T cell receptors that bind presented HPV16, MART1, CMV, EBV, or influenza peptides

Abstract

Described herein are isolated T cell receptors that specifically bind to HPV16, MART1, CMV, EBV, or influenza peptides displayed by HLA, and therapeutic and diagnostic methods of using these isolated TCRs.

Description

[0001] Cross-references to related applications This application claims priority to U.S. Provisional Application No. 63 / 579,554, filed August 30, 2023, and U.S. Provisional Application No. 63 / 504,425, filed May 25, 2023, the disclosures of which are hereby incorporated in their entirety.

[0002] sequence list The XML sequence list titled “11384WO01 Sequence Listing XML.xml” was created on May 22, 2024, and is 1222 Kb in size. It is incorporated in this paper by full reference. Background Technology

[0003] The T-cell receptor (TCR) is a membrane-bound heterodimer consisting of α and β chains, each resembling the variable (V) and constant (C) regions of an immunoglobulin. The TCR α chain includes a V-α chain covalently linked to the C-α chain, while the β chain includes a V-β chain covalently linked to the C-β chain. The V-α and V-β chains form a pocket or cleft that allows antigens to bind in the context of the major histocompatibility complex (MHC), known as the HLA complex in humans.

[0004] T-cell receptors (TCRs) are major effectors of the immune system and offer unique advantages as a platform for developing therapeutics. Conventional antibody therapies are limited to recognizing pathogens in the blood and extracellular space, or protein targets on the cell surface, while T-cell receptors recognize antigens displayed by MHC molecules on the cell surface, including antigens derived from intracellular proteins. Depending on the T-cell subtype that recognizes and activates the antigen-displaying T-cell, TCRs can participate in controlling various immune responses. For example, T cells participate in regulating humoral immune responses by inducing B cells to differentiate into antibody-producing cells. Additionally, activated T cells can initiate cell-mediated immune responses. Therefore, TCRs can recognize other targets that antibodies cannot. Furthermore, TCRs have been reported to mediate cell killing, increase B-cell proliferation, and influence the development and severity of various conditions, including cancer, allergies, viral infections, and autoimmune diseases.

[0005] Given the function of TCRs, antigen-specific TCRs have been evaluated for use in immunotherapy because they can redirect T cells to tumors expressing antigens of interest. TCRs bind to small peptides, only 8-12 amino acids in length, which are bound to the surface of target cells via the major histocompatibility complex (MHC). Therefore, TCRs can recognize intracellular antigens derived from cancer or viral proteins, as these antigens are processed and manifested as peptides in the surface MHC environment. Thus, TCRs can recognize additional internal cellular targets that conventional antibodies or therapies cannot penetrate cells.

[0006] Identifying epitopes of T-cell responses is crucial for understanding T-cell-mediated immunity. Primary cells derived from hypovolemic cells still require identification of low-frequency T-cell reactivity, from which paired TCR ligand information can be directly used to select immunogenic antigens for vaccine epitope inclusion, antigen-specific TCR tracking, and TCR cloning for further therapeutic development. Summary of the Invention

[0007] Defined paired epitope specificity and TCR sequences were evaluated using the Rapid TCR:Epitope Sequencing (RAPTER) assay, a single-cell RNA sequencing (scRNA-SEQ) method that uses primary human T cells and antigen-presenting cells (APCs) to assess functional T cell reactivity at single-cell resolution, as well as hash-tag oligonucleotide (HTO) encoding and T cell activation-inducing markers (AIMs). This paper describes low-frequency circulating HPV16-specific T cell clones from cervical cancer patients. Additionally, this paper describes T cell receptors (TCRs) targeting MART1, EBV, CMV, and influenza epitopes identified by RAPTER, which have been functionally confirmed in in vitro assays.

[0008] In some embodiments, the present invention provides a TCR (e.g., an isolated TCR or a TCR expressed on isolated cells) that specifically binds to HLA-presented HPV16, MART1, CMV, EBV, or influenza peptides, and is identified using the RAPTER method, wherein the antigen-binding protein exhibits one or more of the following characteristics: (i) comprising an α-chain variable (TCR Vα) domain containing complementarity-determining regions (αCDR) 1, αCDR2, and / or αCDR3 that are at least 95% identical to the amino acid sequences shown in Table 9; and / or (ii) comprising a β-chain variable (TCR Vβ) domain containing complementarity-determining regions (βCDR) 1, βCDR2, and / or βCDR3 that are at least 95% identical to the amino acid sequences shown in Table 9; and / or (iii) comprising a TCR Vα domain that is at least 95% identical to the amino acid sequences shown in Table 9; and / or (iv) a TCR that is at least 95% identical to the amino acid sequences shown in Table 9. Vβ domain; and / or (v) nonspecific binding to cells expressing predicted off-target peptides but not binding to HLA-presented HPV16, MART1, CMV, EBV, or influenza peptides, as determined by luminescent bioassay; and / or (vi) activation of T cell responses approximately twice that of patient-derived HPV16, MART1, CMV, EBV, or influenza-specific TCRs, for example, activation of T cell responses approximately twice, three times, or four times that of patient-derived HPV16, MART1, CMV, EBV, or influenza-specific TCRs, as determined by luminescent bioassay of TCR-mediated T cell signaling.

[0009] This article also describes isolated cells expressing the TCR variable domains and / or TCR α / β variable domain pairs described herein; isolated polynucleotide molecules encoding the TCR variable domains and / or TCR α / β variable domain pairs described herein; targeting vectors containing the polynucleotides described herein; isolated cells expressing the targeting vectors described herein; and pharmaceutical compositions containing the TCR variable domains and / or TCR α / β variable domain pairs, cells, and / or polynucleotides described herein. Methods using the following are also described: (i) a TCR α / β variable domain specific to HPV16 peptides as described herein, for example, in methods for treating HPV-16-related diseases in patients in need; (ii) a TCR α / β variable domain specific to MART1 peptides as described herein, for example, in methods for treating MART1-related diseases in patients in need; (iii) a TCR α / β variable domain specific to EBV peptides as described herein, for example, in methods for treating EBV-related diseases in patients in need; or (iv) a TCR α / β variable domain specific to influenza peptides as described herein, for example, in methods for treating influenza in patients in need.

[0010] Therefore, this article provides a T cell receptor (TCR) or its variable domain, comprising: (i) a TCRα variable (TCR Vα) domain containing TCRα complementarity-determining regions (αCDR) 1, αCDR2, and / or αCDR3 that are 90% identical to the amino acid sequences of αCDR1, αCDR2, and / or αCDR3 shown in Table 9; and / or (ii) a TCRβ variable (TCR Vβ) domain containing TCRβ complementarity-determining regions (βCDR) 1, βCDR2, and / or βCDR3 that are 90% identical to the amino acid sequences of βCDR1, βCDR2, and / or βCDR3 shown in Table 9, wherein the TCR or its variable domain specifically binds to HLA-presenting peptides, and optionally wherein the TCR or its variable domain has been identified using a rapid TCR:epitope sequencing (RAPTER) assay.

[0011] In some embodiments, the TCR or its variable domains described herein comprise: (i) αCDR3, which comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of the αCDR3 domain of the TCR shown in Table 9; and / or (ii) βCDR3, which comprises an amino acid sequence that is at least 95% identical to the amino acid sequence of the βCDR3 domain of the TCR shown in Table 9.

[0012] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR1-αCDR2-αCDR3 amino acid sequence set that is at least 95% identical to the αCDR1-αCDR2-αCDR3 amino acid sequence set of the TCR Vα domain shown in Table 9; and / or (ii) a βCDR1-βCDR2-βCDR3 amino acid sequence set that is at least 95% identical to the βCDR1-βCDR2-βCDR3 amino acid sequence set of the TCR Vβ domain shown in Table 9.

[0013] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain containing an amino acid sequence that is at least 95% identical to the amino acid sequence of the TCR Vα domain shown in Table 9; and / or (ii) a TCR Vβ domain containing an amino acid sequence that is at least 95% identical to the amino acid sequence of the TCR Vβ domain shown in Table 9.

[0014] In some embodiments, the TCR or its variable domains described herein comprise: (i) αCDR3, which comprises an amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence of the TCR Vα / Vβ amino acid sequence pair shown in Table 9; and (ii) βCDR3, which comprises an amino acid sequence that is at least 95% identical to the βCDR3 amino acid sequence of the TCR Vα / Vβ amino acid sequence pair shown in Table 9.

[0015] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR1-αCDR2-αCDR3 amino acid sequence set that is at least 95% identical to the αCDR1-αCDR2-αCDR3 amino acid sequence set of the TCR Vα domain shown in Table 9; and (ii) a βCDR1-βCDR2-βCDR3 amino acid sequence set that is at least 95% identical to the βCDR1-βCDR2-βCDR3 amino acid sequence set of the TCR Vβ domain shown in Table 9.

[0016] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain containing an amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence of the TCR Vα / Vβ amino acid sequence pairs shown in Table 9; and (ii) a TCR Vβ domain containing an amino acid sequence that is at least 95% identical to the TCR Vβ domain amino acid sequence of the TCR Vα / Vβ amino acid sequence pairs shown in Table 9.

[0017] In some embodiments, the TCR or its variable domains described herein comprise: (i) αCDR3, which comprises the αCDR3 amino acid sequence of the TCR Vα domain as shown in Table 9; and / or (ii) βCDR3, which comprises the βCDR3 amino acid sequence of the TCR Vβ domain as shown in Table 9.

[0018] In some embodiments, the TCR or its variable domains described herein comprise: (i) the αCDR1-αCDR2-αCDR3 amino acid sequence set of the TCRVα domain as shown in Table 9; and / or (ii) the βCDR1-βCDR2-βCDR3 amino acid sequence set of the TCR Vβ domain as shown in Table 9.

[0019] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain comprising the TCR Vα domain amino acid sequence as shown in Table 9; and / or (ii) a TCR Vβ domain comprising the TCR Vβ domain amino acid sequence as shown in Table 9.

[0020] In some embodiments, the TCR or its variable domains described herein comprise: (i) αCDR3, which comprises the αCDR3 amino acid sequence of the TCR Vα / Vβ amino acid sequence pair as shown in Table 9; and (ii) βCDR3, which comprises the βCDR3 amino acid sequence of the TCR Vα / Vβ amino acid sequence pair as shown in Table 9.

[0021] In some embodiments, the TCR or its variable domains described herein comprise: (i) the set of αCDR1-αCDR2-αCDR3 amino acid sequences of the TCR Vα / Vβ amino acid sequence pairs as shown in Table 9; and (ii) the set of βCDR1-βCDR2-βCDR3 amino acid sequences of the TCR Vα / Vβ amino acid sequence pairs as shown in Table 9.

[0022] In some embodiments, the TCR or its variable domain described herein comprises: (i) the TCR Vα amino acid sequence of the TCR Vα / Vβ amino acid sequence pair as shown in Table 9; and (ii) the TCRVβ amino acid sequence of the TCR Vα / Vβ amino acid sequence pair as shown in Table 9.

[0023] In some implementations, the HLA-presenting peptide includes the HPV16 peptide.

[0024] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 133, 149, 165, 181, 197 and 213; and / or (ii) a βCDR3 amino acid sequence that is at least 95% identical to a βCDR3 sequence selected from the group consisting of SEQ ID NO: 141, 157, 173, 189, 205 and 221.

[0025] In some embodiments, the TCR or its variable domains described herein comprise: (i) an amino acid sequence set αCDR1-αCDR2-αCDR3 that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 129-131-133, 145-147-149, 161-163-165, 177-179-181, 193-195-197 and 209-211-213; and / or (ii) an amino acid sequence set βCDR1-βCDR2-βCDR3 that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 137-139-141, 153-155-157, 169-171-173, 185-187-189, 201-203-205 and 217-219-221.

[0026] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to a TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 135, 151, 167, 183, 199 and 215; and / or (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to a TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 143, 159, 175, 191, 207 and 223.

[0027] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 133, 149, 165, 181, 197 and 213; and (ii) a βCDR3 amino acid sequence that is at least 95% identical to a βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 141, 157, 173, 189, 205 and 221.

[0028] In some implementations, the TCR or its variable domain described herein includes: In some embodiments, the TCR or its variable domain described herein contains an αCDR3 / βCDR3 amino acid sequence pair that is at least 95% identical to the αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205 and 213 / 221.

[0029] In some embodiments, the TCR or its variable domains described herein comprise αCDR3 / βCDR3 amino acid sequence pairs selected from the group consisting of SEQ ID NO: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205 and 213 / 221.

[0030] In one embodiment, the TCR or its variable domains described herein comprise: (i) an amino acid sequence set αCDR1-αCDR2-αCDR3 that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 129-131-133, 145-147-149, 161-163-165, 177-179-181, 193-195-197 and 209-211-213; and (ii) an amino acid sequence set βCDR1-βCDR2-βCDR3 that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 137-139-141, 153-155-157, 169-171-173, 185-187-189, 201-203-205 and 217-219-221.

[0031] In some embodiments, the TCR or its variable domains described herein comprise an amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 that is at least 95% identical to the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 selected from the group consisting of SEQ ID NO: 129-131-133-137-139-141, 145-147-149-153-155-157, 161-163-165-169-171-173, 177-179-181-185-187-189, 193-195-197-201-203-205, and 209-211-213-217-219-221.

[0032] In some embodiments, the TCR or its variable domains described herein comprise the set of amino acid sequences selected from the group consisting of SEQ ID NO: 129-131-133-137-139-141, 145-147-149-153-155-157, 161-163-165-169-171-173, 177-179-181-185-187-189, 193-195-197-201-203-205, and 209-211-213-217-219-221, namely αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3.

[0033] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 135, 151, 167, 183, 199 and 215; and (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to the TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 143, 159, 175, 191, 207 and 223.

[0034] In some embodiments, the TCR or its variable domain described herein contains a TCR Vα / Vβ amino acid sequence pair that is at least 95% identical to the TCR Vα / Vβ amino acid sequence pair selected from the group consisting of 135 / 143, 151 / 159, 167 / 175, 183 / 191, 199 / 207 and 215 / 223.

[0035] In some embodiments, the TCR or its variable domain described herein comprises a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of 135 / 143, 151 / 159, 167 / 175, 183 / 191, 199 / 207 and 215 / 223.

[0036] In some implementations, the HLA-presenting peptide includes the MART1 peptide.

[0037] In some implementations, the TCR or its variable domain described herein includes: In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125; and / or (ii) a βCDR3 amino acid sequence that is at least 95% identical to a βCDR3 sequence selected from the group consisting of SEQ ID NO: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117, and 1133.

[0038] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR1-αCDR2-αCDR3 amino acid sequence set that is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: 961-963-965, 977-979-981, 993-995-997, 1009-1011-1013, 1025-1027-1029, 1041-1043-1045, 1057-1059-1061, 1073-1075-1077, 1089-1091-1093, 1105-1107-1109, and 1121-1123-1125; and / or (ii) a βCDR1-βCDR2-βCDR3 amino acid sequence set that is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: The amino acid sequence sets of the group consisting of 969-971-973, 985-987-989, 1001-1003-1005, 1017-1019-1021, 1033-1035-1037, 1049-1051-1053, 1065-1067-1069, 1081-1083-1085, 1097-1099-1101, 1113-1115-1117 and 1129-1131-1133 are at least 95% identical.

[0039] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111 and 1127; and / or (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to the TCRVβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119 and 1135.

[0040] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125; and (ii) a βCDR3 amino acid sequence that is at least 95% identical to a βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117, and 1133.

[0041] In some embodiments, the TCR or its variable domains described herein contain αCDR3 / βCDR3 amino acid sequence pairs that are at least 95% identical to the αCDR3 / βCDR3 amino acid sequence pairs selected from the group consisting of SEQ ID NO: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117 and 1125 / 1133.

[0042] In some embodiments, the TCR or its variable domains described herein comprise αCDR3 / βCDR3 amino acid sequence pairs selected from the group consisting of SEQ ID NO: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117 and 1125 / 1133.

[0043] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR1-αCDR2-αCDR3 amino acid sequence set that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 961-963-965, 977-979-981, 993-995-997, 1009-1011-1013, 1025-1027-1029, 1041-1043-1045, 1057-1059-1061, 1073-1075-1077, 1089-1091-1093, 1105-1107-1109, and 1121-1123-1125; and (ii) a βCDR1-βCDR2-βCDR3 amino acid sequence set that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: The amino acid sequence sets of the group consisting of 969-971-973, 985-987-989, 1001-1003-1005, 1017-1019-1021, 1033-1035-1037, 1049-1051-1053, 1065-1067-1069, 1081-1083-1085, 1097-1099-1101, 1113-1115-1117 and 1129-1131-1133 are at least 95% identical.

[0044] In some embodiments, the TCR or its variable domains described herein comprise the αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequence set, which is selected from SEQ ID NO: 961-963-965-969-971-973, 977-979-981-985-987-989, 993-995-997-1001-1003-1005, 1009-1011-1013-1017-1019-1021, 1025-1027-1029-1033-1035-1037, 1041-1043-1045-1049-1051-1053, 1057-1059-1061-1065-1067-1069, 1073-1075-1077-1081-1083-1085; The amino acid sequence set of the group consisting of 1089-1091-1093-1097-1099-1101, 1105-1107-1109-1113-1115-1117 and 1121-1123-1125-1129-1131-1133 is at least 95% identical to that of the group αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3.

[0045] In some implementations, the TCR or its variable fields described herein include selections from SEQ ID NO: 961-963-965-969-971-973, 977-979-981-985-987-989, 993-995-997-1001-1003-1005, 1009-1011-1013-1017-1019-1021, 1025-1027-1029-1033-1035-1037, 1041-1043-1045-1049-1051-1053, 1057-1059-1061-1065-1067-1069, 1073-1075-1077-1081-1083-1085; The amino acid sequence set of αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, consisting of 1089-1091-1093-1097-1099-1101, 1105-1107-1109-1113-1115-1117, and 1121-1123-1125-1129-1131-1133.

[0046] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111 and 1127; and (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to the TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119 and 1135.

[0047] In some embodiments, the TCR or its variable domains described herein contain a TCR Vα / Vβ amino acid sequence pair that is at least 95% identical to the TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119 and 1127 / 1135.

[0048] In some embodiments, the TCR or its variable domains described herein comprise the TCR Vα / Vβ amino acid sequence pairs selected from the group consisting of SEQ ID NO: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119, and 1127 / 1135.

[0049] In some implementations, the HLA-presenting peptide includes the CMV peptide.

[0050] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 5, 21, 37, 53, 69, 85, 101 and 117; and / or (ii) a βCDR3 amino acid sequence that is at least 95% identical to a βCDR3 sequence selected from the group consisting of SEQ ID NO: 13, 29, 45, 61, 77, 93, 109 and 125.

[0051] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR1-αCDR2-αCDR3 amino acid sequence set that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 1-3-5, 17-19-21, 33-35-37, 49-51-53, 65-67-69, 81-83-85, 97-99-101, and 113-115-117; and / or (ii) a βCDR1-βCDR2-β ... identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 1-3-5, 17-19-21, 33-35-37, 49-51-53, 65-67-69, 81-83-85, 97-99-101, and 113-115-117; and / or (ii) a βCDR1-βCDR2-βCDR3 amino acid sequence set that is identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 1-3-5, 17-19-21, 33-35-37, 49-51-53, 65-67-69, 81-83-85, The amino acid sequence sets of the groups consisting of 9-11-13, 25-27-29, 41-43-45, 57-59-61, 73-75-77, 89-91-93, 105-107-109 and 121-123-125 are at least 95% identical.

[0052] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to a TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 7, 23, 39, 55, 71, 87, 103 and 119; and / or (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to a TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 15, 31, 47, 63, 79, 95, 111 and 127.

[0053] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 5, 21, 37, 53, 69, 85, 101 and 117; and (ii) a βCDR3 amino acid sequence that is at least 95% identical to a βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 13, 29, 45, 61, 77, 93, 109 and 125.

[0054] In some embodiments, the TCR or its variable domain described herein contains an αCDR3 / βCDR3 amino acid sequence pair that is at least 95% identical to the αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109 and 117 / 125.

[0055] In some embodiments, the TCR or its variable domains described herein comprise αCDR3 / βCDR3 amino acid sequence pairs selected from the group consisting of SEQ ID NO: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, and 117 / 125.

[0056] In some embodiments, the TCR or its variable domains described herein comprise: (i) an amino acid sequence set αCDR1-αCDR2-αCDR3 that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 1-3-5, 17-19-21, 33-35-37, 49-51-53, 65-67-69, 81-83-85, 97-99-101, and 113-115-117; and (ii) an amino acid sequence set βCDR1-βCDR2-βCDR3 that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 9-11-13, 25-27-29, 41-43-45, 57-59-61, 73-75-77, 89-91-93, 105-107-109, and 121-123-125.

[0057] In some embodiments, the TCR or its variable domains described herein comprise the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, which is at least 95% identical to the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 selected from the group consisting of SEQ ID NO: 1-3-5-9-11-13, 17-19-21-25-27-29, 33-35-37-41-43-45, 49-51-53-57-59-61, 65-67-69-73-75-77, 81-83-85-89-91-93, 97-99-101-105-107-109, and 113-115-117-121-123-125.

[0058] In some embodiments, the TCR or its variable domains described herein comprise the set of amino acid sequences selected from the group consisting of SEQ ID NO: 1-3-5-9-11-13, 17-19-21-25-27-29, 33-35-37-41-43-45, 49-51-53-57-59-61, 65-67-69-73-75-77, 81-83-85-89-91-93, 97-99-101-105-107-109, and 113-115-117-121-123-125, namely αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3.

[0059] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to a TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 7, 23, 39, 55, 71, 87, 103 and 119; and (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to a TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 15, 31, 47, 63, 79, 95, 111 and 127.

[0060] In some embodiments, the TCR or its variable domain described herein contains a TCR Vα / Vβ amino acid sequence pair that is at least 95% identical to the TCR Vα / Vβ amino acid sequence pair selected from the group consisting of 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, and 119 / 127.

[0061] In some embodiments, the TCR or its variable domain described herein comprises a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, and 119 / 127.

[0062] In some implementations, the HLA-presenting peptide includes the EBV peptide.

[0063] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405 and 421; and / or (ii) a βCDR3 amino acid sequence that is at least 95% identical to a βCDR3 sequence selected from the group consisting of SEQ ID NO: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413 and 429.

[0064] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR1-αCDR2-αCDR3 amino acid sequence set that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 225-227-229, 241-243-245, 257-259-261, 273-275-277, 289-291-293, 305-307-309, 321-323-325, 337-339-341, 353-355-357, 369-371-373, 385-387-389, 401-403-405, and 417-419-421; and / or (ii) a βCDR1-βCDR2-βCDR3 amino acid sequence set that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: The amino acid sequence sets of the groups 233-235-237, 249-251-253, 265-267-269, 281-283-285, 297-299-301, 313-315-317, 329-331-333, 345-347-349, 361-363-365, 377-379-381, 393-395-397, 409-411-413, and 425-427-429 are at least 95% identical.

[0065] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407 and 423; and / or (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to the TCRVβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415 and 431.

[0066] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405 and 421; and (ii) a βCDR3 amino acid sequence that is at least 95% identical to a βCDR3 sequence selected from the group consisting of SEQ ID NO: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413 and 429.

[0067] In some embodiments, the TCR or its variable domain described herein contains an αCDR3 / βCDR3 amino acid sequence pair that is at least 95% identical to the αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413 and 421 / 429.

[0068] In some embodiments, the TCR or its variable domains described herein comprise αCDR3 / βCDR3 amino acid sequence pairs selected from the group consisting of SEQ ID NO: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413, and 421 / 429.

[0069] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR1-αCDR2-αCDR3 amino acid sequence set that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: 225-227-229, 241-243-245, 257-259-261, 273-275-277, 289-291-293, 305-307-309, 321-323-325, 337-339-341, 353-355-357, 369-371-373, 385-387-389, 401-403-405, and 417-419-421; and (ii) a βCDR1-βCDR2-βCDR3 amino acid sequence set that is at least 95% identical to an amino acid sequence set selected from the group consisting of SEQ ID NO: The amino acid sequence sets of the groups consisting of 233-235-237, 249-251-253, 265-267-269, 281-283-285, 297-299-301, 313-315-317, 329-331-333, 345-347-349, 361-363-365, 377-379-381, 393-395-397, 409-411-413, and 425-427-429 are at least 95% identical.

[0070] In some embodiments, the TCR or its variable domains described herein comprise the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, which is selected from SEQ ID NO: 225-227-229-233-235-237, 241-243-245-249-251-253, 257-259-261-265-267-269, 273-275-277-281-283-285, 289-291-293-297-299-301, 305-307-309-313-315-317, 321-323-325-329-331-333, 337-339-341-34 The amino acid sequence set of the group consisting of 5-347-349, 353-355-357-361-363-365, 369-371-373-377-379-381, 385-387-389-393-395-397, 401-403-405-409-411-413 and 417-419-421-425-427-429 is at least 95% identical to the αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequence set.

[0071] In some implementations, the TCR or its variable fields described herein include selections from SEQ ID NO: 225-227-229-233-235-237, 241-243-245-249-251-253, 257-259-261-265-267-269, 273-275-277-281-283-285, 289-291-293-297-299-301, 305-307-309-313-315-317, 321-323-325-329-331-333, and 337-339-341. The amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, consisting of -345-347-349, 353-355-357-361-363-365, 369-371-373-377-379-381, 385-387-389-393-395-397, 401-403-405-409-411-413, and 417-419-421-425-427-429.

[0072] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407 and 423; and (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to the TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415 and 431.

[0073] In some embodiments, the TCR or its variable domains described herein contain a TCR Vα / Vβ amino acid sequence pair that is at least 95% identical to the TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, and 423 / 431.

[0074] In some embodiments, the TCR or its variable domains described herein comprise TCR Vα / Vβ amino acid sequence pairs selected from the group consisting of SEQ ID NO: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, and 423 / 431.

[0075] In some implementations, HLA-presenting peptides include influenza peptides.

[0076] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949; and / or (ii) a βCDR3 amino acid sequence that is at least 95% identical to an αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: The βCDR3 sequences of the group consisting of 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, and 957 are at least 95% identical.

[0077] In some embodiments, the TCR or its variable domains, as described herein, comprise: (i) a set of αCDR1-αCDR2-αCDR3 amino acid sequences selected from SEQ ID NO: 433-435-437, 449-451-453, 465-467-469, 481-483-485, 497-499-501, 513-515-517, 529-531-533, 545-547-549, 561-563-565, 577-579-581, 593-595-597, 609-611-613, 625-627-629, 641-643-645, 657-659-661, 673-675-677, 689-691-693, 705-70 The amino acid sequence set consisting of groups 7-709, 721-723-725, 737-739-741, 753-755-757, 769-771-773, 785-787-789, 801-803-805, 817-819-821, 833-835-837, 849-851-853, 865-867-869, 881-883-885, 897-899-901, 913-915-917, 929-931-933, and 945-947-949 is at least 95% identical; and / or (ii) the amino acid sequence set βCDR1-βCDR2-βCDR3, which is selected from SEQ ID NO: 441-443-445, 457-459-461, 473-475-477, 489-491-493, 505-507-509, 521-523-525, 537-539-541, 553-555-557, 569-571-573, 585-587-589, 601-603-605, 617-619-621, 633-635-637, 649-651-653, 665-667-669, 681-683-685, 697-699-701, 713 The amino acid sequence set of the group consisting of -715-717, 729-731-733, 745-747-749, 761-763-765, 777-779-781, 793-795-797, 809-811-813, 825-827-829, 841-843-845, 857-859-861, 873-875-877, 889-891-893, 905-907-909, 921-923-925, 937-939-941, and 953-955-957 is at least 95% identical.

[0078] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, and 951; and / or (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: The amino acid sequences of the TCR Vβ domain of the group consisting of 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943 and 959 are at least 95% identical.

[0079] In some embodiments, the TCR or its variable domains described herein comprise: (i) an αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949; and (ii) a β ... identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 437, 453, 469, 485, 501, 517, 533, and 949; The βCDR3 amino acid sequences of the group consisting of NO:445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, and 957 are at least 95% identical.

[0080] In some embodiments, the TCR or its variable domain described herein comprises an αCDR3 / βCDR3 amino acid sequence pair selected from SEQ ID NO: 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717, 72 The αCDR3 / βCDR3 amino acid sequence pairs of the group consisting of 5 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941 and 949 / 957 are at least 95% identical.

[0081] In some implementations, the TCR or its variable fields described herein include selections from SEQ ID NO: 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717. The αCDR3 / βCDR3 amino acid sequence pairs formed by the groups 725 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941, and 949 / 957.

[0082] In some embodiments, the TCR or its variable domains, as described herein, comprise: (i) a set of αCDR1-αCDR2-αCDR3 amino acid sequences selected from SEQ ID NO: 433-435-437, 449-451-453, 465-467-469, 481-483-485, 497-499-501, 513-515-517, 529-531-533, 545-547-549, 561-563-565, 577-579-581, 593-595-597, 609-611-613, 625-627-629, 641-643-645, 657-659-661, 673-675-677, 689-691-693, 705-7 The amino acid sequence set consisting of the groups 07-709, 721-723-725, 737-739-741, 753-755-757, 769-771-773, 785-787-789, 801-803-805, 817-819-821, 833-835-837, 849-851-853, 865-867-869, 881-883-885, 897-899-901, 913-915-917, 929-931-933, and 945-947-949 is at least 95% identical; and (ii) the amino acid sequence set βCDR1-βCDR2-βCDR3, which is selected from SEQ ID NO: 441-443-445, 457-459-461, 473-475-477, 489-491-493, 505-507-509, 521-523-525, 537-539-541, 553-555-557, 569-571-573, 585-587-589, 601-603-605, 617-619-621, 633-635-637, 649-651-653, 665-667-669, 681-683-685, 697-699-701, 713 The amino acid sequence set of the group consisting of -715-717, 729-731-733, 745-747-749, 761-763-765, 777-779-781, 793-795-797, 809-811-813, 825-827-829, 841-843-845, 857-859-861, 873-875-877, 889-891-893, 905-907-909, 921-923-925, 937-939-941, and 953-955-957 is at least 95% identical.

[0083] In some embodiments, the TCR or its variable domains described herein comprise the αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequence set, which is selected from SEQ ID NO: 433-435-437-441-443-445, 449-451-453-457-459-461, 465-467-469-473-475-477, 481-483-485-489-491-493, 497-499-501-505-507-509, 513-515-517-521-523-525, 529-531-533-537-539-541, 545-547-549-553-555-557, 561-563-565-569-571 -573, 577-579-581-585-587-589, 593-595-597-601-603-605, 609-611-613-617-619-621, 625-627-629-633-635-637, 641-643-645-649-651-653, 657-659-661-665-667-669, 673-675-677-681-683-685, 689-691-693-697-699-701, 705-707-709-71 3-715-717, 721-723-725-729-731-733, 737-739-741-745-747-749, 753-755-757-761-763-765, 769-771-773-777-779-781, 785-787-789-793-795-797, 801-803-805-809-811-813, 817-819-821-825-827-829, 833-835-837-841-843-845, 849-851-8 The amino acid sequence set of the group consisting of 53-857-859-861, 865-867-869-873-875-877, 881-883-885-889-891-893, 897-899-901-905-907-909, 913-915-917-921-923-925, 929-931-933-937-939-941 and 945-947-949-953-955-957 is at least 95% identical to the αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequence set.

[0084] In some implementations, the TCR or its variable fields described herein include selections from SEQ ID NO: 433-435-437-441-443-445, 449-451-453-457-459-461, 465-467-469-473-475-477, 481-483-485-489-491-493, 497-499-501-505-507-509, 513-515-517-521-523-525, 529-531-533-537-539-541, 545-547-549-553-555-557, 561-563-565-569-5 71-573, 577-579-581-585-587-589, 593-595-597-601-603-605, 609-611-613-617-619-621, 625-627-629-633-635-637, 641-643-645-649-651-653, 657-659-661-665-667-669, 673-675-677-681-683-685, 689-691-693-697-699-701, 705-707-709 -713-715-717, 721-723-725-729-731-733, 737-739-741-745-747-749, 753-755-757-761-763-765, 769-771-773-777-779-781, 785-787-789-793-795-797, 801-803-805-809-811-813, 817-819-821-825-827-829, 833-835-837-841-843-845, 849- The amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 of the group consisting of 851-853-857-859-861, 865-867-869-873-875-877, 881-883-885-889-891-893, 897-899-901-905-907-909, 913-915-917-921-923-925, 929-931-933-937-939-941 and 945-947-949-953-955-957.

[0085] In some embodiments, the TCR or its variable domains described herein comprise: (i) a TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, and 951; and (ii) a TCR Vβ domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: The amino acid sequences of the TCR Vβ domain of the group consisting of 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943 and 959 are at least 95% identical.

[0086] In some embodiments, the TCR or its variable domain described herein comprises a TCR Vα / Vβ amino acid sequence pair selected from SEQ ID NO: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703. The TCR Vα / Vβ amino acid sequence pairs of the groups consisting of 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943 and 951 / 959 are at least 95% identical.

[0087] In some embodiments, the TCR or its variable domain described herein comprises a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of: SEQ ID NO: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703, 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943 and 951 / 959.

[0088] This article also provides nucleic acid molecules containing sequences encoding the TCR or its variable domains as described herein.

[0089] This article also provides a complex comprising the TCR or its variable domain as described herein, and portions selected from the group consisting of a ligand, a detectable portion, and a therapeutic portion.

[0090] This article also provides cells containing the TCR or its variable domains as described herein, optionally wherein said cells are T cells.

[0091] This article also provides host cells containing the TCR or its variable domains described herein.

[0092] This article also provides a pharmaceutical composition comprising the TCR or its variable domain described herein, and a pharmaceutically acceptable excipient.

[0093] This article also provides TCRs or their variable domains as described herein, nucleic acids encoding them, complexes containing them, cells or host cells containing them, or pharmaceutical compositions containing them for the treatment of HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions.

[0094] This document also provides for the use of TCR or its variable domains, nucleic acids encoding them, complexes containing them, cells or host cells containing them, or pharmaceutical compositions containing them, as described herein, for the manufacture of medicines for the treatment of HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions.

[0095] This article also provides a method for treating HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions, comprising administering to a subject requiring treatment a TCR or its variable domain as described herein, a nucleic acid encoding the TCR, a complex containing the TCR, a cell or host cell containing the TCR, or a pharmaceutical composition containing the TCR.

[0096] In some embodiments of the uses and methods described herein, the HLA-presenting peptide is derived from a polypeptide selected from the group consisting of: CMV pp65, HPV16 E6-p1, HPV16 E6-p2, EBV BMLF1, EBV LMP2A, EBV YVL, influenza M1, influenza M2, and MART1. Attached Figure Description

[0097] Figure 1A , Figure 1B , Figure 1C , Figure 1D , Figure 1E , Figure 1F and Figure 1G A description (not drawn to scale) of a non-limiting exemplary RAPTER assay implementation of the present invention is provided. The RAPTER uses a hash reagent and a T-cell activation-inducing marker (AIM) to select and characterize antigen-specific T cells. Figure 1A In this schematic diagram, PBMCs are evenly distributed in the assay wells. The desired T cell stimulants (proteins, peptides, RNA, etc.) are added to individual wells in an array and cultured with the cells for the required assay time. Figure 1B Following stimulation, each T cell in the well is labeled with a unique hash-tagged oligonucleotide (HTO) labeling reagent (e.g., anti-CD2 antibody) to postcode the location of all T cells in the assay wells, thereby postcoding their corresponding antigen exposure. Figure 1C The HTO-labeled samples were pooled together and stained with the required flow cytometry and scRNA-SEQ reagents (including fluorescently labeled antibodies and CITE-seq antibodies). Figure 1D Antigen-specific T cells were isolated and functionally enriched using T cell AIM via fluorescence activated cell sorting (FACS). Figure 1E The sorted cells were loaded into a 10X Genomics single-cell Chromium splitter, generating 5' sequencing libraries and oligomers for transcriptome, HTO, TCR-seq, and (if needed) CITE-seq for HT sequencing. Figure 1F Bioinformatics demultiplexing of individual HTO allocations was performed to link individual T cell TCRs and phenotypes to specific antigen reactivity. Figure 1GThe antigen-specific TCR sequence was further analyzed by evaluating frequency, clone size and CD137 / 4-1BB expression level.

[0098] Figure 2A , Figure 2B , Figure 2C , Figure 2D , Figure 2E , Figure 2F and Figure 2G The results showed that activation-inducible markers (AIMs) on antigen-specific T cells were upregulated after antigen-specific activation. T cells from CMV-positive, HLA-A*02:01+ healthy donors (HD1) were expanded for 10 days in the presence of CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283) to perform these proof-of-concept tests. Figure 2A Pre-expanded T cells were restimulated with homologous CMV pp65 peptide over a 96-hour time period under RAPTER assay culture conditions. The percentage of AIM+ CD8+ T cells was assessed by flow cytometry. Figure 2B Pre-expanded T cells were restimulated for 24 hours with DMSO or CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283). The percentages of CMV pp65 dextramer+ and CD137 / 4-1BB CD8+ T cells were assessed by flow cytometry. Figure 2C The percentage of CD137 / 4-1BB+ T cells in the dextramer+ T cell population after restimulation was assessed by flow cytometry. Figure 2D T cells from HD1 and three other HD cells with different HLA haplotypes and CMV positivity were expanded for 10 days in the presence of CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283). The percentage of CMV pp65 dextramer+ and CD137 / 4-1BB CD8+ T cells after restimulation was assessed by flow cytometry. Figure 2E Pre-expanded T cells from HD1 were restimulated with DMSO or CMVpp65 peptide for 24 hours, and the percentages of dextramer+, CD137 / 4-1BB+, and PD-1+ CD8+ T cells were assessed by flow cytometry. Figure 2FCMV pp65 and MART1 dextramer+, CMV pp65 CD137 / 4-1BB+, and PD-1+ CD8+ T cells were isolated by FACS and then analyzed by scTCR-SEQ. A heatmap shows the percentage overlap between TCR sequences under different conditions. All dextramer+ TCRs were compared with CD137 / 4-1BB+ and PD-1+ TCRs in clones with a size >= 10 cells. Figure 2G CMV pp65 and MART1 dextramer+, as well as CMV pp65 CD137 / 4-1BB+ and PD-1+ CD8+ T cells, were isolated by FACS and then analyzed by scTCR-SEQ. A heatmap shows the percentage overlap between TCR sequences under different conditions. All dextramer+ TCRs were compared with CD137 / 4-1BB+ and PD-1+ TCRs of clones >= 1 cell.

[0099] Figure 3A , Figure 3B , Figure 3C , Figure 3D , Figure 3E , Figure 3F and Figure 3G The detection limit of RAPTER is displayed. (The result is from HLA-A*02:01) + PBMCs from healthy donors were cultured for 10 days with HLA-A*02:01-restricted MART1 peptide (ELAGIGILTV; SEQ ID NO: 1284) to expand epitope-specific T cells. Figure 3A MART1dextramer was assessed before and after expansion using flow cytometry. + CD8 + The percentage of T cells. Figure 3B T cells expanded with MART1 peptide were serially diluted 2-fold with unexpanded autologous T cells (theoretical MART1). + Range: Total CD8 + T cells (4.26% to 0.02%). T cells at each dilution point were restimulated for 24 hours using a homologous MART1 peptide. Each dilution point was uniquely hashed, and then all samples were pooled. CD137 / 4-1BB was isolated by FACS. + CD3 + T cells and MART1 dextramer + CD8 + T cells are used for scRNA / TCR-seq. Figure 3C HTO demultiplexing is performed to convert CD137 / 4-1BB.+ MART1-responsive T cells were allocated to specific dilution points. TCR clone size ranged from 1 to 140 cells (gray: no clones). Blue: clone size = 1). All TCR clones overlapping with dextramer-sorted clones are shown. The expected dextramer count for each sample is indicated on the left side of the TCR clone plot. + CD8 + percentage of T cells. Figure 3D MART1 + CD8 sorted by dextramer and RAPTER + Uniform manifold approximation and projection (UMAP) map of T cells. A total of 3,554 CD137 / 4-1BB cells were captured. + MART1 Reactive CD8 + T cells, containing 565 unique clones (red), and capturing 9,930 MART1 dextramers. + T cells, containing 587 unique clones (light green). Based on RNA-seq data, MART1 cells were sorted from dextramer and RAPTER. + T cells were broken down into seven distinct phenotypic UMAP clusters. Figure 3E The heatmap shows the genes with the greatest differential expression in each cluster, along with violin plots of related phenotypes and functional T-cell markers. Figure 3F A schematic diagram of the AP-1 firefly luciferase reporter gene assay. Figure 3G Luciferase activity in Jurkat-TCR cells expressing the MART1 (ELAGIGILTV; SEQ ID NO: 1284) epitope-responsive TCRs was measured. Firefly luciferase activity was measured in Jurkat-TCRs cultured with individual DCs treated with DMSO (black circles), cultured alone (black squares), or cultured with dendritic cells pulsed with a CEF peptide pool (black triangles), MART1 peptide (blue hollow circles), or DCs treated with anti-CD3 and anti-CD28 antibodies (black hollow triangles). MART1 TCRs identified in RAPTER and dextramer binding assays (DR3, 4, 5), RAPTER-only assay (R3), dextramer binding assays (D1, D3, D5), or as background in a RAPTER assay (B6) were tested.

[0100] Figure 4A , Figure 4B and Figure 4C It showed that the isolated antigen-specific CD8 +T cell gating strategies. (From HLA-A*02:01) + Healthy donor PBMCs were cultured for 10 days with HLA-A*02:01-restricted MART1 peptide (ELAGIGILTV; SEQ ID NO: 1284) to expand epitope-specific T cells. MART1-peptide-expanded T cells were serially diluted 2-fold with unexpanded autologous T cells, followed by restimulation with homologous MART1 peptide for 24 hours. Each dilution point was uniquely hashed, and all samples were then pooled. Figure 4B ). ( Figure 4A Upper-level FACS gating, including FMO gating of the PE channel. Figure 4B CD137 / 4-1BB separated by FACS - CD3 + T cells and ( Figure 4C MART1 dextramer + CD8 + T cells are used for scRNA / TCR-seq.

[0101] Figure 5A and Figure 5B Flow cytometry analysis of antigen-specific CD8+ T cell frequencies is shown. PBMCs from HLA-A*02:01+ healthy donors were stained with dextramer (HLA haplotype-matched and unmatched) individually with PE-conjugated oligonucleotides. Dextramer+ cells were gated to assess the abundance of antigen-specific CD8+ T cells for each epitope. Figure 5A Gating strategies for CD8+ dextramer+ T cells. Figure 5B Flow cytometry plots of CD8+ dextramer+ T cells associated with the specificity of each dextramer. Each plot shows the percentage of CD8+ T cells that are positive for the indicated dextramer.

[0102] Figure 6A and Figure 6B The dCODE dextramer screening of aggregated oligonucleotide tags is shown. Figure 6A A schematic diagram summarizing the workflow of pooling oligonucleotide-conjugated dextramer staining is presented. Pools of 23 PE-conjugated oligonucleotide-conjugated dCODE dextramers were used to stain PBMCs from healthy donors to detect antigen-specific T cells. Additional flow cytometry and CITE-seq reagents were also applied for FACS and for the detection of cell surface proteins via CITE-seq. Figure 6BCells were sorted on a Sony MA900 FACS machine to isolate CD8+ dextramer+ T cells for scRNA-SEQ.

[0103] Figure 7A , Figure 7B , Figure 7C and Figure 7D Epitope-specific TCRs amplified by clones identified in RAPTER and dextramer assays using aggregated oligonucleotide markers. PBMCs from healthy HLA-A*02:01+, A*29:02+, B*35:01+, and B*57:01+ donors were amplified for 7 days with 22 HLA haplotype-matched and mismatched peptides to amplify epitope-specific T cells. Figure 7A This diagram illustrates the workflow of RAPTER and pooling dextramer on peptide-amplified T cells. The peptide-amplified T cells are separated and tested in either a RAPTER assay (top) or a dCODE dextramer assay with pooling oligonucleotide tags featuring 24 unique pooling dextramers (bottom). Figure 7B This image shows the UMAP of CD8+ T cell clusters as determined by dCODE dextramer and RAPTER. Figure 7C The image shows a heatmap of the most differentially expressed genes in the dCODE dextramer and RAPTER+ T cell clusters (left) and dextramers representing all TCR clones (top), clone sizes >1 (middle), and >10 (bottom). + Venn diagram showing the overlap of paired TCR a / b strand sequences in CD8+ T cells before expansion (gray) and after expansion (white). Figure 7D A correlation diagram showing the overlap of paired TCR a / b chain sequences between dextramer+ (y-axis) and RAPTER+ (x-axis) peptide-amplified CD8+ T cells, divided by clonal size (log10 scale). Dashed lines indicate TCR clonal size >= 5 cells.

[0104] Figure 8 HPV antigen-specific T-cell reactivity in PBMCs from HPV-positive cervical cancer patients is shown. Cryopreserved PBMCs from HLA-A*02:01+ cervical cancer patients were tested in an IFNγ ELISpot assay after overnight standing. (Shown per 2 × 10⁻⁶) 5 The IFNγ+ points in each PBMC were obtained after overnight stimulation using a pool of 15-mer overlapping peptides derived from HPV proteins E6, E7, and L1, or short peptides of common viral antigens of CMV, EBV, and influenza M (collectively referred to as “CEF”).

[0105] Figure 9A , Figure 9B , Figure 9C , Figure 9D , Figure 9E , Figure 9F , Figure 9G , Figure 9H and Figure 9I The image shows the detection of viral memory T cells in blood samples from cervical patients. Figure 9A ) 30 × 10⁻⁶ HLA-A*02:01+ from patients with early-stage, untreated cervical cancer were tested in the IFNγ ELISPOT assay. 6 The reactivity of PBMCs to a group of human papillomavirus (HPV) E6 15-mer synthetic long peptides (SLP) and 5 HLA-A*02:01-restricted CEF 9-mer peptides is shown. The number of IFNγ points per 2 × 10⁵ PBMCs is displayed. Figure 9B UMAP from total sorted CD8+ T cells and CD137 / 4-1BB+ T cells as determined by RAPTER assay. Figure 9A Unexpanded PBMCs from patients were tested in RAPTER to identify HPV16 E6 and CEF peptide-specific CD8+ T cells. Figure 9C The RAPTER signal was demultiplexed via HTO tags to distribute individual T cells with homologous peptide responsiveness. Of the total 3129 T cells, 352 unique TCR clones were identified. TCR clone size (y-axis) was plotted against each HTO name (x-axis). Figure 9D (Violin diagram of relevant phenotypes and functional T cell markers.) Figure 9E The TCR clones identified by RAPTER as specific for HPV and CEF epitopes were projected onto... Figure 9B The scRNA-SEQ UMAP. The color scale represents the TCR clone size. Figure 9F The total score selected in the RAPTER test of this figure is CD8. + T cells and CD137 / 4-1BB + The UMAP of T cells (left) and a heatmap showing the most differentially expressed genes in each T cell cluster within the UMAP (right). Figure 9G )show Figure 9E A heatmap of the top 16 differentially expressed genes in influenza M, HPV16_E6_101, EBV BMLF1, and LMP2A reactive T cell clusters. Figure 9HTCR sequences corresponding to the influenza A epitope (GILGFVFTL [SEQ ID NO: 1287], HTO84) and the EBV BMLF1 epitope (GLCTLVAML [SEQ ID NO: 1286], HTO83) were cloned and functionally tested in a Jurkat-TCR luciferase reporter assay. Luciferase activity in Jurkat-TCR cells expressing influenza M (GILGFVFTL; SEQ ID NO: 1287) or EBV BMLF1 (GLCTLVAML; SEQ ID NO: 1286) epitope-responsive TCRs was measured. The relative abundance of each TCR in the RAPTER assay was indicated, and the specific cloning frequency was provided under the TCR name. Luciferase activity was measured in Jurkat-TCRs cultured alone or co-cultured with dendritic cells pulsed with specified peptides. Figure 9I Luciferase activity in Jurkat-TCR cells engineered with two nonspecific background TCRs, the TCRs being associated with multiple HTOs at low frequencies.

[0106] Figure 10A , Figure 10B , Figure 10C , Figure 10D , Figure 10E and Figure 10F The results showed that both anti-CD2 antibodies and lipid-based scattering reagents were effective in identifying T cells based on HTO classification. Each aliquot of T cells was labeled with two HTOs: an anti-CD2 antibody with a unique barcode and a separate lipid HTO with a unique barcode. After staining, the aliquots were washed and pooled for capture. Figure 10A and Figure 10B Each anti-CD2 antibody ( Figure 10A (hTag_105_regn to hTag_144_regn, in left-to-right, top-to-bottom order) or lipid HTO ( Figure 10B The original HTO UMI distribution histogram (hTag_145_regn to hTag_171_regn, then hTag_173_regn to hTag_184_regn, in left-to-right, top-to-bottom order). Figure 10C and Figure 10D Based on the use of anti-CD2 antibody ( Figure 10C ) or lipid HTO ( Figure 10D Independent classification of demultiplexed cells identified the number of cells as bimodal, negative, or unimodal. Triple captures are shown. Figure 10E A comparison of cell classification between anti-CD2 antibodies and lipid HTO. The classification of lipid HTO is largely consistent with that of anti-CD2 antibody HTO.Figure 10F This matrix displays the total percentage of cells classified by all possible antibody:lipid HTO pairs. Input pairs for each T-cell aliquot are located diagonally and recovered via HTO demultiplexing.

[0107] Figure 11A and Figure 11B This demonstrates how to expand CMV pp65+ T cells in culture for a proof-of-concept experiment. Figure 11A The baseline percentage of CMVpp65 dextramer+ CD8+ T cells from CMV seropositive, HLA-A*02:01+ healthy donors (HD1) was assessed by flow cytometry. Figure 11B HD1 T cells were expanded in culture for 10 days in the presence of CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283) and DC and T cell supporting cytokines. After expansion, the percentage of CMV pp65 dextramer+ CD8+ T cells was determined by flow cytometry.

[0108] Figure 12 The results showed that activation-inducing markers on antigen-specific T cells were upregulated after antigen-specific activation. T cells from CMV-seropositive, HLA-A*02:01+ healthy donors (HD1) were expanded for 10 days in the presence of CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283) for a proof-of-concept test. The expanded T cells were restimulated for 24 hours with either DMSO or CMV pp65 peptide (NLVPMVATV; SEQ ID NO: 1283). The percentage of CD8+ T cells positive for the indicated AIM staining was assessed by flow cytometry. CD137 / 4-1BB+ CD8+ T cells within each AIM+ gate are represented by a blue-red scale. T cells within the dashed outline of each dot plot represent cells with the highest CD137 / 4-1BB content, as indicated by the dashed box on the color scale.

[0109] Figure 13A , Figure 13B , Figure 13C , Figure 13D and Figure 13E A fluorescence-activated cell sorting (FACS) gating strategy was demonstrated for isolating CD8+ T cell populations for scRNA and TCR-seq analysis. Figure 13A FACS upper-level gating includes fluorescence minus one (FMO) gating of the PE channel. Figure 13B CD137 / 4-1BB+ CD8+ T cells. Figure 13C PD-1+ CD8+ T cells. Figure 13DCMV pp65 dextramer+ CD8+ T cells. Figure 13E MART1 dextramer+ CD8+ T cells.

[0110] Figure 14A and Figure 14B This demonstrates how to isolate CMV pp65 and MART1 dextramer+, CMV pp65CD137 / 4-1BB+ and PD-1+ CD8+ T cells using FACS, followed by analysis using scTCR-SEQ. Figure 14A From all before filtering and ( Figure 14B Total scRNA-SEQ was captured from the filtered samples to select TCR sequences with paired α and β strands. Any TCR captures with multiple strands were excluded from the analysis.

[0111] Figure 15 A, Figure 15 B. Figure 15 C Figure 15 D、 Figure 15 E, Figure 15 F, Figure 15 G, Figure 15 H, Figure 15 I and Figure 15 J showed the results of the dextramer assay ( Figure 15 A, Figure 15 B. Figure 15 C and Figure 15 D) RAPTER assay Figure 15 E) or two determinations ( Figure 15 F and Figure 15 Flow cytometry image of dextramer-specific MART1 TCRs identified in G). TCR-engineered Jurkat cells expressing MART1 ELAGIGILTV (SEQ ID NO: 1284) epitope-responsive TCRs were treated with the MART1 ELAGIGILTV (SEQ ID NO: 1284) dextramer. Figure 15 A, Figure 15 B. Figure 15 C Figure 15 D、 Figure 15 E, Figure 16A F, Figure 16B G and Figure 16C H) or negative control dextramer staining. Representative negative control dextramer staining is shown. Figure 16D I) and FMO control ( Figure 16E J).

[0112] Figure 16F, Figure 16A , Figure 16B , Figure 16C , Figure 16D and Figure 16E Epitope-specific memory T cell expansion maintains clonal T cells. PBMCs from healthy HLA-A*02:01+, A*29:02+, B*35:01+, and B*57:01+ donors were expanded for 7 days using HLA haplotype-matched and unmatched peptides (see Table 3 in the examples below) to expand epitope-specific T cells. Figure 16A UMAP maps of total CD8+ T cells that were not amplified (n=6592 cells) and peptide-amplified (n=3453 cells) were decomposed into 7 distinct UMAP clusters using scRNA-SEQ data. Figure 16F This is a characteristic map representing the cloning frequencies of total unamplified and peptide-amplified TCR sequences of paired TCR a / b chains. Figure 17A The image shows a stacking diagram of single paired TCR a / b strand sequences from pre-amplification and peptide-amplified CD8+ T cells in memory (left) and naive (right) T cell compartments. T cell memory phenotypes were determined using RNA and CITE-seq data. Figure 17B The diagram shows the overlap of paired TCR a / b strand sequences between CD8+ T cells (all clones, clones >= 2 cells, and clones >= 10 cells) before expansion (gray) and after expansion (white). Figure 17C ) Figure 17A Violin plots of relevant phenotypes and functional T cell markers for unamplified and amplified CD8+ T cells. Figure 17B A heatmap showing the most differentially expressed genes in T cell clusters that are neither amplified nor peptide-amplified.

[0113] Figure 17C , Definitions and Immunol. Flow cytometry plots showing the dextramer-specific expression of TCRs identified in the RAPTER assay are displayed. Genome Biol. Influenza M (GILGFVFTL; SEQ ID NO: 1287) epitope-responsive TCRs (TCR2, TCR4, and TCR5), ( Nat. Method ) EBV BMLF1 (GLCTLVAML; SEQ ID NO: 1286) epitope-responsive TCRs (TCR8, TCR9, and TCR10) or ( Nature TCR-engineered Jurkat cells with two nonspecific TCRs (TCR13 and TCR15) were stained with the indicated dextramer. Detailed Implementation

[0114] Identifying and functionally assessing antigen-specific T cells from human samples is crucial for understanding disease pathogenesis, identifying which antigens induce T cell responses, and developing effective targeted vaccines and TCR-based cell therapies. Observations that tumors associated with higher mutational burden (TMB) or viral drivers are more sensitive to immune checkpoint inhibitor (ICI) therapy have fueled interest in identifying which tumor antigens elicit functional T cell-mediated antitumor responses. Advances in sequencing technology now allow for routine identification of tumor-restricting mutations, and computational algorithms that import large amounts of whole-exome sequences (WES) and RNA sequences (RNA-seq) from matched tumor and normal tissues can predict which tumor-restricting peptides are likely to be present on human leukocyte antigen (HLA) alleles. However, the actual functional relevance of these epitopes must be determined through T cell assays.

[0115] In oncology, there is a growing interest in considering functional T-cell reactivity when sequencing immunogenic tumors or viral antigens to better understand which antigens should serve as therapeutic targets for tumor control. Primary human T-cell functional responsiveness assays widely employ traditional low-throughput assays, including enzyme-linked immunospot (ELISpot) and intracellular cytokine staining (ICS). ELISpot and ICS provide functional information by capturing T cells that produce activation-inducing T-cell cytokines. However, both methods require relatively large numbers of cells for high-throughput screening of responsiveness and do not provide TCR sequences.

[0116] Recent advances in single-cell sequencing have enabled higher throughput resolution for homologous TCR-ligand interactions. DNA oligonucleotide-tagged dextran technology allows for higher throughput multimer screening directly on clinical blood samples. Significant limitations include the requirement for haplotype matching, the cost of dextramer reagents, and the limited availability of HLA class II dextramers. Other sequence-based methods aimed at high-throughput TCR-ligand pairing include yeast display, T-Scan, SABR, cytokine capture, and similar assays, although all of these methods require engineered expression systems and are not directly applicable to clinical samples.

[0117] The Multiplex Identification of T Cell Receptor Antigen Specificity (MIRA) assay developed by Adaptive Biotechnologies uses a well antigen “addressing” system to screen for T cell reactivity from primary human blood cells. Antigen-specific T cells are identified by upregulation of CD137 / 4-1BB expression after exposure to homologous antigens and sorted for batch TCR sequencing. While MIRA does not require engineered cells and uses endogenous T cell activation markers, its antigen-addressing approach requires numerous input cells to capture the low-frequency tumor antigen-specific T cell population available in the patient’s circulation.

[0118] The RAPTER assay was developed to provide a rapid and flexible solution for screening candidate immunogenic T-cell antigens. It allows for the parallel screening of T-cell reactivity for dozens to hundreds of antigens using a limited number of patient blood cells, simultaneously obtaining paired epitope-TCR information at single-cell resolution. RAPTER was designed to use autologous human T cells and APCs and requires fewer cells than most other primary T-cell assays, making it particularly attractive for testing blood samples in clinical trials. Reactivity to individual antigens is tracked by labeling T cells with antibodies conjugated with unique hash-tagged oligonucleotides (HTOs) associated with the specific antigens exposed to them. To maintain assay sensitivity and reduce the number of cells required for screening, HTO labeling allows all functionally reactive T cells to pool together, sort on the same cell surface activation-induced T-cell marker (AIM), and undergo scRNA-SEQ. Antigen reactivity is then resolved via HTO demultiplexing (DEMUX). Cell indexing of transcriptomes and epitopes via sequencing (CITE-seq) antibody reagents are also available in RAPTER to provide information on T-cell surface proteins. Therefore, RAPTER scRNA-SEQ assay readings provide paired epitope:TCR information, as well as phenotypic T cell information at the RNA and protein levels, for all detected reactivity. This article describes paired TCR α / β sequences for certain epitopes (MART1, EBV, CMV, and influenza). This article also describes isolated cells expressing the TCR variable domains and / or TCR α / β variable domain pairs described herein; isolated polynucleotide molecules encoding the TCR variable domains and / or TCR α / β variable domain pairs described herein; targeting vectors containing the polynucleotides described herein; isolated cells expressing the targeting vectors described herein; and pharmaceutical compositions containing the TCR variable domains and / or TCR α / β variable domain pairs, cells, and / or polynucleotides described herein. Methods using the following are also described: (i) a TCR α / β variable domain specific to HPV16 peptides as described herein, for example, in methods for treating HPV 16-related diseases in patients in need; (ii) a TCR α / β variable domain specific to MART1 peptides as described herein, for example, in methods for treating MART1-related diseases in patients in need; (iii) a TCR α / β variable domain specific to EBV peptides as described herein, for example, in methods for treating EBV-related diseases in patients in need; or (iv) a TCR α / β variable domain specific to influenza peptides as described herein, for example, in methods for treating influenza in patients in need.

[0119] Methods Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0120] Unless the context clearly specifies otherwise, the singular forms “a,” “an,” and “described” include a plural referent. Thus, a reference to “a method” for example includes one or more methods, and / or steps of the type described herein, and / or will become apparent to those skilled in the art after reading this disclosure, etc.

[0121] The term “about” or “approximately” includes a meaningful range of values. The permissible variations covered by the term “about” or “approximately” depend on the specific system being studied and are readily understood by one of ordinary skill in the art.

[0122] The terms “comprising” or “comprises” are used herein to refer to compositions, methods and their respective components that are essential to the content of this disclosure, but may also include unspecified elements, whether or not they are necessary.

[0123] The term “composed of” means the compositions, methods and their respective components described herein, excluding any elements not listed in this description of the embodiments.

[0124] T cells bind to epitopes on small antigenic determinants associated with the major histocompatibility complex (MHC) on the surface of antigen-presenting cells. T cells bind to these epitopes via the T cell receptor (TCR) complex on their surface. The T cell receptor is a heterodimeric structure composed of two types of chains: α (alpha) and β (beta) chains, or γ (gamma) and δ (delta) chains. The α chain is encoded by a nucleic acid sequence located at the α locus on human chromosome 14, which also contains the entire δ locus, while the β chain is encoded by a nucleic acid sequence located at the β locus on human chromosome 7. Most T cells possess an αβ TCR; a minority of T cells possess a γδ TCR. Although the α and β chains are generally referred to herein, the methods, compositions, and kits described herein can be similarly applied to the γδ TCR chain.

[0125] T cell receptor α and β polypeptides (and similar γ and δ polypeptides) are interconnected by disulfide bonds. Each of the two polypeptides constituting the TCR contains an extracellular domain comprising a constant region and a variable region, a transmembrane domain, and a cytoplasmic tail (the transmembrane domain and cytoplasmic tail are also part of the constant region). The variable region of the TCR determines its antigen specificity and, similar to immunoglobulins, contains three complementarity-determining regions (CDRs), such as CDR1, CDR2, and CDR3. Similar to immunoglobulin genes, T cell receptor variable loci (e.g., TCRα and TCRβ loci) contain numerous unrearranged V(D)J segments (variable (V), linking (J), and diversity (D) segments in TCRβ and δ). During T cell development in the thymus, the TCRα variable locus rearranges, resulting in a TCRα variable domain encoded by a specific combination of VJ segments (Vα / Jα sequences); and the TCRβ variable locus rearranges, resulting in a TCRβ variable region encoded by a specific combination of VDJ segments (Vβ / Dβ / Jβ sequences). The TCR α and β variable domains, especially CDR1, CDR2 and CDR3, and more particularly CDR3, provide the specificity for TCR binding to MHC.

[0126] As used in this article, the term "T-cell receptor" (TCR) refers to a member of the immunoglobulin superfamily possessing a variable binding domain, a constant domain, a transmembrane region, and a short cytoplasmic tail; see, for example, Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rd ed., Current Biology Publications, 4:33, 1997), which specifically binds to antigenic peptides that bind to MHC receptors. TCRs can be found on the cell surface and are typically composed of heterodimers with α and β chains (also known as TCRα and TCRβ) or γ and δ chains (also known as TCRγ and TCRδ). Similar to immunoglobulins, the extracellular portion of the TCR chain (e.g., the α chain, β chain) contains two immunoglobulin regions: a variable region (e.g., the TCR variable α region or Vα and the TCR variable b region or Vβ; typically the N-terminus based on Kabat numbered amino acids 1 to 116) and a constant region adjacent to the cell membrane (e.g., the TCR constant domain α or Cα, typically based on Kabat amino acids 117 to 259, and the TCR constant domain β or Cβ, typically based on Rabat amino acids 117 to 295). Furthermore, like immunoglobulins, the variable domain contains complementarity-determining regions (CDRs) separated by framework regions (FRs). In some embodiments, the TCR is present on the surface of T cells (or T lymphocytes) and associated with the CD3 complex. The TCRs disclosed herein can be derived from a variety of animal species, such as humans, mice, rats, rabbits, or other mammals. In some embodiments, a selected portion of the TCR of the present invention is derived from genetically engineered mice to produce a TCR comprising human α and β chains (e.g., see PCT Publication WO 2016 / 164492, the entire contents of which are incorporated herein by reference). For example, genetically engineered mice can be used to provide α and / or β chains (or sequences thereof), to which variable regions or CDRs, determined by RAPTER assays, can be implanted (replacing homologous portions).

[0127] The term “variable region” (variable region of the α chain (Vα or Va), variable region of the β chain (Vβ or Vb)) used in this article refers to each part of the α and β chains that are directly involved in the binding of the TCR to the antigen.

[0128] The "constant regions" of the α and β chains do not directly participate in the binding of TCR to antigens, but exhibit various effector functions.

[0129] The terms "major histocompatibility complex" and "MHC" encompass the terms "human leukocyte antigen" or "HLA" (the latter two are commonly used for human MHC), naturally occurring MHC, single chains of MHC (e.g., MHC class I α (heavy) chain, β2 microglobulin, MHC class II α chain, and MHC class II β chain), single subunits of such MHC chains (e.g., α1, α2, and / or α3 subunits of the MHC class I α chain, α1-α2 subunits of the MHC class II α chain, and β1-β2 subunits of the MHC class II β chain), and portions (e.g., peptide-binding portions, such as peptide-binding grooves), mutants, and various derivatives (including fusion proteins), wherein such portions, mutants, and derivatives retain the ability to display antigenic peptides for recognition by T cell receptors (TCRs), such as antigen-specific TCRs. MHC I contains a peptide-binding groove formed by the α1 and α2 domains of the heavy α chain, which can accommodate a peptide of approximately 8-10 amino acids. Although both classes of MHC bind to a core of approximately nine amino acids (e.g., 5 to 17 amino acids) within a peptide, the open nature of the MHC class II peptide-binding groove (where the α1 domain of a class II MHC α peptide binds to the β1 domain of a class II MHC β peptide) allows for a wider range of peptide lengths. MHC class II bound peptides are typically between 13 and 17 amino acids in length, but shorter or longer lengths are not uncommon. Therefore, peptides can move within the MHC class II peptide-binding groove, thus altering which 9-mer is directly located within the groove at any given time.

[0130] The term "antigen" encompasses any substance (e.g., protein, peptide, polysaccharide, glycoprotein, glycolipid, nucleotide, part thereof, or combination thereof) that, when introduced into an immune-active host, is recognized by the host's immune system and elicits an immune response. T cell receptors (TCRs) recognize peptides presented in the major histocompatibility complex (MHC) as part of an immune synapse. Peptide-MHC (pMHC) complexes are recognized by TCRs, where the peptide (antigenic determinant) and the TCR idiotype provide the specificity of the interaction. Therefore, the term "antigen" encompasses peptides presented in the context of the MHC, such as peptide-MHC complexes, such as pMHC complexes. Peptides displayed on the MHC can also be referred to as "epitopes" or "antigenic determinants." The terms "peptide," "antigenic determinant," "epitope," etc., include not only peptides naturally presented by antigen-presenting cells (APCs) but can also be any desired peptide, provided it can be recognized by T cells when properly presented. For example, peptides with artificially prepared amino acid sequences can also be used as epitopes.

[0131] The binding of TCRs to homologous pMHCs is typically transient, although this interaction can be stabilized by an "affinity effect" resulting from the incorporation of multiple pMHCs onto a single backbone (e.g., a surface), for example using polymers such as tetramers, dextramers, etc. Various pMHC polymerization platforms have been utilized, many of which are commercially available. See, for example, Wooldridge et al. (2009). Nat. Methods 126:147-64. To accommodate this affinity effect, in some embodiments, the MHCs described herein are preferably surface-bound in order to achieve an appropriate MHC density.

[0132] In the non-limiting embodiments disclosed herein, non-limiting exemplary surfaces that MHC can be combined with include: a. Cell membranes, for example, where MHC is expressed on the surface of antigen-presenting cells (e.g., specialized antigen-presenting cells such as dendritic cells, monocytes, macrophages, and B cells), the surface of liposomes, the envelope of viral vectors, etc. b. Beads, c. Cell culture dishes, such as the wells of multi-well plates, and d. As a polymer, such as a tetramer, dextramer, etc.

[0133] Antigens may include synthetic peptides, proteins, mRNA, viruses, viral vectors, DNA, live cells, cell lysates, etc. In some non-limiting embodiments, the antigen is a tumor-associated antigen, including its peptide portion. In such embodiments, the tumor-associated antigen may be selected from the group consisting of: ALK, BAGE protein, BIRC5 (survivin), BIRC7, CA9, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD27, CD30, CD33, CD38, CD40, CD44, CD52, CD56, CD79, CDK4, CEACAM3, CEACAM5, CLEC12A, EGFR, EGFR variant III, ERBB2. (HER2), ERBB3, ERBB4, EPCAM, EPHA2, EPHA3, FCRL5, FLT3, FOLR1, GAGE ​​protein, GD2, GD3, GPNMB, GM3, GPR112, IL3RA, KIT, KRAS, LGR5, EBV-derived LMP2, L1CAM, MAGE protein, MART1, MLANA, MSLN, MUC1, MUC2, MUC3, MUC4, MUC5, MUC16, MUM1, ANKRD30A, NY-ESO1 (CTAG1B), OX40, PAP, PAX3, PAX5, PLAC1, PRLR, PMEL, PRAME, PSMA (FOLH1), RAGE protein, RET, RGS5, ROR1, SART1, SART3, SLAMF7, SLC39A6 (LIV1), STEAP1, STEAP2, TERT, TMPRSS2, Thompson-nouvelle antigen, TNFRSF17, TYR, UPK3A, VTCN1, WT1.

[0134] In another embodiment, the antigen may be associated with an infectious disease. In such an embodiment, for example, a biological sample can become a unique biological sample by adding an infectious agent or an epitope derived therefrom. In one such embodiment, the infectious disease-associated antigen may be a viral antigen, and said viral antigen is selected from the group consisting of: HIV, hepatitis A, hepatitis B, hepatitis C, herpesviruses (e.g., HSV-1, HSV-2, CMV, HAV-6, VZV, Epstein-Barr virus), adenovirus, influenza virus, flavivirus, echovirus, rhinovirus, Coxsackievirus, coronavirus (e.g., SARS-CoV-2), respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV, dengue virus, papillomavirus (e.g., human papillomavirus (HPV)), molluscum contagiosum virus, poliovirus, rabies virus, JC virus, Ebola virus, and arbovirus encephalitis virus antigens. In another such embodiment, the infectious disease-related antigen may be a bacterial antigen, and the bacterial antigen is selected from the group consisting of: Chlamydia, Rickettsia, Mycobacterium, Staphylococcus, Streptococcus, Pneumococcus, Neisseria meningitidis, Neisseria gonorrhoeae, Klebsiella, Proteus, Serratia, Pseudomonas, Legionella, Diphtheria, Salmonella, Bacillus, Cholera, Tetanus, Botulinum toxin, Anthrax, Plague, Leptospira, and Lyme disease bacterial antigens.

[0135] As used in the methods described herein, the term "biosample" refers to a culture containing bioactive cells, an activator of the bioactive cells, and a culture medium optionally supporting cell viability and / or bioactivation (e.g., cell activity). Bioactive cells can be a homogeneous cell population, such as isolated cells of a specific type (e.g., T cells), or a mixture of different cell types (e.g., a co-culture of peripheral blood mononuclear cells (PBMCs), antigen-presenting cells (APCs), and T cells, a co-culture of dendritic cells (DCs), and T cells, etc.), which may be isolated from a subject (e.g., a human, mammalian, or other species subject) or contain biological fluids or tissues isolated from the subject. As a non-limiting example, biological fluids or tissues may include serum, plasma, whole blood, peripheral blood, saliva, urine, vaginal or cervical secretions, amniotic fluid, placental fluid, cerebrospinal fluid, serous fluid, or mucosal secretions (e.g., oral, vaginal, or rectal). Other samples include biosamples or tissues of blood or biopsy origin, such as tissues containing tumor-infiltrating lymphocytes (e.g., tumors), indurations, etc.

[0136] Some non-limiting biological samples disclosed herein comprise T cells and surface-bound MHC for presenting antigens (e.g., T cell epitopes). For example, the biologically active cell is a T cell, and the activator is the surface-bound MHC for presenting antigens (e.g., T cell epitopes). Some non-limiting biological samples disclosed herein include T cells, surface-bound MHC (presenting antigens, such as T cell epitopes), and one or more cytokines that support T cell viability, activation, and / or activity. For example, the biologically active cell is a T cell, the activator is the surface-bound MHC (presenting antigens, such as T cell epitopes), and the culture medium contains one or more cytokines that support T cell viability, activation, and / or activity. In some embodiments, the cytokines supporting T cell viability, activation, and / or activity include interleukins selected from the group consisting of IL-2, IL-4, IL-7, IL-15, IL-21, and combinations thereof. Some of the non-restrictive biological samples disclosed herein contain surface-binding MHCs of T cells and antigen-presenting cells, wherein the MHCs are expressed on the surface of antigen-presenting cells (e.g., somatic cells), said antigen-presenting cells optionally being specialized antigen-presenting cells selected from the group consisting of monocyte-derived dendritic cells, monocytes, macrophages, and B cells. These non-restrictive biological samples containing surface-binding MHCs of T cells and antigen-presenting cells, wherein the MHCs are expressed on the surface of antigen-presenting cells, optionally further comprising cytokines supporting the viability, activation, and / or activity of T cells (e.g., IL-2, IL-4, IL-7, IL-15, and / or IL-21) and / or cytokines supporting the viability, activation, and / or activity of antigen-presenting cells (e.g., GM-CSF, FLT3L, and / or IL-4). Other cytokines or combinations of cytokines (and the amounts of cytokines or combinations of cytokines used to support the viability, activation, and / or activity of T cells and / or antigen-presenting cells) are well known in the art. In some embodiments, the cell viability-supporting culture medium contains other factors that activate APCs, such as IFNα, LPS, poly-IC, TNF, IL-1β, IL-6, PGE2, etc.

[0137] Biological samples are typically obtained or derived from specific sources, subjects, or patients.

[0138] "Individual," "subject," or "animal" refers to a human, a veterinary animal (e.g., a cat, dog, cow, horse, sheep, pig, etc.), and a disease experimental animal model (e.g., a mouse, rat). In one implementation, the subject is a human.

[0139] In one non-limiting embodiment of this document, the biological sample includes peripheral blood mononuclear cells (PBMCs) derived from the subject. The biological sample described herein may include newly isolated PBMCs, freshly thawed PBMCs that have been cryopreserved, or induced PBMCs, for example, cultured for about one week in the presence of the antigen to amplify memory responsiveness and increase the assay signal.

[0140] Generally, the biological samples described herein (e.g., unique biological samples) contain a sufficient number of T cells and surface-binding MHC to support T cell activation in response to antigens, for example, at least 1 × 10⁻⁶. 5 5×10 5 1×10 6 One or more whole peripheral blood mononuclear cells. The combination of hashing and reuse advantageously provides for performing the methods described herein on low-volume blood samples (e.g., low-volume human blood samples), since 1 mL of whole (human) blood can contain 5 × 10⁻⁶ cells. 5 Up to 3×10 6 5 × 10 peripheral blood mononuclear cells (PBMCs) and / or cells that can be used to isolate 5 × 10 3 Up to 5×10 5 APCs (e.g., dendritic cells) and 5 × 10 3 Up to 5×10 6 5 × 10 T cells. As a non-limiting example, the cell collection obtained from 10 mL of whole blood isolated from a subject may contain 5 × 10 T cells. 6 Up to 3×10 7 One PBMC allows the cell collection to be equally distributed across multiple individual biological samples, for example, at least 20 biological samples, each containing approximately 1 × 10⁻⁶ cells. 5 Up to 1×10 6 One PBMC and / or 1×10 5 Up to 5×10 5 One DC and 1×10 5 Up to 5×10 6 The cells, such as T cells, can then be pooled (after adding a unique antigen and / or a unique HTO to each sample) and assayed according to the methods described herein. Therefore, in some embodiments, the cell pool contains a sufficient number of peripheral blood mononuclear cells (PBMCs) such that the cell pool can be evenly distributed across multiple biological samples. In some embodiments, the cell pool contains a sufficient number of PBMCs such that the cell pool can be equally distributed into at least two separate biological samples, each containing at least about 1 × 10⁻⁶ cells. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6The cell collection, for example, can be obtained from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject (e.g., a human subject). In some embodiments, the cell collection contains a sufficient number of PBMCs such that the cell collection can be equally distributed into at least three separate samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 The cell collection, for example, can be obtained from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject (e.g., a human subject). In some embodiments, the cell collection contains a sufficient number of PBMCs such that the cell collection can be equally distributed into at least five separate samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 The cell collection, for example, can be obtained from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject (e.g., a human subject). In some embodiments, the cell collection contains a sufficient number of PBMCs such that the cell collection can be equally distributed into at least ten individual samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 The cell collection, for example, can be obtained from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject (e.g., a human subject). In some embodiments, the cell collection contains a sufficient number of PBMCs such that the cell collection can be equally distributed into at least twenty individual samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 The cell collection, for example, can be obtained from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject (e.g., a human subject). In some embodiments, the cell collection contains a sufficient number of PBMCs such that the cell collection can be equally distributed into at least thirty individual samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 105 One PBMC or at least approximately 1×10 6 The cell collection may be derived from approximately 1 mL, 3 mL, 5 mL, 10 mL, 15 mL, 20 mL, or 50 mL of whole blood isolated from a subject (e.g., a human subject). In some embodiments, the cell collection contains a sufficient number of PBMCs such that the cell collection can be equally distributed into at least fifty individual samples, each containing at least approximately 1 × 10⁻⁶ PBMCs. 5 One PBMC, at least approximately 5 × 10 5 One PBMC or at least approximately 1×10 6 Each PBMC, for example, may be derived from approximately 1 mL, approximately 3 mL, approximately 5 mL, approximately 10 mL, approximately 15 mL, approximately 20 mL, or approximately 50 mL of whole blood isolated from a subject (e.g., a human subject). In one embodiment, the cell collection contains a sufficient number of T cells and antigen-presenting cells (APCs) (e.g., dendritic cells (DCs)) such that the cell collection can be equally distributed across multiple individual biological samples. In some embodiments, the cell collection contains a sufficient number of APCs and T cells isolated from a subject (e.g., a human subject) such that the cell collection can be equally distributed across multiple individual biological samples, each biological sample containing APCs and T cells (e.g., DCs and T cells) with an APC:T cell ratio of approximately 1:1, approximately 1:5, or approximately 1:10, for example, where each sample contains at least approximately 5 × 10⁶ cells. 3 5×10 4 Or 5×10 5 One DC and approximately 5 × 10 3 1×10 4 2.5×10 4 5×10 4 1×10 6 2.5×10 5 5×10 5 1×10 6 2.5×10 6 Or 5×10 6 Individual cells. For example, the cell collection may be derived from approximately 5 mL, approximately 10 mL, approximately 15 mL, approximately 20 mL, or approximately 50 mL of whole blood isolated from a subject (e.g., a human subject).

[0141] Biological samples isolated from the subject may be further diluted with saline, buffer, or physiologically acceptable diluents. Alternatively, biological samples from the subject may be concentrated using conventional methods. Biological samples isolated from the subject may also be aliquoted into two or more equal portions to form “multiple biological samples,” each of which contains approximately the same number of bioactive cells (e.g., T cells) and approximately the same amount of supporting reagents. Therefore, unless otherwise stated, “multiple biological samples” as used herein refers to multiple distinct bioactive cell populations, each isolated from the same subject, containing approximately the same number of bioactive cells, and maintained under similar culture conditions, such as using supporting reagents to support the viability, activation, and / or activity of bioactive cells.

[0142] In some embodiments of the invention, the biological sample is in vitro priming, such as pre-amplification, by incubating with the antigen for about a week (e.g., about 7-10 days), followed by in vitro restimulation with the antigen for about one to three days (e.g., 6-72 hours, or 18-24 hours), and then hashing, enrichment, and / or analysis of the unique biological sample. In some embodiments of the invention, the biological sample is not in vitro priming before in vitro restimulation with the antigen and subsequent hashing, enrichment, and / or analysis of the unique biological sample. For biological samples that may encounter the antigen in vivo, in vitro priming is generally not required. For biological samples containing T cells, priming and restimulation protocols, including the same timeline (e.g., priming for 7-10 days, restimulation for 6-72 hours, or 18-24 hours), are well known in the art.

[0143] In some non-limiting embodiments, each of the multiple biological samples becomes a unique biological sample by being cultivated together with its own unique stimuli or unique combination of stimuli (e.g., antigens or pools of antigens (e.g., T-cell epitopes)) and / or its own unique barcode (e.g., for hash tags and optional reuse (hash-tagged oligonucleotides)).

[0144] As used herein, "hash tag," "hash," "tag," etc., refer to contacting a bioactive cell of a unique biological sample with a molecule (e.g., a unique hash-tagged oligonucleotide (HTO)) conjugated to a unique barcode, wherein the unique barcode identifies a unique characteristic of the unique biological sample, such as a unique antigen (e.g., a unique T-cell epitope) or the absence of a unique antigen, and wherein the molecule is incorporated into the cell membrane of the bioactive cell and / or specifically binds to a cell surface marker expressed by the bioactive cell, regardless of the activation state of the bioactive cell. In some embodiments, the HTO molecule may be incorporated into any cell, such as any dividing cell, and / or bind to a cell surface marker expressed by most or all cells (e.g., β2-microglobulin, CD298). In some embodiments, the selected cell marker is expressed by T cells, regardless of their activation state (e.g., CD2, CD3, CD4, and / or CD8, etc.). In some embodiments, when two or more molecules are each conjugated to an HTO in two or more different ways (e.g., one molecule may incorporate itself into the cell membrane while another molecule binds to the marker, and two or more molecules may bind to two or more different markers) and are each used in a hashing method to label the same unique biological sample, the two or more molecules may contain the same barcode. In some embodiments, the two or more markers used to hash and label a unique biological sample may be the same or different markers. In some embodiments, a first unique biomarker may be a first molecular marker conjugated to a first unique barcode (e.g., a first HTO), a second unique biological sample may be a second molecular marker conjugated to a second unique barcode (e.g., a second HTO), and a third biological sample may be a third molecular marker conjugated to a third barcode (e.g., a third barcode), wherein each of the first, second, and third molecules is identical, for example, each integrates itself into the cell membrane or specifically binds to the same marker; however, each of the first, second, and third molecules contains sufficiently different unique barcodes such that each of the first, second, and third molecules can be distinguished. After washing away unbound molecules, unique biological samples that have undergone unique hashing can be pooled and optionally cultured with additional reagents for further functional and phenotypic analysis of antigen-specific activated T cell populations (e.g., flow cytometry analysis and / or fluorescence cell activation sorting, single-cell sequence analysis, etc.), because hashing allows for later detection, tracking, and / or quantification of each sample and target from the same sample.

[0145] Some non-limiting embodiments may further enhance the sensitivity and / or robustness of the methods described herein. For example, in some non-limiting embodiments, pooling 20 potentially reactive oligonucleotides per scSEQ sample for hash assay typically results in sufficient enrichment. In some embodiments, combined hashing methods may be employed to increase the sensitivity of the assay. For example, two or more molecules that are respectively HTO-tagged with cells in two or more different ways (e.g., one molecule may incorporate itself into the cell membrane while another molecule binds to the tag, two or more molecules may bind two or more different tags, etc. (e.g., β2 microglobulin and CD2)) are each conjugated with the same barcode, such as an HTO conjugate containing the same sequence, and are each used in a hashing method to label the same unique biological sample.

[0146] The generation and use of “hash-tagged oligonucleotides,” “HTO,” etc., are well known, including the conjugation of hash-tagged oligonucleotides to molecules (e.g., antibodies or other macromolecules, such as lipids), said molecules optionally and preferably in some non-limiting embodiments, to activation-inducible tags. See, for example, WO2018144813; Stoeckius et al. (2018). Cell 19:224; van Buggenum JAGL et al., each reference is incorporated herein by reference in its entirety. Typically, an HTO contains a unique barcode, for example, a nucleic acid containing a unique sequence that can be determined according to a standard polymerase chain reaction protocol, such as a single-cell RNA sequencing protocol for sequencing the cellular transcriptome (see, for example, Stoeckius et al. (2017)). Cell 9:2579-10), in the embodiments described herein, the unique sequence identifies an activated biological sample, such as a stimulus or combination of stimuli that causes the biological sample to express an activation-inducing marker. Conjugation chemistry, such as iEDDA click chemistry, can be used to conjugate (e.g., covalently link) hash-tagged oligonucleotides to molecules, such as ligands that bind cell surface markers (e.g., constitutively expressed cell surface markers). In one embodiment, the cell surface marker is expressed by most or all cells (including T cells) (e.g., β2 microglobulin, CD298). In some embodiments, selected cell markers are expressed by T cells regardless of their activation state (e.g., CD2, CD3, CD4, and / or CD8, etc.). Although oligonucleotide-tagged antibodies are described herein, other oligonucleotide-tagged tracking molecules besides antibodies, such as oligonucleotide-tagged cell membrane incorporation lipids and cell-penetrating nucleic acids, can be used, particularly for further functional and / or phenotypic characterization based on single-cell sequencing analysis.

[0147] The hash-tagged oligonucleotides (HTOs) used in these compositions and methods can be conjugated to any naturally occurring or synthetic biological or chemical molecule that can be used to label cells, such as lipids incorporated into the cell membrane and / or ligands that bind specifically to a single identified marker. The binding can be covalent or non-covalent, i.e., conjugation, or by any known means, taking into account the nature of the ligand and its respective target. The terms “first HTO conjugated molecule” and “additional HTO conjugated molecule” or “second HTO conjugated molecule” refer to HTO conjugated molecules that label cells in different ways; for example, one molecule may incorporate itself into the cell membrane while a second molecule binds a marker, and two or more molecules may bind to different targets or different portions of a target. For example, multiple “first HTO conjugated molecules” may be incorporated into the cell membrane or bind to the same marker at the same location. Multiple additional HTO conjugated molecules may bind to markers that are different from the first HTO conjugated molecule and different from any other HTO conjugated molecule. HTO conjugated molecules (e.g., a first HTO conjugated molecule, and additional HTO conjugated molecules, such as second, third, fourth, and fifth HTO conjugated molecules, etc.) may be independently selected from peptides, proteins, antibodies or antibody fragments (e.g., the antigen-binding portion of an antibody), antibody mimics, affinities, ribose or deoxyribonucleic acid sequences, aptamers, lipids, cholesterol, polysaccharides, lectins, or chimeric molecules formed from multiple identical or different molecules. Other non-limiting examples of HTO-conjugated molecules include molecules comprising: Fab, Fab', F(ab')2, Fv fragments, single-chain Fv (scFv), biantibodies (Dab), synthetic antibodies, nanobodies, BiTE, SMIP, DARPins, DNL, ​​Duocalins, adnectin, fynomers, Kunitz domain Albu-dabs, DART, DVD-IG, Covx-bodies, peptibodies, scFv-Igs, SVD-Igs, dAb-Igs, Knob-in-Holes, triomAbs, and combinations thereof. In some embodiments, the HTO-conjugated molecule is a recombinant or naturally occurring protein. In some embodiments, the HTO-conjugated molecule is a monoclonal or polyclonal antibody or a fragment thereof. In one embodiment, the HTO-bound molecule itself may also be directly labeled with one or more detectable tags, such as fluorophores, which can be measured by methods independent of measuring or detecting barcodes (e.g., HTO) according to well-known methods.

[0148] In some embodiments, the HTO conjugate molecule comprises lipids that are incorporated into the cell membrane. In some embodiments, the HTO conjugate molecule comprises cholesterol that is incorporated into the cell membrane. In some embodiments, the HTO conjugate molecule comprises lipid and cholesterol-modified oligonucleotides (LMO and CMO). See, for example, McGinnis et al. (2019). Nat. Commun. I. PV16, MART1, CMV, EBV, or influenza T cells, T cell receptors (TCRs), and compositions comprising PV16, MART1, CMV, EBV, or influenza TCRs 16:619-26, which are incorporated in full by quotation.

[0149] Assays for further analysis of the function and phenotype of antigen-specific activated T cell populations are well known in the art and include, but are not limited to, fluorescent cell activation sorting and / or flow cytometry analysis using fluorescently labeled binding proteins (e.g., antibodies) or MHC multimers, single-cell RNA sequencing (scRNA-seq), and / or cell indexing of transcriptomes and epitopes by sequencing (CITE-seq). "Flow cytometry" involves suspending cells or particles in a liquid and injecting the suspension into a flow cytometer, which focuses the sample to ideally allow cells to flow through a laser beam one at a time, where scattered light is characteristic of the cells and their components. Cells labeled with fluorescent tags absorb the laser and emit wavelength bands that can be used to distinguish the cells. In a preferred embodiment, after hashing and pooling, a unique biological sample is enriched to obtain activated T cells, for example, sorting those cells expressing activation-inducing tags. In one implementation, before or simultaneously with any further functional and phenotypic analysis of the cells, such as before or simultaneously with any additional flow cytometry analysis and / or single-cell sequencing analysis (which may include CITE-seq analysis of any CITE-seq reagents added to the biological sample before or after sorting), the cells are enriched with activated T cells using fluorescently labeled antibodies against activation-inducing markers and fluorescent activated cell sorting (FACS), for example, sorting. "CITE-seq" encompasses methods for measuring protein expression levels in a sample using oligonucleotide-labeled molecules (e.g., oligonucleotide-labeled antibodies), such as during single-cell sequencing methods, as described by Stoeckius et al. (20017). II. Pharmaceutical compositionsThe literature described in 14:865-868 is incorporated herein by reference in its entirety. In some non-limiting embodiments, further functional and phenotypic analysis of the cells includes flow cytometry analysis using fluorescently labeled antibodies that detect protein expression levels of cell surface markers (e.g., additional activation markers) or intracellular proteins (e.g., intracellular cytokines). In some non-limiting embodiments, further functional and phenotypic analysis of the cells includes single-cell RNA sequencing for each activated cell. Non-limiting exemplary platforms for single-cell RNA sequencing include, but are not limited to, plate-based methods or microfluidic / nanopore methods, such as droplet-based microfluidic methods, such as, but not limited to, Drop-seq (Macosko et al. (2015)). III. Therapeutic uses of HPV16, MART1, CMV, EBV, or influenza TCRs or immune effector cells comprising HPV16, MART1, CMV, EBV, or influenza TCRs 161:1202-14), InDrop (Kein et al. (2015) Example 1 - Rapid TCR: Epitope ordering 161:1187-1201), 10X Genomics (Zhen et al. (2017) Figure 1A 8:1-12) and ILLUMINA® / BIO-RAD single-cell sequencing solutions. Since mRNA expression levels may not correlate well with protein expression levels in cells, in some non-limiting embodiments, single-cell RNA sequencing is combined with CITE-Seq analysis using, for example, oligonucleotide-labeled antibodies, MHC multimers, etc. (see, for example, WO2018144813, which is incorporated herein by reference in its entirety).

[0150] "Activation-inducing markers" (AIMs) are markers expressed or upregulated after T cell activation. Well-known T cell activation-inducing markers include, but are not limited to, CD137 / 4-1BB, CD107, IFNγ, PD-1, CD40L, OX40, CD25, CD69, CD28, HLA-DR, CX3CR1, TIM3, LAG3, TIGIT, etc. In some embodiments, T cell activation markers, such as activation-inducing markers, include CD40L. CD40L may also be referred to as CD154. In some embodiments, T cell activation markers, such as activation-inducing markers, include CD137. CD137 is also referred to herein as 4-1BB. Therefore, CD137 / 4-1BB refers to molecules referred to in the art as CD137, 4-1BB, etc., and the phrases "CD137", "4-1BB", and "CD137 / 4-1BB" are used interchangeably. CD137 / 4-1BB is a transient T cell activation marker that is rapidly upregulated upon antigen-specific TCR binding and remains expressed on cells for approximately 72 hours. In the methods described herein, 20–36 hours after antigen exposure appears to be the optimal time point for CD137 / 4-1BB expression and detection enrichment. In some embodiments, the activation-inducing marker includes CD107. CD107 may also be referred to as CD107a or LAMP1. In some embodiments, the activation-inducing marker includes interferon-γ (IFNγ), which may also be referred to as interferon-gamma, IFNG, IFG, etc. In some embodiments, the activation-inducing marker includes PD-1, which may also be referred to as programmed cell death 1, CD279, and HPD-1. In some embodiments, the activation-inducing marker includes TNF receptor superfamily member 4, which may also be referred to as OX40 and / or CD134. In some embodiments, the activation-inducing marker includes interleukin-2 receptor α, which may also be referred to as IL-2R, IL-2Rα, and / or CD25. In some embodiments, the activation-inducing marker includes CD69, which may also be referred to as leukocyte surface antigen Leu-23 and / or MLR3. In some embodiments, the activation-inducing marker includes CD28, which may also be referred to as Tp44 and / or T cell-specific surface glycoprotein. In some embodiments, the activation-inducing marker includes major histocompatibility complex class II DR, which may also be referred to as HLA-DR. In some embodiments, the activation-inducing marker includes CXC motif chemokine receptor (CX3CR1), which may also be referred to as IL-8 receptor, IL-8Rα, and / or CDw128a. In some embodiments, the activation-inducing marker includes TIM3, which may also be referred to as hepatitis A virus cell receptor 2, T cell membrane protein 3, and / or CD366. In some embodiments, the activation-inducing marker includes lymphocyte activation gene 3 (LAG3), which may also be referred to as CD223.In some implementations, activation-inducing markers include T-cell immune receptors with Ig and ITIM domains (TIGIT), which may also be referred to as protein 9 (VSIG9) containing V-Set and immunoglobulin domains and / or protein 3 (VSTM3) containing V-Set and / or transmembrane domains.

[0151] The terms “immunoglobulin,” “antibody,” “antibodies,” and “binding protein” refer to monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, chimeric antibodies, single-chain Fv (scFv), single-chain antibodies, Fab fragments, F (ab′) fragments, disulfide-linked Fv (sdFv), intracellular antibodies, microantibodies, biantibodies, and anti-idiotype (anti-Id) antibodies (including, for example, anti-Id antibodies against antigen-specific TCRs), as well as epitope-binding fragments of any of the above. The terms “antibody” and “antibodies” also refer to covalent biantibodies, such as those disclosed in U.S. Patent Application Publication No. 20070004909, which is incorporated herein by reference in its entirety, and Ig-DARTS, such as those disclosed in U.S. Patent Application Publication No. 20090060910, which is incorporated herein by reference in its entirety.

[0152] As used herein, the term "detectable label" refers to a reagent, fraction, or compound capable of providing a detectable signal, depending on the assay method employed. Labels may be associated solely with the molecule and / or with a unique barcode (e.g., a unique HTO) or its functional portion. Alternatively, different labels may be used for each component of an HTO-conjugated molecule. Such labels can act alone or synergistically with other compositions or compounds to provide a detectable signal. In one embodiment, these labels interact to generate a detectable signal. In one specific embodiment, the label can be detected visually, such as by colorimetry. Various enzyme systems exhibit colorimetric signals in assays; for example, glucose oxidase (using glucose as a substrate) releases peroxides as a product, producing blue-colored TMB oxide in the presence of the peroxidase and a hydrogen donor (e.g., tetramethylbenzidine (TMB)). Other examples include horseradish peroxidase (HRP) or alkaline phosphatase (AP), and hexokinase bound to glucose-6-phosphate dehydrogenase, which reacts with ATP, glucose, and NAD+ to produce products such as NADH, which is detected as an increase in absorbance at 340 nm. Other labeling systems available in the methods and molecules can be detected in other ways; for example, colored latex microparticles embedded with dyes (Bangs Laboratories, Indiana) can be used instead of enzymes to provide a visual signal indicating the presence of the labeled molecule in the applicable assay. Other labels include fluorescent compounds, fluorophores, radioactive compounds, or elements. In one embodiment, fluorescence can detect fluorescent dyes such as fluorescein isothiocyanate (FITC), phycoerythrin (PE), allophycocyanin (APC), phycocyanin-0 (CPO) or tandem dyes, PE-blue protein-5 or-7 (PC5 or PC7), PE-Texas Red (ECD), PE-blue protein-5.5, rhodamine, PerCP, and Alexa dyes. Depending on the assay method, combinations of these labels may be used, such as Texas Red and Rhodamine, FITC + PE, FITC + PECy5, and PE + PECy7, etc. The selection and / or generation of suitable labels for labeling any components of the molecular and / or polymer molecule is within the scope of the art as provided in this specification.

[0153] The terms "specific binding" and "binding in a specific manner" indicate that the molecules involved in specific binding (1) can bind stably under physiological conditions, such as through association or the formation of intermolecular non-covalent bonds, and (2) cannot bind stably to molecules other than the specific binding pair under physiological conditions. Specific binding also means that the TCR forms a relatively stable complex with the antigen under physiological conditions. Specific binding is characterized by at least about 1 × 10⁻⁶. -6 M or smaller, such as 1×10 -8M or a smaller equilibrium dissociation constant (e.g., a smaller KD indicates a tighter binding). Methods for determining whether two molecules are specifically bound are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, etc.

[0154] The term "off-target peptide" refers to a peptide that differs from a target peptide by 1, 2, 3, 4, 5, or more amino acids. In some embodiments, the term includes peptides that differ from a target peptide by 3 or fewer amino acids. For example, for a 9-meric peptide, if 1, 2, or 3 amino acids are different from the target peptide, it is considered an "off-target" peptide. In some embodiments, amino acid identity is expressed as 'DoS'. If a 9-meric peptide has 6 or more identical amino acids, the DoS is 6. In some embodiments, peptides with a DoS < 6 are considered "off-target" peptides. The term "off-target" peptide also refers to a peptide that is similar to the target peptide based on sequence homology, is expected to bind to HLA-A2, and is contained in proteins expressed in essential, normal tissues. Therefore, in some embodiments, the TCR of this disclosure can bind to HPV16, MART1, CMV, EBV, or influenza peptides with an affinity corresponding to a KD value at least ten times lower than its affinity for binding to off-target peptides.

[0155] The term "separation" refers to a composition, compound, substance, or molecule that has been artificially altered from its natural state. For example, a composition or substance that exists in nature has been altered or removed from its original environment, or both.

[0156] For example, a polynucleotide or polypeptide naturally present in an animal is not isolated, but the same polynucleotide or polypeptide isolated from its native coexisting material is isolated, as the term is used herein. More specifically, an isolated TCR may refer to a TCR that has been removed from a cell, such as a purified TCR. A TCR may also be expressed by isolated cells, such as cells isolated from an animal or from a cell culture. In this case, the isolated cells may express the TCR on their surface (i.e., the cells may “present” the TCR). Therefore, any TCR or variable domain disclosed herein may be provided as an isolated TCR or its variable domain. Similarly, any nucleic acid molecule containing a sequence encoding a TCR or its variable domain disclosed herein may be provided as an isolated nucleic acid molecule. Likewise, any cell containing a TCR or its variable domain disclosed herein, or any host cell containing a nucleic acid containing a sequence encoding a TCR or its variable domain disclosed herein, may be provided as an isolated cell.

[0157] The term "protein" encompasses all types of naturally occurring and synthetic proteins, including protein fragments of all lengths, fusion proteins, and modified proteins, including but not limited to glycoproteins, as well as all other types of modified proteins (e.g., proteins produced by phosphorylation, acetylation, myristylation, palmitoylation, glycosylation, oxidation, formylation, amidation, polyglutamylation, ADP-ribosylation, PEGylation, biotinylation, etc.).

[0158] Unless otherwise stated, the terms "oligonucleotide," "nucleic acid," and "nucleotide" cover DNA, RNA, modified bases, or combinations of these bases. In some embodiments, the hash-tagged oligonucleotide comprises DNA. In some embodiments, the hash-tagged oligonucleotide comprises 3 to 100, 3 to 50, 3 to 30, 5 to 30, 10 to 20, 5 to 20, or 5 to 15 nucleotides. In some embodiments, the hash-tagged oligonucleotide comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 5 A sequence of 1, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 80, 91, 92, 93, 94, 95, 96, 97, 98, 99, or up to 100 nucleotides. In some embodiments, the hash-tagged oligonucleotide comprises a polyadenylated sequence, which may comprise ten or more (e.g., 10-40, 10-30, or 10-20) consecutive adenosine nucleotides, derivatives of adenosine nucleotides, or variants thereof.

[0159] As used herein, the term "recombinant" refers to the TCRs of the present invention generated, expressed, isolated, or obtained by techniques or methods known in the art, such as recombinant DNA technology, including, for example, DNA splicing and transgenic expression. The term also refers to TCRs expressed in non-human mammalian (including transgenic non-human mammalian, such as transgenic mice) or cell (e.g., CHO cells) expression systems, or TCRs isolated from recombinant human antibody libraries.

[0160] The term "self" refers to a biological component isolated from the same source, and includes those biological components that are not isolated from the same source but possess the same physical (e.g., amino acid sequence) and functional characteristics as those isolated from the same source. In contrast, "heterogeneous" refers to a reagent or entity from a different source.

[0161] The term "vector" refers to a nucleic acid molecule that can replicate autonomously within a host cell and accept foreign DNA. A vector carries its own origin of replication, one or more unique recognition sites for restriction endonucleases that can be used to insert foreign DNA, and typically optional markers (such as genes encoding antibiotic resistance) and recognition sequences (such as promoters) typically used to express the inserted DNA. Common vectors include plasmid vectors and phage vectors.

[0162] In some embodiments, the TCR of the present invention may be conjugated with a portion such as a ligand, a detectable portion, or a therapeutic portion (“immunoconjugate”), said therapeutic portion being such as a cytotoxic agent, an anticancer drug, or any other therapeutic portion that can be used to treat a disease or condition (including HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions).

[0163] As used herein, the terms “non-natural” or “engineered” can refer to proteins (e.g., TCRs or their variable domains), nucleic acids (e.g., vectors), or cells (e.g., host cells) comprising a complex structure (e.g., an amino acid or nucleic acid sequence) created through human intervention beyond the scope of isolation and not yet found to exist in nature. In some cases, non-natural proteins, nucleic acids, or cells can be prepared by combining naturally occurring components of proteins, nucleic acids, or cells, for example, by combining two or more sequences, by modifying naturally occurring sequences (e.g., by deletion, addition, or substitution), or by genetically modifying cells to contain heterologous nucleic acids or to contain or encode heterologous proteins. For example, non-natural proteins can include synthetic proteins, such as fusion proteins, and other modified proteins, including soluble T-cell receptors or their variable regions, as described elsewhere herein. Non-natural nucleic acids can include vectors that have been engineered to incorporate heterologous genetic elements, such as origins of replication, promoters, restriction endonuclease recognition sites, and / or other sequences, such as polynucleotide sequences encoding TCRs or the variable domains provided herein. Those skilled in the art are familiar with various methods of altering naturally occurring proteins, such as TCRs or their variable domains, without impairing protein function (e.g., the binding affinity or specificity of naturally occurring TCRs to their homologous antigens (e.g., HLA-presenting peptides)). Some modifications may actually increase binding affinity or specificity. Similarly, those skilled in the art are familiar with various methods of altering naturally occurring nucleic acids to improve the expression of proteins encoding proteins (e.g., TCRs or their variable domains) or engineering cells to improve the survival, expression, or function of proteins encoding proteins (e.g., TCRs or their variable domains). Therefore, any TCR or variable domain disclosed herein may be provided as a non-naturally occurring TCR or its variable domain, or a non-naturally occurring protein containing it. Similarly, any nucleic acid molecule containing a sequence encoding a TCR or its variable domain disclosed herein may be provided as a non-naturally occurring nucleic acid molecule (e.g., a vector). Likewise, any cell containing a TCR or its variable domain disclosed herein, or any host cell containing a nucleic acid containing a sequence encoding a TCR or its variable domain disclosed herein, may be provided as a non-naturally occurring cell.

[0164] As used herein, the term “surface plasmon resonance” refers to an optical phenomenon that allows for the analysis of real-time biomolecular interactions by detecting changes in protein concentration in a biosensor matrix, for example, using the BIACORE™ system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, NJ).

[0165] The term "KD," also known as KD or Kd, is designed to refer to the equilibrium dissociation constant of a particular biomolecule and its binding complex. KD measurements are particularly useful for assessing protein-protein interactions, such as antigen-binding protein-antigen interactions. The smaller the KD value, the greater (or stronger) the binding interaction or affinity between the antigen-binding protein and the antigen (e.g., the target). The larger the KD value, the weaker the binding interaction or affinity between the antigen-binding protein and the antigen.

[0166] The term "substantially identical" or "substantially identical" when referring to a nucleic acid or fragment thereof means that, when optimally aligned with another nucleic acid (or its complementary strand) with appropriate nucleotide insertions or deletions, as measured by any known sequence identity algorithm such as FASTA, BLAST, or Gap, at least about 90%, more preferably at least about 95%, 96%, 97%, 98%, or 99% of the nucleotide bases have nucleotide sequence identity, as discussed below. In some cases, a nucleic acid molecule substantially identical to a reference nucleic acid molecule may encode a polypeptide with the same or substantially similar amino acid sequence as the polypeptide encoded by the reference nucleic acid molecule.

[0167] Algorithms can be used to calculate sequence identity, such as the Needleman-Wunsch algorithm for global alignment (Needleman and Wunsch 1970, J. Mol. Biol. 48: 443-453) or the Smith-Waterman algorithm for local alignment (Smith and Waterman 1981, J. Mol. Biol. 147: 195-197). Dufresne et al. described another preferred algorithm in Nature Biotechnology in 2002 (Vol. 20, pp. 1269-71), which is used in the software GenePAST (GQ Life Sciences, Inc. Boston, MA).

[0168] When applied to peptides, the term "substantially similar" or "substantially analogous" means that two peptide sequences share at least 90% sequence identity, and more preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity, when optimally aligned using procedures such as GAP or BESTFIT with default gap weights. Preferably, the difference lies in a conserved amino acid substitution. A "conserved amino acid substitution" is a substitution in which an amino acid residue is replaced by another amino acid residue with a side chain (R group) having similar chemical properties (e.g., charge or hydrophobicity). Generally, conserved amino acid substitutions do not substantially alter the functional properties of a protein. In cases where two or more amino acid sequences differ from each other in that they are conserved substitutions, the percentage or degree of similarity can be adjusted upwards to correct for the conservatism of the substitution. Methods for making such adjustments are well known to those skilled in the art. See, for example, Pearson (1994) Methods Mol. Biol. 24: 307-331, which is incorporated herein by reference. Examples of amino acid groups with chemically similar side chains include 1) aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) aliphatic-hydroxy side chains: serine and threonine; 3) amide-containing side chains: asparagine and glutamine; 4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; 5) basic side chains: lysine, arginine, and histidine; 6) acidic side chains: aspartic acid and glutamic acid; and 7) sulfur-containing side chains: cysteine ​​and methionine. Preferred conserved amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate, and asparagine-glutamine. Alternatively, a conserved substitution is any change with a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Science 256: 1443 45, which is incorporated herein by reference. A “moderately conservative” permutation is any change that has a non-negative value in the PAM250 log-likelihood matrix.

[0169] Peptide sequence similarity is typically measured using sequence analysis software. Protein analysis software uses similarity metrics assigned to various substitutions, deletions, and other modifications (including conserved amino acid substitutions) to match similar sequences. For example, GCG software contains programs such as GAP and BESTFIT, which can be used with default parameters to determine sequence homology or sequence identity between closely related peptides (such as homologous peptides from different species) or between wild-type proteins and their mutant counterparts. See, for example, GCG version 6.1. Peptide sequences can also be compared using FASTA with default or recommended parameters; the program in GCG version 6.1. FASTA (e.g., FASTA2 and FASTA3) provides an alignment of the best overlapping regions between the query and retrieved sequences and a percentage of sequence identity (Pearson (2000) ibid.). Sequences can also be compared using the Smith-Waterman homology search algorithm, which uses an affine vacancy search with a vacancy opening penalty of 12 and a vacancy extension penalty of 2, and a BLOSUM matrix of 62. When comparing the sequences of this invention with databases containing a large number of sequences from different organisms, another preferred algorithm is the computer program BLAST, especially BLASTP or TBLASTN, using default parameters. See, for example, Altschul et al. (1990) J. Mol. Biol. 215: 403-410 and (1997) Nucleic Acids Res. 25:3389-3402, each of which is incorporated herein by reference.

[0170] "Patient-derived TCRs" are TCRs generated by isolating the α and β chains of TCRs that are reactive to specific antigens (such as HPV16, MART1, CMV, EBV, or influenza) from T lymphocytes that mediate disease regression associated with specific antigens (such as HPV16, MART1, CMV, EBV, or influenza).

[0171] “Affinity-matured TCRs” are TCRs generated through in vitro mutagenesis and selection. For example, non-targeted or targeted (e.g., oligonucleotide-guided) mutagenesis can be performed to introduce variations in the TCR sequence, and then subsequent TCRs can be screened for affinity for the target, for example, by using phage display.

[0172] The phrase “therapeutic effective amount” refers to the amount that, when administered, produces the desired effect. The exact amount will depend on the therapeutic purpose and will be determined by someone skilled in the art using known techniques (see, for example, Lloyd (1999) The Art, Science and Technology of Pharmaceutical Compounding). The term “effective amount” is intended to cover situations such as pharmaceutically effective amounts or therapeutically effective amounts. For example, in some embodiments, an effective amount is capable of achieving a beneficial state, a beneficial outcome, functional activity in screening assays, or an improvement in clinical condition.

[0173] As described herein, the TCR of the present invention can be "administered" to a subject.

[0174] "Administering" the TCR of the present invention includes, but is not limited to, administering cells expressing the TCR of the present invention (e.g., effector cells, such as T cells), administering nucleic acids expressing the TCR of the present invention (e.g., vectors expressing such TCRs), and administering polypeptides containing the TCR of the present invention, wherein the polypeptides have been formatted for such administration (e.g., bispecific polypeptides containing a TCR chain and a CD3-binding antibody chain).

[0175] As used herein, the term "subject" refers to an animal, preferably a mammal, that requires improvement, prevention, and / or treatment of a disease or condition associated with HPV16, MART1, CMV, EBV, or influenza. The term also includes subjects who have or are at risk of having a disease or condition associated with HPV16, MART1, CMV, EBV, or influenza.

[0176] As used herein, “anticancer drug” means any agent that can be used to treat, improve, or inhibit cancer, including but not limited to cytotoxins and agents such as antimetabolites, alkylating agents, anthracyclines, antibiotics, antimitotic agents, procarbazine, hydroxyurea, asparaginase, corticosteroids, cyclophosphamide, mitotane (O,P'-(DDD)), biologics (e.g., antibodies and interferons), and radiopharmaceuticals. As used herein, “cytotoxic agent” also refers to chemotherapeutic agents and means any agent that is harmful to cells. Examples include Taxol® (paclitaxel), temozolomide, cytochalasin B, bacitracin D, ethidium bromide, emetine, cisplatin, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, anthraquinone, mitoxantrone, photomycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin, as well as their analogues or homologs.

[0177] The terms “prevent,” “preventing,” “prevention,” and “preventive treatment” are intended to reduce the likelihood that a subject who does not have a certain condition or disease but is at risk of developing or being susceptible to it will develop that condition or disease. Prevention does not mean preventing a subject from developing a specific disease or disease. Prevention may require the administration of multiple doses. Prevention may include preventing a relapse of disease in a subject whose symptoms have all subsided, or preventing a relapse of a relapsing-remitting disease. Conventional molecular biology, microbiology, and recombinant DNA techniques within the scope of this disclosure may be employed. Such techniques are explained in detail in the literature. See, for example, Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989 (referred to here as "Sambrook et al., 1989"); DNA Cloning: A Practical Approach, Volumes I and II (edited by DN Glover, 1985); Oligonucleotide Synthesis (edited by MJ Gait, 1984); Nucleic Acid Hybridization [edited by BD Hames and SJ Higgins (1985)]; Transcription And Translation [edited by BD Hames and SJ Higgins (1984)]; Animal Cell Culture [edited by RI Freshney (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); Ausubel, FM et al. (eds.). Current Protocols in Molecular Biology. John Wiley & Sons, Inc., 1994. Each publication is incorporated herein by reference in its entirety.These techniques include site-directed mutagenesis, see, for example, Kunkel, Proc. Natl. Acad. Sci. USA 82: 488-492 (1985), U.S. Patent No. 5,071,743; Fukuoka et al., Biochem. Biophys. Res. Commun. 263: 357-360 (1999); Kim and Maas, BioTech. 28:196-198 (2000); Parikh and Guengerich, BioTech. 24: 428-431 (1998); Ray and Nickoloff, BioTech. 13: 342-346 (1992); Wang et al., BioTech. 19: 556-559 (1995); Wang and Malcolm, BioTech. 26: 680-682 (1999); Xu and Gong, BioTech. 26: 639-641 (1999), U.S. Patent Nos. 5,789,166 and 5,932,419; Hogrefe, Strategies l4. 3: 74-75 (2001); U.S. Patent Nos. 5,702,931, 5,780,270 and 6,242,222; Angag and Schutz, Biotech. 30: 486-488 (2001); Wang and Wilkinson, Biotech. 29: 976-978 (2000); Kang et al., Biotech. 20: 44-46 (1996); Ogel and McPherson, Protein Engineer. 5: 467-468 (1992), Kirsch and Joly, Nucl. Acids. Res. 26: 1848-1850 (1998), Rhem and Hancock, J. Bacteriol. 178: 3346-3,349 (1996), Boles and Miogsa, Curr. Genet. 28: 197-198 (1995), Barrenttino et al., Nuc. Acids. Res. 22: 541-542 (1993), Tessier and Thomas, Meths. Molec. Biol. 57: 229-237, and Pons et al., Meth. Molec. Biol. 67: 209-218; each publication is incorporated herein by reference in its entirety.

[0178] Figure 1B Figure 1C T cells are a subset of cells that, along with other immune cell types (polymorphonuclear cells, eosinophils, basophils, mast cells, B cells, and NK cells), constitute the cellular components of the immune system. Under physiological conditions, T cells perform immune surveillance and eliminate foreign antigens. However, under pathological conditions, there is compelling evidence that T cells play a crucial role in the development and spread of diseases. In these conditions, the disruption of T cell immune tolerance (whether central or peripheral) is a fundamental process leading to autoimmune diseases.

[0179] T cells bind to epitopes on small antigenic determinants on the surface of antigen-presenting cells. These epitopes are associated with the major histocompatibility complex (MHC; in mice) or the human leukocyte antigen (HLA; in humans) complex. T cells bind to these epitopes via the T cell receptor (TCR) complex on their surface. The T cell receptor is a heterodimeric structure composed of two types of chains: α (alpha) and β (beta) chains, or γ (gamma) and δ (delta) chains. The α chain is encoded by a nucleic acid sequence located at the α locus (located on human or mouse chromosome 14), which also contains the entire δ locus, and the β chain is encoded by a nucleic acid sequence located at the β locus (located on mouse chromosome 6 or human chromosome 7). Most T cells have an αβ TCR; a minority of T cells have a γδ TCR.

[0180] T cell receptor α and β polypeptides, i.e., the α chain and β chain (and similar γ and δ polypeptides, i.e., the γ chain and δ chain), are interconnected by disulfide bonds. Each of the two polypeptides that make up the TCR contains an extracellular domain comprising a constant region and a variable region, a transmembrane domain, and a cytoplasmic tail (the transmembrane domain and cytoplasmic tail are also part of the constant region). The variable region of the TCR determines its antigen specificity and, similar to immunoglobulins, contains three complementarity-determining regions (CDRs). The TCR is expressed on most T cells in vivo and is known to be involved in the recognition of MHC-restricted antigens. The TCR α chain includes covalently linked Vα and Cα regions, while the β chain includes a Vβ region covalently linked to the Cβ region. The Vα and Vβ regions form a pocket or cleft that allows antigens to bind in the context of the major histocompatibility complex (MHC) (or human HLA). The TCR is a highly specific detection molecule and, like antibodies, exhibits great diversity.

[0181] The general structure of TCR molecules and methods for their manufacture and use, including their binding to peptide:major histocompatibility complexes, have been disclosed. See, for example, PCT / US98 / 04274; PCT / US98 / 20263; WO99 / 60120.

[0182] Non-human animals (e.g., rodents, such as mice or rats) can be genetically engineered to express human or humanized T-cell receptors (TCRs) containing a variable domain encoded by at least one human TCR variable region gene fragment, for example, as described in PCT Publication No. WO 2016 / 164492, the entire contents of which are hereby incorporated by reference. For example, the VelociT® mouse technology (Regeneron) is a genetically modified mouse that produces a fully human therapeutic TCR against tumor and / or viral antigens, which can be used to generate selected portions of the TCRs of the present invention. Those skilled in the art can obtain altered TCR sequences and test their specific binding affinity and / or specificity using standard mutagenesis techniques combined with the assays described herein. Useful mutagenesis techniques known in the art include, but are not limited to, de novo gene synthesis, oligonucleotide directed mutagenesis, region-specific mutagenesis, adapter scanning mutagenesis, and site-directed mutagenesis by PCR (see, for example, Sambrook et al. (1989) and Ausubel et al. (1999)).

[0183] In summary, in some embodiments, methods for generating TCRs targeting HPV16, MART1, CMV, EBV, or influenza peptides may include immunizing a non-human animal (e.g., a rodent, such as a mouse or rat), for example a genetically engineered non-human animal whose genome contains an unrearranged human TCR variable gene locus, with PV16, MART1, CMV, EBV, or influenza peptides or nucleic acids encoding PV16, MART1, CMV, EBV, or influenza peptides; allowing the animal to generate an immune response to the peptide; isolating T cells from the animal that are responsive to the peptide; determining the nucleic acid sequence of the human TCR variable region expressed by the T cells; cloning the human TCR variable region into a nucleotide construct containing the nucleic acid sequence of the human TCR constant region, such that the human TCR variable region is operatively linked to the human TCR constant region; and expressing human T cell receptors specific for PV16, MART1, CMV, EBV, or influenza peptides, respectively, from the construct. In some implementations, the steps of isolating T cells, determining the nucleic acid sequence of the human TCR variable region expressed by the T cells, cloning the human TCR variable region into a nucleotide construct containing the nucleic acid sequence of the human TCR constant region, and expressing the human T cell receptor are performed using standard techniques known to those skilled in the art.

[0184] In some embodiments, methods for identifying TCR sequences specific to homologous HPV16, MART1, CMV, EBV, or influenza peptides include the methods set forth in WO / 2021067851, which is incorporated herein by reference in its entirety and is briefly described in Example 1 and Figure 1 herein. Such TCR sequences can then be cloned and expressed according to standard techniques known to those skilled in the art for producing human therapeutics. In some embodiments, portions of the TCR sequence (e.g., Vα and / or Vβ or one or more of their CDRs), such as portions obtained by the methods described in WO / 2021067851 or in Example 1 and Figure 1 herein, can be combined with other molecules (e.g., grafted thereon), such as TCR sequences or portions thereof obtained from different TCR sequences, including different TCR sequences obtained from the same method (e.g., from the same or different subjects) or TCR sequences obtained from entirely different methods (e.g., from immunized humanized mice, such as those described in PCT Publication WO 2016 / 164492). For example, in some embodiments, the fusion protein comprises Vα or Vβ of the TCR sequence described herein, and a sequence of the constant domain, transmembrane domain, cytoplasmic tail, or a combination thereof (including the entire constant region) of another TCR, including different TCRs or common or universal sequences described herein, such as sequences for therapeutic purposes. The combined TCR sequence or portions thereof may be autologous or heterologous. In some preferred embodiments, all portions of the TCR sequence are derived from human.

[0185] In some embodiments, a nucleotide sequence encoding a T-cell receptor specific to the antigen of interest is expressed in the cell. In some embodiments, the cells expressing the TCR are selected from CHO, COS, 293, HeLa, PERC.6™ cells, etc.

[0186] Upon obtaining the variant TCR coding sequence, those skilled in the art will recognize that TCR-derived proteins can be modified by certain amino acid substitutions, additions, deletions, and post-translational modifications without loss or reduction of biological activity. In particular, it is well known that conserved amino acid substitutions—that is, replacing one amino acid with another of similar size, charge, polarity, and conformation—are unlikely to significantly alter protein function. The 20 standard amino acids that make up proteins can be broadly classified into four groups of conserved amino acids: the nonpolar (hydrophobic) group includes alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, and valine; the polar (uncharged, neutral) group includes asparagine, cysteine, glutamine, glycine, serine, threonine, and tyrosine; the positively charged (basic) group contains arginine, histidine, and lysine; and the negatively charged (acidic) group contains aspartic acid and glutamic acid. Replacing one amino acid in a protein with another within the same group is unlikely to adversely affect the protein's biological activity.

[0187] In some embodiments, the TCR of this disclosure comprises a TCRα chain polypeptide and / or a TCRβ chain polypeptide. In some embodiments, the TCRα chain polypeptide comprises a TCRα variable (TCR Vα) domain and / or the TCRβ chain polypeptide comprises a TCRβ variable (TCR Vβ) domain. In some embodiments, the TCR Vα domain comprises a TCRα complementarity-determining region (αCDR) 1, αCDR2, and / or αCDR3, and / or the TCR β domain comprises a TCRβ complementarity-determining region (βCDR) 1, βCDR2, and / or βCDR3. In some embodiments, the CDRs of this disclosure, such as αCDR1, αCDR2, αCDR3, βCDR1, βCDR2, and / or βCDR3, may contain one or more substitutions compared to the reference CDR amino acid sequence disclosed herein. For example, the TCR of this disclosure may contain a CDR sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more substitutions compared to the CDR sequence of the TCR identified herein.

[0188] Table 9 below lists the sequence identifiers of the amino acid sequences of the αCDR (e.g., αCDR1, αCDR2 and αCDR3), βCDR (e.g., βCDR1, βCDR2 and βCDR3), TCR Vα domain and TCR Vβ domain of the TCR of this disclosure, wherein the sequence identifier of the nucleic acid encoding it is shown in parentheses.

[0189] In some embodiments, the TCR of this disclosure or its variable domain includes αCDR1 of the TCR Vα domain shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0190] In some embodiments, the TCR of this disclosure or its variable domain includes αCDR2 of the TCR Vα domain shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0191] In some embodiments, the TCR of this disclosure or its variable domain includes αCDR3 of the TCR Vα domain shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0192] In some embodiments, the TCR of this disclosure or its variable domain includes βCDR1 of the TCR Vβ domain shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0193] In some embodiments, the TCR of this disclosure or its variable domain includes βCDR2 of the TCR Vβ domain shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0194] In some embodiments, the TCR of this disclosure or its variable domain includes βCDR3 of the TCR Vβ domain shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0195] In one embodiment, the TCR of this disclosure or its variable domain comprises the αCDR3 amino acid sequence of the TCR Vα domain shown in Table 9 and the βCDR3 amino acid sequence of the TCR Vβ domain shown in Table 9, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all combinations of sequences is at least 90%, at least 95%, at least 98%, or at least 99%.

[0196] In one embodiment, the TCR of this disclosure or its variable domain comprises αCDR3 and βCDR3 amino acid sequence pairs from the same TCR, i.e., αCDR3 / βCDR3 amino acid sequence pairs from the TCR Vα domain and TCR Vβ domain sequence pairs from the same TCR, for example, TCR Vα / Vβ amino acid sequence pairs as shown in Table 9, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all sequence combinations is at least 90%, at least 95%, at least 98%, or at least 99%.

[0197] In one embodiment, the TCR of this disclosure or its variable domain comprises a set of three αCDR sequences, namely the set of αCDR1-αCDR2-αCDR3 amino acid sequences of the TCR Vα domain shown in Table 9, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all sequences is at least 90%, at least 95%, at least 98%, or at least 99%.

[0198] In one embodiment, the TCR of this disclosure or its variable domain comprises a set of three βCDR sequences, namely the set of amino acid sequences βCDR1-βCDR2-βCDR3 of the TCR Vβ domain shown in Table 9, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all sequences is at least 90%, at least 95%, at least 98%, or at least 99%.

[0199] In one embodiment, the TCR or its variable domain of the present disclosure comprises a set of six CDR sequences, namely, the αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequence set of the TCR Vα and TCR Vβ domain sequence pairs from the same TCR, i.e., the TCR Vα / Vβ amino acid sequence pairs as shown in Table 9, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all sequence combinations is at least 90%, at least 95%, at least 98%, or at least 99%.

[0200] In various embodiments, the TCR of this disclosure or its variable domain comprises αCDR1, which comprises an amino acid sequence selected from any αCDR1 amino acid sequence listed in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR of this disclosure or its variable domain comprises αCDR1, which comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 1, 17, 33, 49, 65, 81, 97, 113, 129, 145, 161, 177, 193, 209, 225, 241, 257, 273, 289, 305, 321, 337, 353, 369, 385, 401, 417, 433, 449, 465, 481, 497, 513, 529, 545, 561, 577, 593, 609, 625, 641, 657, 673 689, 705, 721, 737, 753, 769, 785, 801, 817, 833, 849, 865, 881, 897, 913, 929, 945, 961, 977, 993, 1009, 1025, 1041, 1057, 1073, 1089, 1105, and 1121, or sequences substantially similar to those having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0201] In various embodiments, the TCR of this disclosure or its variable domain comprises αCDR2, which comprises an amino acid sequence selected from any αCDR2 amino acid sequence listed in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR of this disclosure or its variable domain comprises αCDR2, which comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 3, 19, 35, 51, 67, 83, 99, 115, 131, 147, 163, 179, 195, 211, 227, 243, 259, 275, 291, 307, 323, 339, 355, 371, 387, 403, 419, 435, 451, 467, 483, 499, 515, 531, 547, 563, 579, 595, 611, 627, 643, 659, 675 691, 707, 723, 739, 755, 771, 787, 803, 819, 835, 851, 867, 883, 899, 915, 931, 947, 963, 979, 995, 1011, 1027, 1043, 1059, 1075, 1091, 1107 and 1123, or sequences substantially similar to those having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0202] In various embodiments, the TCR of this disclosure or its variable domain comprises αCDR3, which comprises an amino acid sequence selected from any αCDR3 amino acid sequence listed in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR of this disclosure or its variable domain comprises αCDR3, which comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 5, 21, 37, 53, 69, 85, 101, 117, 133, 149, 165, 181, 197, 213, 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405, 421, 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, 949, 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109 and 1125, or sequences substantially similar to those having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0203] In various embodiments, the TCR of this disclosure or its variable domain comprises βCDR1, which comprises an amino acid sequence selected from any βCDR1 amino acid sequence listed in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR of this disclosure or its variable domain comprises βCDR1, which comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 9, 25, 41, 57, 73, 89, 105, 121, 137, 153, 169, 185, 201, 217, 233, 249, 265, 281, 297, 313, 329, 345, 361, 377, 393, 409, 425, 441, 457, 473, 489, 505, 521, 537, 553, 569, 585, 601, 617, 633, 649, 665, 681 697, 713, 729, 745, 761, 777, 793, 809, 825, 841, 857, 873, 889, 905, 921, 937, 953, 969, 985, 1001, 1017, 1033, 1049, 1065, 1081, 1097, 1113 and 1129, or sequences substantially similar to those having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0204] In various embodiments, the TCR of this disclosure or its variable domain comprises βCDR2, which comprises an amino acid sequence selected from any βCDR2 amino acid sequence listed in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR of this disclosure or its variable domain comprises βCDR2, which comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 11, 27, 43, 59, 75, 91, 107, 123, 139, 155, 171, 187, 203, 219, 235, 251, 267, 283, 299, 315, 331, 347, 363, 379, 395, 411, 427, 443, 459, 475, 491, 507, 523, 539, 555, 571, 587, 603, 619, 635, 651, 667, 683 699, 715, 731, 747, 763, 779, 795, 811, 827, 843, 859, 875, 891, 907, 923, 939, 955, 971, 987, 1003, 1019, 1035, 1051, 1067, 1083, 1099, 1115 and 1131, or sequences substantially similar to those having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0205] In various embodiments, the TCR of this disclosure or its variable domain comprises βCDR3, which comprises an amino acid sequence selected from any βCDR3 amino acid sequence listed in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR of this disclosure or its variable domain comprises βCDR3, which comprises an amino acid sequence selected from the group consisting of: SEQ ID NO: 13, 29, 45, 61, 77, 93, 109, 125, 141, 157, 173, 189, 205, 221, 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, 429, 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, 957, 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117 and 1133, or sequences substantially similar to those having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0206] In one embodiment, the TCR of this disclosure or its variable domain comprises an αCDR3 and βCDR3 amino acid sequence pair from the same TCR, namely, an αCDR3 / βCDR3 amino acid sequence pair selected from the TCR Vα / Vβ amino acid sequence pairs shown in Table 9, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all sequence combinations is at least 90%, at least 95%, at least 98%, or at least 99%. In some embodiments, the TCR of this disclosure or its variable domain comprises an αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of: SEQ ID NO: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, 117 / 125, 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205, 213 / 221, 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 34 1 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413, 421 / 429, 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653 661 / 669, 677 / 685, 693 / 701, 709 / 717, 725 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941, 949 / 957, 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117 and 1125 / 1133, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0207] In one embodiment, the TCR of this disclosure or its variable domain comprises a set of three αCDR sequences, namely the αCDR1-αCDR2-αCDR3 amino acid sequence set shown in Table 9, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all sequences is at least 90%, at least 95%, at least 98%, or at least 99%.In some embodiments, the TCR of this disclosure or its variable domain comprises a set of αCDR1-αCDR2-αCDR3 amino acid sequences selected from the group consisting of: SEQ ID NO: 1-3-5, 17-19-21, 33-35-37, 49-51-53, 65-67-69, 81-83-85, 97-99-101, 113-115-117, 129-131-133, 145-147-149, 161-163-165, 177-179-181, 193-195-197, 209-211-213, 225-227-229, 241-243-245, 257-259-261, 273-275-277, 289-291-293, 305-307-309, 321-323-32 5. 337-339-341, 353-355-357, 369-371-373, 385-387-389, 401-403-405, 417-419-421, 433-435-437, 449-451-453, 465-467-469, 481-483-485, 497-499-501, 513-515-517, 529-531-533, 545-547-549, 561-563-565, 577-579-581, 593-595-597, 609-611-613, 625-627-6 29, 641-643-645, 657-659-661, 673-675-677, 689-691-693, 705-707-709, 721-723-725, 737-739-741, 753-755-757, 769-771-773, 785-787-789, 801-803-805, 817-819-821, 833-835-837, 849-851-853, 865-867-869, 881-883-885, 897-899-901, 913-915-917, 929-931- 933, 945-947-949, 961-963-965, 977-979-981, 993-995-997, 1009-1011-1013, 1025-1027-1029, 1041-1043-1045, 1057-1059-1061, 1073-1075-1077, 1089-1091-1093, 1105-1107-1109 and 1121-1123-1125, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all combinations of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0208] In one embodiment, the TCR of this disclosure or its variable domain comprises a set of three βCDR sequences, namely the βCDR1-βCDR2-βCDR3 amino acid sequence set shown in Table 9, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all combinations of sequences is at least 90%, at least 95%, at least 98%, or at least 99%.In some embodiments, the TCR of this disclosure or its variable domain comprises a set of βCDR1-αCDR2-βCDR3 amino acid sequences selected from the group consisting of: 9-11-13, 25-27-29, 41-43-45, 57-59-61, 73-75-77, 89-91-93, 105-107-109, 121-123-125, 137-139-141, 153-155-157, 169-171-173, 185-187-189, 201-203-205, 217-219-221, 233-235-237, 249-251-253, 265-267-269, 28 1-283-285, 297-299-301, 313-315-317, 329-331-333, 345-347-349, 361-363-365, 377-379-381, 393-395-397, 409-411-413, 425-427-429, 441-443-445, 457-459-461, 473-475-477, 489-491-493, 505-507-509, 521-523-525, 537-539-541, 553-555-557, 569-571-573, 585-587-589, 601-60 3-605, 617-619-621, 633-635-637, 649-651-653, 665-667-669, 681-683-685, 697-699-701, 713-715-717, 729-731-733, 745-747-749, 761-763-765, 777-779-781, 793-795-797, 809-811-813, 825-827-829, 841-843-845, 857-859-861, 873-875-877, 889-891-893, 905-907-909, 921-923-92 5. 937-939-941, 953-955-957, 969-971-973, 985-987-989, 1001-1003-1005, 1017-1019-1021, 1033-1035-1037, 1049-1051-1053, 1065-1067-1069, 1081-1083-1085, 1097-1099-1101, 1113-1115-1117 and 1129-1131-1133, or substantially similar sequences, having at least 90%, at least 95%, at least 98% or at least 99% sequence identity for each sequence or for all sequences in a combination.

[0209] In one embodiment, the TCR or its variable domain of the present disclosure comprises a set of six CDR sequences, namely the set of αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequences selected from the TCR Vα / Vβ amino acid sequence pairs shown in Table 9, wherein the sequence identity of each sequence or all sequence combinations is at least 90%, at least 95%, at least 98%, or at least 99%. In some embodiments, the TCR of this disclosure or its variable domain comprises an αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequence set selected from the group consisting of: 1-3-5-9-11-13, 17-19-21-25-27-29, 33-35-37-41-43-45, 49-51-53-57-59-61, 65-67-69-73-75-77, 81-83-85-89-91-93, 97-99-101-105-107-109, 113-115-117 -121-123-125, 129-131-133-137-139-141, 145-147-149-153-155-157, 161-163-165-169-171-173, 177-179-181-185-187-189, 193-195-197-201-203-205, 209-211-213-217-219-221, 225-227-229-233-235-237, 241-243-245-249-251-253, 257-259 -261-265-267-269, 273-275-277-281-283-285, 289-291-293-297-299-301, 305-307-309-313-315-317, 321-323-325-329-331-333, 337-339-341-345-347-349, 353-355-357-361-363-365, 369-371-373-377-379-381, 385-387-389-393-395-397, 401 -403-405-409-411-413, 417-419-421-425-427-429, 433-435-437-441-443-445, 449-451-453-457-459-461, 465-467-469-473-475-477, 481-483-485-489-491-493, 497-499-501-505-507-509, 513-515-517-521-523-525, 529-531-533-537-539-541545-547-549-553-555-557, 561-563-565-569-571-573, 577-579-581-585-587-589, 593-595-597-601-603-605, 609-611-613-617-619-621, 625- 627-629-633-635-637, 641-643-645-649-651-653, 657-659-661-665-667-669, 673-675-677-681-683-685, 689-691-693-697-699-701, 705-707- 709-713-715-717, 721-723-725-729-731-733, 737-739-741-745-747-749, 753-755-757-761-763-765, 769-771-773-777-779-781, 785-787-789- 793-795-797, 801-803-805-809-811-813, 817-819-821-825-827-829, 833-835-837-841-843-845, 849-851-853-857-859-861, 865-867-869-873-8 75-877, 881-883-885-889-891-893, 897-899-901-905-907-909, 913-915-917-921-923-925, 929-931-933-937-939-941, 945-947-949-953-955-9 57, 961-963-965-969-971-973, 977-979-981-985-987-989, 993-995-997-1001-1003-1005, 1009-1011-1013-1017-1019-1021, 1025-1027-1029-10 33-1035-1037, 1041-1043-1045-1049-1051-1053, 1057-1059-1061-1065-1067-1069, 1073-1075-1077-1081-1083-1085, 1089-1091-1093-1097-1099-1101, 1105-1107-1109-1113-1115-1117 and 1121-1123-1125-1129-1131-1133, or sequences substantially similar thereto, wherein the sequence identity of each sequence or all combinations of sequences is at least 90%, at least 95%, at least 98%, or at least 99%.

[0210] In some embodiments, the TCR of this disclosure or its variable domain comprises a TCR Vα domain as shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR of this disclosure or its variable domain comprises a TCR Vα domain selected from the group consisting of: SEQ ID NO: 7, 23, 39, 55, 71, 87, 103, 119, 135, 151, 167, 183, 199, 215, 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407, 423, 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, 951, 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127, or sequences substantially similar to those having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0211] In some embodiments, the TCR of this disclosure or its variable domain comprises a TCR Vβ domain as shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR of this disclosure or its variable domain comprises a TCR Vβ domain selected from the group consisting of: SEQ ID NO: 15, 31, 47, 63, 79, 95, 111, 127, 143, 159, 175, 191, 207, 223, 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, 431, 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, 959, 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119, and 1135, or sequences substantially similar to those having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0212] In one embodiment, the TCR of this disclosure or its variable domain comprises the TCR Vα and TCR Vβ domains shown in Table 9, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%. In some embodiments, the TCR of this disclosure or its variable domain comprises a TCR Vα domain selected from the group consisting of: SEQ ID NO: 7, 23, 39, 55, 71, 87, 103, 119, 135, 151, 167, 183, 199, 215, 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407, 423, 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 71 1, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, 951, 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127, or sequences substantially similar to them having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity; and the TCR Vβ domain selected from the group consisting of: SEQ ID NO: 15, 31, 47, 63, 79, 95, 111, 127, 143, 159, 175, 191, 207, 223, 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415, 431, 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, 959, 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119, and 1135, or sequences substantially similar to those having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0213] In one embodiment, the TCR or its variable domain of this disclosure comprises a TCR Vα and TCR Vβ domain pair of the same TCR, namely the TCR Vα / Vβ amino acid sequence pair shown in Table 9, or a substantially similar sequence, wherein the sequence identity of each sequence or sequence combination is at least 90%, at least 95%, at least 98%, or at least 99%. In some embodiments, the TCR Vα / Vβ amino acid sequence pair is selected from the group consisting of: SEQ ID NO: 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, 119 / 127, 135 / 143, 151 / 159, 167 / 175, 183 / 191, 199 / 207, 215 / 223, 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, 423 / 431, 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703, 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943, 951 / 95 9, 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119 and 1127 / 1135, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, 95%, 98% or 99%.

[0214] In some embodiments of this disclosure, the HLA-presenting peptide of the TCR or its variable domain comprises the HPV16 peptide. In one embodiment, the TCR or its variable domain comprises αCDR3 selected from the group consisting of SEQ ID NO: 133, 149, 165, 181, 197 and 213, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or βCDR3 selected from the group consisting of SEQ ID NO: 141, 157, 173, 189, 205 and 221, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In one embodiment, the TCR or its variable domain comprises an αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205 and 213 / 221, or a sequence substantially similar thereto, wherein the sequence identity of each sequence or sequence combination is at least 90%, at least 95%, at least 98% or at least 99%.

[0215] In one embodiment, the TCR or its variable domain comprises an αCDR1-αCDR2-αCDR3 amino acid sequence set selected from the group consisting of SEQ ID NO: 129-131-133, 145-147-149, 161-163-165, 177-179-181, 193-195-197, and 209-211-213, or substantially similar sequences thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%; and / or a βCDR1-βCDR2-βCDR3 amino acid sequence set selected from the group consisting of SEQ ID NO: 137-139-141, 153-155-157, 169-171-173, 185-187-189, 201-203-205 and 217-219-221, or sequences substantially similar thereto, wherein each sequence or combination of sequences has a sequence identity of at least 90%, at least 95%, at least 98% or at least 99%. In one embodiment, the TCR or its variable domain comprises a set of αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequences selected from the group consisting of: SEQ ID NO: 129-131-133-137-139-141, 145-147-149-153-155-157, 161-163-165-169-171-173, 177-179-181-185-187-189, 193-195-197-201-203-205 and 209-211-213-217-219-221, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%.

[0216] In one embodiment, the TCR or its variable domain comprises a TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 135, 151, 167, 183, 199 and 215, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 143, 159, 175, 191, 207 and 223, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In one embodiment, the TCR or its variable domain comprises a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO: 135 / 143, 151 / 159, 167 / 175, 183 / 191, 199 / 207 and 215 / 223, or a sequence substantially similar thereto, wherein the sequence identity of each sequence or sequence combination is at least 90%, at least 95%, at least 98% or at least 99%.

[0217] In some embodiments of this disclosure, the HLA-presenting peptide of the TCR or its variable domain comprises the MART1 peptide. In one embodiment, the TCR or its variable domain comprises αCDR3 selected from the group consisting of SEQ ID NO: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity; and / or βCDR3 selected from the group consisting of SEQ ID NO: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117, and 1133, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In one embodiment, the TCR or its variable domain comprises an αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117 and 1125 / 1133, or a substantially similar sequence, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0218] In one embodiment, the TCR or its variable domain comprises an αCDR1-αCDR2-αCDR3 amino acid sequence set selected from the group consisting of SEQ ID NO: 961-963-965, 977-979-981, 993-995-997, 1009-1011-1013, 1025-1027-1029, 1041-1043-1045, 1057-1059-1061, 1073-1075-1077, 1089-1091-1093, 1105-1107-1109, and 1121-1123-1125, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%; and / or selected from SEQ ID NO: The set of βCDR1-βCDR2-βCDR3 amino acid sequences of the group consisting of 969-971-973, 985-987-989, 1001-1003-1005, 1017-1019-1021, 1033-1035-1037, 1049-1051-1053, 1065-1067-1069, 1081-1083-1085, 1097-1099-1101, 1113-1115-1117 and 1129-1131-1133, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%. In some embodiments, the TCR or its variable fields include selections from SEQ ID NO: 961-963-965-969-971-973, 977-979-981-985-987-989, 993-995-997-1001-1003-1005, 1009-1011-1013-1017-1019-1021, 1025-1027-1029-1033-1035-1037, 1041-1043-1045-1049-1051-1053, 1057-1059-1061-1065-1067-1069, 1073-1075-1077-1081-1083-1085; The set of αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequences of the group consisting of 1089-1091-1093-1097-1099-1101, 1105-1107-1109-1113-1115-1117 and 1121-1123-1125-1129-1131-1133, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%.

[0219] In one embodiment, the TCR or its variable domain comprises a TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111 and 1127, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119 and 1135, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In one embodiment, the TCR or its variable domain comprises a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119 and 1127 / 1135, or a substantially similar sequence, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0220] In some embodiments of this disclosure, the HLA-presenting peptide of the TCR or its variable domain comprises a CMV peptide. In one embodiment, the TCR or its variable domain comprises αCDR3 selected from the group consisting of SEQ ID NO: 5, 21, 37, 53, 69, 85, 101, and 117, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity; and / or βCDR3 selected from the group consisting of SEQ ID NO: 13, 29, 45, 61, 77, 93, 109, and 125, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In one embodiment, the TCR or its variable domain comprises an αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, and 117 / 125, or a sequence substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%.

[0221] In one embodiment, the TCR or its variable domain comprises an αCDR1-αCDR2-αCDR3 amino acid sequence set selected from the group consisting of: 1-3-5, 17-19-21, 33-35-37, 49-51-53, 65-67-69, 81-83-85, 97-99-101, and 113-115-117, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%; and / or a βCDR1-βCDR2-βCDR3 amino acid sequence set selected from the group consisting of: SEQ ID NO: 9-11-13, 25-27-29, 41-43-45, 57-59-61, 73-75-77, 89-91-93, 105-107-109 and 121-123-125, or sequences substantially similar thereto, wherein each sequence or combination of sequences has a sequence identity of at least 90%, at least 95%, at least 98% or at least 99%. In one embodiment, the TCR or its variable domain comprises the set of αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequences selected from the group consisting of SEQ ID NO: 1-3-5-9-11-13, 17-19-21-25-27-29, 33-35-37-41-43-45, 49-51-53-57-59-61, 65-67-69-73-75-77, 81-83-85-89-91-93, 97-99-101-105-107-109 and 113-115-117-121-123-125, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%.

[0222] In one embodiment, the TCR or its variable domain comprises a TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 7, 23, 39, 55, 71, 87, 103 and 119, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 15, 31, 47, 63, 79, 95, 111 and 127, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In one embodiment, the TCR or its variable domain comprises a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO:7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111 and 119 / 127, or a sequence substantially similar thereto, wherein the sequence identity of each sequence or sequence combination is at least 90%, at least 95%, at least 98% or at least 99%.

[0223] In some embodiments of this disclosure, the HLA-presenting peptide of the TCR or its variable domain comprises an EBV peptide. In one embodiment, the TCR or its variable domain comprises αCDR3 selected from the group consisting of SEQ ID NO: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405, and 421, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity; and / or βCDR3 selected from the group consisting of SEQ ID NO: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413, and 429, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In one embodiment, the TCR or its variable domain comprises an αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413 and 421 / 429, or a substantially similar sequence, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0224] In one embodiment, the TCR or its variable domain comprises the set of αCDR1-αCDR2-αCDR3 amino acid sequences selected from the group consisting of: 225-227-229, 241-243-245, 257-259-261, 273-275-277, 289-291-293, 305-307-309, 321-323-325, 337-339-341, 35 3-355-357, 369-371-373, 385-387-389, 401-403-405, and 417-419-421, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%; and / or the set of βCDR1-βCDR2-βCDR3 amino acid sequences selected from the group consisting of: SEQ SEQ ID NO: 233-235-237, 249-251-253, 265-267-269, 281-283-285, 297-299-301, 313-315-317, 329-331-333, 345-347-349, 361-363-365, 377-379-381, 393-395-397, 409-411-413, and 425-427-429, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98%, or at least 99%. In some embodiments, the TCR or its variable fields contain selections from SEQ ID NO: 225-227-229-233-235-237, 241-243-245-249-251-253, 257-259-261-265-267-269, 273-275-277-281-283-285, 289-291-293-297-299-301, 305-307-309-313-315-317, 321-323-325-329-331-333, 337-339-341-345-347-349, 353-355-357-36 The set of αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequences of the group consisting of 1-363-365, 369-371-373-377-379-381, 385-387-389-393-395-397, 401-403-405-409-411-413 and 417-419-421-425-427-429, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0225] In one embodiment, the TCR or its variable domain comprises a TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407 and 423, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity; and / or a TCR Vβ domain amino acid sequence selected from the group consisting of SEQ ID NO: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415 and 431, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98% or at least 99% sequence identity. In one embodiment, the TCR or its variable domain comprises a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415 and 423 / 431, or a substantially similar sequence, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0226] In some embodiments of this disclosure, the HLA-presenting peptide of the TCR or its variable domain comprises an influenza peptide. In some embodiments, the TCR or its variable domain comprises an αCDR3 amino acid sequence selected from the group consisting of: SEQ ID NO: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949, or a substantially similar sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it; and / or a βCDR3 selected from the group consisting of: SEQ ID NO: 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941, and 957, or sequences substantially similar to them having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR or its variable domain contains sequences selected from SEQ ID NO: 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717, 725 / 733, 741 / 749, 757 / 765, 77 The αCDR3 / βCDR3 amino acid sequence pairs of the group consisting of 3 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941 and 949 / 957, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0227] In one embodiment, the TCR or its variable region comprises an αCDR1-αCDR2-αCDR3 amino acid sequence set selected from the group consisting of: 433-435-437, 449-451-453, 465-467-469, 481-483-485, 497-499-501, 513-515-517, 529-531-533, 545-547-549, 561-563-565, 577-579-581, 593-595-597, 609-611-613, 625-627-629, 641-643-645, 657-659-661, 673-675-677, 68 9-691-693, 705-707-709, 721-723-725, 737-739-741, 753-755-757, 769-771-773, 785-787-789, 801-803-805, 817-819-821, 833-835-837, 849-851-853, 865-867-869, 881-883-885, 897-899-901, 913-915-917, 929-931-933, and 945-947-949, or sequences substantially similar to them, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, or at least 98%. % or at least 99%; and / or selected from the following groups of βCDR1-βCDR2-βCDR3 amino acid sequences: 441-443-445, 457-459-461, 473-475-477, 489-491-493, 505-507-509, 521-523-525, 537-539-541, 553-555-557, 569-571-573, 585-587-589, 601-603-605, 617-619-621, 633-635-637, 649-651-653, 665-667-669, 681-683-685, 697-699-70 1. 713-715-717, 729-731-733, 745-747-749, 761-763-765, 777-779-781, 793-795-797, 809-811-813, 825-827-829, 841-843-845, 857-859-861, 873-875-877, 889-891-893, 905-907-909, 921-923-925, 937-939-941 and 953-955-957, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.In some implementations, the TCR or its variable fields include selections from SEQ ID NO: 433-435-437-441-443-445, 449-451-453-457-459-461, 465-467-469-473-475-477, 481-483-485-489-491-493, 497-499-501-505-507-509, 513-515-517-521-523-525, 529-531-533-537-539-541, 545-547-549-553-555-557, 561-563-565-569-571-573, 577-579. -581-585-587-589, 593-595-597-601-603-605, 609-611-613-617-619-621, 625-627-629-633-635-637, 641-643-645-649-651-653, 657-659-661-665-667-669, 673-675-677-681-683-685, 689-691-693-697-699-701, 705-707-709-713-715-717, 721-723-725-72 9-731-733, 737-739-741-745-747-749, 753-755-757-761-763-765, 769-771-773-777-779-781, 785-787-789-793-795-797, 801-803-805-809-811-813, 817-819-821-825-827-829, 833-835-837-841-843-845, 849-851-853-857-859-861, 865-867-869-873-875-8 77, the set of αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequences of the group consisting of 881-883-885-889-891-893, 897-899-901-905-907-909, 913-915-917-921-923-925, 929-931-933-937-939-941 and 945-947-949-953-955-957, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0228] In one embodiment, the TCR or its variable domain comprises an amino acid sequence of the TCR Vα domain selected from the group consisting of SEQ ID NO: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, and 951, or a substantially similar sequence having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it; and / or selected from SEQ ID NO: The TCRVβ domain amino acid sequence of the group consisting of 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943, and 959, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the TCR or its variable domain comprises a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of: SEQ ID NO: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703, 711 / 719, 727 / 735, 743 / 751 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943 and 951 / 959, or sequences substantially similar thereto, wherein the sequence identity of each sequence or combination of sequences is at least 90%, at least 95%, at least 98% or at least 99%.

[0229] This document also provides nucleic acid molecules encoding the TCR, its variable domain, or portions thereof disclosed herein. In some embodiments, the nucleic acid molecules of the present invention comprise nucleotide sequences of αCDR (e.g., αCDR1, αCDR2, and / or αCDR3), βCDR (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domain, and / or TCR Vβ domain selected from the group consisting of: SEQ ID NO:2,4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38,40,42,44,46,48,50,52,54,56,58,60,62,64,66,68,70,72 ,74,76,78,80,82,84,86,88,90,92,94,96,98,100,102,104,106,108,110,112,114,116,118,120,122,124,126,128,130,13 2, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332, 334, 336, 338, 340, 342, 344 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, ​​384, 386, 388, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450,452、454、456、458、460、462、464、466、468、470、472、474、476、478、480、482、484、486、488、490、492、494、496、498、500、502、504、506、508、510、512、514、516、518、520、522、524、526、528、530、532、534、536、538、540、542、544、546、548、550、552、554、556、558、560、562、564、566、568、570、572、574、576、578、580、582、584、586、588、590、592、594、596、598、600、602、604、606、608、610、612、614、616、618、620、622、624、626、628、630、632、634、636、638、640、642、644、646、648、650、652、654、656、658、660、662、664、666、668、670、672、674、676、678、680、682、684、686、688、690、692、694、696、698、700、702、704、706、708、710、712、714、716、718、720、722、724、726、728、730、732、734、736、738、740、742、744、746、748、750、752、754、756、758、760、762、764、766、768、770、772、774、776、778、780、782、784、786、788、790、792、794、796、798、800、802、804、806、808、810、812、814、816、818、820、822、824、826、828、830、832、834、836、838、840、842、844、846、848、850、852、854、856、858、860、862、864、866、868、870、872、874、876、878、880、882、884、886、888、890、892、894、896、898、900、902、904、906、908、910、912、914、916、918、920、922、924、926、928、930、932、934、936、938、940、942、944、946、948、950、952, 954, 956, 958, 960, 962, 964, 966, 968, 970, 972, 974, 976, 978, 980, 982, 984, 986, 988, 990, 992, 994, 996, 998, 1000, 1002, 1004, 1006, 1008, 1010, 1012, 1014, 1016, 1018, 1020, 1022, 1024, 1026, 1028, 1030, 1032, 1034, 1036, 1038, 1040, 1042, 1044, 1046, 1048, 1050, 1052, 1054, 1056, 1 058, 1060, 1062, 1064, 1066, 1068, 1070, 1072, 1074, 1076, 1078, 1080, 1082, 1084, 1086, 1088, 1090, 1092, 1094, 1096, 1098, 1100, 1102, 1104, 1106, 1108, 1110, 1112, 1114, 1116, 1118, 1120, 1122, 1124, 1126, 1128, 1130, 1132, 1134, 1136, or sequences substantially similar to them having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0230] In various embodiments, the nucleic acid molecule of this disclosure comprises a polynucleotide sequence encoding the amino acid sequence of αCDR1 shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding αCDR1 is selected from the group consisting of: SEQ ID NO: 2, 18, 34, 50, 66, 82, 98, 114, 130, 146, 162, 178, 194, 210, 226, 242, 258, 274, 290, 306, 322, 338, 354, 370, 386, 402, 418, 434, 450, 466, 482, 498, 514, 530, 546, 562, 578, 594, 610, 626, 642, 658, 67 4, 690, 706, 722, 738, 754, 770, 786, 802, 818, 834, 850, 866, 882, 898, 914, 930, 946, 962, 978, 994, 1010, 1026, 1042, 1058, 1074, 1090, 1106 and 1122, or sequences substantially similar to those having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0231] In various embodiments, the nucleic acid molecule of this disclosure comprises a polynucleotide sequence encoding the αCDR2 amino acid sequence shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding αCDR2 is selected from the group consisting of: SEQ ID NO: 4, 20, 36, 52, 68, 84, 100, 116, 132, 148, 164, 180, 196, 212, 228, 244, 260, 276, 292, 308, 324, 340, 356, 372, 388, 404, 420, 436, 452, 468, 484, 500, 516, 532, 548, 564, 580, 596, 612, 628, 644, 660, 6 76, 692, 708, 724, 740, 756, 772, 788, 804, 820, 836, 852, 868, 884, 900, 916, 932, 948, 964, 980, 996, 1012, 1028, 1044, 1060, 1076, 1092, 1108, and 1124, or sequences substantially similar to those having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0232] In various embodiments, the nucleic acid molecule of this disclosure comprises a polynucleotide sequence encoding the αCDR3 amino acid sequence shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding αCDR3 is selected from the group consisting of: SEQ ID NO: 6, 22, 38, 54, 70, 86, 102, 118, 134, 150, 166, 182, 198, 214, 230, 246, 262, 278, 294, 310, 326, 342, 358, 374, 390, 406, 422, 438, 454, 470, 486, 502, 518, 534, 550, 566, 582, 598, 614, 630, 646, 662, 6 78, 694, 710, 726, 742, 758, 774, 790, 806, 822, 838, 854, 870, 886, 902, 918, 934, 950, 966, 982, 998, 1014, 1030, 1046, 1062, 1078, 1094, 1110, and 1126, or sequences substantially similar to those having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0233] In various embodiments, the nucleic acid molecule of this disclosure comprises a polynucleotide sequence encoding the βCDR1 amino acid sequence shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding βCDR1 is selected from the group consisting of: SEQ ID NO: 10, 26, 42, 58, 74, 90, 106, 122, 138, 154, 170, 186, 202, 218, 234, 250, 266, 282, 298, 314, 330, 346, 362, 378, 394, 410, 426, 442, 458, 474, 490, 506, 522, 538, 554, 570, 586, 602, 618, 634, 650, 666, 6 82, 698, 714, 730, 746, 762, 778, 794, 810, 826, 842, 858, 874, 890, 906, 922, 938, 954, 970, 986, 1002, 1018, 1034, 1050, 1066, 1082, 1098, 1114 and 1130, or sequences substantially similar to those having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0234] In various embodiments, the nucleic acid molecule of this disclosure comprises a polynucleotide sequence encoding the βCDR2 amino acid sequence shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding βCDR2 is selected from the group consisting of: SEQ ID NO: 12, 28, 44, 60, 76, 92, 108, 124, 140, 156, 172, 188, 204, 220, 236, 252, 268, 284, 300, 316, 332, 348, 364, 380, 396, 412, 428, 444, 460, 476, 492, 508, 524, 540, 556, 572, 588, 604, 620, 636, 652, 668, 6 84, 700, 716, 732, 748, 764, 780, 796, 812, 828, 844, 860, 876, 892, 908, 924, 940, 956, 972, 988, 1004, 1020, 1036, 1052, 1068, 1084, 1100, 1116 and 1132, or sequences substantially similar to those having at least 90%, at least 95%, at least 98% or at least 99% sequence identity.

[0235] In various embodiments, the nucleic acid molecule of this disclosure comprises a polynucleotide sequence encoding the βCDR3 amino acid sequence shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding βCDR3 is selected from the group consisting of: SEQ ID NO: 14, 30, 46, 62, 78, 94, 110, 126, 142, 158, 174, 190, 206, 222, 238, 254, 270, 286, 302, 318, 334, 350, 366, 382, ​​398, 414, 430, 446, 462, 478, 494, 510, 526, 542, 558, 574, 590, 606, 622, 638, 654, 670, 6 86, 702, 718, 734, 750, 766, 782, 798, 814, 830, 846, 862, 878, 894, 910, 926, 942, 958, 974, 990, 1006, 1022, 1038, 1054, 1070, 1086, 1102, 1118, and 1134, or sequences substantially similar to those having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0236] In various embodiments, the nucleic acid molecule of this disclosure comprises a polynucleotide sequence encoding the amino acid sequence of the TCR Vα domain shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding the TCR Vα domain is selected from the group consisting of: SEQ ID NO: 8, 24, 40, 56, 72, 88, 104, 120, 136, 152, 168, 184, 200, 216, 232, 248, 264, 280, 296, 312, 328, 344, 360, 376, 392, 408, 424, 440, 456, 472, 488, 504, 520, 536, 552, 568, 584, 600, 616, 632, 648, 664, 680 696, 712, 728, 744, 760, 776, 792, 808, 824, 840, 856, 872, 888, 904, 920, 936, 952, 968, 984, 1000, 1016, 1032, 1048, 1064, 1080, 1096, 1112, and 1128, or sequences substantially similar to those having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0237] In various embodiments, the nucleic acid molecule of this disclosure comprises a polynucleotide sequence encoding the amino acid sequence of the TCR Vβ domain shown in Table 9, or a sequence substantially similar to it having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. In some embodiments, the polynucleotide sequence encoding the TCR Vβ domain is selected from the group consisting of: SEQ ID NO: 16, 32, 48, 64, 80, 96, 112, 128, 144, 160, 176, 192, 208, 224, 240, 256, 272, 288, 304, 320, 336, 352, 368, 384, 400, 416, 432, 448, 464, 480, 496, 512, 528, 544, 560, 576, 592, 608, 624, 640, 656, 672, 688 704, 720, 736, 752, 768, 784, 800, 816, 832, 848, 864, 880, 896, 912, 928, 944, 960, 976, 992, 1008, 1024, 1040, 1056, 1072, 1088, 1104, 1120, and 1136, or sequences substantially similar to those having at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.

[0238] In some embodiments, the TCR or its variable domains provided elsewhere herein may comprise αCDRs (e.g., αCDR1, αCDR2, and / or αCDR3), βCDRs (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domains, and / or TCR Vβ domains containing amino acid sequences substantially similar to, but not identical to, the corresponding αCDRs (e.g., αCDR1, αCDR2, and / or αCDR3), βCDRs (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domains, and / or TCR Vβ domains listed in Table 9 (or a specific SEQ ID NO otherwise specified), such that the subject αCDRs (e.g., αCDR1, αCDR2, and / or αCDR3), βCDRs (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domains, and / or TCR Vβ domains are ... The Vα domain and / or TCR ζβ domain have at least 90%, at least 95%, at least 98%, or at least 99% sequence identity, but not 100% identity. For example, the provided αCDR (e.g., αCDR1, αCDR2, and / or αCDR3), βCDR (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domain, and / or TCR Vβ domain may contain substitutions (e.g., conservative substitutions). Similarly, nucleic acid molecules provided elsewhere in this document may comprise polynucleotide sequences encoding αCDRs (e.g., αCDR1, αCDR2, and / or αCDR3), βCDRs (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domains, and / or TCR Vβ domains, said domains comprising sequences substantially similar to, but not identical to, the amino acid sequences (or otherwise specified SEQ ID NOs) of the corresponding αCDRs (e.g., αCDR1, αCDR2, and / or αCDR3), βCDRs (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domains, and / or TCR Vβ domains listed in Table 9, such that the encoded αCDRs (e.g., αCDR1, αCDR2, and / or αCDR3), βCDRs (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domains, and / or TCR Vβ domains are such that they are not identical to, the encoded αCDRs (e.g., αCDR1, αCDR2, and / or αCDR3), βCDRs (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domains, and / or TCR Vβ domains ... The Vβ domain has at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it, but not 100%.Similarly, nucleic acid molecules provided elsewhere in this document may contain polynucleotide sequences encoding αCDRs (e.g., αCDR1, αCDR2, and / or αCDR3), βCDRs (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domains, and / or TCR Vβ domains, said polynucleotide sequences being substantially similar to but not identical to the polynucleotide sequences encoding the corresponding αCDRs (e.g., αCDR1, αCDR2, and / or αCDR3), βCDRs (e.g., βCDR1, βCDR2, and / or βCDR3), TCR Vα domains, and / or TCR Vβ domains listed in Table 9 (or a specific SEQ ID NO otherwise specified), such that the subject polynucleotide sequence has at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with it, but not 100% identity.

[0239] The nucleic acid molecules of the present invention may comprise any of the polynucleotide sequences disclosed herein, or any combination thereof. In a preferred embodiment, the combinations of polynucleotide sequences disclosed herein are arranged within the nucleic acid molecule such that the nucleic acid molecule encodes a functional polypeptide product capable of binding to an HLA-presenting peptide, such as a TCR, its variable domain, or its antigen-binding moiety. For example, the nucleic acid molecules of the present invention cover any combination of the CDR and / or Vα / Vβ domains of a specific HLA-presenting peptide disclosed in Table 9, provided that the encoded polypeptide product is capable of binding to the HLA-presenting peptide.

[0240] Generally, the TCR of the present invention functions by binding to HLA-presented HPV16, MART1, CMV, EBV, or influenza peptides. As used herein, an HLA-presenting peptide (e.g., an HLA-A2 presenting peptide) can refer to a peptide that binds to human leukocyte antigen (HLA) proteins, such as HLA proteins expressed on the cell surface. Therefore, a TCR bound to an HLA-presenting peptide will bind to the HLA-bound peptide and optionally also to HLA itself. Interaction with HLA can confer specificity for binding to a particular HLA-presenting peptide. In some embodiments, the TCR binds to isolated HLA-presenting peptides. In some embodiments, the TCR binds to HLA-presenting peptides on the cell surface. In some embodiments, the TCR specifically binds to HLA-presenting peptides and is identified using the RAPTER method disclosed herein.

[0241] Generally, the TCRs of this invention function by binding to HLA-presented HPV16, MART1, CMV, EBV, or influenza peptides. This invention includes HPV16, MART1, CMV, EBV, or influenza TCRs that bind to HPV16, MART1, CMV, EBV, or influenza peptides with high specificity in the HLA background. In some embodiments, HPV16, MART1, CMV, EBV, or influenza TCRs do not bind to HPV16, MART1, CMV, EBV, or influenza peptides, or such binding is very weak, in the absence of HLA. Furthermore, in some embodiments, HPV16, MART1, CMV, EBV, or influenza TCRs do not bind to off-target peptides, or such binding is very weak, in the presence of HLA. As used herein, an off-target peptide may refer to a peptide that differs from the target peptide by 1, 2, 3, 4, 5, or more amino acids.

[0242] In some implementations, binding specificity can be determined by: a) measuring targeted binding (e.g., binding to HLA-presented HPV16, MART1, CMV, EBV, or influenza peptides), b) measuring off-target binding, and c) quantifying the difference between the two, for example, by calculating a ratio. This ratio can be calculated, for example, by dividing the values ​​obtained in a) and b). Measurements of targeted and off-target binding can be achieved, for example, by measuring the percentage binding to a peptide / HLA tetramer reagent (e.g., HPV16, MART1, CMV, EBV, or influenza / HLA tetramer reagent), or by other techniques known in the art. In some embodiments, the target binding / off-target binding value of the TCR of this disclosure (e.g., the value obtained by dividing the values ​​obtained by a) and b) above) may be greater than 5, greater than 6, greater than 7, greater than 8, greater than 9, greater than 10, greater than 11, greater than 12, greater than 13, greater than 14, greater than 15, greater than 16, greater than 17, greater than 18, greater than 19, greater than 20, greater than 21, greater than 22, greater than 23, greater than 24, greater than 25, greater than 26, greater than 27, greater than 28, greater than 29, greater than 30, greater than 35, greater than 40, greater than 45, greater than 50, greater than 55, greater than 60, greater than 65, greater than 70, greater than 75, greater than 80, greater than 85, greater than 90, greater than 95, greater than 100, greater than 110. Greater than 120, greater than 130, greater than 140, greater than 150, greater than 160, greater than 170, greater than 180, greater than 190, greater than 200, greater than 225, greater than 250, greater than 275, greater than 300, greater than 325, greater than 350, greater than 375, greater than 400, greater than 425, greater than 450, greater than 475, greater than 500, greater than 550, greater than 600, greater than 650, greater than 700, greater than 750, greater than 800, greater than 850, greater than 900, greater than 950, greater than 1000, greater than 1100, greater than 1200, greater than 1300, greater than 1400, greater than 1500, greater than 1600, greater than 1700, greater than 1800, greater than 1900, or greater than 2000. In some implementations, the target binding / off-target binding value (e.g., the value obtained by dividing the values ​​obtained by a) and b) above) can be about 5 to about 20, about 10 to about 30, about 20 to about 80, about 30 to about 70, about 40 to about 60, about 50 to about 250, about 100 to about 200, about 100 to about 1000, about 300 to about 700, about 500 to about 1500, about 800 to about 1200, about 900 to about 1100, about 800 to about 1500, about 1000 to about 1400, or about 1100 to about 1300.

[0243] In some embodiments, this document describes recombinant antigen-binding proteins (e.g., isolated antigen-binding proteins) that specifically bind to conformational epitopes of HLA-presented human HPV16, MART1, CMV, EBV, or influenza peptides, wherein said antigen-binding proteins have the property of being selected from the group consisting of: (a) a binding dissociation equilibrium constant (K0) of less than about 20 nM. D (a) Binding to monomeric HLA: HPV16, MART1, CMV, EBV, or influenza peptide, as measured by surface plasmon resonance assay at 25°C; (b) with a binding dissociation equilibrium constant (K0) less than about 25 nM. D (c) Binding to monomeric HLA: HPV16, MART1, CMV, EBV, or influenza peptide, as measured by surface plasmon resonance assay at 25°C; (d) Binding to cells expressing HLA: HPV16, MART1, CMV, EBV, or influenza peptide with an EC50 of less than about 6 nM, and not binding to cells expressing predicted off-target peptides, as determined by luminescence assay; (e) Binding to cells expressing HLA: HPV16, MART1, CMV, EBV, or influenza peptide with an EC50 of less than about 1 nM, and substantially not binding to cells expressing predicted off-target peptides, as determined by luminescence assay; (f) Binding to cells expressing HLA: HPV16, MART1, CMV, EBV, or influenza peptide with an EC50 of less than about 30 nM. (f) binding of an EC50 of nM to cells expressing HLA: HPV16, MART1, CMV, EBV, or influenza peptide, as determined by flow cytometry; and (f) binding of an EC50 of less than about 75 nM to cells expressing HLA: HPV16, MART1, CMV, EBV, or influenza peptide, as determined by flow cytometry.

[0244] In some embodiments, the HPV16, MART1, CMV, EBV, or influenza TCR of this disclosure exhibit specific activity or affinity for HPV16, MART1, CMV, EBV, or influenza peptides, as measured by in vitro assays. For example, cells expressing HLA (such as T2 cells) can be pulsed with HPV16, MART1, CMV, EBV, or influenza peptides or off-target peptides to induce the cells to present peptides that bind to HLA. Alternatively or additionally using off-target peptides as controls, off-target HLAs (HLAs other than those recognized by the TCR of interest) can be used. For example, off-target HLAs can be used to present HPV16, MART1, CMV, EBV, or influenza peptides to test the specificity of binding to HPV16, MART1, CMV, EBV, or influenza peptides presented by HLA-A (e.g., HLA-A2). Alternatively, the control can be a cell line that does not express HPV16, MART1, CMV, EBV, or influenza HLA, nor does it express a target HLA (e.g., HLA-A2). Cells can be co-cultured with a population of T cells expressing the TCR of interest, and activity can be measured based on the amount of cytokines (such as interferon-γ) produced by the cells. In some embodiments, the assay may include, in vitro, mixing a population of T cells expressing the TCR with 10 -10 M-peptide-loaded T2 cells were used at an effector cell:target cell ratio of 1:1 (1×10⁻⁶). 5 The cells were co-cultured with effector cells at a ratio of 1.5 × 10⁶ effector cells / 96 wells, and interferon-γ was measured after 24 hours of co-culture (e.g., using a Meso Scale Discovery (MSD®) Sector Imager). In some embodiments, the assay may include in vitro co-culturing of TCR-expressing T cell populations with effector cells at an effector cell:target cell ratio of 5:1 (2.5 × 10⁶ cells / 96 wells). 5 Effector cells: 5 × 10 4 The target cells were co-cultured and interferon-γ was measured 24 hours after co-culture (e.g., by Meso Scale Discovery (MSD®) SectorImager).

[0245] An increase in the detected amount of cytokines can serve as an indicator of activity. The activity or specificity of the TCR of interest in its target peptide compared to a control (off-target) peptide, or the activity or specificity of the TCR of interest in its target HLA-binding peptide compared to an off-target HLA-binding peptide, can be 2-fold or greater, 3-fold or greater, 4-fold or greater, 5-fold or greater, 6-fold or greater, 7-fold or greater, 8-fold or greater, 9-fold or greater, 10-fold or greater, 15-fold or greater, 20-fold or greater, 30-fold or greater, 40-fold or greater, 50-fold or greater, 100-fold or greater, 200-fold or greater, 300-fold or greater, 400-fold or greater, 500-fold or greater, 600-fold or greater. Larger, 700 times or more, 800 times or more, 900 times or more, 1,000 times or more, 1,500 times or more, 2,000 times or more, 2,500 times or more, 3,000 times or more, 4,000 times or more, 5,000 times or more, 10,000 times or more, 20,000 times or more, 30,000 times or more, 40,000 times or more, 50,000 times or more, 60,000 times or more, 70,000 times or more, 80,000 times or more, 90,000 times or more, or 100,000 times or more.

[0246] In some embodiments, the HPV16, MART1, CMV, EBV, or influenza TCR of this disclosure, when administered prophylactically to subjects in need, can inhibit tumor growth or delay cancer progression and improve subject survival. For example, administration of the HPV16, MART1, CMV, EBV, or influenza TCR of this invention can lead to shrinkage of primary tumors and prevent the development of metastatic or secondary tumors. In some embodiments, the HPV16, MART1, CMV, EBV, or influenza TCR of this invention, when administered therapeutically to subjects in need, can inhibit tumor growth and improve subject survival. For example, administration of a therapeutically effective amount of the HPV16, MART1, CMV, EBV, or influenza TCR of this invention to a subject can lead to shrinkage and disappearance of existing tumors in the subject.

[0247] In some embodiments, the present invention provides TCRs identified by a rapter (e.g., isolated TCRs or TCRs expressed on isolated cells). In some embodiments, the TCRs specifically bind to HLA-presented HPV16, MART1, CMV, EBV, or influenza peptides.

[0248] The TCR of the present invention may have one or more of the aforementioned biological characteristics, or any combination thereof. Other biological characteristics of the antigen-binding protein of the present invention will be apparent to those skilled in the art upon reading this disclosure (including the working examples herein).

[0249] In some embodiments, a nucleic acid molecule encoding HPV16, MART1, CMV, EBV, or influenza TCR as described herein is inserted into a vector. As used herein, the term "vector" refers to a medium into which a polynucleotide encoding a protein is covalently inserted to achieve the expression of said protein and / or the cloning of said polynucleotide. Such a vector may also be referred to as an "expression vector." Isolated polynucleotides may be inserted into the vector using any suitable method known in the art, such as, but not limited to, digestion of the vector with a suitable restriction enzyme followed by ligation to an isolated polynucleotide having a matching restriction end. Expression vectors have the ability to incorporate and express heterologous or modified nucleic acid sequences that encode at least a portion of a gene product capable of being transcribed in a cell. In most cases, the RNA molecule is subsequently translated into a protein. Expression vectors may contain a variety of control sequences, which are nucleic acid sequences necessary for transcription and possibly translation of operablely linked coding sequences in a particular host organism. In addition to control sequences that control transcription and translation, vectors and expression vectors may also contain nucleic acid sequences that perform other functions, as discussed below. Expression vectors may contain additional elements; for example, an expression vector may have two replication systems, thereby allowing it to be maintained in two organisms, such as for expression in human cells and for cloning and amplification in a prokaryotic host.

[0250] Expression vectors may contain necessary 5′ upstream and 3′ downstream regulatory elements, such as promoter sequences (e.g., CMV, PGK, and EF1α promoters), ribosome recognition and binding TATA boxes, and a 3′ UTR AAUAAA transcription termination sequence, to enable efficient gene transcription and translation in their respective host cells. Other suitable promoters include constitutive promoters of the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), HIV LTR promoter, MoMuLV promoter, avian leukosis virus promoter, EBV immediate early promoter, and Rous sarcoma virus promoter. Human gene promoters may also be used, including but not limited to actin promoters, myosin promoters, hemoglobin promoters, and creatine kinase promoters. In some embodiments, inducible promoters are also considered as part of the vector expressing the chimeric antigen receptor. This provides a molecular switch capable of turning the expression of the polynucleotide sequence of interest on or off. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, or tetracycline promoters.

[0251] Expression vectors may have additional sequences, such as 6×-histidine, c-Myc, and FLAG tags, which are incorporated into the expressed TCR. Therefore, expression vectors can be engineered to contain 5′ and 3′ untranslated regulatory sequences, which may sometimes act as enhancer sequences, promoter regions, and / or terminator sequences, thereby promoting or enhancing the efficient transcription of the nucleic acid of interest carried on the expression vector. Expression vectors can also be engineered to replicate and / or express functionally (e.g., transcription and translation) in specific cell types, cell locations, or tissue types. Expression vectors may include optional markers for maintaining the vector in host or recipient cells.

[0252] Examples of vectors include plasmids, autonomously replicating sequences, and transposon elements. Additional exemplary vectors include, but are not limited to, plasmids, phagemids, granules, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or PI-derived artificial chromosomes (PAC), bacteriophages such as λ phage or M13 phage, and animal viruses. Examples of animal virus classes that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillary multivoid viruses (e.g., SV40). Examples of expression vectors include the Lenti-X™ bicistronic expression system (Neo) vector (Clontrch) and the pClneo vector (Promega) for expression in mammalian cells; and pLenti4 / V5-DEST™, pLenti6 / V5-DEST™, and pLenti6.2N5-GW / lacZ (Invitrogen) for lentivirus-mediated gene transfer and expression in mammalian cells. The coding sequence of the TCR disclosed in this paper can be ligated into such expression vectors to express chimeric proteins in mammalian cells.

[0253] In some embodiments, the nucleic acid molecule encoding the TCR of the present invention is provided in a viral vector. The viral vector may be derived from retroviruses, lentiviruses, or foamy viruses. As used herein, the term "viral vector" refers to a nucleic acid vector construct containing at least one virally derived element and having the ability to be packaged into viral vector particles. The viral vector may contain coding sequences for various proteins described herein in place of non-essential viral genes. The vector and / or particles can be used for the purpose of transferring DNA, RNA, or other nucleic acids into cells, either in vitro or in vivo. Various forms of viral vectors are known in the art.

[0254] In some implementations, the viral vector containing the coding sequence of the TCR described herein is a retroviral vector or a lentiviral vector. The term "retroviral vector" refers to a vector containing structural and functional genetic elements primarily derived from retroviruses. The term "lentiviral vector" refers to a vector containing structural and functional genetic elements other than the LTR primarily derived from lentiviruses.

[0255] The retroviral vectors used in this article can be derived from any known retrovirus (e.g., type c retroviruses such as Moloney mouse sarcoma virus (MoMSV), Harvey mouse sarcoma virus (HaMuSV), mouse mammary tumor virus (MuMTV), gibberish leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend virus, mouse stem cell virus (MSCV), and Rous sarcoma virus (RSV)). "Retroviruses" also include human T-cell leukemia virus, HTLV-1, and HTLV-2, as well as retroviruses from the lentivirus family, such as human immunodeficiency virus, HIV-1, HIV-2, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), equine immunodeficiency virus (EIV), and other classes of retroviruses.

[0256] The lentiviral vectors used in this article refer to vectors derived from lentiviruses, which are a class (or genus) of retroviruses that cause slowly progressing diseases. This group includes viruses such as HIV (human immunodeficiency virus; including HIV types 1 and 2), visna-maedi virus, caprine arthritis-encephalitis virus, equine infectious anemia virus, feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), and simian immunodeficiency virus (SIV).

[0257] The preparation of recombinant lentiviruses can be carried out according to the methods of Dull et al. and Zufferey et al. (Dull et al., J. Virol., 1998; 72: 8463-8471 and Zufferey et al., J. Virol. 1998; 72: 9873-9880).

[0258] The retroviral vectors (i.e., lentiviruses and non-lentiviruses) used in this invention can be formed by combining the desired DNA sequences in the order and orientation described herein using standard cloning techniques. (Current Protocols in Molecular Biology, Ausubel, FM et al. (eds.), Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals; Eglitis et al. (1985) Science 230: 1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol 150:4104-4115 U.S. Patent Nos. 4,868,116, 4,980,286, PCT Application WO 89 / 07136, WO 89 / 02468, WO 89 / 05345, and WO 92 / 07573.

[0259] Suitable sources for obtaining retroviral (i.e., lentivirus and non-lentivirus) sequences used to form vectors include, for example, genomic RNA and cDNA available from commercial sources, including the American Type Culture Collection (ATCC) in Rockville, Maryland, USA. These sequences can also be chemically synthesized.

[0260] To express HPV16, MART1, CMV, EBV, or influenza TCR, a vector can be introduced into a host cell to allow the peptide to be expressed within the host cell. The expression vector may contain various elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection markers, and signal sequences. As described above, those skilled in the art can appropriately select these elements. For example, a promoter sequence can be selected to initiate transcription of the polynucleotide in the vector. Suitable promoter sequences include, but are not limited to, the T7 promoter, T3 promoter, SP6 promoter, β-actin promoter, EFi promoter, CMV promoter, and SV40 promoter. An enhancer sequence can be selected to enhance the transcription of the polynucleotide. A selection marker can be selected to allow selection of host cells containing the vector from host cells that have never had the vector inserted; for example, the selection marker could be a gene conferring antibiotic resistance. A signal sequence can be selected to allow the expressed peptide to be transported outside the host cell.

[0261] To clone nucleic acid molecules, a vector can be introduced into a host cell (an isolated host cell) to allow the vector itself to replicate, thereby amplifying copies of the polynucleotides it contains. Cloning vectors may contain sequence components, typically including, but not limited to, origin of replication, promoter sequences, transcription initiation sequences, enhancer sequences, and selectability markers. These elements can be appropriately selected by those skilled in the art. For example, the origin of replication can be selected to facilitate autonomous replication of the vector within the host cell.

[0262] In some embodiments, this disclosure provides isolated host cells containing the vectors provided herein. The host cells containing the vectors can be used to express or clone the polynucleotides contained in the vectors. Suitable host cells may include, but are not limited to, prokaryotic cells, fungal cells, yeast cells, or higher eukaryotic cells such as mammalian cells. Suitable prokaryotic cells for this purpose include, but are not limited to, eubacteria, such as Gram-negative or Gram-positive organisms, such as Enterobacteriaceae, such as Escherichia (e.g., E. coli); Enterobacter; Erwinia; Klebsiella; Proteus; Salmonella (e.g., Salmonella typhimurium); Serratia (e.g., Serratia marcescans); and Shigella; as well as Bacilli (e.g., B. subtilis and B. licheniformis); and Pseudomonas (e.g., Pseudomonas aeruginosa). aeruginosa; and Streptomyces.

[0263] The HPV16, MART1, CMV, EBV, or influenza TCR of the present invention are introduced into host cells using transfection and / or transduction techniques known in the art. As used herein, the terms “transfection” and “transduction” refer to the process of introducing a foreign nucleic acid sequence into a host cell. The nucleic acid may be integrated into the host cell DNA or may be retained outside the chromosome. The nucleic acid may be temporarily maintained or stably introduced. Transfection can be performed by a variety of methods known in the art, including but not limited to calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipid transfection, protoplast fusion, retroviral infection, and gene gun methods. Transduction refers to the delivery of genes by viral infection rather than transfection using a virus or retroviral vector. In some embodiments, the retroviral vector is transduced by packaging the vector into a virion before contact with the cell. For example, the nucleic acid encoding the HPV16, MART1, CMV, EBV, or influenza TCR of the present invention carried by the retroviral vector can be transduced into the cell through infection and proviral integration.

[0264] As used herein, the terms “genetic engineering” or “genetic modification” refer to the addition of additional genetic material in the form of DNA or RNA to the total genetic material of a cell. The terms “genetically modified cell,” “modified cell,” and “redirected cell” are used interchangeably.

[0265] Specifically, the TCR of the present invention is introduced and expressed in immune effector cells to specifically redirect them to target antigens of interest, such as HLA-displayed HPV16, MART1, CMV, EBV, or influenza peptides.

[0266] This document describes a method for preparing immune effector cells expressing the TCRs described herein. In some embodiments, the method includes transfecting or transducing immune effector cells, such as immune effector cells isolated from a subject (e.g., a subject with HPV16, MART1, CMV, EBV, or influenza-related illness or condition), such that the immune effector cells express one or more TCRs as described herein. In some embodiments, immune effector cells are isolated from an individual and genetically modified without further in vitro manipulation. Such cells can then be directly re-administered to the individual. In a further embodiment, immune effector cells are first activated and stimulated to proliferate in vitro before being genetically modified to express T cell receptors (TCRs). In this respect, the immune effector cells can be cultured before or after genetic modification (i.e., transduction or transfection to express TCRs as described herein).

[0267] The cell source can be obtained from a subject before any in vitro manipulation or genetic modification of the immune effector cells described herein. Specifically, the immune effector cells used with the TCRs described herein include T cells.

[0268] T cells can be obtained from a variety of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from sites of infection, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments, T cells can be obtained from a unit of blood collected from a subject using a variety of techniques known to those skilled in the art (e.g., FICOLL separation). In some embodiments, cells in an individual's circulating blood are obtained via apheresis. Apheresis products typically contain lymphocytes, including T cells, mononuclear cells, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. In some embodiments, cells collected via apheresis can be washed to remove plasma fractions and placed in a suitable buffer or culture medium for further processing. In some embodiments of the invention, cells are washed with PBS. In alternative embodiments, the wash solution is deficient in calcium and may be deficient in magnesium or may be deficient in many (if not all) divalent cations. Those skilled in the art will understand that the washing step can be performed by methods known to those skilled in the art, such as by using a semi-automatic flow-through centrifuge. After washing, the cells can be resuspended in various biocompatible buffers or other saline solutions with or without buffers. In some embodiments, unwanted components of apheresis samples can be removed in the culture medium in which the cells are directly resuspended.

[0269] In some embodiments, T cells are isolated from peripheral blood mononuclear cells (PBMCs) by lysing red blood cells and exhausting mononuclear cells (e.g., by PERCOLL™ gradient centrifugation). Specific subsets of T cells, such as CD28+, CD4+, CD8+, CD45RA+, and CD45RO+ T cells, can be further isolated using positive or negative selection techniques. For example, enriching T cell populations by negative selection can be achieved using a combination of antibodies targeting surface markers specific to the negatively selected cells. One approach used herein is cell sorting and / or selection via negative magnetic immunoadhesion or flow cytometry, which uses a mixture of monoclonal antibodies targeting cell surface markers present on the negatively selected cells. For example, to enrich CD4+ cells by negative selection, the monoclonal antibody mixture typically includes antibodies against CD14, CD20, CD11b, CD16, HLA-DR, and CD8. Flow cytometry and cell sorting can also be used to isolate cell populations of interest used in this invention.

[0270] The TCR can be directly genetically modified using PBMCs using the methods described herein. In some embodiments, T lymphocytes are further isolated after PBMC isolation, and in some embodiments, cytotoxic T lymphocytes and helper T lymphocytes can be classified into naive T cells, memory T cells, and effector T cell subsets before or after gene modification and / or amplification.

[0271] Immune effector cells (e.g., T cells) may be isolated using known methods and then genetically modified, or may be activated and expanded in vitro (or differentiated into progenitor cells) prior to genetic modification. In some embodiments, immune effector cells, such as T cells, are genetically modified with chimeric antigen receptors as described herein (e.g., transduced with a viral vector containing nucleic acid encoding a TCR), and then activated and expanded in vitro. Methods for activating and expanding T cells are known in the art and are described, for example, in U.S. Patent Nos. 6,905,874, 6,867,041, 6,797,514, WO2012079000, and US 2016 / 0175358.

[0272] The present invention provides a modified immune effector cell population for treating HPV16, MART1, CMV, EBV or influenza-related diseases or conditions (e.g., cancer), said modified immune effector cells comprising HPV16, MART1, CMV, EBV or influenza TCR disclosed herein.

[0273] The immune effector cells expressing HPV16, MART1, CMV, EBV, or influenza TCR prepared as described herein can be used in methods and compositions for adoptive immunotherapy according to known techniques or variations thereof, as will be apparent to those skilled in the art based on this disclosure. See, for example, U.S. Patent Application Publication No. 2003 / 0170238 to Gruenberg et al.; see also U.S. Patent No. 4,690,915 to Rosenberg.

[0274] Figure 1D This invention provides therapeutic compositions comprising HPV16, MART1, CMV, EBV, or influenza TCR of the present invention, or immune effector cells comprising HPV16, MART1, CMV, EBV, or influenza TCR of the present invention. The therapeutic compositions according to the invention are to be administered together with suitable carriers, excipients, and other agents incorporated into the formulation to provide improved transfer, delivery, tolerability, etc. Many suitable formulations can be found in all pharmaceutical chemists' known formulation books (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA). These formulations include, for example, powders, pastes, ointments, gels, waxes, oils, lipids, lipid-containing (cationic or anionic) vesicles (such as LIPOFECTIN™), DNA conjugates, anhydrous absorbent pastes, oil-in-water and water-in-oil emulsions, emulsion polyethylene glycol (polyethylene glycol of various molecular weights), semi-solid gels, and semi-solid mixtures containing polyethylene glycol. See also Powell et al., "Compendium of excipients for parenteral formulations", PDA (1998), JPharm Sci Technol 52:238-311.

[0275] Depending on the severity of the disease, the frequency and duration of treatment may be adjusted. In some embodiments, a second or more subsequent doses of the present invention’s HPV16, MART1, CMV, EBV, or influenza TCR, or immune effector cells containing the present invention’s HPV16, MART1, CMV, EBV, or influenza TCR, may be administered after the initial dose, in an amount approximately equal to or less than the initial dose.

[0276] In some cases, the drug composition can be delivered using a controlled release system. In some embodiments, a pump can be used.

[0277] Injectable formulations may include dosage forms such as intravenous injection, subcutaneous injection, intradermal injection, intracranial injection, intraperitoneal injection, intramuscular injection, and infusion. The TCRs, pharmaceutical compositions, and cells described herein can be administered via parenteral administration. The formulations disclosed herein can be prepared using known methods. For example, they can be prepared, for instance, by dissolving, suspending, or emulsifying the antigen-binding protein described above or its salts in a sterile aqueous or oily medium conventionally used for injection. Aqueous media for injection include, for example, physiological saline, isotonic solutions containing glucose and other excipients, which can be used in combination with suitable solubilizers such as alcohols (e.g., ethanol), polyols (e.g., propylene glycol, polyethylene glycol), and nonionic surfactants [e.g., polysorbate 80, HCO-50 (a polyoxyethylene (50 mol) adduct of hydrogenated castor oil)]. Oily media include, for example, sesame oil and soybean oil, which can be used in combination with solubilizers such as benzyl benzoate and benzyl alcohol. Therefore, the prepared injectable is preferably filled into a suitable ampoule.

[0278] In some implementations, TCR-expressing immune effector cells are formulated by first harvesting them from their culture medium, and then washing and concentrating them to a therapeutically effective amount in a suitable culture medium and container system (“pharmaceutically acceptable” carrier). Suitable infusion media can be any isotonic formulation, typically physiological saline, Normosol R (Abbott), or Plasma-Lyte A (Baxter), but 5% glucose solution or lactated Ringer's solution may also be used. The infusion medium may be supplemented with human serum albumin.

[0279] The number of therapeutically effective cells in the composition is typically greater than 10. 2 Cells, at most 10 6 Cells, at most and including 10 8 One or 10 9 10 cells, and more than 10 10 The number of cells will depend on the end use of the composition and the type of cells contained therein.

[0280] For patients receiving treatment, the cells may be autologous or allogeneic. If desired, treatment may also include administration of mitogens (e.g., PHA) or lymphokines, cytokines, and / or chemokines (e.g., IFN-γ, IL-2, IL-12, TNF-α, IL-18 and TNF-β, GM-CSF, IL-4, IL-13, Flt3-L, RANTES, MIP1α, etc.) as described herein to enhance the induction of an immune response.

[0281] The TCR-expressing immune effector cell populations of the present invention can be administered alone or in combination with diluents and / or other components (e.g., IL-2 or other cytokines or cell populations). In short, the pharmaceutical compositions of the present invention may comprise a combination of TCR-expressing immune effector cell populations (e.g., T cells) as described herein with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may comprise buffers, such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates, such as glucose, mannose, sucrose, or dextran, mannitol; proteins; polypeptides or amino acids, such as glycine; antioxidants; chelating agents, such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The compositions of the present invention are preferably formulated for intravenous administration.

[0282] Figure 1E Figure 1F Anti-HPV16, MART1, CMV, EBV, or influenza immune responses induced in subjects by administration of T cells expressing TCR as described herein using the methods described herein or other methods known in the art may include cellular immune responses mediated by cytotoxic T cells, regulatory T cells, and helper T cells capable of killing infected cells. Humoral immune responses may also be induced, primarily mediated by helper T cells capable of activating B cells, leading to antibody production. Various techniques can be used to analyze the types of immune responses induced by the compositions of the present invention, which are well described in the art; for example, Current Protocols in Immunology, edited by John E. Coligan, Ada M. Kruisbeek, David H. Margulies, Ethan M. Shevach, and Warren Strober (2001), John Wiley & Sons, NY, NY. Therefore, the HPV16, MART1, CMV, EBV, or influenza TCR of the present invention can be used in particular for the treatment, prevention, and / or improvement of any disease or condition associated with or mediated by HPV16, MART1, CMV, EBV, or influenza. For example, the present invention provides a method for treating HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions by administering to a patient requiring such treatment an HPV16, MART1, CMV, EBV, or influenza TCR (or a pharmaceutical composition comprising HPV16, MART1, CMV, EBV, or influenza TCR or multiple cells comprising HPV16, MART1, CMV, EBV, or influenza TCR), and multiple HPV16, MART1, CMV, EBV, or influenza TCR (or pharmaceutical compositions comprising HPV16, MART1, CMV, EBV, or influenza TCR) for treating HPV16, MART1, CMV, EBV, or influenza-related diseases. The antigen-binding protein of the present invention can be used to treat, prevent, and / or improve diseases or conditions or disorders, such as HPV16, MART1, CMV, EBV, or influenza-related conditions, and / or to improve at least one symptom associated with such diseases, conditions, or disorders. In the context of the treatments described herein, HPV16, MART1, CMV, EBV, or influenza TCR (or pharmaceutical compositions or multiple cells) can be administered as a monotherapy (i.e., as the sole therapeutic agent) or in combination with one or more additional therapeutic agents (examples of which are described elsewhere herein).

[0283] In some implementations, HPV16-related diseases or conditions include diseases or conditions selected from the group consisting of: HPV infection and HPV-related cancers. In some implementations, HPV-related cancers are selected from the group consisting of: cervical cancer, oropharyngeal cancer, anal cancer, penile cancer, vaginal cancer, and vulvar cancer.

[0284] In some implementations, MART1-related diseases or conditions include melanoma.

[0285] In some implementations, CMV-related diseases or conditions include diseases or conditions selected from the group consisting of: CMV infection, CMV-associated mononucleosis, and CMV-associated hepatitis.

[0286] In some implementations, EBV-related diseases or conditions include those selected from the group consisting of infectious mononucleosis and EBV-related cancers. In some implementations, EBV-related cancers are selected from the group consisting of nasopharyngeal carcinoma, Burkitt lymphoma, and Hodgkin's lymphoma.

[0287] In some implementation schemes, influenza-related illnesses or conditions include influenza infection.

[0288] Therefore, the present invention provides a method for treating an individual diagnosed with or suspected of having or at risk of having HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions, comprising administering to the individual a therapeutically effective amount of TCR-expressing immune effector cells as described herein.

[0289] Methods of administering the cell compositions described herein include any method that effectively results in the reintroduction of in vitro genetically modified immune effector cells, said immune effector cells either directly expressing the TCR of the present invention in a subject, or the reintroduction of genetically modified progenitor cells of immune effector cells that differentiate into mature immune effector cells expressing the TCR upon introduction into the subject. One method includes transducing peripheral blood T cells in vitro with a nucleic acid construct according to the present invention and returning the transduced cells to a subject.

[0290] One or more TCRs of the present invention can be applied to relieve or prevent one or more symptoms or conditions of a disease or condition or to reduce their severity.

[0291] This document also envisions the use of one or more TCRs of the present invention prophylactically in patients at risk of developing a disease or condition (e.g., HPV16, MART1, CMV, EBV, or influenza-related disease or condition).

[0292] In a further embodiment of the invention, the TCR of the present invention is used to prepare a pharmaceutical composition for treating patients suffering from HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions. In some embodiments of the invention, the TCR of the present invention is used as an adjunct therapy in conjunction with any other agents or therapies known to those skilled in the art for the treatment of HPV16, MART1, CMV, EBV, or influenza-related conditions.

[0293] Combination therapies may include HPV16, MART1, CMV, EBV, or influenza TCR of the present invention, such as immune effector cells containing the TCR of the present invention, or pharmaceutical compositions of the present invention, as well as any additional therapeutic agents that may be advantageously combined with the TCR of the present invention.

[0294] This document envisions combining the TCR of the present invention with immunostimulation and / or immunosupport therapies to inhibit tumor growth and / or improve cancer patient survival. Immunostimulation therapies include direct immunostimulation, which enhances immune cell activity by “releasing the brakes” or “stepping on the gas” to activate the immune response in suppressed immune cells. Examples include targeting other checkpoint receptors, vaccination, and adjuvants. Immunosupport therapies can increase tumor antigenicity through promoting immunogenic cell death, inflammation, or other indirect effects that promote antitumor immune responses. Examples include radiotherapy, chemotherapy, anti-angiogenic agents, and surgery.

[0295] In various embodiments, one or more TCRs of the present invention can be combined with PD-1 inhibitors (e.g., anti-PD-1 antibodies such as nivolumab, pembrolizumab, pidilizumab, BGB-A317, or REGN2810) and PD-L1 inhibitors (e.g., anti-PD-L1 antibodies such as avelumab, atezolizumab, durvalumab, MDX-1105, or REGN3504). CTLA-4 inhibitors (e.g., ipilimumab), TIM3 inhibitors, BTLA inhibitors, TIGIT inhibitors, CD47 inhibitors, GITR inhibitors, antagonists of another T-cell co-inhibitor or ligand (e.g., antibodies against CD-28, 2B4, LY108, LAIR1, ICOS, CD160, or VISTA), indoleamine-2,3-dioxygenase (IDO) inhibitors, and vascular endothelial growth factor (VEGF) antagonists [e.g., "VEGF-Trap" such as aflibercept or US]. Other VEGF inhibitory fusion proteins described in 7,087,411, or anti-VEGF antibodies or their antigen-binding fragments (e.g., bevacizumab or ranibizumab) or small molecule kinase inhibitors of the VEGF receptor (e.g., sunitinib, sorafenib, or pazopanib)], Ang2 inhibitors (e.g., nesvacumab), transforming growth factor β (TGFβ) inhibitors, epidermal growth factor receptor (EGFR) inhibitors (e.g., erlotinib, cetuximab), NY-ESO-1 inhibitors (e.g., anti-NY-ESO-1 antibodies), CD20 inhibitors (e.g., anti-CD20 antibodies, such as rituximab), and antibodies against tumor-specific antigens [e.g., CA9, CA125, melanoma-associated antigen 3]. (MAGE3), carcinoembryonic antigen (CEA), vimentin, tumor-M2-PK, prostate-specific antigen (PSA), mucin-1, MART-1, and CA19-9], vaccines (e.g., Bacillus Calmette-Guerin, a cancer vaccine), adjuvants that enhance antigen presentation (e.g., granulocyte-macrophage colony-stimulating factor), co-stimulators, bispecific antibodies (e.g., CD3xCD20 bispecific antibody, PSMAxCD3 bispecific antibody, or bispecific antibodies that act as co-stimulators),Examples of active ingredients include bispecific antibodies that bind to tumor antigens and have co-stimulatory activation, cytotoxic agents, chemotherapy agents (e.g., dacarbazine, temozolomide, cyclophosphamide, docetaxel, doxorubicin, daunorubicin, cisplatin, carboplatin, gemcitabine, methotrexate, mitoxantrone, oxaliplatin, paclitaxel, and vincristine), cyclophosphamide, radiotherapy, surgery, IL-6R inhibitors (e.g., sarilumab), IL-4R inhibitors (e.g., dupilumab), IL-10 inhibitors, cytokines (e.g., IL-2, IL-7, IL-21, and IL-15), and antibody-drug conjugates (ADCs) (e.g., anti-CD19-DM4 ADCs and anti-DS6-DM4 ADCs). Anti-inflammatory drugs (ADCs), anti-inflammatory drugs (e.g., corticosteroids and nonsteroidal anti-inflammatory drugs), dietary supplements (e.g., antioxidants), or any other therapies for treating cancer. In some embodiments, the TCR of the present invention can be used in combination with cancer vaccines (including dendritic cell vaccines, oncolytic viruses, tumor cell vaccines, etc.) to enhance the anti-tumor response.

[0296] For the purposes of this disclosure, such administration regimens are considered to be administration of HPV16, MART1, CMV, EBV, or influenza TCR "in combination" with a second therapeutic active ingredient.

[0297] Additional therapeutically active ingredients may be administered to subjects prior to the administration of HPV16, MART1, CMV, EBV, or influenza TCR of the present invention. In other embodiments, additional therapeutically active ingredients may be administered to subjects after the administration of HPV16, MART1, CMV, EBV, or influenza TCR of the present invention. In other embodiments, additional therapeutically active ingredients may be administered to subjects concurrently with the administration of HPV16, MART1, CMV, EBV, or influenza TCR of the present invention. For the purposes of this invention, “simultaneous” administration includes, for example, administering HPV16, MART1, CMV, EBV, or influenza TCR and additional therapeutically active ingredients to subjects in a single dose (e.g., co-formulated), or administering them in different doses within approximately 30 minutes or less of each other. If administered in separate dosage forms, each dosage form may be administered via the same route; or each dosage form may be administered via different routes. In any case, for the purposes of this disclosure, administration of the components in a single dose, via the same route in different dosage forms, or via different routes in different dosage forms is considered “simultaneous” administration. For the purposes of this disclosure, the application of HPV16, MART1, CMV, EBV, or influenza TCR “before,” “at the same time,” or “after” the application of the additional therapeutic active ingredient (as these terms are defined above) is considered to be the application of HPV16, MART1, CMV, EBV, or influenza TCR “in combination” with the additional therapeutic active ingredient.

[0298] In some embodiments, the adoptive T-cell therapy described herein includes identifying nucleic acid sequences encoding TCR α and / or β variable domains, such as CDR1, CDR2, and / or CDR3 sequences of the TCR α and / or β variable domains, using the high-throughput screening methods, compositions, and / or kits described herein. (Alternatively, in other embodiments, nucleic acid sequences encoding TCR δ and / or γ variable domains.) In one embodiment, the identified nucleic acid sequences encoding TCR α and / or β variable domains, such as CDR1, CDR2, and / or CDR3 sequences of the TCR α and / or β variable domains (or, in other embodiments, nucleic acid sequences encoding TCR δ and / or γ variable regions), are used to create a human therapeutic agent.

[0299] In one embodiment, the human therapeutic agent is a T cell (e.g., a human T cell, such as a T cell derived from a human subject) containing a nucleic acid sequence of interest (e.g., transfected, transduced, or otherwise introduced with the nucleic acid of interest), such that the T cell expresses a TCR with affinity for the antigen of interest. In one aspect, the subject receiving the therapeutic agent requires treatment for a specific disease or condition, and the antigen is associated with said disease or condition. In one aspect, the T cell is a cytotoxic T cell, the antigen is a tumor-associated antigen, and the disease or condition is cancer. In one aspect, the T cell is derived from a subject. Therefore, after identifying the nucleic acid and the homologous antigen, the adoptive T cell therapy methods described herein may further include cloning a nucleic acid sequence or a portion thereof (e.g., a nucleic acid sequence of the TCR variable domain) of a T cell receptor identified by the methods described herein into an expression vector (e.g., a retroviral vector), introducing the vector into T cells derived from the subject, such that the T cells express the antigen-specific T cell receptor, and infusing the T cells into the subject.

[0300] In other embodiments of the adoptive T-cell therapy described herein, nucleic acid sequences encoding the TCRα and / or β variable domains of antigen-specific T cells, such as CDR1, CDR2, and / or CDR3 sequences of the TCRα and / or β variable domains (or, in other embodiments, nucleic acid sequences encoding the TCRδ and / or γ variable regions), are used to create human T-cell receptor therapeutics. In one embodiment, the therapeutic receptor is a soluble T-cell receptor. Significant efforts have been made to generate soluble T-cell receptors or TCR variable regions for use in therapeutics. The generation of soluble T-cell receptors depends on obtaining rearranged TCR variable regions. One approach is to engineer single-chain TCRs containing TCRα and TCRβ, and, similar to the scFv immunoglobulin format, fuse them together via adapters (see, for example, International Application WO 2011 / 044186). If the resulting scTv is similar to scFv, a thermostable and soluble form of the TCRα / β binding protein will be provided. Other approaches include designing soluble TCRs with a TCRβ constant domain (see, for example, Chung et al., (1994) Functional three-domain single-chain T-cell receptors, Proc. Natl. Acad. Sci. USA. 91:12654-58); and engineering non-natural disulfide bonds into the interface between TCR constant domains (reviewed in Boulton and Jakobsen (2005) Stable, soluble, high-affinity, engineered T cell receptors: novel antibody-like proteins for specific targeting of peptide antigens, Clinical and Experimental Immunology 142:454-60; see also U.S. Patent No. 7,569,664). Other forms of soluble T-cell receptors have been described. The methods described herein can be used to determine the sequence of a T-cell receptor that binds to an antigen of interest with high affinity, and then design soluble T-cell receptors based on said sequence.

[0301] Soluble T-cell receptors containing sequences identified according to the high-throughput methods, compositions, and / or kits described herein can be used to block the function of proteins of interest (e.g., viral, bacterial, or tumor-associated proteins). Alternatively, soluble T-cell receptors can be fused with portions capable of killing infected or cancerous cells, such as cytotoxic molecules (e.g., chemotherapeutic agents), toxins, radionuclides, prodrugs, antibodies, etc. Soluble T-cell receptors can also be fused with immunomodulatory molecules, such as cytokines, chemokines, etc. Soluble T-cell receptors can also be fused with immunosuppressive molecules, such as molecules that inhibit T cells from killing other cells containing antigens recognized by T cells. Such soluble T-cell receptors fused with immunosuppressive molecules can be used, for example, to block autoimmunity. A review of various exemplary immunosuppressive molecules that can be fused with soluble T-cell receptors is available in Ravetch and Lanier (2000) Immune Inhibitory Receptors, Science 290:84-89, which is incorporated herein by reference.

[0302] While the invention has been specifically shown and described with reference to numerous embodiments, those skilled in the art will understand that changes in form and detail may be made to the various embodiments disclosed herein without departing from the spirit and scope of the invention, and that the various embodiments disclosed herein are not intended to be limiting of the scope of the claims.

[0303] The following embodiments further illustrate the invention, but are not intended to limit the invention in any way. All references, patents, and the entire contents of published patent applications cited throughout this application are hereby incorporated by reference.

[0304] Example Figure 1 illustrates a non-limiting implementation of an exemplary method that can be used to discover the T cell receptor sequences described herein. The data provided in the examples presented herein demonstrate that hashing methods can be used in combination with functional analyses, such as activation-inducible marker (AIM) cell enrichment and single-cell transcriptome sequencing, to screen for homologous T cells and antigen reactivity, such as T cell epitope reactivity, and that this approach is particularly useful in primary human cells. A description of the methods and data presented herein (including related figures) is also available in Deering et al., (2023) Rapid TCR: Epitope Ranker (RAPTER): a primary human T cell reactivity screening assay pairing epitope and TCR at single-cell resolution, Sci. Rep. 13(1):8452, which is incorporated herein by reference in its entirety.

[0305] Figure 1G Identifying epitopes of T-cell responses is crucial for understanding T-cell-mediated immunity. Traditional multimer and other single-cell assays typically require large amounts of blood and / or expensive HLA-specific reagents, and provide limited phenotypic and functional information. Recently, WO / 2021067851, incorporated herein by reference in its entirety, describes a rapid TCR:epitope sequencing (RAPTER) assay, schematically depicted on... Human peripheral blood mononuclear cells (PBMCs): , Peptides , Primary cell culture , Generation of oligonucleotide-tagged hash antibodies , Direct ex vivo IFNy / GranzymeB ELISPOT , Antibody and phenotypic characterization of T cells by flow cytometry and Expansion of antigen-specific T cells RAPTER uses hash-tagged oligonucleotides (HTO), T-cell activation-inducing markers (AIM), and single-cell RNA sequencing (scRNA-SEQ) methods to assess functional T-cell reactivity at single-cell resolution, determine paired epitope specificity and TCR sequences, and include T-cell phenotypic information at both the RNA and protein levels in samples that may contain primary human T cells and antigen-presenting cells (APCs). This high-throughput approach enables the rapid identification and generation of novel and potentially personalized therapeutics. In fact, the examples provided herein demonstrate that the paired antigen reactivity and TCR information provided by RAPTER can be used to understand the breadth of antigen-specific T-cell responses in human samples and potentially rapidly inform vaccine antigen inclusion and develop targeted TCR therapies. The materials and methods used throughout these examples are described below.

[0306] Antibody and phenotypic characterization of T cells by flow cytometryCryopreserved PBMCs were purchased (Precision for Medicine, Frederick, Maryland) or isolated from fresh blood of human subjects, separated by density gradient centrifugation using Ficoll-Paque Plus (GE Healthcare Life Sciences, 45-001, 749) reagent according to the manufacturer's instructions, and cryopreserved in cryopreservation medium (90% human serum (Millipore Sigma), 10% tissue culture grade DMSO (Millipore Sigma, 2438)).

[0307] Antigen-specific T cell reactivity assays The peptides were custom-synthesized in Genscript (Piscataway, NJ). The lyophilized peptides were reconstituted in DMSO at concentrations of 10–50 mg / mL to form a stock solution, which was then further diluted to 10 μg / mL in appropriate assay media for use. A 10 μg / mL CEF control peptide pool (Anaspec, AS-61036-003) and a cell stimulation mixture (ThermoFisher, 00-4970-93) were used according to the manufacturer's instructions.

[0308] Cell hashing after functional T cell assay performance Thaw the frozen PBMCs and incubate them in CellGenix GMP DC serum-free medium (CellGenix, 20801-0500) containing 5% human serum AB (Millipore Sigma, H3667) and 1% penicillin-streptomycin (ThermoFisher Scientific, 15140163). The culture was supplemented with dendritic cell and T cell supporting cytokines: T cell culture medium (CellGenix dendritic cell culture medium, catalog number 20801-0500 + 5% human serum AB (Sigma, catalog number H3667)) + 1% penicillin / streptomycin / L-glutamine (ThermoFisher, catalog number 10378-016), 5 ng / ml of T cell supporting cytokines IL-7 and IL-15 (CellGenix, catalog numbers 1410-050 and 1413-050) and 10 U / ml of IL-2 (Peprotech, catalog number 200-0).

[0309] CITE-seq antibody staining and fluorescent antibody stainingMonoclonal anti-human CD2 antibody (clone RPA-2, Biolegend) was conjugated to hash oligonucleotides (IDTs) via anti-electron demand Diels-Alder (iEDDA) click chemistry, as previously described. The hash-tagged oligonucleotides were 5'-amine modified (\5AmMC12\ GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXXXXXXXXXXXXXCCCATATAAGA*A*A (SEQ ID NO: 1279, where X represents a unique 15nt barcode for each hash tag) and purified by ethanol precipitation upon receipt. * indicates a phosphate thioester bond, which enhances the resistance of the nucleotide bond to nuclease degradation. Trans-cyclooctene-PEG4-NHS (TCO; Click Chemistry Tools, USA) was dissolved in anhydrous DMSO to a final concentration of 100 mM and added in a 10-fold excess to purified oligonucleotides in 1X borate buffer (BBS, 50 mM borate, 150 mM NaCl, pH 8.5) replenished with DMSO, resulting in a final DMSO concentration of 20% in the reaction mixture. After 15 minutes at room temperature, a second aliquot of 10-fold excess TCO was added, and the reaction mixture was incubated at room temperature for another 15 minutes. Residual NHS groups were quenched by adding glycine, and the modified oligonucleotides were purified by desalting using a Micro Bio-Spin P6 column (Bio-Rad, USA). The antibody buffer was exchanged into 1X BBS using an Amicon Ultra-4 30 kDa MWCO centrifuge filter (Millipore, USA). Methyltetraazine-PEG4-NHS ester (ClickChemistry Tools, USA) was dissolved in anhydrous DMSO and added to the antibody in a 30-fold excess. The reaction mixture was stirred at room temperature for 30 min. Residual NHS groups were quenched by adding glycine, and residual free tags were removed by centrifugation. Antibody-oligonucleotide conjugates were formed by mixing the modified antibody and oligonucleotides at a ratio of 30 picomoles of oligonucleotides per microgram of antibody and incubating at room temperature for at least 1 hour, followed by overnight incubation at 4°C. Residual methyltetraazine groups on the antibody were quenched by adding 1 mM trans-cyclooctene-PEG4-glycine. Unreacted oligonucleotides were removed by centrifugation using an Amicon Ultra-4 50 kDa MWCO filter (Millipore, USA). The purified antibody-oligonucleotide conjugates were run on a 4% agarose E-gel (ThermoFisher, USA) to verify the removal of conjugated and free oligonucleotides.The antibody-oligonucleotide conjugate was stored in PBS (pH 7.2) containing 0.09% sodium azide and 1 mM EDTA at 4°C.

[0310] ​ The Dual Human IFNγ / GranzymeB FluoroSpot Assay Kit was purchased from ImmunoSpot (Cleveland, OH) and used according to the manufacturer's protocol. In short, PBMCs were thawed and cultured in 200 μL per well in FluoroSpot plates for 48 hours while undergoing peptide stimulation. ELISPOT reactivity was read out on an ImmunoSpot analyzer using the manufacturer's automated software.

[0311] ​Fluorescently labeled antibodies were purchased from a commercial supplier. For flow cytometry phenotypic characterization, cells were harvested, washed, and stained with LIVE / DEAD Green immobilizable dye (Invitrogen catalog number L34970). To stain for surface antigens, cells were resuspended in flow cytometry staining buffer (staining buffer BSA, BDBiosciences, catalog number 554657) containing human Seroblock Fc blocking reagent (BioRad, #BUF070B) and incubated at room temperature for 10 minutes, followed by the addition of the fluorescently labeled antibody of interest. Cells were incubated at 4°C for 30 minutes and then washed three times with staining buffer. To detect intracellular proteins, cells were fixed and permeabilized using eBioscience FoxP3 / Transcription Factor Staining Buffer Set (Invitrogen #00-5523-00) according to the manufacturer's instructions. Intracellular proteins were detected by staining with fluorescently labeled antibody diluted in permeabilization buffer at 4°C in the dark for 30 minutes. Cells were washed before being collected on an A3 Symphony flow cytometer (BDBiosciences). Flow cytometry data were analyzed using FlowJo analysis software (FlowJo, Ashland, OR).The following antibodies were purchased from BD Biosciences: Granzyme B Alexa Fluor 647 (clone GB11, #560212), CD27 APC-R700 (clone M-T271, #565116), CCR7 BB700 (clone 3D12, #566437), CD95 BUV395 (clone DX2, #740306), CD8 BUV496 (clone RPA-T8, #612942), CD4 BUV563 (clone SK3, #612912), CD3 BUV661 (clone SK7, #741692), Tim-3 BUV737 (clone 7D3, #748820), CD45RA BUV805 (clone HI100, #742020), GITR BV711 (clone V27-580, #747662), CD69 BV750 (clone FN50, #747522), HLA-DR / DP BV786 (clone G46-6, #564041), CX3CR1 PE-CF594 (clone 2A9-1, #565897), CD28 PE-Cy5 (clone 8124737, #555730), TCF-7 BB630 (clone S33-966, BD Customs, #624294), CTLA-4 BB660 (clone BNI3, BD Customs, #624295), Ki67BB790 (clone B56, BD Customs, #624296), HLA-ABC BV570 (clone G46-2.6, BD Customs, #624298). The following antibodies were purchased from BioLegend: LAG-3 APC / Fire 750 (clone 7H2C65, #369214), TIGITBV421 (clone A15153G, #372710), ICOS BV510 (clone C398.4.A, #313525), CD45RO BV605 (clone UCHL1, #304238), 4-1BB BV650 (clone 4B4-1, #309828), and PD-1 PE (clone EH12.2H7, #329906). The following antibodies were purchased from Invitrogen: CD25 PE-Cy5.5 (clone PC61.5, #35-0251-82) and FoxP3PE-Cy7 (clone PCH101, #25-4776-42).

[0312] ​PBMCs were seeded into T-cell culture medium supplemented with dendritic cell support factors GM-CSF 1000 U / mL (CellGenix, #1412-050) and IL-4 500 U / mL (CellGenix, #1403-050), T-cell support cytokines IL-7 5 ng / mL (CellGenix, #1410-050), IL-15 5 ng / mL (CellGenix #1413-050), and IL-2 10 U / mL (Peprotech, #200-02). Single peptides or peptide pools were added to the cells at 10 µg / mL (Genscript). Cytokine-containing culture medium was replenished every 2 to 3 days. Cells were restimulated with a single peptide or peptide pool that initially stimulated them, or with DMSO, a control CEF peptide pool, or anti-CD3 (clone HIT3a) / anti-CD28 (clone CD28.2), and the activation-inducible markers were analyzed by flow cytometry after 24 hours. Antibodies used for flow cytometry analysis are described above. ​ ​

[0313] ​ Peripheral blood mononuclear cells (PBMCs) were isolated using the Ficoll-Paque Plus gradient separation method. PBMCs were seeded into culture plates, for example, in equal parts of T cell culture medium (CellGenix GMP DC medium, catalog number 20801-0500 + 5% human serum AB (Sigma, catalog number H3667)) + 1% penicillin / streptomycin / L-glutamine (ThermoFisher, catalog number 10378-016), 1000 U / mL dendritic cell support factor GM-CSF and 500 U / mL IL-4 (CellGenix, #1412-050 and CellGenix, #1403-050, respectively), 5 ng / mL T cell support cytokines IL-7 and IL-15 (CellGenix, #1410-050 and #1413-050, respectively), and 10 U / mL IL-2 (Peprotech, catalog number 200-0). A single antigen (e.g., a peptide of interest) is added to the assay well at a rate of 10 μg / ml (Genscript) to form a unique biological sample. T cell reactivity is analyzed 24 hours after peptide stimulation or 10 days after amplification.

[0314] Overnight cultures were harvested 24 hours after peptide stimulation and prepared for sorting and single-cell sequencing. For 10-day pre-expansion cultures, fresh medium and cytokines were added to cells every two days for 10 days following the initial peptide addition. The single peptide of interest was then added to T-cell expansion cultures for overnight restimulation to upregulate the expression of activation-inducible markers (e.g., CD137 / 4-1BB) and allow for functional T-cell sorting based on antigen-specific AIMs. Following peptide restimulation, cells were prepared for flow cytometry characterization or further processing to allow for hashing, pooling, and single-cell sequencing. Antibodies used for flow cytometry analysis were purchased from commercial vendors. The following antibodies were purchased from BD Biosciences: CD3 BUV661 (clone SK7, #741692), CD8 BUV496 (clone RPA-T8, #612942), CD4 BUV563 (clone SK3, #612912), CD69BV750 (clone FN50, #747522), HLADR BUV395 (clone DX2, #740306), and Ki67 BB790 (clone B56, BD Customs #624296). The following antibodies were purchased from BioLegend: 4-1BB BV650 (clone 4B4-1, #309828), PD-1 PE (clone EH12.2H7, #329906), CD25 Alexa Fluor 488 (clone M-A251, #356116), IFNγPE-Cy7 (clone 4S.B3, #502528), CX3CR1 PE / Dazzle594 (clone 2A9-1, #341623), CD40LBV421 (clone 24-31, #310824), and OX40 APC (clone Ber-ACT35, #350008).

[0315] ​ Following functional stimulation, cells from each well were collected into a 96-well assay block, washed, and resuspended in flow cytometry BD BSA staining buffer (BD Biosciences, #554657) containing the scattering reagent of interest. Cells were stained with one or two scatter-tagged oligonucleotide (HTO) antibodies at a concentration of 1 μg / 10⁻⁶ for each antibody. 6 Cells were incubated at 4°C for 30 minutes, washed twice, and then collected. If the analysis included oligonucleotide-labeled dextramer, the sample was stained with dextramer first, followed by CITE-seq and flow cytometry antibody staining according to the oligonucleotide-labeled dextramer staining protocol below.

[0316] ​Following the hash staining procedure, the pooled and hashed samples were resuspended in BD BSA staining buffer containing the optimal concentrations of CITE-seq antibody and fluorescently labeled flow cytometry antibody, respectively. Cells were incubated at 4°C for 30 minutes, washed twice, and then sorted for single-cell sequencing.

[0317] Oligonucleotide-tagged Dextramer staining and FACS sorting Frozen healthy donor PBMCs were briefly thawed in a 37°C water bath. CD8+ T cells were enriched using magnetic beads (Miltenyi Biotec). Cells were washed by centrifugation and then treated with PBS (Gibco, 14190-250) containing totipotent nuclease (Millipore, 70664) and 50 nM dasatinib (Axon Medchem, 1392) at 37°C for 45 min. Cells were transferred to 96-well assay blocks (Corning, 3960), centrifuged, and the supernatant was aspirated. Cells were incubated at room temperature in the dark with an appropriate custom-made Immudex dCODE-PE dextramer pool (Copenhagen, Denmark) at 1 μL / 100 μL of reactant for 30 min. Next, a surface label labeled with fluorescent dye was added, and cells were incubated at 4°C for another 30 min. Cells were immediately sorted after washing. Flow cytometry antibody staining and washing were performed in staining buffer (BD, 554657). The surface markers for FACS include the following markers and fluorescence: Live / Dead – DAPI (Sigma, 10236276001), CD3 BUV737 (BD Biosciences, 612750), CD4 BV510 (BD Biosciences, 563919), CD8 BUV805 (BD Biosciences, 612889), CCR7 AF647 (BioLegend 353218), and CD45RO BV605 (BioLegend 304238), added on-site to the sorter.

[0318] CD137 / 4-1BB+ T cell FACS sorting 24 hours after restimulation, cells were collected and stained with fluorescently labeled antibodies for FACS using an Astrios cell sorter (Beckman Coulter) for CD3 (BD ​​Biosciences, catalog number 612750) and CD137 / 4-1BB (Biolegend, catalog number 309828). Forward scatter plots, lateral scatter plots, and fluorescence channel gating were set to select live cells while excluding debris and bimodal cells. Individual CD3+ CD137 / 4-1BB+ cells were sorted using a 100 µm nozzle for further processing.

[0319] Chromium single-cell segmentation and library preparation: The sorted cells were then loaded onto a Chromium single-cell 5' microarray (10x Genomics, 1000287) and processed using a Chromium Controller to generate a GEM (gel bead emulsion). Following the manufacturer's protocol, RNA-Seq libraries were prepared using the Chromium Single Cell 5' Library & Gel Bead Kit (10x Genomics, 1000265).

[0320] Plasmid cloning: The TRA and TRB of EBV BMFL1 or Flu M TCR were subcloned into the lentiviral vector pLVXEF1a in Genscript. The TRA and TRB of MART1 TCR were subcloned into the lentiviral vector pLVX-EF1a between the SpeI and XbaI of IRES-EGFP.

[0321] Transfection and lentivirus generation: Lenti-X 293T cells were seeded onto poly-D-lysine-coated tissue culture plates. Transfection was performed using Lenti-X Packaging Single Shots (Takara) according to the manufacturer's instructions. Supernatant containing lentiviral particles was collected at 48 and 72 hours post-transfection. If necessary, the viral supernatant was concentrated using an Amicon Ultra-15 centrifuge-filtration system (NMWL 100 kDa, Millipore UFC910096).

[0322] Jurkat reporter cell lineThe Jurkat / NFAT-Luc cell line was generated by stable transfection of Jurkat (clone E6-1, ATCC) with the NFAT reaction element-luciferase reporter plasmid. The Jurkat TCRab dKO cell line was generated by CRISPR editing of the TRA and TRB in the Jurkat clone E6-1 (ATCC TIB-152). TRB was edited using a single gRNA (AGGCTTCTTCCCCGACCACG [SEQ ID NO: 1280]). TRA was edited using two gRNAs (ACATACCAGAAGAGATATGG [SEQ ID NO: 1281] and TGGATTTAGAGTCTCTCAGC [SEQ ID NO: 1282]). Lentiviral particles expressing the AP-1 reaction element firefly luciferase (Qiagen) were used to transduce Jurkat TCRab dKO cells to generate Jurkat TCRab dKO / AP1.Luc cells, which were subsequently transduced in pLVX with lentiviral particles expressing human CD8. The resulting Jurkat TCRab dKO / AP1.Luc / hCD8 cells were used to assess the antigenic reactivity of TCRs. Briefly, lentiviral particles containing TRA and TRB of interest for the TCRs of interest were transduced into Jurkat TCRab dKO / AP1.Luc / hCD8 cells in the presence of 8 μg / mL polyglobulin. TCR expression was confirmed by flow cytometry analysis using the following antibodies: CD3 BUV661 (clone SK7, BD Biosciences), CD4 BUV563 (clone SK3, BD Biosciences), CD8 BUV496 (clone RPA-T8, BD Biosciences), and TCR / b PerCP-vio700 (clone REA652, Miltenyi Biotec). When desired, TCR+ cells were enriched using anti-APC microbeads (Miltenyi Biotec) after labeling with an APC-conjugated anti-human TCRab antibody (clone REA652).

[0323] Jurkat firefly luciferase reporter gene assayCD14+ cells isolated from PBMCs using the EasySep Human Mononuclear Cell Isolation Kit (STEMCELL) were cultured in CellGenix GMP DC serum-free medium (CellGenix, #20801-0500) supplemented with 1% human serum AB (Millipore Sigma, #H3667) and 1% penicillin-streptomycin-L-glutamine (ThermoFisher Scientific, #10378-016). GM-CSF (1000 U / mL, CellGenix #1412-050) and IL-4 (500 U / mL, CellGenix #1403-050) were added to the medium to generate Mo-DCs. On day 5, DCs were treated with a peptide pool or single peptide pulse in the presence of IFNγ (500 U / mL), GM-CSF (1000 U / mL), and IL-4 (500 U / mL). 12,500 to 100,000 Jurkat TCRab dKO / AP1.Luc / hCD8 cells expressing the TCR of interest (Jurkat-TCR) were co-cultured with 30,000 DCs pulsed with the antigen peptide for 5 hours, then lysed to assess luciferase activity using the One-Glo luciferase assay (Promega) according to the manufacturer's instructions. 100,000 Jurkat-TCR cells were co-cultured with 30,000 DCs pulsed with an irrelevant peptide or DCs treated with DMSO as a negative control. Jurkat / NFAT-Luc cells were used as filler cells when titrating with Jurkat-TCR cells. Non-specific activation of TCRs was achieved using soluble anti-CD3 (clone HIT3a, BD Biosciences) and anti-CD28 (clone CD28.2, BioLegend). Emission signals were measured using an EnVision plate reader. RLU values ​​were plotted after subtracting the background signal.

[0324] Bioinformatics methods Transcriptome, TCR (VDJ), hash, CITE-seq, and dextramer libraries were sequenced, and raw sequencing data were processed using a 10X CellRanger analysis pipeline. CellRanger analysis generated a feature barcode UMI count matrix and TCR (VDJ) amino acid sequences. Features included gene expression, hash antibodies, CITE-seq antibodies, and dextramer capture. Downstream analysis was performed using the feature barcode matrix as input using the R package Seurat v3.1.4 (Butler et al. 2018). Gene UMI counts were normalized to standard logarithm, and the 1000 most variable genes were identified, followed by data scaling and centering. Principal component analysis (PCA) was then performed, and 50 PCs were calculated and stored. Clustering was then performed using Seurat's graph-based clustering method. A k-nearest neighbor (KNN) graph was calculated based on Euclidean distance in a 20-dimensional PCA space, and clustering was performed at various resolutions. At each resolution, top-level marker genes were identified and used to create gene expression heatmaps across different clusters. The optimal clustering resolution was determined through visual inspection. All cells belonging to the dead cell cluster, with mitochondrial genes as the top-level gene marker, were removed from downstream analysis. Cells with fewer than or equal to 500 detected genes and mitochondrial gene expression fractions greater than or equal to 0.25 were removed. Since one of the primary objectives of the assay is to identify T-cell reactivity against various antigens driven by TCR-antigen interactions, any cells with a single TCR chain, a non-productive chain, or more than one α or β chain were also removed. Any anomalous cells with a large number of detected genes and / or a large number of detected UMIs were also removed. For the remaining cells, data from other features (CITE-seq, hash, dextramer) were then processed. The data in the count matrices corresponding to these features were normalized using a central logarithmic ratio transformation and then scaled. The MultiSeqDemux algorithm (McGinnis et al. (2019)) was used. Nature Methods Cellular demultiplexing was performed on the hash data (16:619-26; default parameters). Any cell not assigned a hash tag according to the hashing scheme was removed after demultiplexing. For each cell, a paired TCR amino acid sequence defining the cell's unique functional clonal type was obtained. After demultiplexing, the clonal type size of each T cell clone in all cells associated with the hash tag assay well was calculated. Any clonal type > 20 was considered potentially reactive to the specific antigen in the labeled well. Table 8 provides the GEO accession numbers for the single-cell sequencing files.

[0325] The RAPTER assay was developed using whole peripheral blood mononuclear cells (PBMCs) as a source of T cells and APCs, or using T cells cultured from autologous mononuclear cell-derived dendritic cells (moDCs). However, PBMC culture systems may utilize patient blood more quickly and efficiently.

[0326] To perform the RAPTER assay, PBMC or T cell / moDC cultures are first distributed into the assay wells in the culture medium. Then, a single antigen or antigen pool is added to the culture wells. Figure 1A In the experiments presented in this paper, the antigen was provided in the form of a synthetic peptide. T cells in each assay well were stained with an HTO-conjugated antibody 24 hours later. Figure 1B While the antibody targets for all wells are constant and should target markers typically expressed by T cells, such as anti-CD2, the HTO sequence for each well is unique. Cell target-agnostic lipid-based hashing reagents can also be reused for this assay. Figure 10A , Figure 10B , Figure 10C , Figure 10D , Figure 10E and Figure 10F HTOs were sequenced using transcriptome analysis using specific primers added to the standard scRNA-SEQ protocol. The HTOs identified which assay well each T cell originated from, thus identifying which antigen each T cell was exposed to.

[0327] Once the T cells in each well are uniquely labeled with the HTO antibody, the cells from all wells are pooled together. Sample pooling offers several benefits: consistency of surface antibody staining for flow cytometry and CITE-seq, ensuring sufficient cells for fluorescence-activated cell sorting (FACS), reducing the use of scRNA-SEQ reagents, and reducing overall technical differences between wells. Figure 1C While individual antigen-specific T cell reactivity may contain very low, unsortable cell populations, pooling all wells together provides a larger composite cell population, enabling rapid and efficient sorting. The design strategy involved simultaneous scRNA-SEQ, HTO hashing, and oligonucleotide-labeled CITE-seq antibody / dextramer reagent staining, but generating separate sequencing libraries from each of the three groups to optimize individual library amplification.

[0328] Next, AIM expression was used as a functional selection marker to sort the aggregated cell population. Figure 1DAt least one assay well may include a pool of common viral antigens, such as a 35-peptide CMV-EBV-influenza (CEF) peptide pool, serving both as a positive control and ensuring a stable, sortable cell population for FACS and single-cell sequencing. The sorted AIM+ cells are "overloaded" into a 10X Genomics single-cell splitter, with an expected yield of 20,000 single cells. Figure 1E After sequencing, HTO demultiplexing is computed to link each T cell to the specific antigen it is exposed to. Figure 1F HTO-specific TCRs were selected based on clone size and AIM expression. Figure 1G ).

[0329] Although RAPTER can be used for PBMC or T cell / moDC culture, all examples in this article use the entire PBMC culture system.

[0330] Following antigen-specific TCR signaling, T cells upregulate multiple activation-inducible markers (AIMs), including CD137 / 4-1BB, CD25, CD69, HLA-DR, CD40L, OX40, and PD-1. To preliminarily develop a RAPTER assay, the dynamics of AIM upregulation on CD8+ T cells were tested using an HLA class I restricted viral epitope system, employing both HLA class I restricted viral and tumor model epitope systems. Primary human T cells from HLA-A*02:01+ healthy donors (HD) confirmed to have CMV-specific antibodies were subjected to CMVpp65 assays. 495-503 Pre-amplification was performed for 10 days in the presence of the peptide (NLVPMVATV; SEQ ID NO: 1283) to increase the test population size. Figure 11A and Figure 11B After amplification, CMVpp65 was used. 495-503 Peptide restimulation of cells and measurement of various activation markers, including CD137 / 4-1BB, CD25, CD69, and PD-1, at time intervals over 96 hours. Compared to other AIMs, CMVpp65 495-503 24 hours after restimulation, the percentage of CD8+ T cells with upregulated CD137 / 4-1BB was comparable to that of the corresponding dextramer+ population (23.5% vs. 23.9%). Figure 2A and Figure 2B This is consistent with previous reports (Wolfl, M. et al. (2007)). Blood 110:201-210). Most CD137 / 4-1BB+ T cells co-express CD25 and high levels of PD-1 and HLA-DR ( ). Figure 12Furthermore, the kinetics of CD25 expression are most similar to those of CD137 / 4-1BB expression. Figure 2A In the absence of homoligand stimulation, all tested AIMs (HLA-DR, PD-1, CD25, etc.) except CD137 / 4-1BB showed varying degrees of expression at baseline. Figure 2A and Figure 2B The extremely low baseline expression of CD137 / 4-1BB on CD8+ T cells makes them ideal for identifying and isolating low-frequency reactive AIMs. AIMs highly co-expressed with CD137 / 4-1BB+ cells (e.g., CD25) can also be used for further enrichment of antigen-specific T cells. Unsurprisingly, the number of detectable CMV pp65dextramer+ T cells decreased after homologous ligand stimulation, likely due to TCR internalization, but most T cells still expressed CD137 / 4-1BB upon post-stimulation detection by dextramer. Figure 2B and Figure 2C Therefore, cells were subjected to a simulated stimulus (DMSO treatment) to collect dextramer+ cells for all experiments described herein. CMV pp65 epitope-specific dextramer+ and CD137 / 4-1BB+ T cells were detected only in HLA-A*02:01+ cells naturally exposed to CMV in HD cells. Figure 2D This data, together with the data shown in WO / 2021067851 above, demonstrates that CD137 / 4-1BB is a specific and sensitive marker of CD8+ T cell epitope reactivity and can be used for functional assays to provide effective and similar functional assay results to conventional multimer staining.

[0331] To confirm that the TCR clones found in the CD137 / 4-1BB+ T cell population were indeed antigen-specific, CMVpp65 was used. 495-503 Peptide restimulation Figure 2A and Figure 2B The CMV pp65+ T cells in the HD shown were expanded, and the clones were compared with CMV pp65 dextramer+ cells or MART1 dextramer+ T cells using single-cell RNA sequencing (scRNA-SEQ) and single-cell TCR sequencing (scTCR-SEQ). After 24 hours of restimulation, the population size of DMSO-treated dextramer+ and CD137 / 4-1BB+ T cells was consistent, as observed by flow cytometry. Figure 2E This is consistent with previous studies using PD-1 as an AIM to identify circulating antigen-specific T cells (Gros, A. (2016)). Nat Med22: 433-438; Gros et al. (2019) J Clin Invest 129: 4992-5004), CD137 / 4-1BB+ T cells also express PD-1 ( Figure 12 However, PD-1 was expressed on T cells even before restimulation with CMV pp65 peptide. Figure 2E CD8+ T cells expressing CD137 / 4-1BB or PD-1, as well as CMV pp65 dextramer+ T cells and MART1 dextramer+ T cells, were subjected to scRNA and scTCR-SEQ assays after restimulation as a reference control. Figure 13A , Figure 13B , Figure 13C , Figure 13D , Figure 13E , Figure 14A and Figure 14B The overlap between expanded TCR clones (clone size >= 10 cells) was more significant between the dextramer+ and CD137 / 4-1BB+ populations than between the dextramer+ and PD-1+ or PD-1+ and CD137 / 4-1BB+ populations. Figure 2F When considering overlap between TCR clones > 1 cell, dextramer+ and CD137 / 4-1BB+ samples were also significantly correlated. Figure 2G Almost no TCR overlap was observed between MART1 dextramer+ TCRs and CMVpp65-specific TCRs captured by dextramer, PD-1, or CD137 / 41-BB. These experiments demonstrate that the same epitope-specific TCR clones can be found using CD137 / 4-1BB and dextramer sorting. See also WO / 2021067851 above.

[0332] After confirming that the CD137 / 4-1BB+ T cell population is an epitope-specific TCR enriched after antigen re-exposure, it was demonstrated that a RAPTER using an AIM (e.g., CD137 / 4-1BB) could recover multiple antigen-specific populations at their respective starting ratios. See, for example, WO / 2021067851 above. After 10 days of peptide-specific amplification (CMVpp65, EBV BMLF1, EBV LMP2A, influenza M) and 24 hours of re-exposure, see WO / 2021067851 above, scattered and pooled T cells were tested in a RAPTER assay using the CD137 / 4-1BB+ signal as a selection marker. In 6,474 CD137 / 4-1BB+CD8+ T cells sequenced using RAPTER, DEMUX revealed five viral antigen-associated populations that retained the relative frequencies determined by both ELISpot and flow cytometry (Pearson R = 0.94, p = 2.1 × 10⁻⁶). 7 Furthermore, the consistency between scRNA and CITE-SEQ gene expression on these virus-specific T cells was observed, see, for example, WO / 2021067851, above. These experiments demonstrate that the relative frequencies of different reactivity were maintained during amplification and restimulation during the RAPTER assay.

[0333] WO / 2021067851 (ibid.) and this embodiment confirm that RAPTER is a functional T-cell assay system using primary autologous immune cells. It can be used to simultaneously screen for dozens to hundreds of antigen reactivity types and to select antigen-specific cells using T-cell AIM expression.

[0334] In the following examples, it is demonstrated that RAPTER can be used to identify specific reactivity to viral and tumor antigens with a sensitivity as low as 0.15% of total CD8+ T cells, and to deconvolve low-frequency circulating HPV16-specific T cell clones from cervical cancer patients. Additionally, the following examples show that the specificity of RAPTER-identified TCRs for MART1, EBV, and influenza epitopes can be functionally confirmed in vitro. In summary, RAPTER uses primary cells from hypovolemic cells to identify low-frequency T cell reactivity, and the resulting paired TCR:ligand information can be used to select immunogenic antigens for vaccine epitope incorporation, antigen-specific TCR tracking, and TCR cloning for further therapeutic development.

[0335] Example 2 – RAPTER Sensitivity Test The limit of detection for RAPTER was determined. By understanding the lower limit of detection in the positive population during the assay, the number of queried concurrent reactivity samples can be estimated more accurately. For this proof-of-concept experiment, the focus was on the epitope associated with a very small number of antigen-specific T cells at baseline, namely ELAGIGILTV (SEQ ID NO:1284) from the MART1 protein. At baseline, the percentage of MART1 dextramer+ T cells was 0.018% of total CD8+ T cells in healthy donors (HD), but after 10 days of peptide-specific amplification, 8.48% of T cells were MART1 dextramer+ (SEQ ID NO:1284). Figure 3A Next, a series of dilutions were performed using autologous, unexpanded cells to dilute the antigen-specific target population. Figure 3B Cells at each dilution point were restimulated with MART1ELAGIGILTV (SEQ ID NO: 1284). After 24 hours, cells were scattered, pooled, sorted using CD137 / 4-1BB signaling, and submitted to scRNA / TCR-SEQ. Additionally, expanded DMSO-stimulated T cells were stained with MART1 dextramer, sorted, and subjected to scRNA / TCR-SEQ to provide a positive control for comparison of RAPTER-enriched TCRs (…). Figure 4A , Figure 4B and Figure 4C For TCR clones found in ≥2 cells, MART1 CD137 / 4-1BB+ TCRs were robustly detected in samples with dextramer+ levels as low as 0.15% in total CD8+ T cells and as low as 0.07% in total CD3+ T cells. Figure 3C The RAPTER TCR was cross-referenced with its corresponding dextramer+ TCR to confirm specificity and high relevance.

[0336] UMAP clustering was performed using scRNA-SEQ data from all MART1 sorted T cells. It appears that dextramer+ and RAPTER+ T cells clustered separately, possibly due to a lack of restimulation of dextramer-sorted cells. Figure 3D Unsupervised clustering identified 5 dextramer sorting clusters. Figure 3D ) and two RAPTER sorting clusters, whose expression was consistent with T cell activation after antigen restimulation, including high levels of CD137 / 4-1BB, GZMB, IFNG, CCL4, TNFRSF4 (OX40), and TNFRSF18 (GITR), and low levels of ZNF683 (HOBIT) and SELL ( Figure 3EHowever, the functional characteristics of the RAPTER clusters differ. Cluster 2 is characterized by high expression of XCL1 / 2, CD28, IL2RA, and TFRC (CD71). Cluster 3 is characterized by expression of KLRD1, GNLY, and ENTPD1 (CD39), as well as T cell activation markers, including PD-1, TIGIT, and KLRD1.

[0337] Example 3 – Functional Verification of MART1 TCR Qualified by RAPTER Although most MART1 TCRs were present in samples stained with both RAPTER and dextramer, some TCRs were identified only by dextramer, while conversely, some TCRs were present in RAPTER assays but not by dextramer staining. Therefore, all classes of TCRs were cloned into a TCR-deficient Jurkat T cell line engineered to express luciferase under the control of the AP-1 promoter. Figure 3F (Table 1) and tested their functional responsiveness to the MART1 ELAGIGILTV (SEQ ID NO: 1284) peptide loaded on moDCs derived from HLA-A*02:01+ healthy donor PBMCs. All MART1 TCRs identified by both RAPTER and dextramer assays, as well as 3 of the 4 tested MART1 TCRs identified by dextramer assays, showed a functional response to restimulation with the MART1 peptide. Figure 3G (Table 2). Nonspecific background TCRs did not exhibit functional activity under any peptide conditions. Although a TCR could bind to the MART1 dextramer, antigen restimulation of the TCR did not lead to T cell activation ( Figure 15 A, Figure 15 B. Figure 15 C Figure 15 D、 Figure 15 E, Figure 15 F, Figure 15 G, Figure 15 H, Figure 15 I and Figure 15 J).

[0338] Table 1. MART1 TCR sequences from TCR validation. Table 2. Example 4 – Direct Comparison of RAPTER and Dextramer (a pooling oligonucleotide marker) To determine baseline diversity of antigen-positive T cells, a previously developed pooled oligonucleotide marker dextramer (dCODE) screening procedure for human sample analysis was used. (Zhang (2021)) Sci Adv 7. Using a set of 23 custom dCODE dextramers (Table 3) containing multiple HLA alleles and virus- and cancer-associated epitopes, HLA-A*02:01 was analyzed. + A*29:02 + B*35:01 + and B*57:01 + Donor T cells were stained with each type of dextramer ( Figure 5A and Figure 5B ), and as a filter for the aggregated dCODE dextramer read using scSEQ ( Figure 6A and Figure 6B To understand population frequencies and identify antigen-specific TCR sequences, these tests used 50 million PBMCs, but many dextramers... + The T cell population was so infrequent that it could not be sorted from the available PBMCs using a single dextramer method.

[0339] Table 3. The impact of peptide pre-amplification on the TCR library was assessed, and it was determined that our culture conditions maintained pre-existing antigen-specific memory T cells, although the preferentially expanded T cell clones consisted of ≥2 cells prior to expansion. Figure 16A , Figure 16B , Figure 16C , Figure 16D , Figure 16E and Figure 16F A 7-day T-cell expansion culture protocol was performed using 21 non-control peptides listed in Table 3, a protocol previously demonstrated to maintain pre-existing antigen-specific memory T cells. The expanded samples were tested in parallel using pooled dCODE dextramer and RAPTER assays. Figure 7A and Figure 7B TCR sequences identified in the dCODE dextramer screening before and after amplification were compared. Significant overlap was observed in dextramer-stained clones, particularly TCR clones with sizes >1 and >10. Figure 7COf the 23 dextramers tested, T cells specific to three haplotype-matched reactivity types (CMV pp65, EBV BMLF1, and influenza M) represented the majority of the signal in each assay and provided sufficient TCR for relevant analysis. For each reactivity type, dextramer detected more unique T cell clones than RAPTER, but when dextramer... + and RAPTER + When TCRs are correlated by clonal size, significant overlap was observed among clones sharing a TCR of >= 5 cells. Figure 7D These experiments demonstrate that RAPTER can reproduce major clones detectable by pooling dextramer screening, at a cost that is only a fraction of the cost of dextramer reagents.

[0340] Example 5 - Using RAPTER to identify HPV16-specific T cell responsiveness The immunosuppressive tumor microenvironment makes the detection of circulating human papillomavirus (HPV)-specific T cells challenging. To test whether RAPTER could improve the ability to detect and functionally characterize HPV16-driven tumor antigen-specific T cells in patients with cancer, the HPV16 IFNγ ELISPOT assay was compared with RAPTER. PBMCs were collected from HLA A*02:01+ patients with early-stage cervical cancer at tumor resection but prior to systemic therapy. To determine whether any HPV16 epitope-specific T cells could be detected in this sample, direct ex vivo IFNγ ELISPOT was performed using a pool of three overlapping 15-amino acid synthetic long peptides (SLPs) encoding HPV16 E6, E7, and L1 proteins (Table 2). Low positive HPV16 peptide-specific IFNγ ELISPOT signals were detected (approximately 10 SFCs / 2 × 10⁵ PBMCs), which appeared to be isolated into the E6 peptide pool ( Figure 8 A second IFNγ ELISPOT assay using 23 permutations of E6 SLP identified targets for HPV16 E6. 101-115 (KPLCDLLIRCINCQK; SEQ ID NO: 1285) A single low-reactivity signal of the peptide ( Figure 9A (Table 4). However, the responsiveness is too low (approximately 5 SFCs / 2 × 10⁻⁶). 5 One PBMC is not enough to be considered a true positive.

[0341] Table 4. To assess whether the RAPTER assay could provide a stronger signal and higher specificity resolution than HPV IFNγ ELISPOT, HPV16+ PBMC samples were tested using 15 HPV16 E6 and E7 SLPs and 5 separate 9-amino acid CEF peptides (forming a positive control peptide pool) (Table 5).

[0342] Table 5. RAPTER revealed a unique, expanded CD8+ T cell clone that responded to HPV16 E6101-115 (KPLCDLLIRCINCQK; SEQ ID NO: 1285) SLP, but no other HPV peptide-specific T cells were identified. Figure 9C In addition, CEF control peptide reactivity is mainly composed of CD8+ T cell reactivity against EBV LMP2A, EBV BMLF1, and influenza M antigen.

[0343] The phenotypic characteristics of the total CD8+ T cell population and the CD137 / 4-1BB RAPTER sorting subset were compared. scRNA-SEQ data were used to cluster the total CD8+ T cells and RAPTER+ T cells. Figure 9B RAPTER+ T cells are transcribed into clusters primarily characterized by cytotoxic (IFNG, GZMA / B) and activation-related (41BB, HLA-DR, LAG3) gene programs. Figure 9D Surprisingly, AIM+ HPV and EBV TCR clones clustered separately from each other within these transcript-based functional clusters. Figure 9E and Figure 9F Differential gene expression (DEG) analysis was performed on cells with the four most abundant reactivity types corresponding to HPV16_E6_101, EBV BMLF1, EBV LMP2A, and influenza M. Figure 9G Consistent with the immunosuppressive tumor microenvironment, HPV16_E6_101-specific T cells expressed immunosuppression-related factors, including FOXP3, KLRC1 (NKG2A), and LGALS3 (galactolectin 3), and low levels of AIMs, including CCL3, CCL4, and IFNG, compared to other virus-specific clusters. This suggests that HPV16_E6_101-specific T cells may not respond maximally to homologous ligand stimulation. These results indicate that RAPTER can detect T cell responsiveness even without maximally stimulating T cells.

[0344] Example 6 – Functional Validation of EBV and Influenza TCR Identified by RAPTER To ensure that RAPTER can reliably detect different antigen-specific populations, especially phenotypically similar T cells, and to confirm the specificity of RAPTER-identified reactive TCRs, RAPTER-identified EBV BMLF1 and influenza M TCRs were cloned for functional reactivity testing. These two reactivity types were chosen because their homologous peptides have similar characteristics (BMLF1: GLCTLVAML [SEQ ID NO: 1286]; Influenza M: GILGFVFTL [SEQ ID NO: 1287]) and their phenotypic characteristics are similar (…). Figure 9G ).use Figure 9B The RAPTER scTCR-seq pairing information was used to clone the TCR sequence (Table 6) into the Jurkat T cell reporter line. Figure 3F In addition, two “non-specific” background TCRs were cloned, which were found in multiple wells at very low frequencies in RAPTER assays.

[0345] Table 6. TCR-engineered Jurkat reporter cells were titrated and co-cultured with moDCs treated with DMSO, CEF peptide pools, HPV peptide pools (Table 7), and BMLF1 or influenza M test peptides. In the TCR validation experiments, all three influenza M TCRs showed a specific response only to the influenza M peptide. Figure 9H ; Figure 17A This includes low-abundance TCR5 detected in only three cells in the RAPTER assay. Similarly, all three BMLF1 TCRs showed a specific response to the BMLF1 peptide. Figure 9H ; Figure 17B Neither of the two nonspecific TCRs responded to peptide stimulation in any of the tests. Figure 9I ; Figure 17C These experiments provide orthogonal support demonstrating that the peptide-specific T-cell responsiveness determined using RAPTER is accurate.

[0346] Table 7. Example 7 – Overview of RAPTER assay validation for all test samples The above embodiments describe a method for separating specific T cell epitope pairs at single-cell resolution using standard hashing reagents and naturally occurring T cell activation markers. The RAPTER assay was developed to simultaneously map antigen reactivity topology and identify TCR epitope pairs using actual volumes of patient blood. Reusing universal hash tags does not alter st...

Claims

1. A T-cell receptor (TCR) or its variable domain, comprising: (i) A TCRα variable (TCR Vα) domain containing TCRα complementarity-determining regions (αCDRs) 1, αCDR2, and / or αCDR3 that are 90% identical to the amino acid sequences of αCDR1, αCDR2, and / or αCDR3 shown in Table 9; and / or (ii) A TCRβ variable (TCR Vβ) domain containing TCRβ complementarity-determining regions (βCDRs) 1, βCDR2, and / or βCDR3 that are 90% identical to the amino acid sequences of βCDR1, βCDR2, and / or βCDR3 shown in Table 9. The TCR or its variable domain specifically binds to the HLA-presenting peptide, and optionally The TCR or its variable domain has been identified using the Rapid TCR: Epitope Ordination (RAPTER) assay.

2. The TCR or its variable domain as described in claim 1, comprising: (i) αCDR3, which contains at least 95% identical amino acid sequences to the αCDR3 amino acid sequence of the TCR Vα domain shown in Table 9; and / or (ii) βCDR3, which contains at least 95% of the same amino acid sequence as the βCDR3 amino acid sequence of the TCR Vβ domain shown in Table 9.

3. The TCR or its variable domain as described in claim 1 or claim 2, comprising: (i) an αCDR1-αCDR2-αCDR3 amino acid sequence set that is at least 95% identical to the αCDR1-αCDR2-αCDR3 amino acid sequence set of the TCR Vα domain shown in Table 9; and / or (ii) The βCDR1-βCDR2-βCDR3 amino acid sequence set, which is at least 95% identical to the βCDR1-βCDR2-βCDR3 amino acid sequence set of the TCR Vβ domain shown in Table 9.

4. The TCR or its variable domain as described in any of the preceding claims, comprising: (i) A TCR Vα domain containing an amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence shown in Table 9; and / or (ii) TCR Vβ domain, which contains an amino acid sequence that is at least 95% identical to the amino acid sequence of the TCR Vβ domain shown in Table 9.

5. The TCR or its variable domain as described in any of the preceding claims, comprising: (i) αCDR3, which contains at least 95% identical amino acid sequences to the αCDR3 amino acid sequences of the TCR Vα / Vβ amino acid sequence pairs shown in Table 9; and (ii) βCDR3, which contains at least 95% identical amino acid sequences to the βCDR3 amino acid sequence of the TCR Vα / Vβ amino acid sequence pair shown in Table 9.

6. The TCR or its variable domain as described in any of the preceding claims, comprising: (i) The αCDR1-αCDR2-αCDR3 amino acid sequence set, which is at least 95% identical to the αCDR1-αCDR2-αCDR3 amino acid sequence set of the TCR Vα domain shown in Table 9; and (ii) The βCDR1-βCDR2-βCDR3 amino acid sequence set, which is at least 95% identical to the βCDR1-βCDR2-βCDR3 amino acid sequence set of the TCR Vβ domain shown in Table 9.

7. The TCR or its variable domain as described in any of the preceding claims, comprising: (i) A TCR Vα domain containing an amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence of the TCR Vα / Vβ amino acid sequence pairs shown in Table 9; and (ii) TCR Vβ domain, which contains an amino acid sequence that is at least 95% identical to the TCR Vβ domain amino acid sequence of the TCR Vα / Vβ amino acid sequence pair shown in Table 9.

8. The TCR or its variable domain as described in claim 1, comprising: (i) αCDR3, which contains the αCDR3 amino acid sequence of the TCR Vα domain shown in Table 9; and / or (ii) βCDR3, which contains the βCDR3 amino acid sequence of the TCR Vβ domain shown in Table 9.

9. The TCR or its variable domain as described in claim 8, comprising: (i) Specifically, the set of αCDR1-αCDR2-αCDR3 amino acid sequences of the TCR Vα domain shown in Table 9; and / or (ii) Specifically, the set of amino acid sequences βCDR1-βCDR2-βCDR3 of the TCR Vβ domain shown in Table 9.

10. The TCR or its variable domain as claimed in claim 8 or 9, comprising: (i) a TCR Vα domain containing the TCR Vα domain amino acid sequence shown in Table 9; and / or (ii) TCR Vβ domain, which contains the TCR Vβ domain amino acid sequence shown in Table 9.

11. The TCR or its variable domain as claimed in any one of claims 8 to 10, comprising: (i) αCDR3, which contains the αCDR3 amino acid sequence of the TCR Vα / Vβ amino acid sequence pairs shown in Table 9; and (ii) βCDR3, which contains the βCDR3 amino acid sequence of the TCR Vα / Vβ amino acid sequence pair shown in Table 9.

12. The TCR or its variable domain as claimed in any one of claims 8 to 11, comprising: (i) The set of αCDR1-αCDR2-αCDR3 amino acid sequences for the TCR Vα / Vβ amino acid sequence pairs shown in Table 9; and (ii) The set of βCDR1-βCDR2-βCDR3 amino acid sequences of the TCR Vα / Vβ amino acid sequence pairs shown in Table 9.

13. The TCR or its variable domain as claimed in any one of claims 8 to 12, comprising: (i) The TCR Vα amino acid sequence of the TCR Vα / Vβ amino acid sequence pair shown in Table 9; and (ii) The TCR Vβ amino acid sequence of the TCR Vα / Vβ amino acid sequence pair shown in Table 9.

14. The TCR or its variable domain as claimed in any one of claims 1 to 13, wherein the HLA-presenting peptide comprises the HPV16 peptide.

15. The TCR or its variable domain as described in claim 14, comprising: (i) an αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 133, 149, 165, 181, 197 and 213; and / or (ii) The βCDR3 amino acid sequence that is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 141, 157, 173, 189, 205 and 221.

16. The TCR or its variable domain as claimed in claim 14 or 15, comprising: (i) The αCDR1-αCDR2-αCDR3 amino acid sequence set that is at least 95% identical to the amino acid sequence set selected from the groups consisting of 129-131-133, 145-147-149, 161-163-165, 177-179-181, 193-195-197, and 209-211-213; and / or (ii) The amino acid sequence set βCDR1-βCDR2-βCDR3 is at least 95% identical to the amino acid sequence set selected from the group consisting of 137-139-141, 153-155-157, 169-171-173, 185-187-189, 201-203-205 and 217-219-221.

17. The TCR or its variable domain as claimed in any one of claims 14 to 16, comprising: (i) The TCR Vα domain amino acid sequence is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 135, 151, 167, 183, 199 and 215; and / or (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 143, 159, 175, 191, 207 and 223.

18. The TCR or its variable domain as claimed in any one of claims 14 to 17, comprising: (i) The αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 133, 149, 165, 181, 197 and 213; and (ii) The βCDR3 amino acid sequence that is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 141, 157, 173, 189, 205 and 221.

19. The TCR or its variable domain as claimed in any one of claims 14 to 18, comprising an αCDR3 / βCDR3 amino acid sequence pair, said amino acid sequence pair being at least 95% identical to the αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205 and 213 / 221.

20. The TCR or its variable domain as claimed in any one of claims 14 to 19, comprising an αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 133 / 141, 149 / 157, 165 / 173, 181 / 189, 197 / 205 and 213 / 221.

21. The TCR or its variable domain as claimed in any one of claims 14 to 19, comprising: (i) The amino acid sequence set αCDR1-αCDR2-αCDR3, which is at least 95% identical to the amino acid sequence set selected from the groups consisting of 129-131-133, 145-147-149, 161-163-165, 177-179-181, 193-195-197, and 209-211-213; and (ii) The amino acid sequence set βCDR1-βCDR2-βCDR3 is at least 95% identical to the amino acid sequence set selected from the group consisting of 137-139-141, 153-155-157, 169-171-173, 185-187-189, 201-203-205 and 217-219-221.

22. The TCR or its variable domain as claimed in claim 21, comprising an amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, said amino acid sequence set being at least 95% identical to the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 selected from the group consisting of SEQ ID NO: 129-131-133-137-139-141, 145-147-149-153-155-157, 161-163-165-169-171-173, 177-179-181-185-187-189, 193-195-197-201-203-205 and 209-211-213-217-219-221.

23. The TCR or its variable domain as claimed in claim 22, comprising the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 selected from the group consisting of SEQ ID NO: 129-131-133-137-139-141, 145-147-149-153-155-157, 161-163-165-169-171-173, 177-179-181-185-187-189, 193-195-197-201-203-205 and 209-211-213-217-219-221.

24. The TCR or its variable domain as claimed in any one of claims 14 to 19, comprising: (i) The TCR Vα domain amino acid sequence, which is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 135, 151, 167, 183, 199 and 215; and (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 143, 159, 175, 191, 207 and 223.

25. The TCR or its variable domain as claimed in claim 24, comprising a TCR Vα / Vβ amino acid sequence pair, said amino acid sequence pair being at least 95% identical to a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of 135 / 143, 151 / 159, 167 / 175, 183 / 191, 199 / 207 and 215 / 223.

26. The TCR or its variable domain as claimed in claim 25, comprising a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of 135 / 143, 151 / 159, 167 / 175, 183 / 191, 199 / 207 and 215 / 223.

27. The TCR or its variable domain as claimed in any one of claims 1 to 13, wherein the HLA-presenting peptide comprises the MART1 peptide.

28. The TCR or its variable domain as described in claim 27, comprising: (i) an αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125; and / or (ii) The βCDR3 amino acid sequence is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117 and 1133.

29. The TCR or its variable domain as described in claim 27 or claim 28, comprising: (i) The αCDR1-αCDR2-αCDR3 amino acid sequence, which is at least 95% identical to the amino acid sequence selected from the group consisting of 961-963-965, 977-979-981, 993-995-997, 1009-1011-1013, 1025-1027-1029, 1041-1043-1045, 1057-1059-1061, 1073-1075-1077, 1089-1091-1093, 1105-1107-1109, and 1121-1123-1125; and / or (ii) The amino acid sequence set βCDR1-βCDR2-βCDR3, which is at least 95% identical to the amino acid sequence selected from the group consisting of SEQ ID NO: 969-971-973, 985-987-989, 1001-1003-1005, 1017-1019-1021, 1033-1035-1037, 1049-1051-1053, 1065-1067-1069, 1081-1083-1085, 1097-1099-1101, 1113-1115-1117 and 1129-1131-1133.

30. The TCR or its variable domain as claimed in any one of claims 27 to 29, comprising: (i) The amino acid sequence of the TCR Vα domain is at least 95% identical to the amino acid sequence of the TCR Vα domain selected from the group consisting of SEQ ID NO: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111 and 1127; and / or (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119 and 1135.

31. The TCR or its variable domain as claimed in any one of claims 27 to 30, comprising: (i) The αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 965, 981, 997, 1013, 1029, 1045, 1061, 1077, 1093, 1109, and 1125; and (ii) The βCDR3 amino acid sequence is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 973, 989, 1005, 1021, 1037, 1053, 1069, 1085, 1101, 1117 and 1133.

32. The TCR or its variable domain as claimed in any one of claims 27 to 31, comprising an αCDR3 / βCDR3 amino acid sequence pair, said amino acid sequence pair being at least 95% identical to the αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117 and 1125 / 1133.

33. The TCR or its variable domain as claimed in any one of claims 27 to 32, comprising an αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 965 / 973, 981 / 989, 997 / 1005, 1013 / 1021, 1029 / 1037, 1045 / 1053, 1061 / 1069, 1077 / 1085, 1093 / 1101, 1109 / 1117 and 1125 / 1133.

34. The TCR or its variable domain as claimed in any one of claims 27 to 32, comprising: (i) The αCDR1-αCDR2-αCDR3 amino acid sequence, which is at least 95% identical to the amino acid sequence selected from the group consisting of 961-963-965, 977-979-981, 993-995-997, 1009-1011-1013, 1025-1027-1029, 1041-1043-1045, 1057-1059-1061, 1073-1075-1077, 1089-1091-1093, 1105-1107-1109, and 1121-1123-1125; and (ii) The amino acid sequence set βCDR1-βCDR2-βCDR3, which is at least 95% identical to the amino acid sequence selected from the group consisting of SEQ ID NO: 969-971-973, 985-987-989, 1001-1003-1005, 1017-1019-1021, 1033-1035-1037, 1049-1051-1053, 1065-1067-1069, 1081-1083-1085, 1097-1099-1101, 1113-1115-1117 and 1129-1131-1133.

35. The TCR or its variable domain as claimed in claim 34, comprising the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, wherein the amino acid sequence set is selected from SEQ ID NO: 961-963-965-969-971-973, 977-979-981-985-987-989, 993-995-997-1001-1003-1005, 1009-1011-1013-1017-1019-1021, 1025-1027-1029-1033-1035-1037, 1041-1043-1045-1049-1051-1053, 1057-1059-1061-1065-1067-1069, 1073-1075-1077-1081-1083-1085; The amino acid sequence set of the group consisting of 1089-1091-1093-1097-1099-1101, 1105-1107-1109-1113-1115-1117 and 1121-1123-1125-1129-1131-1133 is at least 95% identical to that of the group αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3.

36. The TCR or its variable domain as described in claim 35, comprising selections from SEQ ID NO: 961-963-965-969-971-973, 977-979-981-985-987-989, 993-995-997-1001-1003-1005, 1009-1011-1013-1017-1019-1021, 1025-1027-1029-1033-1035-1037, 1041-1043-1045-1049-1051-1053, 1057-1059-1061-1065-1067-1069, 1073-1075-1077-1081-1083-1085; The amino acid sequence set of αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, consisting of 1089-1091-1093-1097-1099-1101, 1105-1107-1109-1113-1115-1117, and 1121-1123-1125-1129-1131-1133.

37. The TCR or its variable domain as claimed in any one of claims 27 to 36, comprising: (i) The TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 967, 983, 999, 1015, 1031, 1047, 1063, 1079, 1095, 1111, and 1127; and (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 975, 991, 1007, 1023, 1039, 1055, 1071, 1087, 1103, 1119 and 1135.

38. The TCR or its variable domain as claimed in claim 37, comprising a TCR Vα / Vβ amino acid sequence pair, said amino acid sequence pair being at least 95% identical to a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119 and 1127 / 1135.

39. The TCR or its variable domain as claimed in claim 38, comprising a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO: 967 / 975, 983 / 991, 999 / 1007, 1015 / 1023, 1031 / 1039, 1047 / 1055, 1063 / 1071, 1079 / 1087, 1095 / 1103, 1111 / 1119 and 1127 / 1135.

40. The TCR or its variable domain as claimed in any one of claims 1 to 13, wherein the HLA-presenting peptide comprises a CMV peptide.

41. The TCR or its variable domain as described in claim 40, comprising: (i) an αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 5, 21, 37, 53, 69, 85, 101 and 117; and / or (ii) The βCDR3 amino acid sequence that is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 13, 29, 45, 61, 77, 93, 109 and 125.

42. The TCR or its variable domain as claimed in claim 40 or claim 41, comprising: (i) The amino acid sequence set αCDR1-αCDR2-αCDR3, which is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: 1-3-5, 17-19-21, 33-35-37, 49-51-53, 65-67-69, 81-83-85, 97-99-101 and 113-115-117; and / or (ii) The amino acid sequence set βCDR1-βCDR2-βCDR3, which is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: 9-11-13, 25-27-29, 41-43-45, 57-59-61, 73-75-77, 89-91-93, 105-107-109 and 121-123-125.

43. The TCR or its variable domain as claimed in any one of claims 40 to 42, comprising: (i) The TCR Vα domain amino acid sequence is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 7, 23, 39, 55, 71, 87, 103 and 119; and / or (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 15, 31, 47, 63, 79, 95, 111 and 127.

44. The TCR or its variable domain as claimed in any one of claims 40 to 43, comprising: (i) The αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 5, 21, 37, 53, 69, 85, 101, and 117; and (ii) The βCDR3 amino acid sequence that is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 13, 29, 45, 61, 77, 93, 109 and 125.

45. The TCR or its variable domain as claimed in any one of claims 40 to 44, comprising an αCDR3 / βCDR3 amino acid sequence pair, said amino acid sequence pair being at least 95% identical to the αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, and 117 / 125.

46. ​​The TCR or its variable domain as claimed in any one of claims 40 to 45, comprising an αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 5 / 13, 21 / 29, 37 / 45, 53 / 61, 69 / 77, 85 / 93, 101 / 109, and 117 / 125.

47. The TCR or its variable domain as claimed in any one of claims 40 to 46, comprising: (i) The amino acid sequence set αCDR1-αCDR2-αCDR3, which is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: 1-3-5, 17-19-21, 33-35-37, 49-51-53, 65-67-69, 81-83-85, 97-99-101 and 113-115-117; and (ii) The amino acid sequence set βCDR1-βCDR2-βCDR3, which is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: 9-11-13, 25-27-29, 41-43-45, 57-59-61, 73-75-77, 89-91-93, 105-107-109 and 121-123-125.

48. The TCR or its variable domain as claimed in claim 47, comprising the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, wherein the amino acid sequence set is selected from SEQ ID NO: The amino acid sequence set of the group consisting of 1-3-5-9-11-13, 17-19-21-25-27-29, 33-35-37-41-43-45, 49-51-53-57-59-61, 65-67-69-73-75-77, 81-83-85-89-91-93, 97-99-101-105-107-109 and 113-115-117-121-123-125 is at least 95% identical to the αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequence set.

49. The TCR or its variable domain as claimed in claim 48, comprising the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 selected from the group consisting of SEQ ID NO: 1-3-5-9-11-13, 17-19-21-25-27-29, 33-35-37-41-43-45, 49-51-53-57-59-61, 65-67-69-73-75-77, 81-83-85-89-91-93, 97-99-101-105-107-109 and 113-115-117-121-123-125.

50. The TCR or its variable domain as claimed in any one of claims 40 to 45, comprising: (i) The TCR Vα domain amino acid sequence, which is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 7, 23, 39, 55, 71, 87, 103 and 119; and (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 15, 31, 47, 63, 79, 95, 111 and 127.

51. The TCR or its variable domain as claimed in claim 50, comprising a TCR Vα / Vβ amino acid sequence pair, said amino acid sequence pair being at least 95% identical to a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, and 119 / 127.

52. The TCR or its variable domain as claimed in claim 51, comprising a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of 7 / 15, 23 / 31, 39 / 47, 55 / 63, 71 / 79, 87 / 95, 103 / 111, and 119 / 127.

53. The TCR or its variable domain as claimed in any one of claims 1 to 13, wherein the HLA-presenting peptide comprises an EBV peptide.

54. The TCR or its variable domain as described in claim 53, comprising: (i) an αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405 and 421; and / or (ii) The βCDR3 amino acid sequence is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413 and 429.

55. The TCR or its variable domain as described in claim 53 or claim 54, comprising: (i) The amino acid sequence set αCDR1-αCDR2-αCDR3, which is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: 225-227-229, 241-243-245, 257-259-261, 273-275-277, 289-291-293, 305-307-309, 321-323-325, 337-339-341, 353-355-357, 369-371-373, 385-387-389, 401-403-405, and 417-419-421; and / or (ii) The amino acid sequence set βCDR1-βCDR2-βCDR3, which is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: 233-235-237, 249-251-253, 265-267-269, 281-283-285, 297-299-301, 313-315-317, 329-331-333, 345-347-349, 361-363-365, 377-379-381, 393-395-397, 409-411-413, and 425-427-429.

56. The TCR or its variable domain as claimed in any one of claims 53 to 55, comprising: (i) The TCR Vα domain amino acid sequence is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407 and 423; and / or (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415 and 431.

57. The TCR or its variable domain as claimed in any one of claims 53 to 56, comprising: (i) The αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 229, 245, 261, 277, 293, 309, 325, 341, 357, 373, 389, 405, and 421; and (ii) The βCDR3 amino acid sequence is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 237, 253, 269, 285, 301, 317, 333, 349, 365, 381, 397, 413 and 429.

58. The TCR or its variable domain as claimed in any one of claims 53 to 57, comprising an αCDR3 / βCDR3 amino acid sequence pair, said amino acid sequence pair being at least 95% identical to the αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413 and 421 / 429.

59. The TCR or its variable domain as claimed in any one of claims 53 to 58, comprising an αCDR3 / βCDR3 amino acid sequence pair selected from the group consisting of SEQ ID NO: 229 / 237, 245 / 253, 261 / 269, 277 / 285, 293 / 301, 309 / 317, 325 / 333, 341 / 349, 357 / 365, 373 / 381, 389 / 397, 405 / 413 and 421 / 429.

60. The TCR or its variable domain as claimed in any one of claims 53 to 59, comprising: (i) The amino acid sequence set αCDR1-αCDR2-αCDR3, which is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: 225-227-229, 241-243-245, 257-259-261, 273-275-277, 289-291-293, 305-307-309, 321-323-325, 337-339-341, 353-355-357, 369-371-373, 385-387-389, 401-403-405, and 417-419-421; and (ii) The amino acid sequence set βCDR1-βCDR2-βCDR3, which is at least 95% identical to the amino acid sequence set selected from the group consisting of SEQ ID NO: 233-235-237, 249-251-253, 265-267-269, 281-283-285, 297-299-301, 313-315-317, 329-331-333, 345-347-349, 361-363-365, 377-379-381, 393-395-397, 409-411-413 and 425-427-429.

61. The TCR or its variable domain as claimed in claim 60, comprising the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, wherein the amino acid sequence set is selected from SEQ ID NO: 225-227-229-233-235-237, 241-243-245-249-251-253, 257-259-261-265-267-269, 273-275-277-281-283-285, 289-291-293-297-299-301, 305-307-309-313-315-317, 321-323-325-329-331-333, 337-339-341-34 The amino acid sequence set of the group consisting of 5-347-349, 353-355-357-361-363-365, 369-371-373-377-379-381, 385-387-389-393-395-397, 401-403-405-409-411-413 and 417-419-421-425-427-429 is at least 95% identical to the αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequence set.

62. The TCR or its variable domain as claimed in claim 61, comprising selections from SEQ ID NO: 225-227-229-233-235-237, 241-243-245-249-251-253, 257-259-261-265-267-269, 273-275-277-281-283-285, 289-291-293-297-299-301, 305-307-309-313-315-317, 321-323-325-329-331-333, 337-339-341. The amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, consisting of -345-347-349, 353-355-357-361-363-365, 369-371-373-377-379-381, 385-387-389-393-395-397, 401-403-405-409-411-413, and 417-419-421-425-427-429.

63. The TCR or its variable domain as claimed in any one of claims 53 to 58, comprising: (i) The TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 231, 247, 263, 279, 295, 311, 327, 343, 359, 375, 391, 407 and 423; and (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 239, 255, 271, 287, 303, 319, 335, 351, 367, 383, 399, 415 and 431.

64. The TCR or its variable domain as claimed in claim 63, comprising a TCR Vα / Vβ amino acid sequence pair, said amino acid sequence pair being at least 95% identical to a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415, and 423 / 431.

65. The TCR or its variable domain as claimed in claim 64, comprising a TCR Vα / Vβ amino acid sequence pair selected from the group consisting of SEQ ID NO: 231 / 239, 247 / 255, 263 / 271, 279 / 287, 295 / 303, 311 / 319, 327 / 335, 343 / 351, 359 / 367, 375 / 383, 391 / 399, 407 / 415 and 423 / 431.

66. The TCR or its variable domain as claimed in any one of claims 1 to 13, wherein the HLA-presenting peptide comprises influenza peptide.

67. The TCR or its variable domain as described in claim 66, comprising: (i) an αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949; and / or (ii) The βCDR3 amino acid sequence that is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941 and 957.

68. The TCR or its variable domain as described in claim 66 or claim 67, comprising: (i) The amino acid sequence set αCDR1-αCDR2-αCDR3, selected from SEQ ID NO: 433-435-437, 449-451-453, 465-467-469, 481-483-485, 497-499-501, 513-515-517, 529-531-533, 545-547-549, 561-563-565, 577-579-581, 593-595-597, 609-611-613, 625-627-629, 641-643-645, 657-659-661, 673-675-677, 689-691-693, 705- The amino acid sequence sets of the groups consisting of 707-709, 721-723-725, 737-739-741, 753-755-757, 769-771-773, 785-787-789, 801-803-805, 817-819-821, 833-835-837, 849-851-853, 865-867-869, 881-883-885, 897-899-901, 913-915-917, 929-931-933, and 945-947-949 are at least 95% identical; and / or (ii) The set of amino acid sequences βCDR1-βCDR2-βCDR3, selected from SEQ ID NO: 441-443-445, 457-459-461, 473-475-477, 489-491-493, 505-507-509, 521-523-525, 537-539-541, 553-555-557, 569-571-573, 585-587-589, 601-603-605, 617-619-621, 633-635-637, 649-651-653, 665-667-669, 681-683-685, 697-699-701, 713 The amino acid sequence set of the group consisting of -715-717, 729-731-733, 745-747-749, 761-763-765, 777-779-781, 793-795-797, 809-811-813, 825-827-829, 841-843-845, 857-859-861, 873-875-877, 889-891-893, 905-907-909, 921-923-925, 937-939-941, and 953-955-957 is at least 95% identical.

69. The TCR or its variable domain as claimed in any one of claims 66 to 68, comprising: (i) The amino acid sequence of the TCR Vα domain, which is at least 95% identical to the amino acid sequence of the TCR Vα domain selected from the group consisting of SEQ ID NO: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935 and 951; and / or (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943 and 959.

70. The TCR or its variable domain as claimed in any one of claims 66 to 69, comprising: (i) The αCDR3 amino acid sequence that is at least 95% identical to the αCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 437, 453, 469, 485, 501, 517, 533, 549, 565, 581, 597, 613, 629, 645, 661, 677, 693, 709, 725, 741, 757, 773, 789, 805, 821, 837, 853, 869, 885, 901, 917, 933, and 949; and (ii) The βCDR3 amino acid sequence that is at least 95% identical to the βCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 445, 461, 477, 493, 509, 525, 541, 557, 573, 589, 605, 621, 637, 653, 669, 685, 701, 717, 733, 749, 765, 781, 797, 813, 829, 845, 861, 877, 893, 909, 925, 941 and 957.

71. The TCR or its variable domain as described in any one of claims 66 to 70, comprising an αCDR3 / βCDR3 amino acid sequence pair, said amino acid sequence pair being selected from SEQ ID NO: 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 717, 72 The αCDR3 / βCDR3 amino acid sequence pairs of the group consisting of 5 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941 and 949 / 957 are at least 95% identical.

72. The TCR or its variable domain as described in any one of claims 66 to 71, comprising selections from SEQ ID NO: 437 / 445, 453 / 461, 469 / 477, 485 / 493, 501 / 509, 517 / 525, 533 / 541, 549 / 557, 565 / 573, 581 / 589, 597 / 605, 613 / 621, 629 / 637, 645 / 653, 661 / 669, 677 / 685, 693 / 701, 709 / 7 The αCDR3 / βCDR3 amino acid sequence pairs formed by the groups 17, 725 / 733, 741 / 749, 757 / 765, 773 / 781, 789 / 797, 805 / 813, 821 / 829, 837 / 845, 853 / 861, 869 / 877, 885 / 893, 901 / 909, 917 / 925, 933 / 941, and 949 / 957.

73. The TCR or its variable domain as claimed in any one of claims 66 to 71, comprising: (i) The set of amino acid sequences αCDR1-αCDR2-αCDR3, selected from SEQ ID NO: 433-435-437, 449-451-453, 465-467-469, 481-483-485, 497-499-501, 513-515-517, 529-531-533, 545-547-549, 561-563-565, 577-579-581, 593-595-597, 609-611-613, 625-627-629, 641-643-645, 657-659-661, 673-675-677, 689-691-693, 705 The amino acid sequence sets of the groups -707-709, 721-723-725, 737-739-741, 753-755-757, 769-771-773, 785-787-789, 801-803-805, 817-819-821, 833-835-837, 849-851-853, 865-867-869, 881-883-885, 897-899-901, 913-915-917, 929-931-933, and 945-947-949 are at least 95% identical; and (ii) The set of amino acid sequences βCDR1-βCDR2-βCDR3, selected from SEQ ID NO: 441-443-445, 457-459-461, 473-475-477, 489-491-493, 505-507-509, 521-523-525, 537-539-541, 553-555-557, 569-571-573, 585-587-589, 601-603-605, 617-619-621, 633-635-637, 649-651-653, 665-667-669, 681-683-685, 697-699-701, 713 The amino acid sequence set of the group consisting of -715-717, 729-731-733, 745-747-749, 761-763-765, 777-779-781, 793-795-797, 809-811-813, 825-827-829, 841-843-845, 857-859-861, 873-875-877, 889-891-893, 905-907-909, 921-923-925, 937-939-941, and 953-955-957 is at least 95% identical.

74. The TCR or its variable domain as claimed in claim 73, comprising the amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3, said amino acid sequence set being selected from SEQ ID NO: 433-435-437-441-443-445, 449-451-453-457-459-461, 465-467-469-473-475-477, 481-483-485-489-491-493, 497-499-501-505-507-509, 513-515-517-521-523-525, 529-531-533-537-539-541, 545-547-549-553-555-557, 561-563-565-569-571 -573, 577-579-581-585-587-589, 593-595-597-601-603-605, 609-611-613-617-619-621, 625-627-629-633-635-637, 641-643-645-649-651-653, 657-659-661-665-667-669, 673-675-677-681-683-685, 689-691-693-697-699-701, 705-707-709-71 3-715-717, 721-723-725-729-731-733, 737-739-741-745-747-749, 753-755-757-761-763-765, 769-771-773-777-779-781, 785-787-789-793-795-797, 801-803-805-809-811-813, 817-819-821-825-827-829, 833-835-837-841-843-845, 849-851-8 The amino acid sequence set of the group consisting of 53-857-859-861, 865-867-869-873-875-877, 881-883-885-889-891-893, 897-899-901-905-907-909, 913-915-917-921-923-925, 929-931-933-937-939-941 and 945-947-949-953-955-957 is at least 95% identical to the αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 amino acid sequence set.

75. The TCR or its variable domain as claimed in claim 74, comprising selections from SEQ ID NO: 433-435-437-441-443-445, 449-451-453-457-459-461, 465-467-469-473-475-477, 481-483-485-489-491-493, 497-499-501-505-507-509, 513-515-517-521-523-525, 529-531-533-537-539-541, 545-547-549-553-555-557, 561-563-565-569-5 71-573, 577-579-581-585-587-589, 593-595-597-601-603-605, 609-611-613-617-619-621, 625-627-629-633-635-637, 641-643-645-649-651-653, 657-659-661-665-667-669, 673-675-677-681-683-685, 689-691-693-697-699-701, 705-707-709 -713-715-717, 721-723-725-729-731-733, 737-739-741-745-747-749, 753-755-757-761-763-765, 769-771-773-777-779-781, 785-787-789-793-795-797, 801-803-805-809-811-813, 817-819-821-825-827-829, 833-835-837-841-843-845, 849- The amino acid sequence set αCDR1-αCDR2-αCDR3-βCDR1-βCDR2-βCDR3 of the group consisting of 851-853-857-859-861, 865-867-869-873-875-877, 881-883-885-889-891-893, 897-899-901-905-907-909, 913-915-917-921-923-925, 929-931-933-937-939-941 and 945-947-949-953-955-957.

76. The TCR or its variable domain as claimed in any one of claims 66 to 71, comprising: (i) The TCR Vα domain amino acid sequence that is at least 95% identical to the TCR Vα domain amino acid sequence selected from the group consisting of SEQ ID NO: 439, 455, 471, 487, 503, 519, 535, 551, 567, 583, 599, 615, 631, 647, 663, 679, 695, 711, 727, 743, 759, 775, 791, 807, 823, 839, 855, 871, 887, 903, 919, 935, and 951; and (ii) The amino acid sequence of the TCR Vβ domain is at least 95% identical to the amino acid sequence of the TCR Vβ domain selected from the group consisting of SEQ ID NO: 447, 463, 479, 495, 511, 527, 543, 559, 575, 591, 607, 623, 639, 655, 671, 687, 703, 719, 735, 751, 767, 783, 799, 815, 831, 847, 863, 879, 895, 911, 927, 943 and 959.

77. The TCR or its variable domain as claimed in claim 76, comprising the TCR Vα / Vβ amino acid sequence pair, said amino acid sequence pair being selected from SEQ ID NO: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703 The TCR Vα / Vβ amino acid sequence pairs of the groups consisting of 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943 and 951 / 959 are at least 95% identical.

78. The TCR or its variable domain as claimed in claim 77, comprising selections from SEQ ID NO: 439 / 447, 455 / 463, 471 / 479, 487 / 495, 503 / 511, 519 / 527, 535 / 543, 551 / 559, 567 / 575, 583 / 591, 599 / 607, 615 / 623, 631 / 639, 647 / 655, 663 / 671, 679 / 687, 695 / 703 The TCR Vα / Vβ amino acid sequence pairs consisting of 711 / 719, 727 / 735, 743 / 751, 759 / 767, 775 / 783, 791 / 799, 807 / 815, 823 / 831, 839 / 847, 855 / 863, 871 / 879, 887 / 895, 903 / 911, 919 / 927, 935 / 943, and 951 / 959.

79. A nucleic acid molecule comprising a sequence encoding a TCR or a variable domain thereof as described in any one of claims 1 to 78.

80. A complex comprising: (a) The TCR or its variable domain as claimed in any one of claims 1 to 78; and (b) Select the portion consisting of the free ligand, the detectable portion, and the therapeutic portion.

81. A cell comprising a TCR or a variable domain thereof as claimed in any one of claims 1 to 78, wherein the cell is optionally a T cell.

82. A host cell comprising nucleic acid, said nucleic acid comprising a sequence encoding a TCR or a variable domain thereof as described in any one of claims 1 to 78.

83. A pharmaceutical composition comprising: (a) The TCR or its variable domain as described in any one of claims 1 to 78, the nucleic acid molecule as described in claim 79, the complex as described in claim 80, the cell as described in claim 81, or the host cell as described in claim 82; and (b) Pharmaceutically acceptable excipients.

84. The TCR or its variable domain as described in any one of claims 1 to 78, the nucleic acid molecule as described in claim 79, the complex as described in claim 80, the cell as described in claim 81, the host cell as described in claim 82, or the pharmaceutical composition as described in claim 83, for the treatment of HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions.

85. Use of a TCR or its variable domain as described in any one of claims 1 to 78, a nucleic acid molecule as described in claim 79, a complex as described in claim 80, a cell as described in claim 81, a host cell as described in claim 82, or a pharmaceutical composition as described in claim 83, for the manufacture of a medicament for the treatment of HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions.

86. A method of treating HPV16, MART1, CMV, EBV, or influenza-related diseases or conditions, comprising administering to a subject in need a TCR or its variable domain as described in any one of claims 1 to 78, a nucleic acid molecule as described in claim 79, a complex as described in claim 80, a cell as described in claim 81, a host cell as described in claim 82, or a pharmaceutical composition as described in claim 83.

87. The use or method according to any one of claims 84 to 86, wherein the HLA-presenting peptide is derived from a polypeptide selected from the group consisting of: CMV pp65, HPV16 E6-p1, HPV16 E6-p2, EBV BMLF1, EBV LMP2A, EBVYVL, influenza M1, influenza M2, and MART1.

88. A TCR or a variable domain thereof; a nucleic acid comprising a sequence encoding the TCR or a variable domain thereof; a complex comprising the TCR or a variable domain thereof and one or more portions, such as a ligand, a detectable portion or a therapeutic portion; a cell presenting the TCR or a variable domain thereof; a host cell comprising a nucleic acid encoding the TCR or a variable domain thereof; and / or a pharmaceutical composition comprising the above substances, as shown and described herein.

Images