DNA information storage encryption method based on'material-DNA 'synergy

Abstract

The invention discloses a DNA information storage encryption method based on'material-DNA 'synergy, and belongs to the technical field of DNA information storage, and the DNA information storage encryption method comprises the following steps: a user customizes a password book; converting the original digital information of the text to be encrypted into a continuous first binary bit stream; based on the definite optical distinguishable material, calling a user-defined password corresponding to the definite optical distinguishable material from the password book, and converting the user-defined password into a continuous second binary bit stream; expanding the second binary bit stream to be equal to the first binary bit stream in length to form a key bit stream; carrying out gradual specific OR operation on the first binary bit stream and the key bit stream to generate an encrypted bit stream; converting the encrypted bit stream into a DNA base sequence through a predefined mapping rule, and performing chemical synthesis; preparing a carrier-nucleic acid compound from the synthesized DNA sequence and a selected optically distinguishable material through a biochemical method, and completing information storage; and a decryption reading process. According to the method, an encryption key is decoupled from a DNA molecule, the physical attribute of an optical distinguishable material is converted to serve as a key carrier, and then the key carrier is dynamically coupled with a user-defined password book, so that a dual-protection mechanism is constructed, and the overall safety of DNA information storage is improved.

Description

Technical Field

[0001] This invention belongs to the field of DNA information storage technology, specifically relating to a DNA information storage encryption method based on "material-DNA" synergy. Background Technology

[0002] The explosive growth of global data has placed unprecedented demands on the density, energy consumption, and lifespan of information storage technologies. Information storage technology based on deoxyribonucleic acid (DNA) has emerged to address this need. By encoding binary data into base sequences of adenine (A), thymine (T), cytosine (C), and guanine (G), it achieves a paradigm shift in information from "bits" to "bases." Compared to traditional storage media, DNA can theoretically achieve storage densities of hundreds of petabytes per gram and can be stably preserved for thousands of years under dry or low-temperature conditions. Therefore, it shows enormous potential in areas such as ultra-long-term data archiving, backup in extreme environments, and the preservation of cultural heritage.

[0003] However, information security is a core obstacle that must be overcome in order to move DNA information storage from laboratory proof-of-concept to engineered system applications. The security requirements for DNA information storage are a systematic project, not simply data encryption. It requires ensuring confidentiality (preventing unauthorized access), integrity (preventing the original data from being tampered with or damaged by errors in the synthesis, storage, and sequencing processes), and availability (achieving data retrieval and recovery at an acceptable cost).

[0004] In existing technologies, strategies for protecting DNA information mainly rely on chemical or structural modifications to the DNA molecule itself. For example, non-natural nucleic acids are used to replace the natural DNA strand, or DNA origami techniques are used to construct three-dimensional spatial structures to conceal information. However, these methods have significant inherent drawbacks: First, chemical modifications may alter the physicochemical properties of DNA, affecting sequencing compatibility and the chemical stability of DNA during long-term storage; second, constructing complex spatial structures significantly increases the difficulty and cost of DNA synthesis, while also significantly reducing the storage density of effective information, thus weakening the core competitiveness of DNA storage technology.

[0005] A deep analysis of the DNA information storage process reveals that its security design must be aligned with the inherent complexity of the process itself. The process begins by mapping binary data into a quaternary DNA sequence through constrained encoding. This process avoids long homopolymers, controls GC content and secondary structure formation, and incorporates address embedding and error correction redundancy. Subsequently, oligonucleotide pools are chemically synthesized and then preserved long-term via freeze-drying or embedding vectors. During reading, polymerase chain reaction (PCR) and high-throughput sequencing are used to sample and acquire the sequences from the amplified reads. Finally, at the decoding end, the original information is fully recovered through coordinated processing of indexing, content reconstruction, and error correction. Given that DNA information storage is inherently an end-to-end process constrained by biochemical processes and subject to significant noise and high latency, existing technologies typically employ multiple encoding strategies to ensure information reliability. Specifically, to mitigate read / write losses and random errors during synthesis, sequencing, and storage, the system needs to incorporate error correction mechanisms such as fountain codes, Reed-Solomon codes, or low-density parity-check codes (LDPC) and their cascaded frameworks. Furthermore, to support data availability and random access, primer indexing technology is commonly relied upon, supplemented by sequence redundancy and multiple-copy verification to enhance overall recovery capabilities. On top of this, because this process spans both biomolecular manipulation and information encoding processing, its engineering implementation inevitably involves complex security constraints. Besides facing traditional eavesdropping and replay attacks, the process also suffers from issues such as statistical information leakage due to PCR bias, unauthorized amplification caused by exhaustive primer indexing, and interference from sample contamination or secondary amplification.

[0006] Therefore, secure DNA information storage solutions should not employ drastic chemical or structural modifications that could compromise syntheticity and sequenceability. Instead, they should be considered a synergistic attribute throughout the entire process of coding, synthesis, storage, and retrieval. The ideal security strategy is to implement process-friendly "minimum protection" without introducing additional complexity or sacrificing storage density and process versatility. This effectively reduces the specificity and identifiability of stored sequences, thereby preventing the exposure of core data and ensuring that the system can still successfully verify and recover data even in the event of common read / write errors and fragment loss.

[0007] Therefore, the security design of DNA information storage should abandon the traditional approach of adding independent encryption modules after the fact, and instead establish information security as an inherent, collaborative attribute throughout the entire process of encoding, synthesis, storage, and retrieval. Its core concept lies in implementing a process-friendly, minimal protection approach: that is, while strictly adhering to the constraints of DNA synthesizability and sequenceability, reducing the specificity and identifiability of stored sequences through technical means to avoid exposing core data. Accordingly, the system must ensure efficient data verification and recovery even in the face of routine read / write errors and fragment loss. In this regard, at the operational level, a simple version management and decentralized backup strategy should be employed to continuously ensure system availability and traceability. Compared to relying on "masking" methods such as chemical modifications or complex structures, this process-oriented integrated design can maintain the inherent advantages of high-density DNA storage and process universality while systematically coordinating the three major security goals of data confidentiality, integrity, and availability in a verifiable and maintainable manner. Summary of the Invention

[0008] To address the aforementioned deficiencies in existing technologies, the present invention aims to provide a DNA information storage encryption method based on "material-DNA" synergy. This method decouples the encryption key from the DNA molecule and uses the physical properties of an optically discernible material as the key carrier, then dynamically couples it with a user-defined password book, thereby constructing a dual protection mechanism to enhance the overall security of DNA information storage.

[0009] This invention is achieved through the following technical solution: A DNA information storage and encryption method based on "material-DNA" synergy specifically includes the following steps: Encrypted storage process: S1. A user-customized password book, wherein the password book contains the color attributes of optically discernible materials and their corresponding user-customized passwords; S2. Convert the original digital information of the text to be encrypted into a continuous first binary bit stream; S3. Based on the selected optically discernible material, retrieve the corresponding user-defined password from the codebook and convert it into a continuous second binary bit stream; S4. Extend the second binary bitstream to the same length as the first binary bitstream to form a key bitstream; perform a bitwise XOR operation between the first binary bitstream and the key bitstream to generate an encrypted bitstream. S5. Convert the encrypted bit stream into a DNA base sequence using a predefined mapping rule, and then perform chemical synthesis. S6. The synthesized DNA sequence and the selected optically recognizable material are combined using biochemical methods to prepare a carrier-nucleic acid complex, thereby completing information storage; Decryption and reading process: S7. Amplify and sequence the synthesized DNA sequence in the vector-nucleic acid complex to obtain its DNA base sequence; convert the DNA base sequence into a third binary bit stream through the predefined mapping rule; retrieve the user-defined password from the codebook again based on the optically discernible material to generate a decryption key bit stream; perform a bit-by-bit XOR operation between the third binary bit stream and the decryption key bit stream to restore the first binary bit stream; decode the restored first binary bit stream to obtain the original digital information and complete the decryption process.

[0010] Furthermore, in step S1, the optically recognizable material includes gold nanoparticles, carboxylated silica microspheres, or streptavidin-modified magnetic beads, with corresponding color attributes of red, white, and black, respectively.

[0011] Furthermore, when the optically recognizable material is selected as gold nanoparticles, the method for preparing the carrier-nucleic acid complex in step S6 includes: centrifuging and concentrating the gold nanoparticle solution, adding single-stranded DNA containing poly-A, mixing, drying, resuspending, ultrasonically dispersing, centrifuging and washing, and resuspending in buffer solution; When the optically recognizable material is selected as carboxylated silica microspheres, the preparation method in step S6 includes: washing the carboxylated silica microspheres with an activation buffer, adding a solution of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide, and incubating at room temperature; then incubating with primary amine-modified single-stranded DNA in an activation buffer, and finally washing by centrifugation and resuspending in a buffer. When the optically recognizable material is streptavidin-modified magnetic beads, the preparation method in step S6 includes: magnetically separating the streptavidin-modified magnetic beads and washing them with a washing buffer, then incubating them with biotinylated single-stranded DNA in a washing buffer, and finally magnetically separating and washing them and resuspending them in a buffer.

[0012] Furthermore, in steps S2 and S7, the rule for converting the user-defined password into a binary bit stream is the ASCII encoding rule, which maps the user-defined password into a fixed 8-bit binary representation and concatenates them in sequence.

[0013] Furthermore, in step S4, a cyclic redundancy expansion mechanism is used to expand the second binary bit stream to the same length as the first binary bit stream.

[0014] Furthermore, in steps S5 and S7, the predefined mapping rule is as follows: binary value 00 is mapped to base A, 01 is mapped to T, 10 is mapped to C, and 11 is mapped to G.

[0015] Furthermore, in step S7, the amplification is performed using polymerase chain reaction (PCR).

[0016] Compared with the prior art, the advantages of the present invention are as follows: This invention presents a DNA information storage encryption method based on "material-DNA" synergy. By cryptographically coupling DNA sequences with optically recognizable materials under the control of a codebook, it achieves dynamic encryption driven by the physical carrier. This overcomes the limitations of traditional encryption schemes in terms of security, stability, and cost-effectiveness without altering the natural structure of the DNA molecule. Its core innovation lies in integrating a user-defined codebook, material-visualized key guidance, and an XOR algorithm—a triple mechanism—to construct a DNA information storage encryption system with strong anti-interference capabilities and high decryption efficiency, significantly enhancing system security. This solution not only ensures high stability and low implementation cost for the DNA information storage encryption system but also, through the reversibility and universality of XOR operations, is compatible with multiple types of DNA information architectures and encoding rules, providing a scalable solution for the secure storage of high-value data. Attached Figure Description

[0018] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.

[0019] Figure 1 This is a schematic diagram of the encryption storage process of a DNA information storage encryption method based on "material-DNA" synergy according to the present invention; Figure 2 This is a schematic diagram of the decryption and reading process of a DNA information storage and encryption method based on "material-DNA" synergy according to the present invention; Figure 3 This is a schematic diagram of agarose gel electrophoresis analysis of the products after specific amplification of the synthesized DNA sequences in three vector-nucleic acid complexes by PCR. The lanes from left to right represent: M: nucleic acid molecular weight standard; 1: gold nanoparticle-nucleic acid complex specific amplification product; 2: carboxylated silica microsphere-nucleic acid complex specific amplification product; 3: streptavidinized magnetic bead-nucleic acid complex specific amplification product.

[0020] Figure 4This diagram illustrates the decryption process when the sequencing results of the target product, which is specifically amplified by PCR and encodes "Jilin University" using a carboxylated silica microsphere-nucleic acid complex, are used as program input; it includes two decryption scenarios: using the correct key and using the wrong key.

[0021] Figure 5 The diagram shows the agarose gel electrophoresis analysis of the products of three vector-nucleic acid complexes encoding "Jilin University" after being soaked in 1 M HCl for 0, 20, 40 and 60 min respectively, and the target nucleic acid templates after PCR-specific amplification. Among them, A is a gold nanoparticle-nucleic acid complex, B is a carboxylated silica microsphere-nucleic acid complex, and C is a streptavidinized magnetic bead-nucleic acid complex. From left to right, the lanes represent: M: Nucleic acid molecular weight standard; 1: Free DNA group incubated for 0 min; 2: Free DNA group incubated for 20 min; 3: Free DNA group incubated for 40 min; 4: Free DNA group incubated for 60 min; 5: Vector-nucleic acid complex group incubated for 0 min; 6: Vector-nucleic acid complex group incubated for 20 min; 7: Vector-nucleic acid complex group incubated for 40 min; 8: Vector-nucleic acid complex group incubated for 60 min. Figure 6 The diagram shows the agarose gel electrophoresis analysis of the products of three vector-nucleic acid complexes encoding "Jilin University" after being soaked in 1 M NaOH for 0, 20, 40 and 60 min respectively, and the target nucleic acid templates after PCR-specific amplification. Among them, A is a gold nanoparticle-nucleic acid complex, B is a carboxylated silica microsphere-nucleic acid complex, and C is a streptavidinized magnetic bead-nucleic acid complex. From left to right, the lanes represent: M: nucleic acid molecular weight standard; 1: free DNA group incubated for 0 min; 2: free DNA group incubated for 20 min; 3: free DNA group incubated for 40 min; 4: free DNA group incubated for 60 min; 5: vector-nucleic acid complex group incubated for 0 min; 6: vector-nucleic acid complex group incubated for 20 min; 7: vector-nucleic acid complex group incubated for 40 min; 8: vector-nucleic acid complex group incubated for 60 min. Detailed Implementation

[0023] The embodiments given below are further illustrations of the present invention to enable those skilled in the art to more fully understand the invention. However, the given embodiments should not be construed as limiting the scope of protection of the present invention. Therefore, non-essential improvements and adjustments made by those skilled in the art based on the above-described invention should also fall within the scope of protection of the present invention.

[0024] Example 1 This embodiment provides a DNA information storage encryption method based on "material-DNA" synergy, which specifically includes the following steps: Encrypted storage process: S1. A user-customized password book, wherein the password book contains the color attributes of optically discernible materials and their corresponding user-customized passwords; Each user creates their own unique user-defined password book, which contains the color attributes of the optically identifiable materials used (e.g., gold nanoparticles correspond to red; carboxylated silica microspheres correspond to white; streptavidin-modified magnetic beads correspond to black) and the user-defined password corresponding to the color attribute of each material. S2. Convert the original digital information of the text to be encrypted into a continuous first binary bit stream; Input the text to be encrypted, read the text content in text mode to obtain the original string data; then, according to the ASCII encoding rules, map each character in the original string data to the corresponding byte sequence; convert each byte into a fixed 8-bit binary representation, and concatenate them strictly according to the original character order to generate a continuous first binary bit stream; S3. Based on the selected optically discernible material, retrieve the corresponding user-defined password from the codebook and convert it into a continuous second binary bit stream; After selecting the target optically recognizable material, the corresponding password string is retrieved from the pre-stored password book; based on the ASCII encoding rules, each character in the password string is mapped to the corresponding byte sequence; each byte is converted into a fixed 8-bit binary representation and concatenated strictly according to the original character order to generate a continuous second binary bit stream; S4. Extend the second binary bitstream to the same length as the first binary bitstream to form a key bitstream; perform a bitwise XOR operation between the first binary bitstream and the key bitstream to generate an encrypted bitstream. The second binary bitstream corresponding to the password is extended to the first binary bitstream of the file to be encrypted using a cyclic redundancy expansion mechanism to form a key bitstream. Based on the principle of symmetric encryption, the extended key bitstream is XORed bit by bit with the key bitstream to generate an encrypted bitstream. This operation satisfies the reversibility identity XOR(XOR(A,B),B)=A. During decryption, the same key bitstream is used to perform the XOR operation again to restore the original file bitstream without loss.

[0025] S5. Convert the encrypted bit stream into a DNA base sequence using a predefined mapping rule, and then perform chemical synthesis. The encrypted bitstream is divided into groups of two bits each, and converted into DNA base sequences using predefined mapping rules to achieve a biological encoding representation of the data. The predefined mapping rule is as follows: binary value 00 is mapped to base A, 01 is mapped to T, 10 is mapped to C, and 11 is mapped to G.

[0026] S6. The synthesized DNA sequence and the selected optically recognizable material are combined using biochemical methods to prepare a carrier-nucleic acid complex, thereby completing information storage; After the target DNA sequence is chemically synthesized by a commissioned company, it is incubated with the selected optically recognizable material to prepare a carrier-nucleic acid complex for carrying biological coding information.

[0027] This section lists the preparation methods for gold nanoparticle-nucleic acid complexes, carboxylated silica microsphere-nucleic acid complexes, and streptavidin-modified magnetic beads-nucleic acid complexes. The steps are as follows: (1) Preparation of gold nanoparticle-nucleic acid complex Take 1000 μL of gold nanoparticle (AuNPs) solution (10 nM), centrifuge at 13000 rpm for 15 min, discard 990 μL of supernatant, and concentrate the AuNPs 100-fold (final AuNPs concentration 1 μM). Add 2 μL of 100 μM poly-A single-stranded DNA molecules (ssDNA). Evaporate the resulting mixture to dryness in a 90 °C metal bath, and immediately remove it after drying (drying time approximately 12 min). Redissolve the precipitate in 1000 μL of distilled water. Briefly sonicate the sample to improve its dispersion in water. Then, wash the AuNPs three times by centrifugation to remove excess ssDNA. Finally, resuspend the precipitate in 100 μL of TE buffer (pH 7.4) for short-term storage.

[0028] (2) Preparation of carboxylated silica microspheres-nucleic acid complex 100 μL of carboxylated silica microspheres (25 mg / mL) were transferred to a 1.5 mL EP tube and incubated at 8000 °C.g Centrifuge at 8000 rpm for 5 min, discard the supernatant, then wash the carboxyl silica microspheres with 1 mL of activation buffer (sodium acetate solution, 10 mM, pH 5.4), and centrifuge at 8000 rpm. g Centrifuge for 5 min. Carefully discard the supernatant, resuspend the particles in 100 μL of the above activation buffer, and vortex for 10 min. Then, add 50 μL of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) solution (100 mg / mL) and 50 μL of N-hydroxysuccinimide (NHS) solution (50 mg / mL), mix well, and incubate at room temperature for 30 min. After incubation, re-incubate the sample at 8000 °C. g Centrifuge at 1000 rpm for 5 min, and wash the particles twice with activation buffer. After activation of the carboxylated silica microspheres, add 2 μL of 100 μM ssDNA modified with primary amine groups, add 100 μL of activation buffer, and incubate slowly at room temperature with tilting rotation for 30 min. After incubation, incubate the sample again at 8000 rpm. g Centrifuge at 10000 μL for 5 min and wash the particles twice with TE buffer. Finally, resuspend the precipitate in 100 μL LTE buffer (pH 7.4) for short-term storage.

[0029] (3) Preparation of streptavidin-modified magnetic beads-nucleic acid complex Transfer 100 μL of streptavidin-modified magnetic beads (10 mg / mL) to a 1.5 mL EP tube, place it on a magnetic rack, and discard the supernatant using a magnetic separation strategy. Add 1 mL of Wash Buffer I (10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, 0.1% Tween-20, pH 7.5) and wash the magnetic beads thoroughly. Repeat the washing step once. Add 2 μL of 100 μM biotinylated ssDNA and dilute with 500 μL of Wash Buffer I (to a magnetic bead concentration of 2 mg / mL), vortex thoroughly to resuspend, and incubate at room temperature for 30 min on a rotary mixer. After incubation, discard the supernatant using magnetic separation, add 1 mL of Wash Buffer I, and wash the magnetic beads thoroughly. Repeat the washing step once to remove excess ssDNA. Finally, resuspend the precipitate in 100 μL of LTE buffer (pH 7.4) for short-term storage.

[0030] Decryption and reading process: S7. Amplify and sequence the synthesized DNA sequence in the vector-nucleic acid complex to obtain its DNA base sequence; convert the DNA base sequence into a third binary bit stream through the predefined mapping rule; retrieve the user-defined password from the codebook again based on the optically discernible material to generate a decryption key bit stream; perform a bit-by-bit XOR operation between the third binary bit stream and the decryption key bit stream to restore the first binary bit stream; decode the restored first binary bit stream to obtain the original digital information and complete the decryption process.

[0031] Specifically, the target nucleic acid template in the vector-nucleic acid complex is specifically amplified using polymerase chain reaction (PCR) to obtain a high copy number DNA fragment. Then, the base sequence of the amplified product is analyzed using Sanger sequencing technology to read the biological coding information carried by the vector. The input DNA base sequence is converted into a corresponding binary bitstream according to predefined binary encoding rules (00→A, 01→T, 10→C, 11→G). Based on the user-provided codebook and the materials selected during encryption, the program automatically extracts the decryption key and generates a key binary bitstream using ASCII encoding rules. The binary bitstream of the DNA sequence and the key binary bitstream are then XORed bitwise, and the result is the binary bitstream of the original file. Finally, this binary bitstream is decoded according to ASCII encoding rules, converting it into the target text and completing the decryption process.

[0032] Example 2 like Figure 1 As shown, this embodiment provides a DNA information storage encryption method based on "material-DNA" synergy, wherein the encryption storage process specifically includes the following steps: Step 1: Receive the path of the file to be encrypted as input parameter, open the target file in binary reading mode, read the original string contained in the file, convert each character read into 8 bits, concatenate all the binary bits into a complete binary bit stream, and output the binary bit stream. Step Two: Identify and convert the specified entry password from the codebook. Extract the corresponding password from the codebook file by matching the entry name with the specified carrier color. If not found, trigger an exception message. Perform binary conversion on the extracted password, converting each character into 8 bits and concatenating them. To meet the target length requirement, perform an expansion operation on the binary password sequence. Length matching is achieved by repeatedly concatenating the basic sequence and then truncating it, ensuring that it can adapt to the length requirements of subsequent encryption processes, thus providing compliant key material for the encryption process. Step 3: Perform an XOR operation on the input file binary bitstream and the password binary bitstream. An encrypted intermediate bitstream is generated through bit-by-bit XOR processing. The length of the encrypted intermediate bitstream generated by the XOR operation is then adjusted for alignment; if the bitstream length is odd, zeros are padded at the end to ensure an even length. The aligned binary bitstream undergoes DNA conversion, using predefined binary encoding rules (00→A, 01→T, 10→C, 11→G) to convert the binary information into a DNA sequence.

[0033] Example 3 like Figure 2 As shown, this embodiment provides a DNA information storage encryption method based on "material-DNA" synergy, wherein the decryption and reading process specifically includes the following steps: Step 1: Verify the input and convert the file to binary data. Verify the completeness of input parameters such as the path to the file to be decrypted, the path to the password book file, the entry name, and the output file path. If all parameters are complete, read the content of the file to be decrypted. Read the file in text mode, check the file content, and complete the binary conversion. Missing parameters, file reading failure, or misclassification of file type will all cause the process to be interrupted. Step 2: Obtain and process the decryption key. Extract the corresponding password from the entry name in the codebook. Convert the password to binary according to ASCII encoding rules, and then expand it to the same length as the file's binary bitstream through repeated concatenation and truncation. Failure to find an entry, a non-existent codebook, or abnormal key processing will affect the decryption validity. Step 3: Perform decryption and save the result. Perform a bitwise XOR operation on the file's binary bitstream and the extended password's binary bitstream. After padding the result with zeros to make it a multiple of 8, convert the binary bitstream into a byte sequence according to ASCII encoding rules, and finally write it to the output file. Error messages will be triggered if the operation fails, the format conversion is incorrect, or the saving fails. If successful, the decryption is complete.

[0034] Example 4 Specific amplification of target nucleic acid templates in three vector-nucleic acid complexes was performed by PCR as follows: A PCR amplification reaction buffer system was prepared, including 1 μM forward primer F (5'-GCAGGCTCTTGCTCCATTGC-3'), nucleotide sequence as shown in SEQ ID No. 1; 1 μM reverse primer R (5'-GCCAGCTGGTGGACGTATTC-3'), nucleotide sequence as shown in SEQ ID No. 2; 2.5 mM dNTPs; 5× Q5 reaction buffer; 0.01 U Q5 high-fidelity DNA polymerase (NEB); and a vector-nucleic acid complex containing 300 ng of DNA template. The reaction system was brought to a final volume of 50 μL with deionized water, and the amplification reaction was performed under a pre-set PCR cycling program. The PCR cycling program was 95... o C, 5 min; 95 o C, 30 seconds, 55 o C, 30 seconds, 72 o C. 30 seconds, repeat 25 times; 72 o C. 10 min. After the amplification reaction is complete, add commercial DNA loading buffer to stop the reaction, mix well by pipetting, and load onto a 2% agarose gel for electrophoresis analysis. The electrophoresis conditions are 120 V for 25 min. The results are then observed in a gel imaging system. Figure 3 As shown, all three vector-nucleic acid complexes can specifically amplify the target nucleic acid template via PCR, resulting in single bands without non-specific band contamination.

[0035] Example 5 This embodiment uses the plaintext "Jilin University" as the original text information to demonstrate the reading and decryption process of the carboxylated silica microsphere-nucleic acid complex. Following the rules of Example 2, the original text information "Jilin University" was converted into a 104 bp DNA sequence (GCAGGCTCTTGCTCCATTGCTGCGTTCGTTGGAACAAAGATAAGTCTATTGATTCCATTGAATGATATTAACTTCGTATGATCAGAATACGTCCACCAGCTGGC), with the nucleotide sequence shown in SEQ ID No. 3. This sequence includes two primer sequences: F1: GCAGGCTCTTGCTCCATTGC and R1: GAATACGTCCACCAGCTGGC. The encoded sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd., and then covalently coupled with carboxylated silica microspheres to obtain the carboxylated silica microsphere-nucleic acid complex. The carboxylated silica microsphere-nucleic acid complex was amplified by PCR according to Example 4, and the resulting product was sent to Jilin Kumei Biotechnology Co., Ltd. for sequencing. Then, decryption was performed according to Example 3, inputting the 6-digit key "123abc" matching the vector index and the key "456abc" corresponding to the simulated incorrect vector information. The results are as follows... Figure 4 As shown, Figure 4 The upper half displays a portion of the sequencing results of the amplified product, while the lower half shows the decoding process of restoring the original text information by XORing the ciphertext binary bitstream and the key binary bitstream. Both sides use the same ciphertext binary bitstream. On the left, because the key is correct, the decryption key binary bitstream matches the encryption key binary bitstream, and XORing the ciphertext binary bitstream with the key binary bitstream yields the correct original text information "Jilin University". On the right, under the condition of incorrect key information, the decryption key binary bitstream does not match the encryption key binary bitstream, and XORing the ciphertext binary bitstream with the decryption key binary bitstream only outputs garbled text "Lcfin Sdcveruc~y". Bit fragments such as 00110001 (corresponding to the character "1" under ASCII encoding rules) and 01100011 (corresponding to the character "c" under ASCII encoding rules) visually demonstrate the "bit → character" mapping link.

[0036] from Figure 4As can be seen, decrypting the correct original text information depends on whether the ciphertext binary bitstream is correct and whether the decryption key binary bitstream is the same as the encryption key binary bitstream used during encryption. The principle lies in the two-layer collaboration of the algorithm and experiment. The symmetry and bit-level sensitivity of the XOR algorithm determine that when an incorrect key is used, the restored original information will be incorrectly displayed as approximately random gibberish. Simultaneously, the high specificity of the primers ensures that only the DNA sequence synthesized according to the target sequence can be effectively amplified and sequenced, thus obtaining the correct ciphertext binary bitstream. This result demonstrates the complete process of reading and decrypting the carboxylated silica microsphere-nucleic acid complex, and also verifies the method's effective encryption protection of stored information and its effective resistance to unauthorized access by comparing "correct key yields plaintext, incorrect key yields gibberish."

[0037] Example 6 Free DNA was incubated with three different vector-nucleic acid complexes in 1 M HCl for 0, 20, 40, and 60 min, respectively. At each time point, 20 μL of the incubator was taken, and an equal volume of 1 M NaOH was added to terminate the reaction. Subsequently, PCR amplification was performed as described in Example 4, and the results were detected by agarose gel electrophoresis. Figure 5 As shown in the figure, in three agarose gels (A: gold nanoparticle-nucleic acid complex, B: carboxylated silica microsphere-nucleic acid complex, C: streptavidin magnetic beads-nucleic acid complex), the leftmost lane represents the molecular weight standard (M), lanes 1-4 represent the PCR products of free DNA after incubation in 1 M HCl for 0, 20, 40, and 60 min, and lanes 5-8 represent the PCR products of each vector-nucleic acid complex under the same acid treatment time. The agarose gel electrophoresis results show that free DNA only showed a clear single band at 0 min, and the band became significantly fainter and gradually disappeared from 20 min onwards, proving that the strong acid had severely damaged the synthesized DNA sequence, making it difficult to amplify effectively. In contrast, the three vector-nucleic acid complexes all showed strong and uniform single bands at the same position at 0, 20, 40, and 60 min, with minimal band intensity decay over time, indicating that the synthesized DNA sequence remained intact after acid treatment and could be efficiently amplified.

[0038] The above phenomena demonstrate that, compared to free DNA, the three carrier-nucleic acid complexes exhibit significant resistance to acidic chemical damage: even under harsh conditions of 1 M HCl treatment for 60 min, the synthesized DNA sequence can still be well preserved, thus ensuring efficient amplification via PCR. The principle is that free DNA is prone to depurination / depyrimidine and phosphodiester bond breakage in strong acids; however, when DNA is immobilized on the carrier surface, the dense surface layer and steric hindrance provide a certain "shielding" to the phosphate backbone, reducing the probability of proton attack on bases and phosphodiester bonds, thereby achieving chemical stabilization. This result not only verifies the protective effect of the carrier on nucleic acids but also shows that the storage medium of this invention can still be reliably read by PCR after acidic stress, providing necessary stability guarantees for subsequent information decoding and secure storage.

[0039] Example 7 Free DNA was incubated with three vector-nucleic acid complexes in 1 M NaOH for 0, 20, 40, and 60 min, respectively. At each time point, 20 μL samples were taken, and an equal volume of 1 M HCl was added to terminate the reaction. Subsequently, PCR amplification was performed as in Example 4, and the results were detected by agarose gel electrophoresis. The results are as follows: Figure 6 As shown in the figure, in three agarose gels (A: gold nanoparticle-nucleic acid complex, B: carboxylated silica microsphere-nucleic acid complex, C: streptavidin magnetic beads-nucleic acid complex), the leftmost lane represents the molecular weight standard (M), lanes 1-4 represent the PCR products of free DNA after incubation in 1 M NaOH for 0, 20, 40, and 60 min, and lanes 5-8 represent the products of each vector-nucleic acid complex under the same alkali treatment time. The agarose gel electrophoresis results show that free DNA only showed a clear single band at 0 min, and the band became significantly fainter and gradually disappeared from 20 min onwards, proving that the strong alkali had damaged the synthesized DNA sequence, making it difficult to amplify effectively. In contrast, the three vector-nucleic acid complexes all showed strong and uniform single bands at the same position at 0, 20, 40, and 60 min, and the band intensity did not decrease significantly over time, indicating that the synthesized DNA sequence remained intact after alkali treatment and could be efficiently amplified.

[0040] The above phenomena demonstrate that, compared to free DNA, the three types of carrier-nucleic acid complexes exhibit significant resistance to alkaline chemical damage: even under the harsh conditions of 1 M NaOH treatment for 60 min, the synthesized DNA sequence can still be well preserved, thus ensuring efficient amplification via PCR. The principle is that a strongly alkaline environment deprotonates DNA bases and causes the breakage of interstrand hydrogen bonds, which can subsequently lead to the breakage of phosphodiester bonds, thereby destroying the synthesized DNA sequence and making it difficult to amplify free DNA. However, when DNA is immobilized on the carrier surface, the dense surface layer and steric hindrance form a "shield" against the phosphate backbone, reducing the effective attack of hydroxide ions on bases and phosphodiester bonds, thus achieving chemical stabilization of the synthesized DNA sequence. This result not only verifies the alkaline stabilization effect of the carrier on nucleic acids but also shows that the storage medium of this invention can still be reliably read by PCR after alkaline stress, providing necessary stability guarantees for subsequent information decoding and secure storage.

[0041] The preferred embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0042] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable way without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0043] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. A DNA information storage and encryption method based on "material-DNA" synergy, characterized in that, Specifically, the steps include the following: Encrypted storage process: S1. A user-customized password book, wherein the password book contains the color attributes of optically discernible materials and their corresponding user-customized passwords; S2. Convert the original digital information of the text to be encrypted into a continuous first binary bit stream; S3. Based on the selected optically discernible material, retrieve the corresponding user-defined password from the codebook and convert it into a continuous second binary bit stream; S4. Extend the second binary bitstream to the same length as the first binary bitstream to form a key bitstream; perform a bitwise XOR operation between the first binary bitstream and the key bitstream to generate an encrypted bitstream. S5. Convert the encrypted bit stream into a DNA base sequence using a predefined mapping rule, and then perform chemical synthesis. S6. The synthesized DNA sequence and the selected optically recognizable material are combined using biochemical methods to prepare a carrier-nucleic acid complex, thereby completing information storage; Decryption and reading process: S7. Amplify and sequence the synthesized DNA sequence in the vector-nucleic acid complex to obtain its DNA base sequence; convert the DNA base sequence into a third binary bit stream in reverse using the predefined mapping rule; retrieve the user-defined password from the codebook again based on the optically recognizable material to generate a decryption key bit stream; perform a bit-by-bit XOR operation between the third binary bit stream and the decryption key bit stream to restore the first binary bit stream; The restored first binary bitstream is decoded to obtain the original digital information, thus completing the decryption process.

2. The DNA information storage and encryption method based on "material-DNA" synergy as described in claim 1, characterized in that, In step S1, the optically recognizable material includes gold nanoparticles, carboxylated silica microspheres, or streptavidin-modified magnetic beads, with corresponding color attributes of red, white, and black, respectively.

3. The DNA information storage and encryption method based on "material-DNA" synergy as described in claim 1, characterized in that, When the optically recognizable material is selected as gold nanoparticles, the method for preparing the carrier-nucleic acid complex in step S6 includes: centrifuging and concentrating the gold nanoparticle solution, adding single-stranded DNA containing poly-A, mixing, drying, resuspending, ultrasonically dispersing, centrifuging and washing, and resuspending in buffer solution; When the optically recognizable material is selected as carboxylated silica microspheres, the preparation method in step S6 includes: washing the carboxylated silica microspheres with an activation buffer, adding a solution of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide, and incubating at room temperature; then incubating with primary amine-modified single-stranded DNA in an activation buffer, and finally washing by centrifugation and resuspending in a buffer. When the optically recognizable material is streptavidin-modified magnetic beads, the preparation method in step S6 includes: magnetically separating the streptavidin-modified magnetic beads and washing them with a washing buffer, then incubating them with biotinylated single-stranded DNA in a washing buffer, and finally magnetically separating and washing them and resuspending them in a buffer.

4. The DNA information storage and encryption method based on "material-DNA" synergy as described in claim 1, characterized in that, In steps S2 and S7, the rule for converting the user-defined password into a binary bit stream is the ASCII encoding rule, which maps the user-defined password into a fixed 8-bit binary representation and concatenates them in sequence.

5. The DNA information storage and encryption method based on "material-DNA" synergy as described in claim 1, characterized in that, In step S4, a cyclic redundancy expansion mechanism is used to expand the second binary bit stream to the same length as the first binary bit stream.

6. The DNA information storage and encryption method based on "material-DNA" synergy as described in claim 1, characterized in that, In steps S5 and S7, the predefined mapping rule is as follows: binary value 00 is mapped to base A, 01 is mapped to T, 10 is mapped to C, and 11 is mapped to G.

7. The DNA information storage and encryption method based on "material-DNA" synergy as described in claim 1, characterized in that, In step S7, the amplification is performed using a polymerase chain reaction.

Images