 120 seconds 4 20 ng / μL 10 μM 56℃ 120 seconds 5 20 ng / μL 15 μM 58℃ 60 seconds 6 20 ng / μL 5 μM 61℃ 90 seconds 7 30 ng / μL 15 μM 56℃ 90 seconds 8 30 ng / μL 5 μM 58℃ 120 seconds 9 30 ng / μL 10 μM 61℃ 60 seconds

[0057] 3. Separation and detection of amplification products

[0058] Gel preparation:

[0059] Materials and Formulation: Non-denaturing polyacrylamide gel was prepared with the following composition: 15 mL of 30% gel preparation solution (29:1), 10 mL of 5×TBE buffer, 25 mL of ultrapure water, 600 μL of 10% ammonium persulfate (AP), and 40 μL of TEMED.

[0060] Polymerization conditions: Let stand at room temperature for 60 minutes to ensure complete gel polymerization.

[0061] Electrophoretic separation:

[0062] Electrophoresis environment: 0.5×TBE buffer solution was added to the electrophoresis tank as the electrophoresis solution.

[0063] Loading volume: 1 μL per sample. To avoid edge effects, the wells on both sides of the gel edge are not used, and a 50 bp DNA marker is added to each end as a reference (50 bp DNA marker as shown). Figure 7 (As shown).

[0064] Electrophoresis parameters: Staged constant voltage electrophoresis was used. Stage 1: Voltage 120 V, current 400 mA, time 30 minutes; Stage 2: Voltage 180 V, current 400 mA, time 75 minutes.

[0065] 4. Result Development

[0066] Silver staining: After electrophoresis, place the gel in a 0.1% (w / v) silver nitrate (AgNO3) solution and stain at room temperature in the dark for 10-15 minutes.

[0067] Color development: Remove the gel, rinse briefly with ultrapure water, and then transfer it to the color development solution (composed of 2% (w / v) sodium hydroxide (NaOH) and 1% (v / v) formaldehyde). Develop for 5-8 minutes until the DNA bands are clearly visible.

[0068] Termination and Recording: Rinse the gel twice with ultrapure water to terminate the color development reaction. Then place the gel on a gel imaging system or light box for digital photography and archiving.

[0069] Application examples

[0070] Through the orthogonal experimental design of the aforementioned embodiments (L9(3) 4 The PCR reaction system and procedure were optimized, and the optimal amplification scheme for SSR analysis of Festuca sinensis was finally determined and its effectiveness was verified.

[0071] 1. Optimized reaction system and procedure

[0072] The optimal combination of reaction parameters was determined through orthogonal experimental analysis as follows:

[0073] PCR reaction system (total volume 10 μL): 2× Es Taq MasterMix (Dye): 5 μL; Template DNA (20 ng / μL): 1 μL; Forward primer (15 μM): 1 μL; Reverse primer (15 μM): 1 μL; ddH2O: 2 μL;

[0074] PCR amplification procedure:

[0075] Pre-denaturation: 95 ℃, 2 minutes;

[0076] Cyclic amplification (26 cycles): denaturation at 94 °C for 30 seconds, annealing at 58 °C for 45 seconds, and extension at 72 °C for 60 seconds;

[0077] Final extension: 72 ℃, 7 minutes;

[0078] Storage: 4℃.

[0079] 2. Verification of amplification results

[0080] Amplification was performed using the optimized system and procedure described above. The amplification products were separated using 6% non-denaturing polyacrylamide gel electrophoresis. In the gel pattern, the leftmost and rightmost lanes are 50 bp DNA markers used to determine the fragment size of the amplified products. Every 18 consecutive lanes in the middle represent the amplification results of the same pair of SSR primers. This layout includes 9 treatment combinations and 2 replicates from the orthogonal experiment, totaling 18 samples.

[0081] Using the 18 primer pairs provided in Table 1 as a reference and the orthogonality factors provided in Table 2 as a reference, each primer pair was used for 18 experiments, for a total of 324 experiments.

[0082] Electrophoresis results as follows Figures 1-6 As shown ( Figure 5 and Figure 6 The study also included 36 experiments with two undocumented primer pairs. Results showed that all samples successfully amplified clear, specific DNA bands, and the results were highly consistent between replicates, demonstrating that the optimized scheme has excellent amplification efficiency, stability, and reproducibility.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A set of SSR molecular marker primers of Festuca sinensis, characterized in that, The primers are shown in the following table: 。 2. The application of the Chinese meadowgrass SSR molecular marker primer in the identification of Chinese meadowgrass germplasm resources according to claim 1.

3. The application of the Chinese meadowgrass SSR molecular marker primer in the construction of Chinese meadowgrass fingerprint according to claim 1.

4. The application of the Chinese meadowgrass SSR molecular marker primer in the genetic diversity analysis of Chinese meadowgrass according to claim 1.

5. The application of the Chinese meadowgrass SSR molecular marker primer in the molecular marker assisted breeding of Chinese meadowgrass according to claim 1.

6. A method for analyzing SSR of Festuca sinensis, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of the Chinese meadowgrass sample to be tested; (2) using the genomic DNA as a template, PCR amplification is performed by using the primer provided in claim 1 to obtain an amplification product; (3) performing electrophoretic separation and developing treatment on the amplification product to obtain the Chinese meadowgrass SSR analysis result.

7. The method of claim 6, wherein, The PCR reaction system in step (2) includes the following components when 10 μL is used as a standard: 5 μL of 2× Es Taq MasterMix Dye; 1 μL of template DNA with a concentration of 20 ng / μL; 1 μL of forward primer and 1 μL of reverse primer with a concentration of 15 μM; 2 μL of ddH2O.

8. The method of claim 6, wherein, The PCR amplification program in step (2) is as follows: 95℃ pre-denaturation for 2 minutes; 26 cycles are performed, each cycle including 94℃ denaturation for 30 seconds, 58℃ annealing for 45 seconds, and 72℃ extension for 60 seconds; After the cycle, final extension is performed at 72℃ for 7 minutes; The reaction product is stored in an environment at 4℃.

Citation Information

Patent Citations

  • Method for assisting to identify agrostis plant

    CN102146471A

  • Establishment method for callus induction and regeneration system of mature embryo of festuca sinensis

    CN118020639A