Tobacco plants with reduced levels of nicotine alkaloids

Abstract

The present disclosure provides compositions and methods related to tobacco plants. In particular, the present disclosure provides novel methods for producing tobacco plants and any related tobacco product having low nicotine alkaloid content. The tobacco plants produced according to the methods of the present disclosure exhibit reduced levels of nicotine alkaloids (e.g., nicotine) as compared to naturally occurring and transgenic tobacco plants, and thus represent commercially valuable substitutes for currently available tobacco varieties.

Description

[0001] Cross-references to related applications

[0002] This application claims priority and benefit to U.S. Provisional Patent Application No. 63 / 508,735, filed June 16, 2023, which is incorporated herein by reference in its entirety for all purposes.

[0003] Materials submitted electronically are incorporated by reference. The computer-readable nucleotide / amino acid sequence listing submitted concurrently with this document is incorporated herein by reference in its entirety, and is identified as a 4,741-byte byte ASCII (text) file named “NCSU-42104-601” created on June 12, 2024. Technical Field

[0004] This disclosure provides compositions and methods related to tobacco plants. Specifically, this disclosure provides novel methods for producing tobacco plants and any related tobacco products with low nicotine alkaloid content. Compared to naturally occurring and genetically modified tobacco plants, tobacco plants produced according to the methods of this disclosure exhibit reduced levels of nicotine alkaloids (e.g., nicotine) and thus represent a commercially viable alternative to currently available tobacco varieties. Background Technology

[0005] Nicotine is usually found in tobacco (common tobacco). Nicotiana tabacum L. is the most abundant pyridine alkaloid produced by *L.*, although nornicotine (its demethylation metabolite) can be dominant in some plants due to increased activity of genes encoding nicotine demethylases. Because nicotine contributes to the addictive nature of combustible cigarettes, some public health organizations have suggested studies that may mandate reductions in nicotine levels in combustible cigarettes to reduce human exposure to tobacco smoke-related toxins (US Food and Drug Administration, 2018). The World Health Organization (WHO) recommends reducing nicotine levels in cigarette tobacco fillers to 0.4 mg / g. -1 Or below the non-addictive level (WHO, 2015). The US Food and Drug Administration's Center for Tobacco Products recommends that exposure to smoke from combustible cigarettes containing 0.2–0.7 mg of tobacco filler per cigarette may be associated with a reduced likelihood of addiction (US FDA, 2018). Historically, it has been difficult to develop tobacco varieties that routinely exhibit such ultra-low levels of nicotine accumulation in leaves. Therefore, there is a need for genetic approaches that can be used to develop new tobacco cultivars with nicotine accumulation below the proposed tolerance levels. Summary of the Invention

[0006] Embodiments of this disclosure include tobacco cultivars or any part thereof, said tobacco cultivars or any part thereof containing a reduced level of at least one nicotinic alkaloid compared to the corresponding naturally occurring tobacco plant or part thereof.

[0007] In some implementation schemes, the cultivar is non-GMO.

[0008] In some implementations, at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, anatabine, and anabasine.

[0009] In some embodiments, at least one nicotinic alkaloid is nicotine, and the cultivar contains no more than 0.29% nicotine. In some embodiments, at least one nicotinic alkaloid is nornicotine, and the cultivar contains no more than 0.02% nornicotine. In some embodiments, nornicotine is undetectable in the cultivar. In some embodiments, at least one nicotinic alkaloid is neonicotine, and the cultivar contains no more than 0.01% neonicotine. In some embodiments, neonicotine is undetectable in the cultivar. In some embodiments, at least one nicotinic alkaloid is equisetine, and the cultivar contains no more than 0.002% equisetine. In some embodiments, equisetine is undetectable in the cultivar.

[0010] In some embodiments, at least one nicotinic alkaloid is nicotine and nornicotine, and wherein the cultivar contains no more than 0.29% nicotine and no more than 0.02% nornicotine.

[0011] In some implementations, cultivated varieties include wild types. NIC1 Compared to having reduced expression and / or function nic1 Alleles. In some implementations, cultivars contain alleles related to the wild type. NIC2 Compared to having reduced expression and / or function nic2 Alleles. In some implementation schemes, nic1 Alleles and / or nic2 The alleles are derived from at least one of the following tobacco varieties or lines: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD 609, Lonibow, Vector 21-41, LA Burley 21, LI Burley 21, and HI Burley 21.

[0012] In some implementations, cultivated varieties include wild types. MYC2a Compared to having reduced expression and / or function myc2aAlleles. In some implementation schemes, myc2a Alleles relative to the wild type listed in SEQ ID NO: 1 MYC2a The allele contains at least one nucleotide deletion. In some implementations, myc2a Alleles relative to the wild type listed in SEQ ID NO: 1 MYC2a Alleles consist of deletions of one to five nucleotides. In some implementations, myc2a Alleles relative to the wild type listed in SEQ ID NO: 1 MYC2a The allele contains a five-nucleotide deletion. In some embodiments, this deletion produces a truncated MYC2A protein. In some embodiments, myc2a The allele contains at least 70% of the same nucleic acid sequence as SEQ ID NO: 2. In some implementations, myc2a The allele contains at least 80% of the same nucleic acid sequence as SEQ ID NO: 2. In some implementations, myc2a The allele contains at least 90% identical nucleic acid sequence to SEQ ID NO: 2. In some implementations, myc2a Alleles derived from common tobacco ( N. tabacum ).

[0013] In some implementations, the cultivar further includes inhibition of the expression of at least one of the following within the cultivar: BBL (also known as) NBB1 ), A622 Quinolinate phosphoribosyltransferase ( QPT ), putrescine N- Methyltransferase ( PMT Ornithine decarboxylase ( ODC ), aspartate oxidase ( AO ), quinolinate synthase ( QS ), N -Methyl putrescine oxidase ( MPO ), NtERF221 , NtMYC1a , NtMYC1b or NtMYC2b .

[0014] In some implementations, the cultivar is the NCLA161 cultivar, or a cultivar derived from it.

[0015] The embodiments disclosed herein also include progeny plants, seeds, or cells derived from any of the tobacco cultivars described herein.

[0016] Embodiments of this disclosure also include tobacco products derived from any tobacco cultivar or portion thereof described herein. In some embodiments, the products are selected from the group consisting of tobacco leaves, shredded tobacco, raw-cut tobacco, tobacco dust, tobacco powder, tobacco extract, smokeless tobacco, wet or dry snuff, mouthwash, pipe tobacco, cigar tobacco, cigarette tobacco, cigarette tobacco, and chewing tobacco. In some embodiments, the products are selected from the group consisting of cigarettes, cigarettes, clove cigarettes, filtered cigarettes, make-your-own cigarettes, roll-your-own cigarettes, sticks or pods of heated tobacco products, cigars, tobacco-containing chewing gum, tobacco-containing lozenges, and chewing tobacco.

[0017] Embodiments of this disclosure also include a method for producing tobacco cultivars containing at least one nicotinic alkaloid at a reduced level compared to a corresponding naturally occurring tobacco plant or a portion thereof. According to these embodiments, the method includes crossing a first tobacco variety containing a first low-nicotinic trait with a second tobacco variety containing a second low-nicotinic trait to produce offspring plants. In some embodiments, the offspring plants contain at least one nicotinic alkaloid at a reduced concentration compared to either parent.

[0018] In some implementations, the method includes backcrossing.

[0019] In some embodiments of the method, at least one nicotinic alkaloid is nicotine, and the cultivated variety contains no more than 0.29% nicotine. In some embodiments of the method, at least one nicotinic alkaloid is nornicotine, and the cultivated variety contains no more than 0.02% nornicotine. In some embodiments of the method, nornicotine is undetectable in the cultivated variety. In some embodiments of the method, at least one nicotinic alkaloid is neonicotine, and the cultivated variety contains no more than 0.01% neonicotine. In some embodiments of the method, neonicotine is undetectable in the cultivated variety. In some embodiments of the method, at least one nicotinic alkaloid is pseudoequisetine, and the cultivated variety contains no more than 0.002% pseudoequisetine. In some embodiments of the method, pseudoequisetine is undetectable in the cultivated variety.

[0020] In some embodiments of the method, the first low-nicotine trait and / or the second low-nicotine trait comprises those common to the wild type. NIC1 Compared to having reduced expression and / or function nic1 Alleles. In some embodiments of the method, the first low-nicotinic trait and / or the second low-nicotinic trait comprises alleles associated with the wild type. NIC2 Compared to having reduced expression and / or function nic2Alleles. In some embodiments of the method, the first tobacco variety and / or the second tobacco variety contains at least one derived from one of the following tobacco varieties or lines. nic1 Alleles and / or nic2 Alleles: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD 609, Lonibow, Vector 21-41, LA Burley 21, LIBurley 21, and HI Burley 21.

[0021] In some embodiments of the method, the first tobacco variety and / or the second tobacco variety includes wild-type... MYC2a Compared to having reduced expression and / or function myc2a Alleles. In some embodiments of the method, myc2a Alleles relative to the wild type listed in SEQ ID NO: 1 MYC2a The allele contains at least one nucleotide deletion. In some embodiments of the method, myc2a Alleles relative to the wild type listed in SEQ ID NO: 1 MYC2a Alleles contain deletions of one to five nucleotides. In some embodiments of the method, myc2a Alleles relative to the wild type listed in SEQ ID NO: 1 MYC2a The allele contains a five-nucleotide deletion. In some embodiments of the method, the deletion produces a truncated MYC2A protein. In some embodiments of the method, myc2a The allele contains at least 70% of the same nucleic acid sequence as SEQ ID NO: 2. In some embodiments of the method, myc2a The allele contains at least 80% identical nucleic acid sequence to SEQ ID NO: 2. In some embodiments of the method, myc2a The allele contains a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2. In some embodiments of the method, myc2a Alleles derived from Common tobacco .

[0022] In some embodiments of the method, the first low nicotinic trait comprises that of the wild type NIC1 and / or NIC2 Compared to having reduced expression and / or function nic1 Alleles and / or nic2 Alleles, and the second low nicotinic trait includes alleles from the wild type. MYC2a Compared to having reduced expression and / or function myc2aAlleles.

[0023] In some embodiments of the method, the first tobacco variety, the second tobacco variety, and the progeny plants are non-GMO.

[0024] Embodiments of this disclosure also include seeds or cells obtained from progeny plants produced according to any of the methods described herein.

[0025] Embodiments of this disclosure also include tobacco products derived from progeny plants produced according to any of the methods described herein. In some embodiments, the products are selected from the group consisting of tobacco leaves, shredded tobacco, raw-cut tobacco, tobacco dust, tobacco powder, tobacco extract, smokeless tobacco, wet or dry snuff, mouthwash, pipe tobacco, cigar tobacco, cigarette tobacco, cigarette tobacco, and chewing tobacco. In some embodiments, the products are selected from the group consisting of cigarettes, cigarettes, clove cigarettes, filtered cigarettes, homemade cigarettes, self-rolled cigarettes, sticks or pods of heated tobacco products, cigars, tobacco-containing chewing gum, tobacco-containing lozenges, and chewing tobacco.

[0026] The embodiments disclosed herein also include generating a product with reduced nicotine alkaloid content. Common tobacco Plant-based methods. According to these embodiments, the methods include... Common tobacco In plants, combinations of: (a) one or more genetic modifications that reduce the expression and / or function of MYC2A; and (b) nic1 recessive alleles and / or nic2 The recessive allele. In some implementations, such as compared to the corresponding naturally occurring or non-transformed control tobacco plant, Common tobacco Plants have reduced levels of nicotinic alkaloids.

[0027] In some embodiments of the method, Common tobacco Plants contain nic1 homozygous recessive alleles and / or nic2 The homozygous recessive allele.

[0028] In some embodiments of the method, one or more genetic modifications that reduce the expression and / or function of MYC2A are introduced via transcription activator-like effector nucleases (TALENs), large-scale nucleases, zinc finger nucleases, CRISPR / Cas9 systems, CRISPR / Cpf1 systems, CRISPR / Csm1 systems, gene knock-in technology or techniques, or any combination thereof.

[0029] In some implementations, the method further includes suppressing Common tobacco The expression of at least one of the following in plants: BBL (also known as) NBB1 ), A622Quinolinate phosphoribosyltransferase ( QPT ), putrescine N- Methyltransferase ( PMT Ornithine decarboxylase ( ODC ), aspartate oxidase ( AO ), quinolinate synthase ( QS ), N -Methylputrescine oxidase ( MPO ), NtERF221 , NtMYC1a , NtMYC1b or NtMYC2b In some implementations, the cultivar is the NCLA161 cultivar, or a cultivar derived from it.

[0030] The embodiments of this disclosure also include those produced by any of the methods described herein. Common tobacco Plants. In some embodiments of the method, the plant comprises: (a) one or more genetic modifications that reduce the expression and / or function of MYC2A; and (b) nic1 recessive alleles and / or nic2 The recessive allele.

[0031] Embodiments of this disclosure also include progeny plants or seeds derived from any of the plants described herein. In some embodiments, the progeny plants or seeds comprise: (a) one or more genetic modifications that reduce the expression and / or function of MYC2A; and (b) nic1 recessive alleles and / or nic2 The recessive allele.

[0032] The embodiments disclosed herein also include any content derived therefrom. Common tobacco Tobacco products derived from the plant. In some embodiments, said plant comprises: (a) one or more genetic modifications that reduce the expression and / or function of MYC2A; and (b) nic1 recessive alleles and / or nic2 The recessive allele.

[0033] In some embodiments, the tobacco is selected from the group consisting of tobacco leaves, shredded tobacco, raw-cut tobacco, tobacco dust, tobacco powder, tobacco extract, smokeless tobacco, wet or dry snuff, mouthwash, pipe tobacco, cigar tobacco, cigarette tobacco, cigarette tobacco, and chewing tobacco. In some embodiments, the product is a nicotine-reduced tobacco product selected from the group consisting of cigarettes, cigarettes, clove cigarettes, filtered cigarettes, homemade cigarettes, self-rolled cigarettes, sticks or pods of heated tobacco products, cigars, snuff, mouthwash, tobacco-containing chewing gum, tobacco-containing lozenges, and chewing tobacco. Detailed Implementation

[0034] Embodiments of this disclosure include novel methods for producing tobacco plants and any related tobacco products with low nicotine alkaloid content. Compared to naturally occurring and genetically modified tobacco plants, tobacco plants produced according to the methods of this disclosure exhibit reduced levels of nicotine alkaloids (including nicotine, nornicotine, neonicotine, and pseudoequisetine), and therefore represent a commercially viable alternative to currently available tobacco varieties.

[0035] The chapter titles used in this section and all publicly available content in this document are for organizational purposes only and are not intended to be restrictive.

[0036] 1. Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of any conflict, this document (including the definitions) shall prevail. Although similar or equivalent methods and materials to those described herein may be used in the practice or testing of this disclosure, preferred methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and are not intended to be limiting.

[0037] The term "about" will be understood by those skilled in the art and will vary to some extent depending on the context in which it is used. If, given its context, the use of the term is unclear to those skilled in the art, "about" will mean at most plus or minus 10% of the particular term. For example, in some embodiments, it will mean plus or minus 5% of the particular term. Numerical values ​​preceded by the term "about" are used herein to present certain ranges. The term "about" is used herein to provide textual support for precise figures following it, as well as figures that are close to or approximate to the figures following the term. In determining whether a number is close to or approximates a specifically listed number, a number that is close to or approximates an unlisted number may be a number that is substantially equivalent to the specifically listed number in the context in which it is presented.

[0038] As used herein, the terms “comprise,” “include,” “having,” “has,” “can,” “contain,” and variations thereof are intended as open-ended transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. Unless explicitly specified otherwise in the context, the singular forms “a,” “an,” and “the” include plural referents. This disclosure also contemplates other embodiments that “comprise,” “consist of,” and “are substantially composed of,” whether explicitly stated or not.

[0039] In describing the numerical ranges in this article, each intermediate value with the same precision is explicitly considered. For example, for the range 6–9, the numbers 7 and 8 are considered in addition to 6 and 9, and for the range 6.0–7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly considered.

[0040] As used herein, the term "nucleic acid molecule" refers to any molecule containing nucleic acids, including but not limited to DNA or RNA. The term encompasses sequences containing any known DNA and RNA base analogs, including but not limited to 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxymethyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, etc. Purines, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, methyl uracil-5-oxyacetic acid, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl N-uracil-5-oxyacetic acid, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.

[0041] The term "gene" refers to a nucleic acid (e.g., DNA) sequence containing a coding sequence for producing a polypeptide, precursor, or RNA (e.g., rRNA, tRNA, sRNA, microRNA, lincRNA). A polypeptide may be encoded by a full-length coding sequence or by any portion of the coding sequence, as long as the desired activity or functional property (e.g., enzyme activity, ligand binding, signal transduction, immunogenicity, etc.) is preserved in its full length or fragment. The term also encompasses the coding region of a structural gene and sequences located near the 5' and 3' ends of the coding region, with a distance of approximately 1 kb or longer between either end, such that the gene corresponds to the length of full-length mRNA. A sequence located at the 5' end of the coding region and present on the mRNA is called a 5' untranslated sequence. A sequence located at or downstream of the 3' end of the coding region and present on the mRNA is called a 3' untranslated sequence. The term "gene" encompasses both the cDNA and genomic forms of a gene. The genomic form or clone of a gene contains coding regions interrupted by non-coding sequences, referred to as "introns," "insertion regions," or "insertion sequences." Introns are gene segments transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or "cut out" from nuclear transcripts or primary transcripts; therefore, introns are absent from messenger RNA (mRNA) transcripts. mRNA plays a role during translation, specifying the sequence or order of amino acids in the nascent polypeptide.

[0042] As used herein, the term "heterogeneous gene" refers to a gene that does not exist in its natural environment. For example, heterogeneous genes include genes introduced from one species into another. Heterogeneous genes also include naturally occurring genes in an organism that have been altered in some way (e.g., mutation, addition of multiple copies, ligation to a non-natural regulatory sequence, etc.). The difference between heterogeneous genes and endogenous genes is that heterogeneous gene sequences are typically ligated to DNA sequences not found naturally associated with gene sequences in chromosomes, or to chromosomal segments not found in nature (e.g., genes expressed at loci that are not normally expressed).

[0043] As used herein, “operationally linked” refers to a functional connection between two or more elements. For example, an operationally linked polynucleotide of interest and a regulatory sequence (e.g., a promoter) is a functional connection that allows expression of the polynucleotide of interest. The elements of an operationally linked polynucleotide can be contiguous or discontinuous.

[0044] As used in this article, “gene expression” refers to the biosynthesis or production of gene products, including transcription and / or translation of gene products.

[0045] As used herein, the term "oligonucleotide" refers to a short, single-stranded polynucleotide chain. Oligonucleotides are typically less than about 300 residues in length (e.g., between 15 and 100); however, as used herein, the term is also intended to cover longer polynucleotide chains. Oligonucleotides are generally referred to by their length. For example, a 24-residue oligonucleotide is called a "24-mer". Oligonucleotides can form secondary and tertiary structures through self-hybridization or hybridization with other polynucleotides. Such structures can include, but are not limited to, duplexes, hairpins, crosses, bends, and triplexes.

[0046] The terms "homology" and "homology" refer to the degree of similarity. Partial or complete homology can exist. A partially homologous sequence is one that is less than 100% identical to another sequence.

[0047] As used herein, the terms “complementarity” and “complementarity” are used to refer to polynucleotides (e.g., sequences of nucleotides, such as oligonucleotides or target nucleic acids) that are related by base pairing rules. For example, the sequence “5'-AGT-3'” is complementary to the sequence “3'-TCA-5'”. Complementarity can be “partial,” where only some bases of the nucleic acids match according to base pairing rules. Alternatively, “complete” or “full” complementarity can exist between nucleic acids. The degree of complementarity between nucleic acid chains has a significant impact on the hybridization efficiency and strength between nucleic acid chains. This is particularly important in amplification reactions that depend on binding between nucleic acids and in detection methods. Either term can also be used to refer to individual nucleotides, especially in the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity or lack thereof with a nucleotide within another nucleic acid chain, in contrast to or compared to the complementarity between the rest of the oligonucleotide and the nucleic acid chain.

[0048] In some contexts, the term "complementarity" and related terms (e.g., "complementary," "complementary pair") refer to nucleotides of a nucleic acid sequence that can bind to another nucleic acid sequence via hydrogen bonds, such as nucleotides that can pair via base pairing such as Watson-Crick base pairing or other base pairings. Nucleotides that can form base pairs (e.g., complementary to each other) are the following pairs: cytosine and guanine, thymine and adenine, adenine and uracil, and guanine and uracil. Percentage complementarity does not need to be calculated over the entire length of the nucleic acid sequence. The percentage of complementarity may be limited to a specific region of base pairing in the nucleic acid sequence, such as from the first base-paired nucleotide to the last base-paired nucleotide. As used herein, a complementary pair of a nucleic acid sequence refers to an oligonucleotide that is in "antiparallel association" when aligned with a nucleic acid sequence such that the 5' end of one sequence pairs with the 3' end of another sequence. Certain bases not commonly found in native nucleic acids may be included in the nucleic acids of the present invention, including, for example, inosine and 7-denitroguanine. Complementarity need not be perfect; stable duplexes can contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability based on experience by considering many variables, including, for example, the length of the oligonucleotide, the base composition and sequence of the oligonucleotide, ionic strength, and the occurrence rate of mismatched base pairs.

[0049] Therefore, in some implementations, "complementarity" means that the complementarities of the first and second nucleotide sequences are at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical in a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more nucleotides, or that the two sequences hybridize under strict hybridization conditions. "Complete complementarity" means that each nucleotide in the first nucleic acid can pair with each corresponding nucleotide in the second nucleic acid. For example, in some embodiments, the oligonucleotides, each of which is complementary to the nucleic acid, have the same nucleobase sequence as the complement of the nucleic acid in a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleobases.

[0050] As used herein, "double-stranded nucleic acid" can be a portion of a nucleic acid, a region of a longer nucleic acid, or the entire nucleic acid. "Double-stranded nucleic acid" can be, for example, but not limited to, double-stranded DNA, double-stranded RNA, double-stranded DNA / RNA hybrids, etc. Single-stranded nucleic acids having secondary structures (e.g., secondary structures of base pairing) and / or higher-order structures include "double-stranded nucleic acids." For example, a triplet structure is considered "double-stranded." In some embodiments, any nucleic acid with any base pairing is considered a "double-stranded nucleic acid."

[0051] When used in connection with nucleic acids, such as in "isolated oligonucleotides" or "isolated polynucleotides," the term "isolated" refers to a nucleic acid sequence that has been identified and isolated from at least one component or contaminant typically associated with it in its natural source. Isolated nucleic acids are those that differ from those found in nature. In contrast, non-isolated nucleic acids, such as DNA and RNA, are found in their natural state. For example, a given DNA sequence (e.g., a gene) is found on a host cell chromosome near a neighboring gene; RNA sequences, such as specific mRNA sequences encoding a particular protein, are found in the cell as a mixture with many other mRNAs encoding multiple proteins. However, isolated nucleic acids encoding a given protein include, for example, such nucleic acids in cells that typically express the given protein, where the nucleic acid is located on a different chromosome than in the natural cell, or is otherwise side-mounted by a nucleic acid sequence different from those found in nature. Isolated nucleic acids, oligonucleotides, or polynucleotides can exist in single-stranded or double-stranded forms. When isolated nucleic acids, oligonucleotides, or polynucleotides are used to express proteins, the oligonucleotides or polynucleotides will contain at least a sense strand or coding strand (i.e., oligonucleotides or polynucleotides can be single-stranded), but may contain both sense and antisense strands (i.e., oligonucleotides or polynucleotides can be double-stranded).

[0052] As used herein, a "locus" is a chromosomal region containing a polymorphic nucleic acid, trait determinant, gene, or marker. Loci disclosed herein include one or more polymorphisms in a population; for example, alternative alleles may be present in some individuals. As used herein, an "allelic gene" refers to an alternative nucleic acid sequence at a specific locus. Alleles can be as short as one nucleotide base, but are typically much longer. For example, a first allele may be present on one chromosome, while a second allele may be present on a second homologous chromosome, for example, on different chromosomes of a heterozygous individual, or between different homozygous or heterozygous individuals in a population. As used herein, the term "chromosomal interval" refers to a continuous linear span of genomic DNA located on a single chromosome.

[0053] As used in this article, "introgression" or "introgression" refers to the transfer of the desired allele of a genetic locus from one genetic background to another.

[0054] As used herein, “hybrid” or “hybrid” means that offspring are produced through fertilization (e.g., cells, seeds, or plants), and includes hybridization between plants (sexual hybridization) and self-fertilization (self-pollination).

[0055] As used herein, “backcross” and “backcrossing” refer to the process of repeatedly hybridizing offspring plants back to one of their parents. In a backcross scheme, the “donor” parent is the parent plant that possesses the desired gene or locus to be introgressed. The “recipient” parent (used once or multiple times) or “recurrent” parent (used twice or more) is the parent plant whose gene or locus has been introgressed. The initial hybridization produces the F1 generation. The term “BC1” refers to the second use of the recurrent parent, “BC2” to the third use of the recurrent parent, and so on. In some respects, backcrossing is repeated, with each successive backcross generation's offspring individuals being backcrossed with the same parental genotype.

[0056] As used in this article, “single gene converted” or “single gene conversion” refers to a plant developed using a plant breeding technique called backcrossing or through genetic engineering, in which virtually all of the desired morphological and physiological characteristics of the variety are restored, in addition to the single gene transferred into the variety through backcrossing or through genetic engineering.

[0057] As used herein, the term "variety" refers to a group of plants that share constant characteristics that distinguish them from other plants of the same species. Although not always the case, varieties are frequently sold commercially. While a variety possesses one or more unique traits, a further characteristic of a variety is the very small overall variation among individuals within that variety. "Pureline" varieties can be created through several generations of self-pollination and selection, or through vegetative propagation from a single parent using tissue or cell culture techniques. A variety can be essentially derived from another line or cultivar. As defined in the International Convention for the Protection of New Varieties of Plants (2 December 1961, 10 November 1972; 23 October 1978; and amended in Geneva on 19 March 1991), a variety is “substantially derived” from an initial variety if the following conditions are met: a) the variety is primarily derived from the initial variety, or from a variety primarily derived from the initial variety, while retaining the expression of essential characteristics arising from the genotype or genotype combination of the initial variety; b) the variety is significantly different from the initial variety; and c) the variety conforms to the initial variety in the expression of essential characteristics arising from the genotype or genotype combination of the initial variety, except for differences arising from the derivation process. Substantially derived varieties can be obtained, for example, by selecting natural or induced mutants, somatic clonal variants, or variant individuals from an initial variety, backcross, or transformed plant. A first tobacco variety and a second tobacco variety from which the first variety is substantially derived are considered to have substantially the same genetic background. Unlike a variety, a “strain” typically refers to a group of plants not used commercially, such as in plant research. Strains typically show little overall variation in one or more traits of interest among individuals, although there may be some variation in other traits among individuals.

[0058] As used in this article, “selecting” or “selection” in the context of marker-assisted selection or breeding refers to the act of picking or selecting desired individuals from a population based on certain predetermined criteria.

[0059] As used herein, the term "phenotype" refers to one or more detectable characteristics of a cell or organism that can be influenced by genotype. A phenotype can be observed with the naked eye or by any other assessment method known in the art, such as microscopy, biochemical analysis, genomic analysis, assays of tolerance to a specific disease, etc. In some cases, a phenotype is directly controlled by a single gene or locus, such as a "monogenous phenotype." In other cases, a phenotype is the result of multiple genes.

[0060] As used herein, the terms “gene mutation” or “gene alteration” refer to a heritable genetic modification introduced into a gene to alter the expression or activity of the product encoded by the gene. Such modification may be in any sequence region of a gene, such as a promoter, 5' UTR, exon, intron, 3' UTR, or terminator region. In one aspect, a mutation reduces, suppresses, or eliminates the expression or activity of a gene product. In another aspect, a mutation increases, enhances, strengthens, or strengthens the expression or activity of a gene product. In one aspect, the mutation is not a naturally occurring polymorphism present in a particular tobacco variety or cultivar. As used herein, a “mutant allele” refers to an allele from which the allele contains the mutation. As used herein, “mutation” refers to the generation of a mutation without involving a transgene or without any residual transgene associated with the mutation in the final mutant. In one aspect, mutagenesis is cis-genetic. In another aspect, mutagenesis is via gene or genome editing. In yet another aspect, mutagenesis is via random mutagenesis, such as chemical mutagenesis (e.g., EMS) or physical mutagenesis (r-radiation).

[0061] As used herein, “polymorphism” refers to the presence of one or more variations within a population. Polymorphism can manifest as changes in the nucleotide sequence of nucleic acids or variations in the amino acid sequence of proteins. Polymorphism includes one or more variations in the nucleic acid sequence or nucleic acid characteristics at one or more loci within a population of one or more individuals. Variations may include, but are not limited to, changes in one or more nucleotide bases, insertions of one or more nucleotides, or deletions of one or more nucleotides. Polymorphism can arise from random processes during nucleic acid replication, through mutagenesis, due to the movement of genomic elements, from copy number changes, and during meiotic processes such as unequal crossing over, genome replication, and chromosome breakage and fusion. Variations may be common or present at low frequencies within a population; the former is more practical in general plant breeding, while the latter may be associated with rare but important phenotypic changes. Useful polymorphisms may include single nucleotide polymorphisms (SNPs), insertions or deletions (Indels) in DNA sequences, simple sequence repeats (SSRs) in DNA sequences, restriction fragment length polymorphisms (RFLPs), and tag SNPs. Polymorphism can also include genetic markers, genes, DNA-derived sequences, RNA-derived sequences, promoters, the 5' untranslated region of a gene, the 3' untranslated region of a gene, microRNAs, siRNAs, tolerance loci, satellite markers, transgenes, mRNAs, ds mRNAs, transcriptomic profiles, and methylation patterns. Furthermore, the presence, absence, or copy number variations of the aforementioned components can also be considered polymorphism.

[0062] As used herein, the term "plant" encompasses the whole plant, grafted plants, ancestral and descendant plants, and plant parts, including seeds, buds, stems, roots (including tubers), rootstocks, scions, and plant cells, tissues, and organs. Plants can be in any form, including suspension cultures, embryos, meristematic zones, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores. Plants particularly useful in the methods of this disclosure include those belonging to the genus *[…]*. tobacco All plants in the family.

[0063] As used in this article, the term "tobacco" refers to tobacco that produces nicotine alkaloids. tobacco Any plant in the genus *Tobacco*. Tobacco also refers to plants containing... tobacco Products made from plant-derived materials, and therefore include, for example, flue-cured tobacco, tobacco strips (destemmed tobacco), raw-cut tobacco, expanded tobacco, reconstituted tobacco, cigarettes, cigars, chewing tobacco, or smokeless tobacco in the form of snuff and oral tobacco. Because finished reconstituted tobacco sheets contain non-tobacco components, the nicotine content of reconstituted tobacco is lower than that of the tobacco used to produce it. Because expanded tobacco has a larger volume, it fills cigarettes better than raw-cut tobacco. Tobacco Examples of species include, but are not limited to, the following: Clustered tobacco (Nicotiana acaulis), tapering leaf tobacco (Nicotiana acuminata), Nicotiana acuminata var. multiflora, African tobacco Nicotiana africana, Nicotiana alata, Nicotiana claspingii amplexicaulis, Nicotiana arentsii, Nicotiana arentsii attenuata, Nicotiana benavidesii, Nicotiana benavidesii benthamiana, Nicotiana bigelovii, and Nicotiana benthamiana tobacco. bonariensis, cave-grown tobacco (Nicotiana cavicola), Cleveland-style tobacco (Nicotiana clevelandii), heart-leaved tobacco (Nicotiana cordifolia), umbrella-shaped tobacco (Nicotiana corymbosa), and di Nicotiana debneyi, Nicotiana excelsior, and Nicotiana folgitii (Nicotiana forgetiana), fragrant tobacco (Nicotiana fragrans), pink and blue tobacco (Nicotiana glauca) Nicotiana glutinosa, Nicotiana goodspeedii, and Nicotiana scoparia Nicotiana gossei (grass), Nicotiana hybrid (blended tobacco), Nicotiana ingulba (Tobacco) ingulba), Nicotiana kawakamii, Nicotiana knightiana, and bluegrass. Nicotiana langsdorffii, Nicotiana linearis, and Nicotiana longflora (Nicotiana longiflora), seaside tobacco (Nicotiana maritima), pseudo-tobacco (Nicotiana) megalosiphon, Nicotiana miersii, Nicotiana noctiflora, naked stem Tobacco (Nicotiana nudicaulis), Nicotiana obtusifolia, Nicotiana spp. occidentalis), Western subsp. Hesperis tobacco (Nicotiana occidentalis subsp.). hesperis, Nicotiana otophora, Nicotiana paniculata, and less flowering tobacco Nicotiana pauciflora, Nicotiana petunioides, and Nicotiana jasmine leaf (Nicotiana plumbaginifolia), Nicotiana quadrivalvis, Nicotiana Raymond's tobacco (Nicotiana raimondii), Nicotiana repanda, Nicotiana rosette Nicotiana rosulata), rosette-leaved Nicotiana subsp. ingulba, and round-leaved Nicotiana (Nicotiana rotundifolia), Yellow tobacco (Nicotiana rustica), Sete tobacco (Nicotiana rotundifolia) Setchellii), extra-large tube tobacco (Nicotiana simulans), solanum leaf tobacco (Nicotiana solanifolia), and others. Nicotiana spegazzinii, Nicotiana stocktonii, and sweet tobacco Nicotiana suaveolens (grass), Nicotiana sylvestris (forest tobacco), common tobacco, Nicotiana pseudospike (Nicotiana thyrsiflora), Nicotiana tomentosa, Nicotiana pseudo-tomentosa Tomentosiformis), Nicotiana trigonophylla, Nicotiana spp. Nicotiana umbratica, Nicotiana undulata, Nicotiana velutina, Nicotiana celery (Nicotiana wigandioides) and Red-flowered tobacco (Nicotiana x sanderae).

[0064] As used herein, the term "transgenic plant" refers to a plant that contains... itselfPlants that also exist in another organism or species or use nucleic acid sequences optimized from another organism or species relative to the host codons. Monocotyledonous and dicotyledonous angiosperm or gymnosperm cells can be transformed in a variety of ways known in the art. For example, see Klein et al., Biotechnology 4: 583-590 (1993); Bechtold et al., CR Acad. Sci. Paris 316:1194-1199 (1993); Bent et al., Mol. Gen. Genet. 204:383-396 (1986); Paszowski et al., EMBO J. 3: 2717-2722 (1984); Sagi et al., Plant Cell Rep. 13: 262-266 (1994).

[0065] Unless otherwise defined herein, scientific and technical terms used in conjunction with this disclosure shall have the meanings commonly understood by one of ordinary skill in the art. For example, any nomenclature and techniques used in conjunction with the cell and tissue culture, molecular biology, plant biology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those nomenclature and techniques well-known and commonly used in the art. The meaning and scope of terms should be clear; however, in the event of any potential ambiguity, the definitions provided herein shall prevail over any dictionary or external definition. Furthermore, unless the context requires otherwise, singular terms shall include plural and plural terms shall include singular.

[0066] 2. Low-nicotine tobacco plants The accumulation of tobacco alkaloids is considered a complex trait influenced by multiple genes and environmental factors. Researchers have historically studied the use of... NIC1 and NIC2 Locus (also known as) A loci and B Lower nicotine levels in tobacco are achieved through allelic variation at a specific locus. It has been found that... NIC2 The locus is composed of Common tobacco A cluster of genes on linkage group 19 encodes ethylene response factor (ERF) transcription factors that comprehensively influence the expression of structural genes in the tobacco alkaloid biosynthesis pathway. This cluster of genes was found in 'LA Burley 21' (a backcross derivative of Burley 21). nic1 / nic1 nic2 / nic2 It was removed in version (). A similar gene array is located in Common tobacco On the chain group 7 Nic1 At or near the gene locus, where it is believed ERF199The epigenetic silence of the alleles underlies the effect of alkaloid accumulation at this locus in LA Burley 21. Such variability has been used to develop low-alkaloid breeding lines, such as LA Burley 21 and LAFC53. However, only... NIC1 and NIC2 Homozygous materials of recessive alleles at the locus typically cannot produce results with levels below 0.4 mg g. -1 The average nicotine level of flue-cured tobacco leaves.

[0067] The embodiments disclosed herein include a method for developing tobacco cultivars that generate new tobacco genotypes, wherein the genotype is derived from LAFC53 (Chaplin, 1975). NIC1 and NIC2 Genetic variability at loci and Common tobacco Gene Myc2a The mutant allele combination, wherein the mutant alleles encode transcription factors that positively regulate gene expression in the nicotine biosynthesis pathway. Previously identified The United States Tobacco Germplasm Bank (US Nicotiana Germplasm) Collection) Tobacco introduction in TI 313 Myc2a The harmful 5 bp mutation in LAFC53 (Burner et al., 2022). Surprisingly and unexpectedly, the mutation also occurred in LAFC53. nic1 and nic2 Alleles and mutations from TI 313 myc2a Homozygous alleles showed significantly better results than alleles derived solely from LAFC53. nic1 and nic2 Homozygous tobacco genotypes have low nicotine levels. This indicates that adding a mutant... myc2a Alleles further suppress the overall expression of nicotine biosynthesis genes, exceeding the expression of genes that are only recessive. nic1 and nic2 Suppression of allele production. The result of this method is the production of the lowest reported levels of nicotine in tobacco plants, with corresponding reductions in equisetine, neonicotine, and nornicotine genotypes.

[0068] Based on the foregoing, embodiments of this disclosure include tobacco cultivars or any portion thereof, said tobacco cultivars or any portion thereof containing at least one nicotinic alkaloid at a reduced level compared to the corresponding naturally occurring tobacco plant or portion thereof. In some embodiments, the tobacco cultivars produced according to the methods of this disclosure include at least one nicotinic alkaloid selected from the group consisting of nicotine, nornicotine, neonicotine, and pseudoequisetine. In some embodiments, the cultivars are non-GMO.

[0069] In some embodiments, the tobacco cultivars of this disclosure contain reduced levels of nicotine. In some embodiments, the tobacco cultivars contain no more than 0.30% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.29% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.28% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.27% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.26% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.25% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.24% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.23% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.22% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.21% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.20% nicotine. In some embodiments, the tobacco cultivars contain no more than 0.19% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.18% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.17% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.16% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.15% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.14% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.13% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.12% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.11% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.10% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.09% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.08% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.07% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.06% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.05% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.04% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.03% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.02% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.01% nicotine.

[0070] In some embodiments, the tobacco cultivar contains about 0.1% to about 0.30% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.25% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.20% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.15% nicotine. In some embodiments, the tobacco cultivar contains about 0.15% to about 0.30% nicotine. In some embodiments, the tobacco cultivar contains about 0.20% to about 0.30% nicotine. In some embodiments, the tobacco cultivar contains about 0.25% to about 0.30% nicotine. In some embodiments, the tobacco cultivar contains about 0.15% to about 0.25% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.20% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.29% nicotine. In some embodiments, the tobacco cultivar contains about 0.15% to about 0.29% nicotine. In some embodiments, the tobacco cultivar contains about 0.20% to about 0.29% nicotine. In some embodiments, the tobacco cultivar contains about 0.25% to about 0.29% nicotine.

[0071] In some embodiments, the tobacco cultivars of this disclosure contain reduced levels of nicotine. In some embodiments, the cultivar contains no more than 0.02% nicotine. In some embodiments, the cultivar contains no more than 0.01% nicotine. In some embodiments, the cultivar contains no more than 0.009% nicotine. In some embodiments, the cultivar contains no more than 0.008% nicotine. In some embodiments, the cultivar contains no more than 0.007% nicotine. In some embodiments, the cultivar contains no more than 0.006% nicotine. In some embodiments, the cultivar contains no more than 0.005% nicotine. In some embodiments, the cultivar contains about 0.005% to about 0.01% nicotine. In some embodiments, the cultivar contains about 0.006% to about 0.01% nicotine. In some embodiments, the cultivar contains about 0.007% to about 0.01% nicotine. In some embodiments, the cultivar contains about 0.008% to about 0.01% nornicotinic acid. In some embodiments, the cultivar contains about 0.009% to about 0.01% nornicotinic acid. In some embodiments, the cultivar contains about 0.005% to about 0.009% nornicotinic acid. In some embodiments, the cultivar contains about 0.005% to about 0.008% nornicotinic acid. In some embodiments, the cultivar contains about 0.005% to about 0.007% nornicotinic acid. In some embodiments, the cultivar contains about 0.005% to about 0.006% nornicotinic acid. In some embodiments, nornicotinic acid is undetectable or exceeds the detection limit in the cultivar.

[0072] In some embodiments, the tobacco cultivars of this disclosure contain reduced levels of neonicotinoids. In some embodiments, the cultivar contains no more than 0.02% neonicotinoids. In some embodiments, the cultivar contains no more than 0.01% neonicotinoids. In some embodiments, the cultivar contains no more than 0.009% neonicotinoids. In some embodiments, the cultivar contains no more than 0.008% neonicotinoids. In some embodiments, the cultivar contains no more than 0.007% neonicotinoids. In some embodiments, the cultivar contains no more than 0.006% neonicotinoids. In some embodiments, the cultivar contains no more than 0.005% neonicotinoids. In some embodiments, the cultivar contains about 0.005% to about 0.01% neonicotinoids. In some embodiments, the cultivar contains about 0.006% to about 0.01% neonicotinoids. In some embodiments, the cultivar contains about 0.007% to about 0.01% neonicotinoids. In some embodiments, the cultivar contains about 0.008% to about 0.01% neonicotinoids. In some embodiments, the cultivar contains about 0.009% to about 0.01% neonicotinoids. In some embodiments, the cultivar contains about 0.005% to about 0.009% neonicotinoids. In some embodiments, the cultivar contains about 0.005% to about 0.008% neonicotinoids. In some embodiments, the cultivar contains about 0.005% to about 0.007% neonicotinoids. In some embodiments, the cultivar contains about 0.005% to about 0.006% neonicotinoids. In some embodiments, neonicotinoids are undetectable or exceed the detection limit in the cultivar.

[0073] In some embodiments, the tobacco cultivars of this disclosure contain reduced levels of equisetine. In some embodiments, the cultivar contains no more than 0.002% equisetine. In some embodiments, the cultivar contains no more than 0.001% equisetine. In some embodiments, the cultivar contains no more than 0.0009% equisetine. In some embodiments, the cultivar contains no more than 0.0008% equisetine. In some embodiments, the cultivar contains no more than 0.0007% equisetine. In some embodiments, the cultivar contains no more than 0.0006% neonicotinoids. In some embodiments, the cultivar contains no more than 0.0005% equisetine. In some embodiments, the cultivar contains no more than 0.0004% equisetine. In some embodiments, the cultivar contains no more than 0.0003% equisetine. In some embodiments, the cultivar contains no more than 0.0002% equisetine. In some embodiments, the cultivar contains no more than 0.0001% equisetine. In some embodiments, the cultivar contains about 0.0004% to about 0.002% equisetine. In some embodiments, the cultivar contains about 0.0005% to about 0.002% equisetine. In some embodiments, the cultivar contains about 0.0006% to about 0.002% equisetine. In some embodiments, the cultivar contains about 0.0007% to about 0.002% equisetine. In some embodiments, the cultivar contains about 0.0008% to about 0.002% equisetine. In some embodiments, the cultivar contains about 0.0009% to about 0.002% equisetine. In some embodiments, the cultivar contains about 0.001% to about 0.002% equisetine. In some embodiments, the cultivar contains about 0.0015% to about 0.002% of equisetine. In some embodiments, the cultivar contains about 0.0004% to about 0.0015% of equisetine. In some embodiments, the cultivar contains about 0.0004% to about 0.008% of equisetine. In some embodiments, the cultivar contains about 0.0005% to about 0.0015% of equisetine. In some embodiments, the cultivar contains about 0.0008% to about 0.0012% of equisetine. In some embodiments, equisetine is undetectable or exceeds the detection limit in the cultivar.

[0074] In some implementations, cultivated varieties include wild types. NIC1 Compared to having reduced expression and / or function nic1 Alleles. In some implementations, cultivars contain alleles related to the wild type. NIC2 Compared to having reduced expression and / or function nic2Alleles. In some implementations, cultivars contain alleles related to the wild type. NIC1 and wild type NIC2 Alleles with reduced expression and / or function compared to other alleles nic1 Alleles and nic2 Alleles. In some implementation schemes, nic1 Alleles and / or nic2 The alleles are derived from at least one of the following varieties or lines: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD 609, Lonibow, Vector 21-41, LA Burley 21, LIBurley 21, and HI Burley 21. In some embodiments, the first tobacco variety and / or the second tobacco variety contains nic1 and / or nic2 Invalid alleles (deletion). In some implementations, nic1 and / or nic2 Invalid alleles are derived from other Common tobacco Germplasm.

[0075] In some implementations, cultivated varieties include wild types. MYC2a Compared to having reduced expression and / or function myc2a Alleles. In some implementation schemes, myc2a Alleles relative to the wild type listed in SEQ ID NO: 1 MYC2a The allele contains at least one nucleotide deletion. In some implementations, myc2a Alleles relative to the wild type listed in SEQ ID NO: 1 MYC2a Alleles consist of deletions of one to five nucleotides. In some implementations, myc2a Alleles relative to the wild type listed in SEQ ID NO: 1 MYC2a The allele contains a five-nucleotide deletion. In some embodiments, this deletion produces a truncated MYC2A protein. In some embodiments, myc2a The allele contains at least 70% of the same nucleic acid sequence as SEQ ID NO: 2. In some implementations, myc2a The allele contains at least 75% identical nucleic acid sequence to SEQ ID NO: 2. In some implementations, myc2a The allele contains at least 80% of the same nucleic acid sequence as SEQ ID NO: 2. In some implementations, myc2a The allele contains at least 85% identical nucleic acid sequence to SEQ ID NO:2. In some implementations, myc2aThe allele contains at least 90% identical nucleic acid sequence to SEQ ID NO: 2. In some implementations, myc2a The allele contains a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 2. In some implementations, myc2a The allele contains a nucleic acid sequence that is at least 98% identical to SEQ ID NO: 2. In some implementations, myc2a Alleles derived from Common tobacco .

[0076] In some embodiments, the tobacco cultivars of this disclosure are non-GMO (e.g., not heterologous GMOs). According to these embodiments, the tobacco cultivars of this disclosure can be produced by breeding (e.g., backcrossing) various tobacco lines having a desired trait corresponding to a reduced level of at least one nicotinic alkaloid. Therefore, the tobacco cultivars produced according to any embodiment of this disclosure are not naturally occurring.

[0077] As those skilled in the art will understand based on this disclosure, transgenic methods can also be used to produce tobacco cultivars having reduced levels of at least one nicotinic alkaloid as described herein. In some embodiments, the tobacco cultivars of this disclosure can be engineered to include one or more traits corresponding to the reduced levels of at least one nicotinic alkaloid. For example, tobacco plants can be engineered to include alleles substantially similar to those found in LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD 609, Lonibow, Vector 21-41, LA Burley 21, LI Burley 21, and HI Burley 21. nic1 Alleles and / or nic2 Alleles. These nic1 Alleles and / or nic2 Alleles may have one or more gene alterations that result in a reduction in the level of at least one nicotinic alkaloid (e.g., deletion, truncation, loss of function, or hylomorphic mutation). Furthermore, tobacco plants can be engineered to contain alleles substantially similar to those found in TI 313. myc2a Alleles. These myc2aAlleles may have one or more gene alterations that result in a reduction in the level of at least one nicotinic alkaloid (e.g., deletion, truncation, loss of function, or morphological mutation). Such gene alterations can be engineered using any means known in the art, including but not limited to transcription activator-like effector nucleases (TALENs), large-scale nucleases, zinc finger nucleases, and clustered regularly spaced short palindromic repeats (CRISPR) / Cas9 systems, CRISPR / Cpf1 systems, CRISPR / Csm1 systems, or any combination thereof (see, for example, Gaj et al.). Trends in Biotechnology 31(7):397-405 (2013).

[0078] In some embodiments, this technology provides a method for producing tobacco plants with reduced nicotine alkaloid content, the method comprising: […] in the tobacco plant (… For example , Common tobacco The combinations included: (a) genetic modifications that reduced MYC2A expression and / or function compared to the corresponding naturally occurring or non-transformed control tobacco plants; and (b) nic1 recessive alleles and / or nic2 The recessive allele.

[0079] In some implementation schemes, the following is introduced nic1 recessive alleles and / or nic2 Recessive alleles may include one or more recessive alleles introduced into, for example, tobacco plants through conventional breeding. For example , Common tobacco In this context, the tobacco plant contains one or more genetic modifications that reduce the expression and / or function of MYC2A in the tobacco plant compared to the wild-type tobacco plant.

[0080] In some implementations, the methods of this technology produce genetic modifications that (a) reduce MYC2A expression and / or function; and (b) nic1 recessive alleles and / or nic2Tobacco plants with recessive alleles may contain at least about 40% (e.g., at least about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96% or more, or any range or value thereof) less nicotinic alkaloids than the corresponding naturally occurring or non-transformed control tobacco plants. In some implementations, the nicotine alkaloids reduced in the tobacco plant may be nicotine, wherein the nicotine content is reduced by about 90% or more (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) compared to the corresponding naturally occurring or non-converted control tobacco plant.

[0081] In some implementations, the methods of this technology produce genetic modifications that (a) reduce MYC2A expression and / or function; and (b) nic1 recessive alleles and / or nic2The recessive allele in tobacco plants contains reduced levels of nicotine. In some embodiments, the tobacco cultivar contains no more than 0.29% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.28% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.27% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.26% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.25% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.24% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.23% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.22% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.21% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.20% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.19% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.18% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.17% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.16% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.15% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.14% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.13% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.12% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.11% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.10% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.09% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.08% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.07% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.06% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.05% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.04% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.03% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.02% nicotine. In some embodiments, the tobacco cultivar contains no more than 0.01% nicotine.

[0082] In some embodiments, the tobacco cultivar contains about 0.1% to about 0.30% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.25% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.20% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.15% nicotine. In some embodiments, the tobacco cultivar contains about 0.15% to about 0.30% nicotine. In some embodiments, the tobacco cultivar contains about 0.20% to about 0.30% nicotine. In some embodiments, the tobacco cultivar contains about 0.25% to about 0.30% nicotine. In some embodiments, the tobacco cultivar contains about 0.15% to about 0.25% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.20% nicotine. In some embodiments, the tobacco cultivar contains about 0.1% to about 0.29% nicotine. In some embodiments, the tobacco cultivar contains about 0.15% to about 0.29% nicotine. In some embodiments, the tobacco cultivar contains about 0.20% to about 0.29% nicotine. In some embodiments, the tobacco cultivar contains about 0.25% to about 0.29% nicotine.

[0083] In some implementations, the methods of this technology produce genetic modifications that (a) reduce MYC2A expression and / or function; and (b) nic1 recessive alleles and / or nic2 Tobacco plants with the recessive allele contain reduced levels of nornicotinic acid. In some embodiments, the plant contains no more than about 0.02% nornicotinic acid, no more than about 0.01% nornicotinic acid, or no more than about 0.005% nornicotinic acid. In some embodiments, the plant contains about 0.005% to about 0.02% nornicotinic acid, or about 0.01% to about 0.02% nornicotinic acid. In some embodiments, nornicotinic acid is undetectable or exceeds the detection limit in tobacco.

[0084] In some implementations, the methods of this technology produce genetic modifications that (a) reduce MYC2A expression and / or function; and (b) nic1 recessive alleles and / or nic2Tobacco plants with a recessive allele contain reduced levels of neonicotinoids. In some embodiments, the plant contains no more than 0.01% neonicotinoids. In some embodiments, the plant contains about 0.001% to about 0.01% neonicotinoids, about 0.002% to about 0.01% neonicotinoids, about 0.003% to about 0.01% neonicotinoids, about 0.004% to about 0.01% neonicotinoids, about 0.005% to about 0.01% neonicotinoids, about 0.006% to about 0.01% neonicotinoids, about 0.007% to about 0.01% neonicotinoids, about 0.008% to about 0.01% neonicotinoids, or about 0.009% to about 0.01% neonicotinoids. In some embodiments, neonicotinoids are undetectable or exceed the detection limit in the tobacco plant.

[0085] In some implementations, the methods of this technology produce genetic modifications that (a) reduce MYC2A expression and / or function; and (b) nic1 recessive alleles and / or nic2 The recessive allele in tobacco plants contains reduced levels of equisetine. In some embodiments, the plant contains about 0.0004% to about 0.002% equisetine, about 0.0004% to about 0.0015% equisetine, about 0.0004% to about 0.008% equisetine, about 0.0005% to about 0.0015% equisetine, and about 0.0008% to about 0.0012% equisetine. In some embodiments, equisetine is undetectable or exceeds the detection limit in the tobacco plant.

[0086] As described herein, genetic modifications can be engineered using any means known in the art, including but not limited to transcription activator-like effector nucleases (TALENs), large-scale nucleases, zinc finger nucleases, CRISPR / Cas9 systems, CRISPR / Cpf1 systems, CRISPR / Csm1 systems, gene knock-in technology or techniques, or any combination thereof.

[0087] For example, in some embodiments, the method of this technology involves using a CRISPR / Cas system that binds to a target site in a region of interest in the genome, wherein the CRISPR / Cas system includes a CRISPR / Cas nuclease and engineered crRNA / tracrRNA (or single guide RNA (sgRNA) or guide RNA (gRNA)). In some embodiments, the CRISPR system generally includes (i) a polynucleotide encoding a Cas protein, and (ii) at least one RNA-guided genome-engineered sgRNA for use in plant cells. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Cys3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Smr1, Cmr3, Cmr4, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, their homologs, or modified versions thereof. In some embodiments, the Cas protein is... Streptococcus pyogenes Cas9 protein. These enzymes are known. For example, purulent Streptococcus The amino acid sequence of the Cas9 protein can be found in the SwissProt database with accession number Q99ZW2. In some embodiments, the method of this technique involves using a CRISPR / Cpf1 system that binds to a target site in a region of interest within the genome. In some embodiments, the method of this technique involves using a CRISPR / Csm1 system that binds to a target site in a region of interest within the genome.

[0088] In some implementations, the CRISPR / Cas, CRISPR / Cpf1, or CRISPR / Csm1 system is recognized. myc2a The target site in [the system]. In some implementations, the CRISPR / Cas, CRISPR / Cpf1, or CRISPR / Csm1 system [is used in...]. myc2aSpecific sequence changes are generated, such as mutations and / or substitutions resulting in the deletion of one or more nucleotides, leading to reduced activity / expression of MYC2A (e.g., deletion, truncation, loss of function, or plasmonic mutation). In some embodiments, the CRISPR / Cas, CRISPR / Cpf1, or CRISPR / Csm1 systems generate specific sequence changes via gene knock-in or gene substitution. Gene knock-in or gene substitution methods are well known in the art. CRISPR-based gene knock-in or gene substitution methods may utilize homology-directed repair (HDR) mechanisms, non-homologous end joining (NHEJ) mechanisms, or a combination of HDR and NHEJ mechanisms. A non-limiting example of a CRISPR-based method utilizing HDR and NHEJ mechanisms is called tandem repeat-HDR (TR-HDR), described in Lu et al., “Targeted, efficient sequence insertion and replacement in rice,” Nature Biotechnology, 38 (12):1402-1407. doi: 10.1038 / s41587-020-0581-5, (2020), which is incorporated in whole by reference.

[0089] In some implementations, the methods described herein employ a large-scale nuclease DNA-binding domain to bind to regions of interest in the plant cell genome. Large-scale nucleases are engineered versions of naturally occurring restriction enzymes that typically possess extended DNA recognition sequences. For example (Approximately 14 to 40 base pairs in length). Large-scale nucleases (also known as homing endonucleases) are generally classified into five families based on sequence and structural motifs: the LAGLIDADG family, the GIY-YIG family, the His-Cyst box family, the PD-(D / E)XK family, and the HNH family. In some implementations, large-scale nucleases include engineered homing endonucleases. Homing endonucleases and large-scale nucleases such as I- Sce I- Ceu I, PI- Psp I, PI- Sce I- Sce IV, I- Csm I、I- Pan I、I- Sce II, I- Ppo I、I- Sce III, I- Cre I、I- Tev I、I- Tev II and I- Tev The recognition sequence for III is known.

[0090] In some implementations, a wide range of nucleases are customized to recognize myc2a Targets in alleles. In some implementations, a wide range of nucleases are involved. myc2a Specific sequence changes are generated in the allele, such as mutations and / or substitutions that result in the deletion of one or more nucleotides, which lead to reduced activity / expression of MYC2A (e.g., deletion, truncation, loss of function, or plasmonic mutation).

[0091] In some implementations, the methods described herein employ transcription activator-like effector nucleases (TALENs) to edit plant genomes by inducing double-strand breaks (DSBs). TALENs are restriction enzymes that can be engineered to cleave specific DNA sequences. TALENs are created by combining a TAL effector DNA-binding domain with a DNA cleavage domain (…). For example Nuclease domains, such as those derived from Fok The transcription activator-like effector (TALE) is constructed by fusing the nuclease domain of a nuclease. It can be engineered according to methods known in the art to bind to a desired DNA sequence and, when combined with a nuclease, provides a technique for cutting DNA at a specific location. For example, in some embodiments, TALEN technology is used in… myc2a Specific sequence changes are generated in the allele, such as mutations and / or substitutions that result in the deletion of one or more nucleotides, which lead to reduced activity / expression of MYC2A (e.g., deletion, truncation, loss of function, or plasmonic mutation).

[0092] In some embodiments, the compositions and methods described herein employ zinc finger nucleases (ZFNs) to edit plant genomes by inducing double-strand breaks (DSBs). ZFNs are created by combining zinc finger DNA-binding domains with DNA cleavage domains (…). For example Nuclease domains, such as those derived from Fok ZFN is an artificial restriction enzyme generated by fusing the nuclease domain of a nuclease. ZFN can be engineered to bind to and cleave DNA at specific locations. ZFN contains two protein domains. The first domain is the DNA-binding domain, which contains eukaryotic transcription factors and zinc fingers. The second domain is the nuclease domain, which contains the enzyme responsible for cleaving DNA. FokI. Restriction enzymes. ZFNs can be engineered according to methods known in the art to bind to a desired DNA sequence and cleave DNA at a specific location. For example, after identifying a target sequence in a nicotinic biosynthesis gene, the corresponding ZFN sequence is engineered and inserted into a plasmid. The plasmid is inserted into a target cell, where it is translated to produce a functional ZFN, which then enters the nucleus, binds to and cleaves its target sequence, thereby introducing a double-strand break (DSB). This method can be used to introduce exogenous DNA sequences into the target gene when DSBs are repaired via homologous targeted repair or non-homologous end joining. For example, in some embodiments, ZFN technology is used in… myc2a Specific sequence changes are generated in the allele, such as mutations and / or substitutions that result in the deletion of one or more nucleotides, which lead to reduced activity / expression of MYC2A (e.g., deletion, truncation, loss of function, or plasmonic mutation).

[0093] In some embodiments, this technology further includes inhibiting endogenous genes encoding transcription factors that positively regulate alkaloid production (such as... NtERF221 , NtMYC1a , NtMYC1b and / or NtMYC2b The expression of genes can reduce the level of nicotinic alkaloids in plants.

[0094] In some embodiments, the present technology further includes inhibiting one or more nicotinic alkaloid biosynthetic genes (such as... BBL (also known as) NBB1 ), A622 , QPT (quinolinate phosphoribosyltransferase) PMT (putrescine methyltransferase) ODC (ornithine decarboxylase) AO (aspartate oxidase) QS (quinolinate synthase) and MPO ( N The expression of the methyl putrescine oxidase gene was reduced to decrease the level of nicotinic alkaloids in plants.

[0095] It can be used to suppress ERF199 , ERF189 , NtERF221 , NtMYC1a , NtMYC1b , NtMYC2b , BBL , A622 , QPT , PMT , ODC , AO , QS and / or MPOExamples of gene-based approaches include, but are not limited to, antisense, sense co-repression, RNAi, artificial microRNAs, virus-induced gene silencing (VIGS), antisense, sense co-repression, targeted mutagenesis, and / or targeted genome engineering methods, including but not limited to transcription activator-like effector nucleases (TALENs), large-scale nucleases, zinc finger nucleases, and clustered regularly spaced short palindromic repeats (CRISPR) / Cas9 systems, CRISPR / Cpf1 systems, CRISPR / Csm1 systems, or any combination thereof.

[0096] Based on the foregoing, embodiments of this disclosure also include progeny plants, seeds, or cells derived from any of the tobacco cultivars described herein using genetically modified and / or non-genetically modified methods. Embodiments of this disclosure also include tobacco products derived from any of the tobacco cultivars described herein or portions thereof. In some embodiments, the tobacco products are selected from the group consisting of tobacco leaves, shredded tobacco, raw-cut tobacco, tobacco dust, tobacco powder, tobacco extract, smokeless tobacco, wet or dry snuff, mouthwash, pipe tobacco, cigar tobacco, cigarette tobacco, cigarette tobacco, and chewing tobacco. In some embodiments, the tobacco products are selected from the group consisting of cigarettes, cigarettes, clove cigarettes, filtered cigarettes, homemade cigarettes, self-rolled cigarettes, sticks or pods of heated tobacco products, cigars, tobacco-containing chewing gum, tobacco-containing lozenges, and chewing tobacco.

[0097] Embodiments of this disclosure also include methods for producing tobacco cultivars containing at least one nicotinic alkaloid at a reduced level compared to a corresponding naturally occurring tobacco plant or a portion thereof. According to these embodiments, the method includes crossing a first tobacco variety containing a first low-nicotinic trait with a second tobacco variety containing a second low-nicotinic trait to produce offspring plants. In some embodiments, the offspring plants contain at least one nicotinic alkaloid at a reduced concentration compared to either the first or second tobacco variety. In some embodiments, the method includes backcrossing. As will be appreciated by those skilled in the art, transgenic and / or non-transgenic methods can be used to produce such tobacco cultivars having at least one nicotinic alkaloid at a reduced level.

[0098] In some embodiments, and as further described above, at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, neonicotinoid, and pseudoequisetine. In some embodiments, at least one nicotinic alkaloid is nicotine, and the cultivated variety contains no more than 0.30% nicotine. In some embodiments, at least one nicotinic alkaloid is nornicotine, and the cultivated variety contains no more than 0.02% nornicotine. In some embodiments, at least one nicotinic alkaloid is neonicotinoid, and the cultivated variety contains no more than 0.01% neonicotinoid. In some embodiments, at least one nicotinic alkaloid is pseudoequisetine, and the cultivated variety contains no more than 0.002% pseudoequisetine. In some embodiments, at least one nicotinic alkaloid is nicotine and nornicotine, and the cultivated variety contains no more than 0.30% nicotine and no more than 0.02% nornicotine.

[0099] In some embodiments, and as further described above, at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, neonicotinoid, and equisetine. In some embodiments, at least one nicotinic alkaloid is nicotine, and the cultivated variety contains no more than 0.29% nicotine. In some embodiments, at least one nicotinic alkaloid is nornicotine, and the cultivated variety contains no more than 0.02% nornicotine. In some embodiments, at least one nicotinic alkaloid is neonicotinoid, and the cultivated variety contains no more than 0.01% neonicotinoid. In some embodiments, at least one nicotinic alkaloid is equisetine, and the cultivated variety contains no more than 0.002% equisetine. In some embodiments, at least one nicotinic alkaloid is nicotine and nornicotine, and the cultivated variety contains no more than 0.29% nicotine and no more than 0.02% nornicotine.

[0100] In some embodiments, and as further described above, at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, neonicotinoid, and equisetine. In some embodiments, at least one nicotinic alkaloid is nicotine, and the cultivated variety contains no more than 0.25% nicotine. In some embodiments, at least one nicotinic alkaloid is nornicotine, and the cultivated variety contains no more than 0.02% nornicotine. In some embodiments, at least one nicotinic alkaloid is neonicotinoid, and the cultivated variety contains no more than 0.01% neonicotinoid. In some embodiments, at least one nicotinic alkaloid is equisetine, and the cultivated variety contains no more than 0.002% equisetine. In some embodiments, at least one nicotinic alkaloid is nicotine and nornicotine, and the cultivated variety contains no more than 0.25% nicotine and no more than 0.02% nornicotine.

[0101] In some embodiments, the first low-nicotine trait and / or the second low-nicotine trait comprises those common to the wild type. NIC1 Compared to having reduced expression and / or function nic1 Alleles. In some implementations, the first low-nicotinic trait and / or the second low-nicotinic trait comprises alleles associated with the wild type. NIC2 Compared to having reduced expression and / or function nic2 Alleles. In some embodiments, the first tobacco variety and / or the second tobacco variety contains alleles derived from at least one of the following varieties or lines. nic1 Alleles and / or nic2 Alleles: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD609, Lonibow, Vector 21-41, LA Burley 21, LI Burley 21, and HI Burley 21. In some embodiments, the first tobacco variety and / or the second tobacco variety contains... nic1 and / or nic2 Invalid alleles (deletion). In some implementations, nic1 and / or nic2 Invalid alleles are derived from other Common tobacco Germplasm. In some implementations, the first tobacco variety and / or the second tobacco variety contains elements related to the wild type. MYC2a Compared to having reduced expression and / or function myc2a Alleles. In some implementation schemes, myc2a Alleles derived from Common tobacco .

[0102] In some embodiments of the method, the first low nicotinic trait comprises that of the wild type NIC1 and / or NIC2 Compared to having reduced expression and / or function nic1 Alleles and / or nic2 Alleles, and the second low nicotinic trait includes alleles from the wild type. MYC2a Compared to having reduced expression and / or function myc2a Alleles. In some embodiments of the method, the first tobacco variety, the second tobacco variety, and the progeny plants are non-GMO.

[0103] Embodiments of this disclosure also include seeds or cells obtained from progeny plants produced according to any of the methods described herein.

[0104] Embodiments of this disclosure also include tobacco products derived from progeny plants produced according to any of the methods described herein. In some embodiments, the products are selected from the group consisting of tobacco leaves, shredded tobacco, raw-cut tobacco, tobacco dust, tobacco powder, reconstituted tobacco, tobacco extract, smokeless tobacco, wet or dry snuff, mouthwash, pipe tobacco, cigar tobacco, cigarette tobacco, cigarette tobacco, and chewing tobacco. In some embodiments, the products are selected from the group consisting of cigarettes, cigarettes, clove cigarettes, filtered cigarettes, homemade cigarettes, self-rolled cigarettes, sticks or pods of heated tobacco products, cigars, snuff, mouthwash, tobacco-containing chewing gum, tobacco-containing lozenges, and chewing tobacco. Homemade cigarettes are produced using empty cigarette tubes and a benchtop injector that injects tobacco filler into the empty cigarette tube. Self-rolled cigarettes are handmade by rolling typical flat cigarette paper. Tobacco heating devices (also known as heated non-combustible products or heated tobacco products) are electronic devices that heat tobacco in a pod or stick of the device below its combustion point, thereby producing an aerosol (smokeless) that can be inhaled. Commercial examples include IQOS® and glo®.

[0105] The embodiments disclosed herein also include generating a product with reduced nicotine alkaloid content. Common tobacco Plant-based methods. According to these embodiments, the methods include... Common tobacco In plants, combinations of: (a) one or more genetic modifications that reduce the expression and / or function of MYC2A; and (b) nic1 recessive alleles and / or nic2 The recessive allele. In some implementations, such as compared to the corresponding naturally occurring or non-transformed control tobacco plant, Common tobacco The plants have reduced levels of nicotinic alkaloids. In some embodiments of the method, Common tobacco Plants contain nic1 homozygous recessive alleles and / or nic2 The homozygous recessive allele.

[0106] In some embodiments of the method, one or more genetic modifications that reduce the expression and / or function of MYC2A are introduced via transcription activator-like effector nucleases (TALENs), large-scale nucleases, zinc finger nucleases, CRISPR / Cas9 systems, CRISPR / Cpf1 systems, CRISPR / Csm1 systems, gene knock-in technology or techniques, or any combination thereof.

[0107] In some implementations, the method further includes suppressing Common tobacco The expression of at least one of the following in plants: BBL (also known as) NBB1 ), A622 Quinolinate phosphoribosyltransferase ( QPT ), putrescine N- Methyltransferase ( PMT Ornithine decarboxylase ( ODC ), aspartate oxidase ( AO ), quinolinate synthase ( QS ), N -Methyl putrescine oxidase ( MPO ), NtERF221 , NtMYC1a , NtMYC1b or NtMYC2b In some implementations, the cultivar is the NCLA161 cultivar, or a cultivar derived from it.

[0108] The embodiments of this disclosure also include those generated by the methods described herein. Common tobacco Plants. In some embodiments of the method, the plant comprises: (a) one or more genetic modifications that reduce the expression and / or function of MYC2A; and (b) nic1 recessive alleles and / or nic2 The recessive allele.

[0109] Embodiments of this disclosure also include progeny plants or seeds derived from any of the plants described herein. In some embodiments, the progeny plants or seeds comprise: (a) one or more genetic modifications that reduce the expression and / or function of MYC2A; and (b) nic1 recessive alleles and / or nic2 The recessive allele.

[0110] The embodiments disclosed herein also include any content derived therefrom. Common tobacco Tobacco products derived from the plant. In some embodiments, said plant comprises: (a) one or more genetic modifications that reduce the expression and / or function of MYC2A; and (b) nic1 recessive alleles and / or nic2 The recessive allele.

[0111] In some embodiments, the tobacco is selected from the group consisting of tobacco leaves, shredded tobacco, raw-cut tobacco, tobacco dust, tobacco powder, tobacco extract, smokeless tobacco, wet or dry snuff, mouthwash, pipe tobacco, cigar tobacco, cigarette tobacco, cigarette tobacco, and chewing tobacco. In some embodiments, the product is a nicotine-reduced tobacco product selected from the group consisting of cigarettes, cigarettes, clove cigarettes, filtered cigarettes, homemade cigarettes, self-rolled cigarettes, sticks or pods of heated tobacco products, cigars, snuff, mouthwash, tobacco-containing chewing gum, tobacco-containing lozenges, and chewing tobacco.

[0112] Sequences. The following nucleic acid sequences are referenced throughout this disclosure.

[0113] wild type myc2a (K326):

[0114] Cut off myc2a (TI 313, from Burner et al. 2022): ATGACGGATTATAGAATACCAACGATGACTAATATATGGAGCAATACTACATCCGATGATAATATGATGGAAGCTTTTTTATCTTCTGATCCGTCGTCGTTTTGGCCCGGAACAACTACTACACCAACTCCCCGGA GTTCAGTTTCTCCAGCGCCGGCCGGTGACGGGGATTGCCGGAGACCCATTAAAGTCTATGCCATATTTCAACCAAGAGTCACTGCAACAGCGACTCCAGACTTTAATCGATGGGGCTCGCAAAGGGTGGACGTAT GCCATATTTTGGCAATCGTCTGTTGTGGATTTCGCGAGCCCCTCGGTTTTGGGGTGGGGAGATGGGTATTATAAAAGGTGAAGAAGATAAAAATAAGCGTAAAACGGCGTCGTTTTCGCCTGACTTTATCACGGAAC AAGCACACCGGAAAAAGGTTCTCCGGGAGCTGAATTCTTTAATTTCCGGCACACAAACCGGTGGTGAAAATGATGCTGTAGATGAAGAAGTAACTGATACTGAATGGTTTTATTTCCATGACACAATCGTTTGTTAA (SEQ ID NO: 2).

[0115] 3. Example It will be apparent to those skilled in the art that other suitable modifications and adaptations to the methods of this disclosure described herein are readily applicable and understandable, and can be made using suitable equivalents without departing from the scope of this disclosure or the aspects and embodiments disclosed herein. Having now been described in detail, this disclosure will be more clearly understood by reference to the following examples, which are intended only to illustrate some aspects and embodiments of this disclosure and should not be considered as limiting the scope of this disclosure. All journal references, U.S. patents, and published disclosures cited herein are hereby incorporated in their entirety by reference.

[0116] This disclosure has several aspects, which are illustrated by the following non-limiting examples.

[0117] Example 1 Given the potential for countries worldwide (including the United States) to mandate reductions in nicotine levels in conventional cigarettes below the so-called "sub-addictive threshold," there is commercial interest in tobacco cultivars that produce flue-cured tobacco leaves with nicotine levels that enable manufacturers to achieve target nicotine levels. Currently, regulatory agencies are discussing and / or recommending nicotine levels in cigarette fillers ranging from 0.04% to 0.08%. The tobacco industry has not yet acquired superior flue-cured tobacco cultivars with good agronomical performance that consistently accumulate such low levels of nicotine (averaged across all stem locations under conventional agronomic management systems).

[0118] Therefore, embodiments of this disclosure include a newly established tobacco hybrid NCLA161 (derived from LAFC53) with low nicotine content. nic1 Alleles and nic2 Alleles and from Common tobacco mutation myc2a Allele combinations). Factors affecting low nicotine content NIC1 loci and NIC2 The genetic variation at the locus is derived from the flue-cured tobacco breeding line LAFC53 (Chaplin, 1975). Mutant alleles myc2a The source is tobacco introduced from TI 313 (Burner et al., 2022). Backcross breeding methods (Fehr, 1987) were used to introduce varieties from LAFC53. nic1 and nic2 Alleles and mutants derived from TI 313 myc2a Alleles were combined in a triple homozygous state within the superior genetic background of the flue-cured tobacco cultivar "K326". Six generations of backcrossing were performed, followed by two generations of self-pollination to establish a stable triple homozygous BC6F3 line, named NCLA161. The NCLA161 cultivar is non-GMO.

[0119] More specifically, NCLA161, K326, and K326 22 (a near-isogenic, recessive version of the previously developed K326) were included. nic1 Alleles and nic2Five plants from each allele backcross were transplanted into 3.79-liter pots in a greenhouse. The greenhouse experiment was designed as a randomized complete block design, with the bottom of the pots submerged 1 to 2 inches in a 5-gallon bucket of water for bottom irrigation purposes. To stimulate alkaloid biosynthesis, the plants were pinched (removal of the terminal inflorescence or apical meristem) when approximately 50% of the plants were flowering. After pinching, lateral meristems (suckers) were manually removed from the leaf axils approximately every other day until the leaves were harvested. Twenty-one days after pinching, the top two leaves were harvested from each plant, treated with ethephon as recommended by the manufacturer (Arysta LifeScience, Cary, NC), air-dried, and ground to pass through a 1 mm sieve. The alkaloid profile was determined using gas chromatography according to a previously described method (Lewis et al. 2015).

[0120] The average nicotine content of NCLA161 was found to be approximately 1% of the average nicotine content of K326 and approximately 40% of the average nicotine content of K326 22 (Table 1), thus indicating that... nic1 , nic2 and myc2a The novel mutated genotype exhibits an ideal combined effect in reducing nicotine content in tobacco leaves. (Compared to K326) itself Compared to the observed concentrations, no nicotine, pseudoequiline, and neonicotine were not detected in NCLA161.

[0121] Table 1: Average alkaloid content in the top two leaves of three tobacco genotypes assessed in a greenhouse experiment (“nd” indicates undetectable levels).

[0122]

[0123] These results indicate that the novel hybrid cultivar NCLA161 of this disclosure accumulates nicotine levels lower than those of many other publicly reported cultivars. As described herein, this novel hybrid was developed using naturally occurring genetic variation and conventional breeding methods (i.e., without the use of gene editing, genetic engineering, or novel breeding methods). This hybrid can be grown anywhere in the world without concern for regulations regarding breeding outcomes involving gene editing or genetic engineering. Therefore, the tobacco hybrid NCLA161 has a commercial advantage due to its less regulatory burden, as it is a non-GMO, non-genetically engineered plant with very low levels of nicotine, nornicotine, pseudoequisetine, and neonicotine. Based on these data, embodiments of this disclosure include cultivars of NCLA161, or cultivars derived therefrom.

[0124] Example 2 Field studies were conducted to assess the level of nicotinic alkaloid reduction in the tobacco cultivars disclosed herein. K326 and three backcross-derived low-alkaloid inbred lines were evaluated in two field settings in North Carolina during the 2023 growing season. Experiments were conducted at the Upper Coast Plains Research Station (Rocky Mountains, North Carolina) and the Oxford Tobacco Research Station (Oxford, North Carolina). The experimental design used in each setting was a randomized, fully block design, replicated three times. Plots consisted of a single 20-row plant arrangement and were managed according to standard flue-cured tobacco production practices in North Carolina. At each location, the in-row spacing and inter-row spacing were 56 cm and 122 cm, respectively.

[0125] Tobacco plots were harvested in each of two environments during four separate tobacco harvests, based on maturity rate and maturity. Harvested leaves were cured and weighed. A composite sample of fifty grams of air-dried leaves was collected from each plot using a weighted average basis. The dried samples were ground and their alkaloid composition was analyzed using gas chromatography, and the results are presented in Table 2 below.

[0126] Table 2: Mean values ​​of K326 and backcross-derived low-alkaloid lines in two field environments in North Carolina in 2023. (LSD = Least significant difference.)

[0127] Unless otherwise stated, all analyte measurements of the materials described herein (e.g., nicotine) are performed on a dry weight basis. Based on this disclosure, those skilled in the art will recognize that the levels of nicotine, nornicotine, neonicotine, and pseudoestipine can be measured using a variety of methods known in the art. For example, nicotine alkaloids can be quantified using gas chromatography (GC) and high-performance liquid chromatography (HPLC). (See, for example, Lisko et al. 2013, AnalChem. March 19; 85(6): 3380-3384, which provides a method for measuring the amount of nicotine alkaloids in cigarette filters and tobacco.) Analysis of tobacco alkaloids (e.g., nornicotine, neonicotine, and pseudoestipine) can also be performed using gas chromatography (GC) in conjunction with a wide range of detection techniques, including but not limited to flame ionization detection (FID), nitrogen-phosphorus detection (NPD), and mass spectrometry (MS). Other analytical methods include high performance liquid chromatography-ultraviolet detection (HPLC-UV), capillary zone electrophoresis-ultraviolet detection (CZE-UV), micelle electrokinetic capillary chromatography-ultraviolet detection (MECC-UV), nitrogen chemiluminescence detection (NCD), and microemulsion electrokinetic chromatography-ultraviolet detection (MEEKC-UV).

[0128] Biological Preservation Regenerated material from the breeding line NCLA161 is deposited at the Department of Crop and Soil Sciences, North Carolina State University, Raleigh, NC 27695. Specifically, NCLA161 is deposited under accession number N23-303-2. Samples of biomaterial from either line may be obtained by a third-party expert with prior NCSU approval by submitting a written application to the Ramsey S. Lewis University Faculty Scholar and Charles and Marilyn Stuber Distinguished Professor of Plant Breeding (Department of Crop and Soil Sciences, North Carolina State University, Raleigh, P.O. Box 7620, NC 27695 (Tel: (919)-513-4802)).

[0129] Except 37 CFR Except as permitted in 1.808(b), once a patent is granted from this application or in any application that cites this application for priority purposes, all restrictions imposed on the publicly available deposited biological material shall be irrevocably removed.

Claims

1. A tobacco cultivar or any part thereof comprising reduced levels of at least one nicotine class alkaloid compared to a corresponding naturally occurring tobacco plant or part thereof.

2. The tobacco cultivar of claim 1, wherein the cultivar is non-transgenic.

3. The tobacco cultivar of claim 1 or claim 2, wherein the at least one nicotine class alkaloid is selected from the group consisting of nicotine, nornicotine, anatabine, and pseudotabacine.

4. The tobacco cultivar of any one of claims 1 to 3, wherein the at least one nicotine class alkaloid is nicotine, and wherein the cultivar comprises no more than 0.29% nicotine.

5. The tobacco cultivar of any one of claims 1 to 4, wherein the at least one nicotine class alkaloid is nornicotine, and wherein the cultivar comprises no more than 0.02% nornicotine.

6. The tobacco cultivar of any one of claims 1 to 5, wherein the at least one nicotine class alkaloid is anatabine, and wherein the cultivar comprises no more than 0.01% anatabine.

7. The tobacco cultivar of any one of claims 1 to 6, wherein the at least one nicotine class alkaloid is pseudotabacine, and wherein the cultivar comprises no more than 0.002% pseudotabacine.

8. The tobacco cultivar of claim 1 or claim 2, wherein the at least one nicotine class alkaloid is nicotine and nornicotine, and wherein the cultivar comprises no more than 0.29% nicotine and no more than 0.02% nornicotine.

9. The tobacco cultivar variety of any one of claims 1 to 8, wherein the cultivar variety comprises a wild type NIC1 allele having reduced expression and / or function of nic1 a gene.

10. The tobacco cultivar variety of any one of claims 1 to 9, wherein the cultivar variety comprises a wild type NIC2 allele having reduced expression and / or function of nic2 a gene.

11. The tobacco cultivar as claimed in claim 9 or claim 10, wherein the nic1 allele and / or the nic2 allele is derived from at least one of the following lines: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD 609, Lonibow, Vector 21-41, LA Burley 21, LI Burley 21, and HI Burley 21.

12. The tobacco cultivar variety of any one of claims 1 to 8, wherein the cultivar variety comprises a wild type MYC2a allele having reduced expression and / or function of myc2a a gene.

13. The tobacco cultivar variety of claim 12, wherein the myc2a allele comprises at least one nucleotide deletion relative to the wild-type MYC2a allele set forth in SEQ ID NO:

1.

14. The tobacco cultivar variety of claim 12, wherein the myc2a allele comprises a deletion of one to five nucleotides relative to the wild-type MYC2a allele set forth in SEQ ID NO:

1.

15. The tobacco cultivar variety of claim 12, wherein the myc2a allele comprises a deletion of five nucleotides relative to the wild-type MYC2a allele set forth in SEQ ID NO:

1.

16. The tobacco cultivar of any one of claims 13 to 15, wherein the deletion results in a truncated MYC2A protein.

17. The tobacco cultivar variety of any one of claims 12 to 16, wherein the myc2a The allele comprises a nucleic acid sequence that is at least 70% identical to SEQ ID NO:

2.

18. The tobacco cultivar variety of any one of claims 12 to 16, wherein the myc2a The allele comprises a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

2.

19. The tobacco cultivar variety of any one of claims 12 to 16, wherein the myc2a The allele comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO:

2.

20. The tobacco cultivar variety of any one of claims 12 to 19, wherein said myc2a The alleles are derived from Nicotiana tabacum .

21. The tobacco cultivar according to any one of claims 9 to 20, wherein the cultivar further comprises suppression of expression of at least one of the following within the cultivar: NBB1 , A622 , quinolinate phosphoribosyl transferase QPT , putrescine N- methyltransferase PMT , ornithine decarboxylase ODC , aspartate oxidase AO , quinolinate synthase QS , N - methylputrescine oxidase MPO , NtERF221 , NtMYC1a , NtMYC1b or NtMYC2b .

22. The tobacco cultivar of any one of claims 1 to 22, wherein the cultivar is the NCLA161 cultivar, or is derived therefrom.

23. A progeny plant, seed, or cell produced from any one of the tobacco cultivars of claims 1 to 22.

24. A tobacco product derived from any one of the tobacco cultivars or parts thereof of claims 1 to 22.

25. The tobacco product of claim 24, wherein the product is selected from the group consisting of a tobacco leaf, a tobacco shred, a cut rag, a tobacco dust, a tobacco powder, a reconstituted tobacco, a tobacco extract, a smokeless tobacco, a moist or dry snuff, a chewing tobacco, a pipe tobacco, a cigar tobacco, a little cigar tobacco, a cigarette tobacco, and a chewing tobacco.

26. The tobacco product of claim 24, wherein the product is selected from the group consisting of a little cigar, a cigarette, a cigarillo, a filter cigarette, a roll-your-own cigarette, a roll-your-own cigarette, a stick or pod of a heat-not-burn tobacco product, a cigar, a chewing tobacco, a tobacco-containing gum, a tobacco-containing lozenge, and a chewing tobacco.

27. A method of producing a tobacco cultivar comprising reduced levels of at least one nicotine alkaloid as compared to a corresponding naturally occurring tobacco plant or portion thereof, the method comprising: crossing a first tobacco variety comprising a first low nicotine trait with a second tobacco variety comprising a second low nicotine trait to produce a progeny plant; wherein the progeny plant comprises reduced concentrations of at least one nicotine alkaloid as compared to the first tobacco variety or the second tobacco variety.

28. The method of claim 27, wherein the method comprises backcrossing.

29. The method of claim 27 or claim 28, wherein the at least one nicotine alkaloid is selected from the group consisting of nicotine, nornicotine, anatabine, and pseudotabacine.

30. The method of any one of claims 27 to 29, wherein the at least one nicotine alkaloid is nicotine, and wherein the cultivar comprises no more than 0.29% nicotine.

31. The method of any one of claims 27 to 30, wherein the at least one nicotine alkaloid is nornicotine, and wherein the cultivar comprises no more than 0.02% nornicotine.

32. The method of any one of claims 27 to 31, wherein the at least one nicotine alkaloid is anatabine, and wherein the cultivar comprises no more than 0.01% anatabine.

33. The method of any one of claims 27 to 32, wherein the at least one nicotine alkaloid is pseudotabacine, and wherein the cultivar comprises no more than 0.002% pseudotabacine.

34. The method of any one of claims 27 to 33, wherein the at least one nicotine alkaloid is nicotine and nornicotine, and wherein the cultivar comprises no more than 0.29% nicotine and no more than 0.02% nornicotine.

35. The method of any one of claims 27-34, wherein the first low nicotine trait and / or the second low nicotine trait comprises an allele having reduced expression and / or function of NIC1 compared to a wild type nic1 allele.

36. The method of any one of claims 27-35, wherein the first low nicotine trait and / or the second low nicotine trait comprises an allele having reduced expression and / or function of NIC2 compared to a wild type nic2 allele.

37. The method of any one of claims 27 to 36, wherein the first tobacco variety and / or the second tobacco variety comprises nic1 the allele and / or nic2 the allele: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD 609, Lonibow, Vector 21-41, LA Burley 21, LIBurley 21, and HI Burley 21.

38. The method of any one of claims 27 to 37, wherein the first tobacco variety and / or the second tobacco variety comprises an allele with reduced expression and / or function of MYC2a a wild type myc2a a wild type 39. The method of claim 38, wherein the myc2a allele comprises at least one nucleotide deletion relative to the wild-type MYC2a allele set forth in SEQ ID NO:

1.

40. The method of claim 39, wherein the myc2a allele comprises a deletion of one to five nucleotides relative to the wild-type MYC2a allele set forth in SEQ ID NO:

1.

41. The method of claim 40, wherein the myc2a allele comprises a deletion of five nucleotides relative to the wild-type MYC2a allele set forth in SEQ ID NO:

1.

42. The method of any one of claims 39 to 41, wherein the deletion results in a truncated MYC2A protein.

43. The method of any one of claims 39 to 42, wherein the myc2a The allele comprises a nucleic acid sequence that is at least 70% identical to SEQ ID NO:

2.

44. The method of any one of claims 39 to 42, wherein the myc2a The allele comprises a nucleic acid sequence that is at least 80% identical to SEQ ID NO:

2.

45. The method of any one of claims 39 to 42, wherein the myc2a The allele comprises a nucleic acid sequence that is at least 90% identical to SEQ ID NO:

2.

46. The method of any one of claims 39 to 45, wherein the myc2a alleles are derived from Common tobacco Nicotiana tabacum .

47. The method of any one of claims 27 to 46, wherein the first low nicotinic trait comprises that of the wild type NIC1 and / or NIC2 Compared to having reduced expression and / or function nic1 Alleles and / or nic2 Alleles, and wherein the second low nicotinic trait comprises alleles with wild type MYC2a Compared to having reduced expression and / or function myc2a Alleles.

48. The method of any one of claims 27 to 47, wherein the first tobacco variety, the second tobacco variety, and the progeny plant are non-genetically modified.

49. A seed or cell obtained from the progeny plant produced according to the method of claim 48.

50. A tobacco product derived from the progeny plant produced according to the method of claim 48.

51. The tobacco product of claim 50, wherein the product is selected from the group consisting of a tobacco leaf, a tobacco shred, a cut tobacco, a tobacco dust, a tobacco powder, a reconstituted tobacco, a tobacco extract, a smokeless tobacco, a moist or dry snuff, a chewing tobacco, a pipe tobacco, a cigar tobacco, a little cigar tobacco, a cigarette tobacco, and a chewing tobacco.

52. The tobacco product of claim 50, wherein the product is selected from the group consisting of a little cigar, a cigarette, a clove cigarette, a filter cigarette, a roll-your-own cigarette, a roll-your-own cigarette, a stick or pod of a heat tobacco product, a cigar, a chewing tobacco, a tobacco-containing chewing gum, a tobacco-containing lozenge, and a chewing tobacco.

53. A method for producing a product with reduced nicotinic alkaloid content. Nicotiana tabacum The plant method, the method comprising: In Nicotiana tabacum Combinations in plants: (a) one or more genetic modifications that reduce expression and / or function of MYC2A; and (b) nic1 a recessive allele of the gene encoding the protein of SEQ ID NO: 1 and / or nic2 a recessive allele of the gene encoding the protein of SEQ ID NO:

2. wherein said plants have reduced content of nicotine alkaloids as compared to corresponding naturally occurring or non-transformed control tobacco plants Nicotiana tabacum The plants have reduced content of nicotine alkaloids.

54. The method of claim 53, wherein the Nicotiana tabacum plant comprises nic1 a homozygous recessive allele of and / or nic2 a homozygous recessive allele of.

55. The method of claim 53 or claim 54, wherein the one or more genetic modifications that reduce expression and / or function of MYC2A are introduced by a Transcription Activator-Like Effector Nuclease (TALEN), a meganuclease, a zinc finger nuclease, a CRISPR / Cas9 system, a CRISPR / Cpfl system, a CRISPR / Csm1 system, a gene knock-in technology or technology, or any combination thereof.

56. The method of any one of claims 53 to 55, further comprising suppressing the expression of at least one of: Nicotiana tabacum putrescine NBB1 , A622 , quinolinate phosphoribosyltransferase QPT ), putrescine N- methyltransferase PMT ), ornithine decarboxylase ODC ), aspartate oxidase AO ), quinolinate synthase QS , N putrescine N-methyltransferase MPO , NtERF221 , NtMYC1a , NtMYC1b or NtMYC2b in the plant.

57. A method of producing a plant comprising: (a) reducing expression and / or function of MYC2A; and (b) reducing expression and / or function of MYC2B. Nicotiana tabacum A plant produced by the method of any one of claims 53-56, wherein the plant comprises: (a) one or more genetic modifications that reduce expression and / or function of MYC2A; and (b) nic1 a recessive allele of MYC2A and / or nic2 a recessive allele of MYC2B.

58. A progeny plant or seed produced from the plant of claim 57, wherein the progeny plant or seed comprises: (a) one or more genetic modifications that reduce expression and / or function of MYC2A; and (b) nic1 a recessive allele of MYC2A and / or nic2 a recessive allele of MYC2B.

59. A tobacco product comprising the tobacco from the plant of claim 57 Nicotiana tabacum tobacco, wherein the plant comprises: (a) one or more genetic modifications that decrease expression and / or function of MYC2A; and (b) nic1 a recessive allele of MYC2A and / or nic2 a recessive allele of MYC2A.

60. The tobacco product of claim 59, wherein: (a) the tobacco is selected from the group consisting of a tobacco leaf, a tobacco shred, a cut tobacco, a tobacco dust, a tobacco powder, a reconstituted tobacco, a tobacco extract, a smokeless tobacco, a moist or dry snuff, a chewing tobacco, a pipe tobacco, a cigar tobacco, a little cigar tobacco, a cigarette tobacco, and a chewing tobacco; or (b) the product is a reduced nicotine tobacco product selected from the group consisting of a little cigar, a cigarette, a clove cigarette, a filter cigarette, a roll-your-own cigarette, a roll-your-own cigarette, a stick or pod of a heat tobacco product, a cigar, a snuff, a chewing tobacco, a tobacco-containing chewing gum, a tobacco-containing lozenge, and a chewing tobacco.

Images