Detection reagent, kit and detection method for pathogens of micropterus salmoides

Abstract

The invention discloses a detection reagent, a kit and a detection method for pathogens of micropterus salmoides. The micropterus salmoides pathogen detection reagent comprises primers and probes for specifically amplifying an infectious spleen and kidney necrosis virus, a viral nervous necrosis virus, flavobacterium columnar, a perch rhabdovirus, a micropterus salmoides double-RNA virus, edwardsiella tarda, nocardia and a micropterus salmoides iridovirus; specific upstream and downstream primers and probes of the eight pathogens are sequences as shown in SEQ ID NO.1 to SEQ ID NO.24 in sequence. The micropterus salmoides pathogen detection reagent and method can detect eight pathogens at the same time, have the advantages of high sensitivity, high specificity, good repeatability and the like, provide reliable basis for prevention and control of the pathogens, also improve the prevention and control work efficiency, and have good application prospects. The kit is especially suitable for large-scale rapid screening and mixed infection diagnosis of aquaculture pathogens, and has important value and significance for prevention and treatment of micropterus salmoides pathogens.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of detection of largemouth bass pathogens, in particular to a detection reagent, kit and method for detecting largemouth bass pathogens. BACKGROUND

[0002] Largemouth bass is a fish animal of the genus Micropterus in the family Percichthyidae of Perciformes. It is popular in the market because of its firm flesh, delicious taste, few bones, high nutritional value, and the belief that eating it has special effects on wound healing in some areas.

[0003] During cultivation, largemouth bass is threatened by various pathogens, including infectious spleen and kidney necrosis virus (ISKNV), viral nervous necrosis virus (VNNV), F. columnare, Micropterus spring virus (MSRV), largemouth bass double RNA virus (LBBV), E. tarda, N. seriolae, and largemouth bass iridovirus (LMBV). Among them, LMBV, MSRV and N. seriolae are particularly harmful to the cultivation of largemouth bass.

[0004] Polymerase chain reaction (PCR) technology has become the gold standard for pathogen detection due to its high sensitivity, specificity and rapidity. As a method for real-time monitoring of PCR amplification, fluorescent PCR provides a means for pathogen detection with high sensitivity and specificity by real-time quantitative analysis of DNA amplification through changes in fluorescence signals.

[0005] Although multiplex fluorescent PCR technology has obvious advantages in theory, it still faces many challenges in actual operation. How to design specific primers that do not cross-react, how to optimize the reaction system to improve sensitivity and specificity, and how to handle and interpret complex fluorescence signals are key issues that need to be addressed to establish an effective multiplex fluorescent PCR method.

[0006] In order to improve detection efficiency and reduce detection cost, relevant institutions and units for fish disease detection will not choose a single pathogen for detection. However, there is currently no largemouth bass pathogen multiplex detection technology that meets the use requirements. SUMMARY

[0007] The purpose of the present application is to provide a new detection reagent, kit and method for detecting largemouth bass pathogens.

[0008] The present application adopts the following technical solutions:

[0009] The first aspect of the present application discloses a detection reagent for pathogens of largemouth bass, comprising primers and probes for specifically amplifying infectious spleen and kidney necrosis virus, viral nervous necrosis virus, columnar flavobacterium, sea bass rhabdovirus, largemouth bass double RNA virus, Edwardsiella tarda, Nocardia and largemouth bass iridovirus; the upstream and downstream primers for specifically amplifying the infectious spleen and kidney necrosis virus are respectively represented by SEQ ID NO. 1 and 2, and the probe is represented by SEQ ID NO. 3; the upstream and downstream primers for specifically amplifying the viral nervous necrosis virus are respectively represented by SEQ ID NO. 4 and 5, and the probe is represented by SEQ ID NO. 6; the upstream and downstream primers for specifically amplifying the columnar flavobacterium are respectively represented by SEQ ID NO. 7 and 8, and the probe is represented by SEQ ID NO. 9; the upstream and downstream primers for specifically amplifying the sea bass rhabdovirus are respectively represented by SEQ ID NO. 10 and 11, and the probe is represented by SEQ ID NO. 12; the upstream and downstream primers for specifically amplifying the largemouth bass double RNA virus are respectively represented by SEQ ID NO. 13 and 14, and the probe is represented by SEQ ID NO. 15; the upstream and downstream primers for specifically amplifying the Edwardsiella tarda are respectively represented by SEQ ID NO. 16 and 17, and the probe is represented by SEQ ID NO. 18; the upstream and downstream primers for specifically amplifying the Nocardia are respectively represented by SEQ ID NO. 19 and 20, and the probe is represented by SEQ ID NO. 21; and the upstream and downstream primers for specifically amplifying the largemouth bass iridovirus are respectively represented by SEQ ID NO. 22 and 23, and the probe is represented by SEQ ID NO. 24.

[0010] It should be noted that the detection reagent for pathogens of largemouth bass of the present application can simultaneously detect 8 common and harmful pathogens of largemouth bass, has high sensitivity, strong specificity and good repeatability, is especially suitable for large-scale rapid screening and mixed infection diagnosis of aquatic breeding pathogens, and has important value and significance for the prevention and treatment of pathogens of largemouth bass.

[0011] In an implementation manner of the present application, the detection reagent of the present application further comprises primers and probes for specifically amplifying the internal reference of osteichthyes; the upstream and downstream primers for specifically amplifying the internal reference of osteichthyes are respectively represented by SEQ ID NO. 25 and 26, and the probe is represented by SEQ ID NO. 27.

[0012] The second aspect of the present application discloses a kit for detecting pathogens of largemouth bass, which contains the detection reagent of the present application.

[0013] In an implementation manner of the present application, the kit of the present application further contains positive quality control.

[0014] In an implementation form of the application, the positive quality control is a positive plasmid containing the target fragments amplified by the upstream and downstream primers.

[0015] In an implementation form of the application, the kit of the application further contains the reaction reagents for real-time fluorescent quantitative PCR.

[0016] It should be noted that the key of the kit of the application is that it contains the detection reagent for the pathogens of the largemouth bass of the application, and other components can be combined into the kit of the application according to the needs, and can also be obtained by purchase or order.

[0017] The third aspect of the application discloses a method for detecting pathogens of the largemouth bass for non-diagnostic treatment purposes, comprising detecting the sample to be tested by using the detection reagent of the application or the kit of the application, and judging whether the sample to be tested contains the pathogens of the largemouth bass according to the detection result.

[0018] It should be noted that the method for detecting the pathogens of the largemouth bass for non-diagnostic treatment purposes of the application mainly refers to detecting and monitoring the pathogens of the sample to be tested to prevent the spread of the pathogens and take preventive measures in time; the application provides a simple, fast, efficient and low-cost method for detecting the pathogens of the largemouth bass.

[0019] In an implementation form of the application, the detection method of the application further comprises grouping the primers and probes for specifically amplifying the infectious spleen and kidney necrosis virus, the viral nerve necrosis virus, the columnar yellow bacillus, the largemouth bass rhabdovirus, the largemouth bass double RNA virus, the Edwardsiella tarda, the Nocardia, the largemouth bass iridovirus and the osteichthyes internal reference into at least two groups, and performing real-time fluorescent quantitative PCR amplification respectively.

[0020] In an implementation form of the application, the real-time fluorescent quantitative PCR amplification is performed according to the following grouping:

[0021] Group A includes the primers and probes for the infectious spleen and kidney necrosis virus, the viral nerve necrosis virus, the columnar yellow bacillus and the osteichthyes internal reference;

[0022] Group B includes the primers and probes for the largemouth bass rhabdovirus, the largemouth bass double RNA virus, the Edwardsiella tarda and the osteichthyes internal reference;

[0023] Group C includes the primers and probes for the Nocardia, the largemouth bass iridovirus and the osteichthyes internal reference.

[0024] In an implementation form of the application, the detection method of the application comprises the following steps:

[0025] 1) Extracting the nucleic acid of the sample to be tested, and obtaining the cDNA template by reverse transcription;

[0026] 2) Collect the fluorescence signals of the real-time fluorescence quantitative PCR amplification detection of the cDNA template of the sample to be detected by using the primers and probes of group A, group B and group C respectively in three detection tubes;

[0027] 3) Determine whether the sample contains infectious spleen and kidney necrosis virus, viral nerve necrosis virus, columnar yellow bacillus, sea bass rhabdovirus, large-mouth bass double RNA virus, Edwardsiella tarda, Nocardia and large-mouth bass iridovirus according to the fluorescence signals and Cq values collected in step 2).

[0028] In an implementation manner of the present application, the method for determining whether the sample contains the large-mouth bass pathogen according to the Cq value specifically comprises: when the Cq value is greater than 35 or the system is determined to be negative, the result is determined to be negative; and when the Cq value is less than 35 and each control sample is normal, the result is determined to be positive.

[0029] In an implementation manner of the present application, the ratio of the molar concentration of the primers of the infectious spleen and kidney necrosis virus, the viral nerve necrosis virus, the columnar yellow bacillus and the hard fish internal reference to the molar concentration of the probes in the real-time fluorescence quantitative PCR amplification reaction system of group A is 0.1:0.2:0.4:0.3 in sequence.

[0030] In an implementation manner of the present application, the ratio of the molar concentration of the primers of the sea bass rhabdovirus, the large-mouth bass double RNA virus, the Edwardsiella tarda and the hard fish internal reference in the real-time fluorescence quantitative PCR amplification reaction system of group B is 0.3:0.3:0.4:0.4 in sequence, and the ratio of the molar concentration of the probes of the four is 0.1:0.1:0.2:0.2 in sequence.

[0031] In an implementation manner of the present application, the ratio of the molar concentration of the primers of the Nocardia, the large-mouth bass iridovirus and the hard fish internal reference to the molar concentration of the probes in the real-time fluorescence quantitative PCR amplification reaction system of group C is 0.1:0.1:0.1:0.1 in sequence.

[0032] It should be noted that in principle, as long as the grouping of the present application is followed, the simultaneous detection of the eight pathogens in three reaction tubes can be realized; however, considering the amplification efficiency and detection sensitivity, the present application further optimizes the primer and probe concentrations of each detection object in the reaction system. Under the optimized ratio, each detection object can achieve good amplification efficiency, thereby improving the detection sensitivity.

[0033] In an implementation manner of the present application, the reaction program of the real-time fluorescence quantitative PCR amplification of group A, group B and group C is 50℃ 2min, 95℃ 3min, 95℃ 10s, 60℃ 30s when the method is established.

[0034] The present application has the following beneficial effects:

[0035] The pathogen detection reagent and method of the largemouth bass in the application can simultaneously detect 8 pathogens, has the advantages of high sensitivity, strong specificity, good repeatability, etc., provides a reliable basis for the prevention and control of largemouth bass pathogens, and the high-throughput detection also improves the work efficiency of pathogen prevention and control, provides a simple, fast, efficient and low-cost solution for largemouth bass pathogen detection, especially suitable for large-scale rapid screening and mixed infection diagnosis of aquaculture pathogens, and has important value and significance for the prevention and control of largemouth bass pathogens. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figures 1 to 3 is the amplification curve diagram of the A group, the B group and the C group in the best reaction system exploration of the embodiment of the application, wherein the blue line represents the FAM fluorescence channel, the green line represents the VIC fluorescence channel, the red line represents the CY5 fluorescence channel, and the orange line represents the ROX fluorescence channel;

[0037] Figures 4 to 7 is the sensitivity test result of the A group in the embodiment of the application, and the sensitivity curves of the CY5 fluorescence channel, the FAM fluorescence channel, the VIC fluorescence channel and the ROX fluorescence channel are sequentially shown;

[0038] Figures 8 to 11 is the sensitivity test result of the B group in the embodiment of the application, and the sensitivity curves of the CY5 fluorescence channel, the FAM fluorescence channel, the VIC fluorescence channel and the ROX fluorescence channel are sequentially shown;

[0039] Figures 12 to 14 is the sensitivity test result of the C group in the embodiment of the application, and the sensitivity curves of the FAM fluorescence channel, the VIC fluorescence channel and the ROX fluorescence channel are sequentially shown;

[0040] Figures 15 to 17 is the specificity test result of the A group, the B group and the C group in the embodiment of the application, wherein the blue line represents the FAM fluorescence channel, the green line represents the VIC fluorescence channel, the red line represents the CY5 fluorescence channel, and the orange line represents the ROX fluorescence channel; Figure 21 , curves 1-4 are sequentially shown as the internal reference, ISKNV, VNNV and F.columnare, and curves 5-10 are sequentially shown as LBUSV, A.hydrophila, A.veronii, Saprolegnia, Trichodina and negative control; Figure 22In the figure, curves 1-4 are E. tarda, MSRV, internal reference, LBBV in order, and curves 5-10 are LBUSV, A. hydrophila, A. veronii, Saprolegnia, Trichodina and negative control in order; Figure 23 In the figure, curves 1-3 are LMBV, internal reference, N. seriolae in order, and curves 4-9 are LBUSV, A. hydrophila, A. veronii, Saprolegnia, Trichodina and negative control in order.

[0041] Figures 18 to 20 is an amplification curve diagram of the plasmid standard of the gradient dilution of groups A, B and C in the embodiment of the application, wherein the blue line represents the FAM fluorescence channel, the green line represents the VIC fluorescence channel, the red line represents the CY5 fluorescence channel, and the orange line represents the ROX fluorescence channel.

[0042] Figures 21 to 23 is a standard curve of the standard dilution of groups A, B and C in the embodiment of the application, wherein the blue line represents the FAM fluorescence channel, the green line represents the VIC fluorescence channel, the red line represents the CY5 fluorescence channel, and the orange line represents the ROX fluorescence channel. DETAILED DESCRIPTION

[0043] In order to develop and design a multiplex quantitative detection scheme to better meet the use demand of multiplex detection of largemouth bass pathogens, the application adopts the method of combining theoretical design with experimental verification. First, infectious spleen and kidney necrosis virus, viral nerve necrosis virus, columnar yellow bacillus, largemouth bass rhabdovirus, largemouth bass double RNA virus, Edwardsiella tarda, Nocardia and largemouth bass iridovirus are grouped, and primers and probes of each group are designed to avoid interference between primers and probes; secondly, the best reaction condition is explored; finally, the primers and probes are tested for sensitivity, specificity and repeatability, and a standard curve is established to ensure that the primers and probes meet the requirements in theory.

[0044] Finally, the application develops a detection reagent for pathogens of largemouth bass, which comprises primers and probes for specifically amplifying eight pathogens; the upstream and downstream primers for specifically amplifying infectious spleen and kidney necrosis virus are respectively represented by SEQ ID NO. 1 and 2, and the probe is represented by SEQ ID NO. 3; the upstream and downstream primers for specifically amplifying viral nervous necrosis virus are respectively represented by SEQ ID NO. 4 and 5, and the probe is represented by SEQ ID NO. 6; the upstream and downstream primers for specifically amplifying columnaris yellow bacillus are respectively represented by SEQ ID NO. 7 and 8, and the probe is represented by SEQ ID NO. 9; the upstream and downstream primers for specifically amplifying largemouth bass rhabdovirus are respectively represented by SEQ ID NO. 10 and 11, and the probe is represented by SEQ ID NO. 12; the upstream and downstream primers for specifically amplifying double RNA virus of largemouth bass are respectively represented by SEQ ID NO. 13 and 14, and the probe is represented by SEQ ID NO. 15; the upstream and downstream primers for specifically amplifying Edwardsiella tarda are respectively represented by SEQ ID NO. 16 and 17, and the probe is represented by SEQ ID NO. 18; the upstream and downstream primers for specifically amplifying Nocardia are respectively represented by SEQ ID NO. 19 and 20, and the probe is represented by SEQ ID NO. 21; and the upstream and downstream primers for specifically amplifying iridovirus of largemouth bass are represented by SEQ ID NO. 22 and 23, and the probe is represented by SEQ ID NO. 24.

[0045] Based on the detection reagent for pathogens of largemouth bass, a corresponding kit and a detection method for pathogens of largemouth bass are developed.

[0046] 1. The application can simultaneously detect ISKNV, VNNV, F. columnare, MSRV, LBBV, E. tarda, N. seriolae and LMBV, and provides a simple, fast, efficient and low-cost method for detection of largemouth bass diseases.

[0047] 2. The detection reagent and the multiple TaqMan probe qPCR detection method established by the application have high sensitivity. In one implementation manner of the application, the detection method of the application has a detection sensitivity of 1.88 x 10 0 copies / μL for each pathogen, and has good specificity and repeatability.

[0048] 3. The detection reagent and method of the application provide a reliable basis for the prevention and control of eight pathogens, thereby greatly reducing the workload of single qPCR detection and greatly improving the work efficiency.

[0049] 4、The detection method of the application has good specificity and repeatability, and has high sensitivity, and can be directly used for clinical detection. Through rapid and efficient detection of ISKNV, VNNV, F. columnare, MSRV, LBBV, E. tarda, N. seriolae and LMBV, the eight pathogens in the largemouth bass can be diagnosed and monitored at the same time, and prevention and control measures can be taken in time.

[0050] The application will be further described in detail through specific examples. The following examples are only for further description of the application and should not be understood as limiting the application.

[0051] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0052] Example

[0053] I. Design of primers and probes

[0054] In this example, specific amplification primers and probes were designed for infectious spleen and kidney necrosis virus (ISKNV), viral nervous necrosis virus (VNNV), F. columnare, MSRV, LBBV, E. tarda, N. seriolae, and LMBV, and specific primers and probes for the internal reference (IR-Fish) of the osteichthyes were also designed.

[0055] The sequences of all primers and probes are shown in Table 1, wherein the upstream and downstream primers for specifically amplifying infectious spleen and kidney necrosis virus are SEQ ID NO. 1 and 2, respectively, and the probe is SEQ ID NO. 3; the upstream and downstream primers for specifically amplifying viral nerve necrosis virus are SEQ ID NO. 4 and 5, respectively, and the probe is SEQ ID NO. 6; the upstream and downstream primers for specifically amplifying Flavobacterium columnare are SEQ ID NO. 7 and 8, respectively, and the probe is SEQ ID NO. 9; the upstream and downstream primers for specifically amplifying rock bream rhabdovirus are SEQ ID NO. 10 and 11, respectively, and the probe is SEQ ID NO. 12; the upstream and downstream primers for specifically amplifying largemouth bass double RNA virus are SEQ ID NO. 13 and 14, respectively, and the probe is SEQ ID NO. 15; the upstream and downstream primers for specifically amplifying Edwardsiella tarda are SEQ ID NO. 16 and 17, respectively, and the probe is SEQ ID NO. 18; the upstream and downstream primers for specifically amplifying Nocardia are SEQ ID NO. 19 and 20, respectively, and the probe is SEQ ID NO. 21; and the upstream and downstream primers for specifically amplifying largemouth bass iridovirus are SEQ ID NO. 22 and 23, respectively, and the probe is SEQ ID NO. 24. All primers and probes were synthesized by Shanghai Shengong Bioengineering Co., Ltd.

[0056] Table 1: Primer and probe sequences

[0057] Name SEQ ID NO. Sequence (5 ’ -3 ’ )]]> ISKNV-F 1 TATTGTCCATGGCATTCC ISKNV-R 2 AAGGGTACACTACAGATTC ISKNV-P 3 6-FAM-TGACCACCAGCCACCACACGG-BHQ1 VNNV-F 4 TGTGTCGCTGGAGTGTTCG VNNV-R 5 GTGTCATGATGGGAGCGG VNNV-P 6 VIC-TGAGCGTTCCATCTCTTGAGACACCTG-BHQ1 F. columnare-F 7 TCTGAACCTAATGCAAGT F. columnare-R 8 AGTATCTGATGGGAAAAAT F. columnare-P 9 CY5-CCATGATTTATTAGCGGTTATGCCTTGTTTAT-BHQ3 MSRV-F 10 GGGCTCATGTGGCACTCTA MSRV-R 11 CTGGATTTGTGGTAATGGAAGG MSRV-P 12 VIC-AGTCCTCCTTCTGTCAGACACTGCCAA-BHQ1 LBBV-F 13 GGAACGGTACGACAGAGAC LBBV-R 14 TGTCCATGTTTAGCGTGTT LBBV-P 15 CY5-CCCGCAACATCTGGTCCGC-BHQ3 E. tarda-F 16 CCCGGACAAATCTTGATAAT E. tarda-R 17 CGCTGTTACCGTCCATATTG E. tarda-P 18 6-FAM-TTCTCACACCTGCCTGAGTCAACGC-BHQ1 N. seriolae-F 19 CTCGCTGGATGATCTGGT N. seriolae-R 20 CTTGATGTCGGTCTCGTA N. seriolae-P 21 VIC-CCGCGTACCACTTCGAGGAG-BHQ1 LMBV-F 22 GCTCTTGAGAATTTTACGCTC LMBV-R 23 TACGCCACCTACGATAAATCTG LMBV-P 24 6-FAM-CGAAGCCTCCGAAGTCTCCGTTGC-BHQ1 IR-Fish-F 25 GAGACCACCTACAACAGCAT IR-Fish-R 26 AGACAGCACAGTGTTGGC IR-Fish-P 27 ROX-ATGAAGTGYGACGTSGACATCCG-BHQ2

[0058] II. Establishment and verification of detection method

[0059] 1. Exploration of optimal reaction system

[0060] Preparation of plasmid standard: The gene sequence including 9 amplified fragments with a length of 4846 bp was synthesized by Shanghai Shengong Bioengineering Co., Ltd. using pUC57 as a cloning vector. The reaction system for PCR amplification was prepared according to the instructions of 5×RobustartRTPremix Multi-UNG (Probe qRT-PCR) reagent. The reaction was performed in a QuantStudio 5 real-time fluorescent quantitative PCR instrument (Thermo Fisher Scientific).

[0061] In order to better detect the 8 pathogens, the 8 pathogens and the internal reference were divided into A, B, and C groups, i.e., detection was simultaneously performed in three reaction tubes to achieve simultaneous detection of the 8 pathogens.

[0062] A, B, C group qPCR primers and each group of probes were added to the same reaction system. Orthogonal experiment was set up with different primer and probe final concentration gradient, i.e. orthogonal experiment was set up with primer and probe concentration of 100 nM, 200 nM, 300 nM, 400 nM, respectively, and pathogen plasmid standard concentration of 1.88 x 10 4 copies / μL to explore the optimal reaction conditions of the multiplex reaction. The reaction system for qPCR amplification of each group was 4 μL 5 x Robustart RT Premix Multi Buffer, 0.4 μL 50 x Fast Direct Part Ampli, 0.4 μL 50 x Fast Direct Part Rtase, 0.4 μL 50 x MgCl2, 2 μL primer probe with different final concentrations diluted with ddH2O, 5 μL template, and ddH2O was added to make the total reaction system 20 μL. The reaction program for qPCR amplification was as follows: fluorescence channel setting was temperature control, and the program setting was 50 °C for 2 min and 95 °C for 3 min; 45 cycles included 95 °C for 10 s and 60 °C for 30 s. The fluorescence channel of the qPCR instrument was set as follows: channel 1: FAM, channel 2: VIC, channel 3: CY5, and channel 4: ROX; and the fluorescence signal was collected by the qPCR instrument at the same time. If the Cq value was greater than 35, it was determined to be negative. The results are shown in Figures 1 to 3 Figures 1-3 The test results of A group, B group and C group in sequence are shown in the following table.

[0063] The final determined primer probe final concentration is shown in Table 2.

[0064] Table 2: Results of optimal reaction system exploration test for multiplex Taqman qPCR detection method

[0065]

[0066] 2. Sensitivity test

[0067] The plasmid standard of 1.88 x 10 3 copies / μL was diluted by 10 times to obtain concentrations of 1.88 x 10 -1 copies / μL, 1.88 x 10 0 copies / μL, 1.88 x 10 1 copies / μL, 1.88 x 10 2 copies / μL, and 1.88 x 10 3 ​copies / μL of five plasmid standards for sensitivity test. The optimal reaction system of Table 2 above was used, and 8 replicates were set for each concentration. The minimum concentration that all 8 replicates could be detected according to the experimental results was taken as the sensitivity of the detection method. The reaction procedure and enzymes used in the reaction of this test were the same as those of "1, Optimal reaction system exploration", and the results are shown in Table 3 and Table 4. Figures 4 to 14 and Table 3.

[0068] Table 3 Sensitivity test results of the multiplex Taqman qPCR detection method for detecting single pathogen

[0069]

[0070]

[0071] Among them, Figures 4 to 7 The detection sensitivity of the four fluorescence channels of Group A in sequence is Figures 8 to 11 The detection sensitivity of the four fluorescence channels of Group B in sequence is Figures 12 to 14 The detection sensitivity of the three fluorescence channels of Group C in sequence is

[0072] From Table 3, each group of targets at 1.88×10 -1 copies / μL plasmid concentration could not be completely detected by 8 replicates, and 1.88×10 0 copies / μL plasmid concentration could be completely detected by 8 replicates, so the sensitivity of the multiplex detection method in this example when detecting single pathogen could reach 1.88×10 0 copies / μL.

[0073] 3, Specificity test

[0074] The multiplex fluorescent quantitative qPCR detection method of "1, Optimal reaction system exploration" was used to simultaneously detect ISKNV, VNNV, F. columnare, MSRV, LBBV, E. tarda, N. seriolae, LMBV, L. saugres, A. hydrophila, A. veronii, Saprolegnia, and Trichodina. All the test materials were provided and preserved by the College of Pharmacy, Shenzhen University of Technology.

[0075] The specific steps are as follows:

[0076] (1) Extract the nucleic acid of the sample to be tested, and reverse transcribe to obtain a cDNA template. The eight pathogens used in this example were provided and preserved by the College of Pharmacy, Shenzhen University of Technology. The nucleic acid extraction used MagaBioplus Virus DNA / RNA Purification Kit III (Hangzhou Bio-Rad, China), and the extraction method included: adding 300 μL of lysis solution, 300 μL of deproteinization rinse solution, 300 μL of washing solution, 25 μL of magnetic beads (the magnetic beads should be mixed thoroughly before use) to the automatic nucleic acid extraction instrument cartridge in turn, and then adding 175 μL of ddH2O to the 25 μL of magnetic beads; grind a little lesion tissue into a homogenate, add to 1000 μL of RNase-free ddH2O, take 200 μL of lesion tissue-containing ddH2O and add to the lysis solution, and use the nucleic acid extraction and purification instrument (Bio-Rad, China) to extract the nucleic acid.

[0077] Reverse transcription was performed in a qPCR instrument, and the qPCR amplification kit had reverse transcription function, the reagent name was 5×Robustart RT Premix Multi-UNG (Probe qRT-PCR) (DG) (009401), and the reverse transcription reaction condition was 50°C, 15 min.

[0078] (2) Use group A, group B, and group C qPCR primers and probes for detection: use the cDNA obtained in (1) as a template, and perform qPCR amplification, and collect the fluorescence signal. The reagent used in this example qPCR amplification was: 5×Robustart RT Premix Multi-UNG (Probe qRT-PCR) (DG) (009401), purchased from Zhuhai Baosheng Biological Technology Co., Ltd., and the item number was FM5234-009401.

[0079] The reaction system of the A group qPCR amplification is 4 μL of 5x Robustart RT Premix Multi Buffer, 0.4 μL of 50x Fast Direct Part Ampli, 0.4 μL of 50x Fast Direct Part Rtase, 0.4 μL of 50x MgCl2, 0.02 μL of ISKNV-F and ISKNV-R primers with an initial concentration of 100 μM, 0.04 μL of VNNV-F and VNNV-R primers with an initial concentration of 100 μM, 0.08 μL of F.columnare-F and F.columnare-R primers with an initial concentration of 100 μM, 0.06 μL of IR-Fish-F and IR-Fish-R primers with an initial concentration of 100 μM, 0.02 μL of ISKNV-P probe with an initial concentration of 100 μM, 0.04 μL of VNNV-P probe with an initial concentration of 100 μM, 0.08 μL of F.columnare-P probe with an initial concentration of 100 μM, 0.06 μL of IR-Fish-P probe with an initial concentration of 100 μM, the volume of the template and ddH2O is 12.8 μL, and the total volume of the system is 20 μL.

[0080] The reaction system of the B group qPCR amplification is 4 μL of 5x Robustart RT Premix Multi Buffer, 0.4 μL of 50x Fast Direct Part Ampli, 0.4 μL of 50x Fast Direct Part Rtase, 0.4 μL of 50x MgCl2, 0.06 μL of MSRV-F and MSRV-R primers with an initial concentration of 100 μM, 0.06 μL of LBBV-F and LBBV-R primers with an initial concentration of 100 μM, 0.08 μL of E.tarda-F and E.tarda-R primers with an initial concentration of 100 μM, 0.08 μL of IR-Fish-F and IR-Fish-R primers with an initial concentration of 100 μM, 0.02 μL of MSRV-P probe with an initial concentration of 100 μM, 0.02 μL of LBBV-P probe with an initial concentration of 100 μM, 0.04 μL of E.tarda-P probe with an initial concentration of 100 μM, 0.04 μL of IR-Fish-P probe with an initial concentration of 100 μM, the volume of the template and ddH2O is 12.8 μL, and the total volume of the system is 20 μL.

[0081] The reaction system for group C qPCR amplification was 4 μL 5×Robustart RT Premix Multi Buffer, 0.4 μL 50×Fast Direct Part Ampli, 0.4 μL 50×Fast Direct Part Rtase, and 0.4 μL... The following components were used: 50×MgCl2, 0.02 μL each of N. seriolae-F and N. seriolae-R primers with an initial concentration of 100 μM, 0.02 μL each of LMBV-F and LMBV-R primers with an initial concentration of 100 μM, 0.02 μL each of IR-Fish-F and IR-Fish-R primers with an initial concentration of 100 μM, 0.02 μL of N. seriolae-P probe with an initial concentration of 100 μM, 0.02 μL of LMBV-P probe with an initial concentration of 100 μM, 0.02 μL of IR-Fish-P probe with an initial concentration of 100 μM, and the combined volume of template and ddH2O was 12.8 μL, for a total system volume of 20 μL.

[0082] The reaction program for qPCR amplification was as follows: the fluorescence channel was set to temperature control, and the program was set to 50℃ for 15 min and 95℃ for 3 min; 45 cycles including 95℃ for 10 s and 60℃ for 30 s; the fluorescence channels of the qPCR instrument were set to: channel 1: FAM, channel 2: VIC, channel 3: CY5, channel 4: ROX; and the fluorescence signal was collected simultaneously using the qPCR instrument.

[0083] Result determination: Based on the fluorescence signal and Cq value collected in step (2), determine whether the sample contains ISKNV, VNNV, F. columnare, MSRV, LBBV, E. tarda, N. seriolae and LMBV. When the Cq value is greater than 35 or the system determines it to be negative, the result is determined to be negative.

[0084] The results are as follows Figures 15 to 17 As shown. Figures 15 to 17 The results are, in order, the specificity test results for groups A, B, and C.

[0085] Depend on Figures 15 to 17 The results showed that only the target pathogen was detected normally, while other pathogens were not detected, indicating that the detection method has good specificity.

[0086] 4. Establishment of the standard curve

[0087] The plasmid standard was serially diluted 10-fold with 1×TE to obtain concentrations of 1.88×10⁻⁶. 3 copies / μL, 1.88×10 4 copies / μL, 1.88×10 5copies / μL, 1.88×10 6 copies / μL, 1.88×10 7 copies / μL, 1.88×10 8 Six copies / μL, totaling six concentrations of recombinant plasmid standards.

[0088] The reaction procedure and enzymes used in this experiment are the same as in "2. Exploration of the Optimal Reaction System", and the primer and probe ratios are the same as in Table 2.

[0089] The fluorescence amplification curves and standard curves of the serially diluted plasmid standards were obtained, and the results are as follows: Figures 18 to 23 As shown.

[0090] Figures 18 to 20 The amplification curves of plasmid standards serially diluted in groups A, B, and C are shown in sequence. Figures 18 to 20 In the middle, the curve from left to right is 1.88 × 10 3 copies / μL up to 1.88×10 8 copies / μL; Figures 21 to 23 Standard curves for dilution of standards from groups A, B, and C in that order. Figures 18 to 23 It can be seen that the standard curve of this detection method has been successfully constructed, thus demonstrating the reliability of the data from this detection method.

[0091] 5. Repeatability test

[0092] The "2. Optimal Reaction System Exploration" multiplex quantitative qPCR method was used to simultaneously detect recombinant plasmids containing conserved sequences of ISKNV, VNNV, F. columnnare, MSRV, LBBV, E. tarda, N. seriolae, and LMBV at a concentration of 1.88 × 10⁻⁶. 7 copies / μL, 1.88×10 5 copies / μL, 1.88×10 3 copies / μL, 1.88×10 1 copies / μL, 1.88×10 0 The assay was performed using copies / μL, with 3 intra-group replicates and 3 inter-group replicates. The CV% (volume percentage) values ​​were then calculated for both intra- and inter-group replicates, and the reproducibility of the method was assessed based on the CV%. The reaction procedure and enzymes used in this experiment were the same as in "2. Exploration of the Optimal Reaction System," and the results are shown in Tables 4 to 8.

[0093] Table 4 uses 1.88 × 10 7 Repeatability test results of plasmids at a concentration of copies / μL

[0094]

[0095]

[0096] Table 5 Reproducibility test results of plasmid at 1.88 x 10 5 copies / μL concentration

[0097]

[0098]

[0099] Table 6 Reproducibility test results of plasmid at 1.88 x 10 3 copies / μL concentration

[0100]

[0101]

[0102] Table 7 Reproducibility test results of plasmid at 1.88 x 10 1 copies / μL concentration

[0103]

[0104] Table 8 Reproducibility test results of plasmid at 1.88 x 10 0 copies / μL concentration

[0105]

[0106]

[0107] The stability of the detection method was determined by comparing the CV% values of the groups and the groups within the detection method for detecting pathogens. According to the results of Tables 4 to 8, the coefficient of variation within the group ranges from 0.03% to 7.14%, and the coefficient of variation between the groups ranges from 0.56% to 6.43%; the results show that the detection method has excellent stability.

[0108] The above is a further detailed description of the present application in combination with specific embodiments, and cannot be recognized as the specific embodiments of the present application only limited to these descriptions. For ordinary skilled in the art to which the present application belongs, several simple deductions or substitutions can be made without departing from the concept of the present application.

Claims

1. A detection reagent for a pathogen of Micropterus salmoides, characterized by: The primers and probes specific to Infectious spleen and kidney necrosis virus, Viral nervous necrosis virus, Columnaris, Striped bass reovirus, Micropterus salmoides double-stranded RNA virus, Edwardsiella tarda, Nocardia and Micropterus salmoides iridovirus; The upper and lower primers specific to Infectious spleen and kidney necrosis virus are respectively represented by SEQ ID NO. 1 and 2, and the probe is represented by SEQ ID NO. 3; The upper and lower primers specific to Viral nervous necrosis virus are respectively represented by SEQ ID NO. 4 and 5, and the probe is represented by SEQ ID NO. 6; The upper and lower primers specific to Columnaris are respectively represented by SEQ ID NO. 7 and 8, and the probe is represented by SEQ ID NO. 9; The upper and lower primers specific to Striped bass reovirus are respectively represented by SEQ ID NO. 10 and 11, and the probe is represented by SEQ ID NO. 12; The upper and lower primers specific to Micropterus salmoides double-stranded RNA virus are respectively represented by SEQ ID NO. 13 and 14, and the probe is represented by SEQ ID NO. 15; The upper and lower primers specific to Edwardsiella tarda are respectively represented by SEQ ID NO. 16 and 17, and the probe is represented by SEQ ID NO. 18; The upper and lower primers specific to Nocardia are respectively represented by SEQ ID NO. 19 and 20, and the probe is represented by SEQ ID NO. 21; The upper and lower primers specific to Micropterus salmoides iridovirus are respectively represented by SEQ ID NO. 22 and 23, and the probe is represented by SEQ ID NO.

24.

2. The detection reagent according to claim 1, characterized by: The primers and probes specific to the internal reference of Osteichthyes are also included; The upper and lower primers specific to the internal reference of Osteichthyes are respectively represented by SEQ ID NO. 25 and 26, and the probe is represented by SEQ ID NO.

27.

3. A kit for detection of a pathogen of largemouth bass, characterized by: The detection reagent of claim 1 or 2 is included.

4. The kit of claim 3, wherein: A positive control is also included.

5. The kit of claim 4, wherein: The positive control is a positive plasmid containing the target fragments amplified by each of the upper and lower primers.

6. The kit according to any one of claims 3 to 5, characterized in that: The reaction reagent of real-time fluorescent quantitative PCR is also included.

7. A method for detecting a pathogen of largemouth bass for non-diagnostic therapeutic purposes, characterized by: The detection reagent of claim 1 or 2, or the kit of any one of claims 3-6 is used to detect the sample to be tested, and the presence or absence of the Micropterus salmoides pathogen in the sample to be tested is determined according to the detection result.

8. The detection method of claim 7, wherein: The primers and probes specific to Infectious spleen and kidney necrosis virus, Viral nervous necrosis virus, Columnaris, Striped bass reovirus, Micropterus salmoides double-stranded RNA virus, Edwardsiella tarda, Nocardia and Micropterus salmoides iridovirus and the internal reference of Osteichthyes are divided into at least two groups, and real-time fluorescent quantitative PCR amplification is performed respectively.

9. The detection method of claim 8, wherein: Real-time fluorescent quantitative PCR amplification is performed according to the following grouping: Group A includes the primers and probes specific to Infectious spleen and kidney necrosis virus, Viral nervous necrosis virus, Columnaris and the internal reference of Osteichthyes; Group B includes the primers and probes specific to Striped bass reovirus, Micropterus salmoides double-stranded RNA virus, Edwardsiella tarda and the internal reference of Osteichthyes; Group C includes primers and probes for Nocardia, bigmouth bass iridovirus, and osteichthyes internal reference.

10. The detection method of claim 9, wherein: The method comprises the following steps, 1) extracting nucleic acid of the sample to be tested, and reverse transcribing to obtain a cDNA template; 2) performing real-time fluorescent quantitative PCR amplification detection on the cDNA template of the sample to be tested by using the primers and probes of groups A, B, and C respectively in three detection tubes, and collecting fluorescent signals; 3) determining whether the sample contains infectious spleen and kidney necrosis virus, viral nerve necrosis virus, columnar flavobacterium, sea bass rhabdovirus, bigmouth bass double RNA virus, Edwardsiella tarda, Nocardia, and bigmouth bass iridovirus according to the fluorescent signals and Cq values collected in step 2); Preferably, the method for determining whether the sample contains bigmouth bass pathogens according to the Cq value specifically comprises: when the Cq value is greater than 35 or the system is determined to be negative, the result is determined to be negative; when the Cq value is less than 35 and each control sample is normal, the result is determined to be positive; Preferably, in the real-time fluorescent quantitative PCR amplification reaction system of group A, the molar concentration ratio of the primers of infectious spleen and kidney necrosis virus, viral nerve necrosis virus, columnar flavobacterium, and osteichthyes internal reference is 0.1:0.2:0.4:0.3 in sequence, and the molar concentration ratio of the probes is 0.1:0.2:0.4:0.3 in sequence; Preferably, in the real-time fluorescent quantitative PCR amplification reaction system of group B, the molar concentration ratio of the primers of sea bass rhabdovirus, bigmouth bass double RNA virus, Edwardsiella tarda, and osteichthyes internal reference is 0.3:0.3:0.4:0.4 in sequence, and the molar concentration ratio of the probes is 0.1:0.1:0.2:0.2 in sequence; Preferably, in the real-time fluorescent quantitative PCR amplification reaction system of group C, the molar concentration ratio of the primers of Nocardia, bigmouth bass iridovirus, and osteichthyes internal reference is 0.1:0.1:0.1:0.1 in sequence, and the molar concentration ratio of the probes is 0.1:0.1:0.1:0.1 in sequence; Preferably, the reaction program of real-time fluorescent quantitative PCR amplification of the method comprises the following steps: setting the fluorescence channel as temperature control, setting the program as 50℃ for 2 min, 95℃ for 3 min, 95℃ for 10 s, and 60℃ for 30 s.

Images