Combinations and methods for MED26-mediated erythropoiesis modulation

Abstract

Methods and materials for promoting erythroid differentiation are provided. Also provided are methods of increasing the RNA polymerase II pause mediated by the MED26 polypeptide. Methods of delivering agents to cells are also provided.

Description

Cross-references to related applications

[0001] This application claims priority to International Application No. PCT / CN2023 / 100427, filed on June 15, 2023, the entire disclosure of which is incorporated herein by reference.

[0002] Invention Field This application relates to the field of transcription gene regulation. Background Technology

[0003] During homeostasis, approximately 2-3 million erythrocytes are produced per second in the bone marrow (4). Early erythroid progenitors burst forth to form unit erythroid (BFU-E) cells, which can differentiate into late progenitors and colony to form unit erythroid (CFU-E) cells. CFU-E cells differentiate into mature erythrocytes through 3-5 cell divisions; this process is called terminal erythropoiesis (6). During terminal erythropoiesis, erythroblasts undergo dramatic changes, including nuclear pyknosis, widespread transcriptional repression, large-scale hemoglobin biosynthesis, enucleation, and organelle clearance (7, 8). Erythroid differentiation defects have been observed in myelodysplastic syndromes and megaloblastic anemia (9). Terminal erythropoiesis was associated with decreased levels of several histone tags involved in transcriptional elongation, including H3K36me2, H3K36me3, and H3K79me2 (1, 10), while simultaneously accompanied by an increase in H4K20me, a modification associated with RNA polymerase II (Pol II) pausing and erythroblast chromatin aggregation (11, 12). However, this process did not increase the levels of the repressive histone tags H3K27me3 and H3K9me3, which are associated with heterochromatin formation. The positive transcriptional elongation factor (P-TEFb), which contains the catalytic subunit cyclin-dependent kinase 9 (CDK9), synergistically promotes transcriptional elongation with the erythroid master transcription factor GATA1 (13). Hexim1, a regulator that promotes Pol II pausing, was highly expressed during terminal erythropoiesis and was associated with accelerated differentiation of HUDEP-2 erythroid cells treated with hexamethylene diacetamide (HMBA) (14). In summary, these findings suggest that transcriptional pausing and elongation play a regulatory role in erythropoiesis.

[0004] Phase separation, which mediates the formation of membraneless compartmentalized tissues, or biomolecular condensates, has become an emerging model for elucidating various cellular events, including transcriptional regulation (15-17). Phase separation is involved in transcription initiation and elongation via Pol II CTD phosphorylation (18). Previous studies have proposed the existence of promoter condensates and gene body condensates at different stages of transcription (3,19). Although several phase-separating proteins, including BRD4, MED1, and Pol II CTD, have been identified in transcription condensates (20-22), it remains unclear whether the dynamic combination of these condensates can contribute to driving developmental processes.

[0005] The mediator complex, also known as the TRAP / SMCC, CRSP, PC2, or ARC complex, is a large multi-subunit complex composed of a head, middle, tail, and CDK8 kinase module, conserved from yeast to metazoans (23, 24). The mediator complex forms a functional bridge between gene promoters and enhancers, linking tissue-specific transcription factors (TFs) with universal transcription factors (GTFs) and Pol II, thus serving as an integrative center for pre-initiation complex assembly, transcriptional elongation, and termination (23, 25). Several mediator subunits, through synergy with tissue-specific TFs, play important roles in different developmental processes (26). In erythropoiesis, MED1 is a cofactor of GATA1; MED1 knockout mice die from severe anemia on embryonic day 11.5 (E11.5) (27, 28). Previous studies on the regulation of developmental processes by mediators have focused on the functions of individual subunits and their synergistic effects with TFs; however, it remains unclear whether each mediator subunit has a differentiated function in different developmental stages, thereby contributing to the formation of context-dependent transcription processes (29).

[0006] Based on previous biochemical studies, MED26 is a unique subunit, typically found only in the CDK8 kinase module, and is therefore generally considered a transcriptional activator (30). MED26 interacts directly with the ultraelongation complex (SEC) and the small elongation complex (LEC) containing P-TEFb through its N-terminal domain (NTD) (31-33). MED26 also functions as a molecular switch from the initiation state to the elongation state through its interaction with GTF TFIID (32). However, further research is needed to determine the potential molecular mechanisms between MED26 and various stages of transcription, and its association with developmental processes. Invention Overview The provided method is a way to promote erythroid differentiation, comprising administering to erythroid precursor cells a substance that increases the suspension of RNA polymerase II mediated by the intermediate complex subunit (MED26) polypeptide in the cells.

[0008] In some embodiments, the substance increases the interaction between MED26 and transcriptional pausing factors in the cell, such as negative elongation factor (NELF), DRB sensitivity inducible factor (DSIF), or factors in the polymerase-associated factor (PAF) complex, particularly PAF1.

[0009] In some embodiments, the substance increases the occupancy of MED26 at super-enhancer sites, such as super-enhancers selected from CDK6, BCL2, HMGA1, MYB, RPS14, RPL36AL, and RPL27.

[0010] In some embodiments, the substance comprises a MED26 polypeptide or an active fragment thereof, or a nucleic acid encoding the active fragment.

[0011] In some embodiments, the active fragment comprises an inherent disordered region (IDR) of the MED26 polypeptide, and more specifically, the active fragment comprises a polypeptide having at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 17.

[0012] In some embodiments, the active fragment comprises the TFIIS domain and intrinsically disordered region (IDR) of the MED26 polypeptide. More specifically, the active fragment comprises a polypeptide having at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 2.

[0013] In some embodiments, the substance comprises a MED26 polypeptide or a nucleic acid encoding the MED26 polypeptide; more specifically, the MED26 polypeptide comprises a polypeptide having at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 1.

[0014] A method for promoting erythroid differentiation is also provided, comprising administering to an erythroid precursor a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 17 or a polynucleotide encoding the polypeptide.

[0015] In some embodiments, the polypeptide comprises the amino acid sequence shown in SEQ ID NO: 2.

[0016] In some embodiments, the polypeptide comprises the amino acid sequence shown in SEQ ID NO: 1.

[0017] In some implementations, the erythroid precursor is a hematopoietic stem and progenitor cell (HSPC), such as a CD34+ HSPC.

[0018] In some implementations, the erythroid precursor is erythroblasts, such as erythroblasts derived from CD34+ HSPCs.

[0019] In some embodiments, the substance is applied in vitro to the erythroid precursor.

[0020] In some implementations, the substance is administered in vivo to a subject in need of erythroid precursors.

[0021] In some implementations, the subject needs to be treated for a disease associated with erythroid differentiation defects.

[0022] In some implementations, the disease associated with erythroid differentiation defects is a myelodysplastic syndrome, such as refractory anemia or refractory cytopenia, erythroid dysplasia, bone marrow failure, or megaloblastic anemia.

[0023] A method for identifying substances that promote erythroid differentiation is also provided, including: a. Provide a composition comprising the MED26 peptide or an active fragment thereof; b. Contact the composition with the test substance; and c. Assess whether the test substance enhances the ability of MED26 to mediate RNA polymerase II pausing.

[0024] In some implementations, the evaluation step includes assessing the ability of the test substance to promote the formation of MED26 aggregates, interact with transcriptional pausing factors, and / or occupy super-enhancer sites.

[0025] A composition comprising a substance that increases the pausing of RNA polymerase II mediated by the MED26 polypeptide is also provided.

[0026] Also provided is a substance that increases the pausing of RNA polymerase II mediated by the MED26 polypeptide, used in a method for promoting erythroid differentiation in erythroid precursor cells.

[0027] A method for delivering a reagent to cells is also provided, comprising: (a) preparing an aggregate comprising a MED26 polypeptide or an active fragment thereof and the reagent; and (b) contacting the cells with the aggregate, thereby delivering the reagent to the cells by the MED26 polypeptide or the active fragment thereof.

[0028] In some embodiments, the reagent is a nucleic acid, such as one or more RNA or DNA molecules.

[0029] In some embodiments, the MED26 polypeptide or its active fragment comprises an amino acid sequence having at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 16. In some embodiments, the MED26 polypeptide or its active fragment comprises an amino acid sequence that is at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 97%, 98%, 99%, or 100% sequence identical to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 15. In some embodiments, the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16. In some embodiments, the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO: 2.

[0030] In some embodiments, the nucleic acid encodes one or more components for gene editing. In some embodiments, the gene editing comprises CRISPR gene editing, and the nucleic acid encodes one or more of CRISPR RNA (crRNA), tracrRNA hybridized with the crRNA, and Cas endonucleases (e.g., Cas9, Cas12, Cas13). Preferably, the nucleic acid encodes a single guide RNA comprising the crRNA and the tracrRNA and / or the Cas endonuclease. More preferably, the nucleic acid encodes a single guide RNA and a Cas9 endonuclease.

[0031] In some implementations, the nucleic acid is a DNA molecule, such as plasmid DNA.

[0032] In some implementations, the nucleic acid is RNA, such as mRNA.

[0033] In some embodiments, the reagent is a DNA molecule, such as circular DNA (e.g., plasmid DNA) or linear DNA.

[0034] In some embodiments, the reagent is RNA, such as mRNA, siRNA, antisense RNA, linear RNA, circular RNA, or tRNA.

[0035] In some embodiments, the step of preparing the aggregate includes mixing the reagent with the MED26 peptide or an active fragment thereof in an aqueous buffer.

[0036] In some embodiments, the buffer solution also contains polyethylene glycol (PEG).

[0037] According to the method of claim 34, the buffer solution contains 1–30% (w / v) PEG, such as 2–20% (w / v) PEG, e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14% or 15% (w / v) PEG, preferably 10% (w / v) PEG.

[0038] In some embodiments, the step of preparing the agglomerate includes mixing the reagent with 1–200 μM, preferably 5–150 μM, such as 5, 10, 25, 50, 75, 100, 125 or 150 μM, more preferably 10 μM of the MED26 peptide or its active fragment. Attached Figure Description

[0039] The advantages of the foregoing and other objects, aspects, features and exemplary embodiments will become more apparent and easier to understand by referring to the following description in conjunction with the accompanying drawings.

[0040] Figure 1A -F indicates that the transcriptional condensate switches to a MED26-rich form during erythroid differentiation. Figure 1A Western blot analysis shows the relative abundance of several mediator subunits in a human CD34+ erythroid culture system over time (days 0-20), using β-actin as a loading control. Figure 1B Western blot analysis of the relative abundance of BRD4 and Rpb1 in a human CD34+ erythroid culture system over time (days 0–20), using β-actin as a loading control. Figure 1C The upper part shows a schematic diagram of the OptoDroplet experiment, and the lower part shows time-delayed images of different mediator subunits analyzed by the OptoDroplet experiment. The left side indicates the subunits, and the right side indicates the subcellular localization. Figure 1D Representative images of EGFP-MED26 aggregates FRAP assays in K562 cells. Normalized fluorescence intensities of EGFP-MED26 are expressed as mean ± standard deviation (n = 27, independent observations in 27 dispersed aggregates). Figure 1E Droplet formation experiments were performed on MED26 and MED1 IDR proteins under PEG-free low-salt buffer conditions. Figure 1F The droplet formation experiment shows the addition of 1,6-hexanediol (1,6-Hex) to test its disruptive effect on liquid sample aggregates. Figure 1G The droplet formation experiments were conducted with different NaCl concentrations and 25 mM Tris-HCl (pH 7.4).

[0041] Figure 2A-2I The results show that MED26 is crucial for erythropoiesis under normal conditions and under PHZ-induced stress. Figure 2A The image shows a Western blot demonstrating the efficiency of MED26 knockout in mouse spleen cells, with GAPDH as the loading control. Figure 2B Images of the overall appearance, femur, and spleen of control and kko mice after MED26 knockout induced by pIpC injection are shown. Figure 2C Prussian blue staining of iron in the spleens of control and kko mice is shown. Figure 2D The graph shows the mean erythrocyte volume (MCV) and mean erythrocyte hemoglobin (MCH) in control and MED26 knockout mice 3 days after pIpC injection-induced knockout. Figure 2E Giemsa staining of peripheral blood smears from control and KCO mice is shown. The arrow points to reticulocytes. Figure 2F This shows a FACS analysis of mouse femoral bone marrow cell differentiation status using two erythroid markers (CD71 and Ter119). Figure 2GThis shows the levels of hemoglobin (HGB), red blood cells (RBC), and hematocrit (HCT) in control and conditional MED26 knockout (cKO) mice that were injected with PHZ (60 mg / kg) on ​​day 0 and pretreated with 5 μg / g pIpC the day before. Figure 2H Lin was shown in the bone marrow of control and kko mice. - Representative flow cytometry images of LSK, LT-HSC, ST-HSC, MPP, CMP, GMP, and MEP cells, n=3. Figure 2I The presence of Lin in the bone marrow of control and kko mice was shown. - The percentages of LSK, LT-HSC, ST-HSC, MPP, CMP, GMP, and MEP cells. p-values ​​were calculated using an unpaired two-tailed Student's t-test (C, F, H). Significant differences obtained through the Student's t-test are marked with an asterisk. P<0.05, P<0.01, P<0.001, P < 0.0001, ns, no significant difference.

[0042] Figures 3A-3D This indicates that MED26 is essential for the normal process of erythropoiesis. Figure 3A This image shows representative colony images of human CD34+ cells transduced with control shRNA or shRNA targeting MED26, as part of a colony formation assay. Figure 3B This shows the relative expression level of the MED26 gene in human CD34+ cells transduced with either control shRNA or shRNA targeting MED26. Figure 3C and Figure 3D This image shows the quantitative results of CFU-GM and CFU-GEMM colony sizes after MED26 knockdown in human CD34+ cells. Abbreviations: CFU-GEMM, colony-forming units—granulocytes, erythrocytes, monocytes, megakaryocytes; CFU-GM, colony-forming units—granulocytes, macrophages. p-values ​​were calculated using an unpaired two-tailed Student's t-test (D). Significant differences obtained through the Student's t-test are marked with an asterisk. P<0.05, P<0.01, P<0.001, P < 0.0001, ns, no significant difference.

[0043] Figure 4A –F indicates that the phase separation ability of MED26 is related to erythroid development. Figure 4A Western blot demonstrating MED26 overexpression efficiency in an in vitro human CD34+ erythroid differentiation system on day 8, using GAPDH as a loading control. Figure 4B This shows the FACS analysis of two erythroid biomarkers (CD71 and CD235a) after MED26 overexpression. Figure 4C The results showed that on days 10 and 12, CD34 was observed after MED26 overexpression. + Image of cell deposits. Dashed circles indicate the location of the cell deposits. Figure 4D This diagram shows the TFIIS domain, intrinsic disorder region (IDR), and truncated intermediate complex interaction domains of MED26. The right side summarizes the results of in vivo aggregate formation. Figure 4E The image shows a representative time-delayed image of the MED26 truncated body in the OptoDroplet experiment. Figure 4F Fluorescence images of the in vitro phase separation experiment of the MED26 truncated variant fused with EGFP shown are displayed. Figure 4G The results show the FACS analysis of the detection of erythroid biomarkers (CD71, CD235a) by overexpressing full-length or truncated MED26 in an in vitro human CD34+ erythroid culture system.

[0044] Figure 5A -F indicates that RNA polymerase II exhibits transcriptional pausing function at the MED26 enrichment site. Figure 5A The heatmap of the CUT&Tag experiment shows the number and distribution of common peaks of MED1, MED26, GATA1 and GATA2, the unique peak of MED1, and the unique peak of MED26 in the primary human CD34+ derived red culture system on day 4. Figure 5B This shows the ratio of MED26 to MED1 signal at all transcription start sites (TSS) occupied by MED1 and / or MED26 in primary human erythroblast CUT&Tag experiments on day 4. Each point represents one gene. Figure 5C This diagram illustrates the mediator sites defined as MED26-enriched or MED26-deficient. Figure 5D A heatmap showing RNA Pol II and PRO-seq signals for MED26-enriched or deficient genes, from -3 kb at the TSS to +3 kb at the transcription termination site (TES). Figure 5E IGV visualizations showing examples of MED26 enrichment (top) and MED26 deficiency sites (bottom). The gray shaded areas represent the occupancy of MED26 around the TSS. NC represents the signal in the negative control sample. RPB1 is the largest component of RNA Pol II. Figure 5F Box plots comparing pausing indices at MED26 enriched or deficient sites are displayed. Pausing indices were calculated from Rpb1 CUT&Tag or PRO-seq. p-values ​​were calculated using a two-sided Wilcoxon rank-sum test.

[0045] Figure 6A –I shows that MED26 enrichment is necessary for transcriptional cessation to promote erythropoiesis. Figure 6A A heatmap showing the relative interaction strengths of the proteins in HEK293 cells using MED1 or MED26 as decoys. The relative interaction strengths were calculated using NSAF based on mass spectrometry data. Figure 6B The results of immunoprecipitation in HEK293 cells transfected with 3XFlag-MED1, 3XFlag-MED26, or 3XFlag-EV (control plasmid) are shown. After immunopurification with Flag antibodies, Western blot analysis was performed on the complexes using antibodies targeting the pause complex (NELF-A, NELF-D, PAF1, and LEO1), the mediator CDK8 kinase module (CCNC1), and the extension complex (CDK9 and CCNT1) components. Figure 6C The recombinant proteins mCherry and mCherry-PAF1-400-531 (amino acids 400–531, the putative IDR of PAF1) were purified using a prokaryotic expression system and detected by Coomassie Brilliant Blue staining. Figure 6D The in vitro phase separation experiment of EGFP fusions MED26 1-480 and mCherry-PAF1-400-531 was shown in a buffer containing 5% PEG-8000. Figure 6E This image shows a representative image of MED26 knockout K562 cells transfected with MED26 truncated EGFP and PAF1-mCherry. The white dashed circle indicates the nucleus region. Figure 6F Displaying CD34 + Box plots comparing the signal ratios of MED26 to MED1 on days 4 and 16 of the red culture. (p-values ​​were calculated using a paired Wilcox test). Figure 6G Displaying CD34 + Box plot comparing the pausing index on day 4 and day 16 of the source red strain culture. (p-values ​​were calculated using a paired Wilcox test). Figure 6H IGV views showing the CUT & Tag signals of PRO-seq, MED1, and MED26 at RPS9 (non-erythroid) and HBB (erythroid) loci. Figure 6I FACS analysis of erythroid markers CD71 and CD235a in primary human erythroblasts treated with DRB (5,6-dichloro-1-β-D-furanibosylbenzimidazole).

[0046] Figure 7 Electron microscopy images showing RAW264.7 cells taking up MED26-mRNA coacervate.

[0047] Figure 8FACS analysis of Jurkat cells transfected with MED26 coagulation formulations loaded with EGFP mRNA (Cy5-labeled) at different PEG concentrations.

[0048] Figure 9A Fluorescence micrographs of 293T and Jurkat cells transfected with MED26-EGFP mRNA co-aggregate. Scale bar, 50 μm. Figure 9B The results show the quantitative results of mRNA expression in 293T and Jurkat cells 24 hours after transfection with MED26 co-aggregate or Lipofectamine MessengerMAX.

[0049] Figure 10A A schematic diagram showing the truncated MED26 body. Figure 10B The results show the quantitative results of mRNA expression in Jurkat cells 24 hours after transfection with a coagulate formed from truncated MED26 protein. Figure 10C This shows the quantitative results of mRNA expression in Jurkat cells 24 hours after transfection with coagulation formulations containing different concentrations of MED26 (135-480). Figure 10D This shows the quantitative results of mRNA expression in Jurkat cells 24 hours after transfection with coagulation formulations containing different higher concentrations of MED26 (135-480).

[0050] Figure 11 FACS analysis of Jurkat cells after treatment with a coagulate containing two mRNAs (EGFP mRNA and tdTomato mRNA) for 24 hours.

[0051] Figure 12A This image shows representative confocal laser scanning microscopy images of early endosomes, co-aggregates (Cy5-labeled mRNA), and nuclei (Hoechst 33342) in 293T cells one hour after transfection with MED26 coagulate. Scale bar, 5 μm. Figure 12B This image shows representative confocal laser scanning microscopy images of the lysosomal tracer (LysoTracker), co-aggregate (Cy5-labeled mRNA), and nucleus (Hoechst 33342) in Jurkat cells after 3 hours of incubation with the MED26 coagulate. Scale bar, 5 μm. Figure 12C The expression curve over time is shown in 293T cells transfected with MED26-mRNA co-aggregate. Figure 12D The changes in MED26 protein levels over time are shown in Jurkat cells transfected with MED26-mRNA co-aggregate.

[0052] Figure 13A This shows the relative levels of mRNA in 293T-GFP cells 72 hours after treatment with MED26 co-aggregates loaded with a single target siRNA. Figure 13B This shows the relative levels of mRNA in 293T-GFP cells 72 hours after treatment with MED26 co-aggregates loaded with multi-target siRNA.

[0053] Figure 14A This shows the quantitative results of plasmid expression (sizes: 8 kb and 15 kb) in Jurkat cells 48 hours after transfection with MED26 co-aggregate or Lipofectamine 3000. Figure 14B This shows the quantitative results of plasmid expression (sizes: 8 kb and 15 kb) in 293T cells 48 hours after transfection with MED26 coagulate or Lipofectamine 3000. Figure 14C This shows the quantitative results of plasmid expression in Jurkat cells 48 hours after transfection with coagulates containing different concentrations of MED26 (135-480) of packaged CRISPR / Cas9 pDNA. Figure 14D FACS analysis of Jurkat cells 48 hours after treatment with a coagulate containing two plasmids (GFP plasmid and tdTomato plasmid). Figure 14E A schematic diagram showing the integrated pDNA-CRISPR / Cas9 structure. Figure 14F This shows the transfection efficiency of DNMT1, HBB, and HPRT1 sites in Jurkat cells treated with MED26 co-aggregates loaded with a single target pDNA. Figure 14G This shows the insertion and deletion frequencies of DNMT1, HBB, and HPRT1 sites in Jurkat cells treated with MED26 co-aggregates loaded with a single targeting pDNA. Figure 14H This demonstrates the transfection efficiency of DNMT1, HBB, and HPRT1 sites in 293T cells treated with MED26 co-aggregates loaded with single or triple target pDNA. Figure 14I This shows the insertion and deletion frequencies of DNMT1, HBB, and HPRT1 sites in 293T cells treated with MED26 co-aggregates loaded with single or triple-targeting pDNA. Invention Details Numerous publications, articles, and patents have been referenced or described in the background and throughout this specification; each of these references is incorporated herein by reference in its entirety. Discussions of documents, actions, materials, devices, articles, or the like incorporated herein are intended to provide background context for the invention. Such discussions do not constitute an admission that any or all of the foregoing constitute prior art to any disclosed or claimed invention.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Otherwise, certain terms used herein have the meanings defined in this specification.

[0056] It should be noted that, as used herein and in the appended claims, unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “the” encompass the plural reference.

[0057] Unless otherwise stated, any numerical values, such as concentrations or concentration ranges, mentioned herein should be understood to be modified by the word "approximately" in all cases. Therefore, a given value typically covers ±10% of that value. For example, a concentration of 1 mg / mL includes 0.9 mg / mL to 1.1 mg / mL. Similarly, a concentration range of 1% to 10% (w / v) includes 0.9% (w / v) to 11% (w / v). As used herein, unless the context clearly indicates otherwise, the use of numerical ranges explicitly includes all possible subranges, all individual values ​​within that range, including both integers and fractional values ​​within the range.

[0058] Unless otherwise stated, the term "at least" preceding a series of elements should be understood to encompass every element in the series. Those skilled in the art will identify or be able to determine numerous equivalents of specific embodiments of the invention described herein through experimentation that does not exceed conventional methods. Such equivalents are intended to be covered by this invention.

[0059] As used herein, the terms “comprising,” “containing,” “including,” “comprise,” “have,” “possess,” “include,” or “contain,” or any other variations thereof, shall be understood to indicate inclusion of the stated whole or group of wholes but not exclusion of any other whole or group of wholes, and are intended to be non-exclusive or unlimited. For example, a composition, mixture, process, method, article, or apparatus that includes the listed elements is not necessarily limited to the listed elements, but may also include other elements not expressly listed or inherent to the aforementioned composition, mixture, process, method, article, or apparatus. Furthermore, unless expressly stated to the contrary, “or” refers to inclusive or, not exclusive or. For example, conditions A or B are true if any of the following conditions are met: A is true (or exists) and B is false (or does not exist); A is false (or does not exist) and B is true (or exists); and both A and B are true (or exist).

[0060] As used herein, the conjunction “and / or” connecting multiple listed elements should be understood to include both the individual elements and any combination thereof. For example, when two elements are connected by “and / or”, the first case means that only the first element applies and the second element does not. The second case means that only the second element applies and the first element does not. The third case means that both the first and second elements apply. Any of the above cases is considered to fall within the scope of meaning and therefore satisfies the requirement for the term “and / or” as used herein. The simultaneous application of multiple cases is also considered to fall within the scope of meaning and therefore satisfies the requirement for the term “and / or”.

[0061] As used herein, the term “composed of” or variations thereof such as “constituting of” or “component of”, as used throughout the specification and claims, indicates inclusion of any of the enumerated wholes or groups of wholes, but no additional wholes or groups of wholes may be added to the specified method, structure, or combination.

[0062] As used herein, the term “substantially composed of” or variations thereof such as “substantially constituted of” or “substantially composed of”, as used throughout the specification and claims, indicates the inclusion of any of the listed wholes or groups of wholes, and optionally includes any of the listed wholes or groups of wholes that do not substantially alter the basis or novel characteristics of the specified method, structure, or combination. See Section 2111.03 of the MPEP.

[0063] As used herein, “subject” refers to any animal, preferably a mammal, and most preferably a human. The term “mammal” as used herein encompasses any mammal. Examples of mammals include, but are not limited to, cattle, horses, sheep, pigs, cats, dogs, mice, rats, rabbits, guinea pigs, monkeys, and humans, with humans being more preferred.

[0064] The words “right,” “left,” “down,” and “up” refer to the directions in the attached diagram.

[0065] It should also be understood that when the terms “about,” “around,” “basically,” “roughly,” and similar terms are used herein to refer to the size or feature of a component of the preferred invention, it indicates that the size / feature is not a strict limit or parameter, and does not exclude minor variations that are functionally identical or similar, as would be understood by one of ordinary skill in the art. At a minimum, such references involving numerical parameters should cover a range of variations that, based on generally accepted mathematical and industrial principles in the art (such as rounding, measurement or other systematic errors, manufacturing tolerances, etc.), will not cause a change in the least significant figure.

[0066] In the context of two or more nucleic acid or polypeptide sequences (e.g., the MED26 protein and its fragments or the polynucleotides encoding them), the term “identical” or percentage “identity” means that the two or more sequences or subsequences are identical, or have a specified percentage of identical amino acid residues or nucleotides, when detected, compared and aligned using any of the following sequence alignment algorithms or by visual inspection to obtain the maximum correspondence.

[0067] During sequence alignment, a reference sequence is typically used, and the sequence to be tested is compared to it. When using a sequence comparison algorithm, the sequence to be tested and the reference sequence are input into the computer. If necessary, subsequence coordinates are specified, and the sequence algorithm program parameters are set. Based on the set program parameters, the sequence comparison algorithm then calculates the percentage of sequence identity between the sequence to be tested and the reference sequence.

[0068] Optimal sequence alignment can be achieved, for example, through the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 1981; 2:482, the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 1970; 48:443, the similarity search method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 1988; 85:2444, through computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, 575 Science Dr., Madison, WI)), or through visual inspection (generally see Current Protocols in Molecular Biology, edited by FMAusubel et al., Current Protocols, Greene Publishing Associates, Inc. and John Wiley & Sons, Published jointly by Inc., 1995 supplement (Ausubel).

[0069] Examples of algorithms suitable for determining sequence identity percentages and sequence similarity are the BLAST and BLAST 2.0 algorithms, described in Altschul et al., J. Mol. Biol. 1990; 215: 403-410 and Altschul et al., Nucleic Acids Res. 1997; 25: 3389-3402, respectively. Software for performing BLAST analysis is publicly available from the National Center for Biotechnology Information (NCBI). This algorithm involves first identifying short words of length W in the query sequence—that is, words that either match or satisfy a positive threshold score T when compared with words of the same length in the database sequence—to determine high-scoring sequence pairs (HSPs). T refers to the neighbor word score threshold (Altschul et al., ibid.). These initial neighbor word matches serve as seeds to initiate a search for longer HSPs containing these seeds. Subsequently, these word matches are extended bidirectionally along each sequence as long as the cumulative alignment score increases.

[0070] For nucleotide sequences, the cumulative score is calculated using parameters M (reward score for paired residue pairs, always >0) and N (penalty score for mismatched residues, always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Word matching extensions in all directions terminate when: the cumulative alignment score drops below its peak value X; one or more negative residue alignments cause the cumulative score to drop to zero or a negative value; or any sequence reaches its end. The parameters W, T, and X of the BLAST algorithm determine the alignment sensitivity and speed. The BLASTN program (for nucleotide sequences) defaults to a word length (W) of 11, an expected value (E) of 10, M=5, N=-4, and performs alignments on both strands. For amino acid sequences, the BLASTP program defaults to a word length (W) of 3, an expected value (E) of 10, and a BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 1989; 89:10915).

[0071] In addition to calculating the percentage of sequence identity, the BLAST algorithm also performs statistical analysis on the similarity between two sequences (see, for example, Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 1993; 90:5873-5787). One similarity detection provided by the BLAST algorithm is the minimum sum probability (P(N)), which indicates the probability that a match between two nucleotide or amino acid sequences is caused by random factors. For example, if the minimum sum probability of the test nucleic acid aligning with the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001, then the nucleic acid is considered similar to the reference sequence.

[0072] As described below, a further indicator that two nucleic acid sequences or peptides are substantially identical is that the peptide encoded by the first nucleic acid is immunely cross-reactive with the peptide encoded by the second nucleic acid. Therefore, for example, when two peptides differ only in conserved substitutions, the peptide is usually substantially identical to the second peptide. Another indicator that two nucleic acid sequences are substantially identical is that the two molecules hybridize under stringent conditions.

[0073] As used herein, the term "isolated" means that a biological component (e.g., nucleic acid, peptide, or protein) has been substantially separated, isolated, or purified from other biological components of the organism in which it resides in nature, such as other chromosomes and extrachromosomal DNA and RNA, and proteins. Therefore, "isolated" nucleic acids, peptides, and proteins include nucleic acids and proteins purified using standard purification methods. "Isolated" nucleic acids, peptides, and proteins may be part of the composition if the composition is not part of the native environment of the nucleic acid, peptide, or protein, and will still be isolated. The term also covers nucleic acids, peptides, and proteins prepared through recombinant expression in host cells, as well as chemically synthesized nucleic acids.

[0074] As used herein, synonymous with “nucleic acid molecule,” “nucleotide,” or “nucleic acid,” the term “polynucleotide” refers to any polynucleotide or polydeoxynucleotide, which may be unmodified RNA or DNA, or modified RNA or DNA. “Polynucleotide” includes, but is not limited to, single-stranded and double-stranded DNA, DNA with a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, and RNA with a mixture of single-stranded and double-stranded regions, and hybrid molecules containing DNA and RNA that may be single-stranded or more commonly double-stranded or a mixture of single-stranded and double-stranded regions. Furthermore, “polynucleotide” refers to a triple-stranded region containing RNA or DNA, or RNA and DNA. The term polynucleotide also includes DNA or RNA containing one or more modified bases, and DNA or RNA containing a modified backbone for enhanced stability or other purposes. “Modified” bases include, for example, triphenylmethylated bases and atypical bases such as hypoxanthine nucleotides. DNA and RNA can undergo a variety of modifications; therefore, “polynucleotide” encompasses naturally occurring chemically, enzymatically, or metabolically modified polynucleotide forms, as well as DNA and RNA chemical forms specific to viruses and cells. "Polynucleotides" also encompass relatively short nucleic acid chains, often referred to as oligonucleotides.

[0075] As used in this article, the term "vector" is a replicon in which another nucleic acid fragment can be operatively inserted to achieve the replication or expression of that fragment.

[0076] As used herein, the term "host cell" refers to a cell containing the nucleic acid molecules of the present invention. A "host cell" can be any type of cell, such as a primary cell, a cultured cell, or a cell derived from a cell line. In one embodiment, a "host cell" refers to a cell transfected with the nucleic acid molecules of the present invention. In another embodiment, a "host cell" refers to the progeny or potential progeny of the transfected cells described above. The progeny cells may be identical to or different from the parent cells, for example, due to mutations or environmental influences occurring in subsequent generations, or due to the integration of the nucleic acid molecules into the host cell genome.

[0077] As used herein, the term "expression" refers to the biosynthesis of a gene product. The term encompasses the process of gene transcription into RNA. It also encompasses the process of RNA translation into one or more polypeptides, and further encompasses all naturally occurring post-transcriptional and post-translational modifications.

[0078] As used herein, the terms “peptide,” “polypeptide,” or “protein” can refer to a molecule composed of amino acids that can be recognized as a protein by those skilled in the art. Conventional single-letter or three-letter codes for amino acid residues are used herein. In this document, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably to refer to amino acid polymers of any length. The polymers may be linear or branched, may contain modified amino acids, or may be interrupted by non-amino acids. These terms also cover amino acid polymers modified by natural or artificial intervention; for example, disulfide bonding, glycosylation, lipid modification, acetylation, phosphorylation, or any other operation or modification such as conjugation with a labeled component. The definition also includes, for example, polypeptides containing one or more amino acid analogs (including, for example, non-natural amino acids), and other modifications known in the art.

[0079] The peptide sequences described in this article are written in the conventional manner, with the N-terminus on the left and the C-terminus on the right. Although amino acid isomers are known, all amino acids mentioned in this article are L-form unless otherwise explicitly stated.

[0080] Methods to promote red line differentiation Erythropy refers to the process of producing red blood cells. At each stage of maturation, erythroids exhibit distinct phenotypic characteristics, as well as unique transcriptomic profiles and chromatin landscapes. Morphological changes include a progressively eosinophilic appearance due to hemoglobin accumulation, continuous cell shrinkage, and significant nuclear pyknosis, ultimately leading to enucleation. This process relies on the synergistic action of epigenetic regulators and transcription factors, as well as the precise regulation of RNA polymerase II activity. Humans produce an average of two to three million red blood cells per second to maintain homeostasis and prevent anemia. Defects in terminal erythroid maturation, such as nuclear pyknosis defects or asynchronous nucleocytoplasmic maturation, are commonly seen in myelodysplastic syndromes and hereditary anemia. Elucidating the molecular mechanisms controlling terminal erythroid maturation is crucial for revealing how mutations or other genetic perturbations lead to impaired erythropy and for designing appropriate therapies (Wells and Steiner, Front Genet. 2022; 13: 805265).

[0081] In summary, this application provides a method to promote the differentiation of red lines.

[0082] In some embodiments, a method for promoting erythroid differentiation includes administering a substance to erythroid precursor cells that increases the suspension of RNA polymerase II mediated by the intermediate complex subunit 26 (MED26) polypeptide in the cells.

[0083] As used herein, the term "stem cell" refers to an undifferentiated cell in a multicellular organism capable of self-renewal, which can produce daughter cells that can terminally differentiate into more than one different cell type with specific functions. Stem cells have the potential to differentiate into multiple cell types and can self-replicate an unlimited number of times through asymmetric cell division, a process known as self-renewal. In a preferred embodiment, the stem cells are adult stem cells, also known as somatic stem cells, which are pluripotent and capable of generating cell types within a specific lineage, such as blood cells or endothelial cells.

[0084] In some embodiments, the stem cells are hematopoietic stem cells. As used herein, the term "hematopoietic stem cell" ("HSC") refers to an immature cell capable of self-renewal and differentiation into one or more mature blood cells. Examples of mature blood cells include, but are not limited to, granulocytes (e.g., promyelocytes, neutrophils, eosinophils, basophils), erythrocytes (e.g., reticulocytes, erythrocytes), platelets (e.g., primitive megakaryocytes, platelet-producing megakaryocytes, platelets), monocytes, dendritic cells, microglia, osteoclasts, and lymphocytes.

[0085] As used herein, the term "progenitor cell" refers to a descendant cell of a stem cell that can further differentiate into a specific cell type. This term is not restrictive and does not limit the cells to a particular lineage. Unlike stem cells, progenitor cells have a weaker capacity for self-renewal. Furthermore, the cellular potential of progenitor cells is generally more limited than that of stem cells. Progenitor cells typically differentiate only into cells belonging to the same tissue or organ. Some progenitor cells possess a single terminal target cell (unipotency), while others have the potential to terminally differentiate into more than one cell type (oligopotency or pluripotency).

[0086] As used herein, "erythroid precursor cells" refers to any cell involved in the erythroid process. In some embodiments, the erythroid precursor is a hematopoietic stem and progenitor cell (HSPC), such as a CD34+ HSPC. In some embodiments, the erythroid precursor is an erythroblast, such as an erythroblast derived from a CD34+ HSPC.

[0087] It should be understood that this invention covers the use of any substance capable of increasing RNA polymerase II pausing mediated by the MED26 peptide. Any of a variety of substances may be used to increase RNA polymerase II pausing mediated by the MED26 peptide. This is not limited to this; said substances include small molecules, peptides, polypeptides, nucleic acids, oligonucleotides, antibodies, etc. In some embodiments, the increased interaction or occupancy may be achieved by increasing affinity and / or increasing the amount or concentration.

[0088] As used herein, the term "MED26" or "MED26 polypeptide" refers to the mediator of RNA polymerase II transcription subunit 26, or the mediator complex subunit 26 protein, a component or subunit of the CRSP (a cofactor required for SP1 activation) complex. Embodiments of this application relate to the MED26 polypeptide or an active fragment thereof. Preferably, the MED26 is mammalian MED26, such as human MED26. In some embodiments, the MED26 polypeptide is a human MED26 polypeptide. In some embodiments, the human MED26 polypeptide comprises the amino acid sequence shown in SEQ ID NO: 1 or an active fragment thereof.

[0089] In some embodiments, the substance comprises the MED26 polypeptide or an active fragment thereof, or a nucleic acid encoding the active fragment. As used herein, the term "active fragment" refers to a fragment of MED26 or a derivative thereof that is capable of interacting with transcriptional pausing factors to mediate RNA polymerase II pausing or capable of forming aggregates with a reagent and delivering the reagent to the cell.

[0090] In some embodiments, the active fragment comprises an intrinsically disordered region (IDR) of the MED26 polypeptide. More specifically, the active fragment comprises a polypeptide having at least 75%, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 2. In some embodiments, the active fragment comprises a TFIIS domain and an intrinsically disordered region (IDR) of the MED26 polypeptide. More specifically, the active fragment comprises a polypeptide having at least 75%, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 2.

[0091] In some embodiments, the substance comprises the MED26 polypeptide or a nucleic acid encoding the MED26 polypeptide; more specifically, the MED26 polypeptide comprises a polypeptide having at least 75%, for example, at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO: 1.

[0092] Based on this disclosure, the MED26 polypeptide or its active fragment can be prepared by any suitable method. In some embodiments, the MED26 polypeptide or its active fragment is prepared by recombinant production, for example, by a nucleic acid encoding a polynucleotide sequence or fragment thereof as shown in GenBank accession number NM_004831.5. In some embodiments, the nucleic acid may be optimized to improve protein expression.

[0093] As used herein, an "enhancer" refers to a short region of DNA to which a protein (e.g., a transcription factor) can bind to enhance gene transcription. As used herein, a "transcriptional coactivator" refers to a protein or protein complex that interacts with a transcription factor to promote gene transcription. As used herein, a "superenhancer" or "superenhancer site" refers to a region of DNA containing two or more enhancers that can be co-bound by a group of transcription factor proteins to drive the transcription of a cell identity-related gene. Examples of superenhancers include, but are not limited to, those described, for example, in U.S. Patent Publication US2014 / 0287932, the contents of which are incorporated herein by reference in their entirety.

[0094] In some embodiments, the substance increases the interaction of MED26 with transcriptional pausing factors in the cells, such as negative elongation factor (NELF), DRB sensitivity inducible factor (DSIF), or factors in the polymerase-associated factor (PAF) complex, particularly PAF1.

[0095] In some embodiments, the substance increases the occupancy of MED26 at superenhancer sites, such as superenhancers selected from the following genes: cyclin-dependent kinase 6 (CDK6), apoptosis regulator Bcl-2 (BCL2), high-mobility group box HMG-I / HMG-Y (HMGA1), transcription activator Myb (MYB), 40S ribosomal protein S14 (RPS14), 60S ribosomal protein L36a-like R (PL36AL), and 60S ribosomal protein L27 (RPL27).

[0096] A method for promoting erythroid differentiation is also provided, comprising administering to an erythroid precursor a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 17 or a polynucleotide encoding the polypeptide.

[0097] In some embodiments, the polypeptide comprises the amino acid sequence shown in SEQ ID NO: 2. In some embodiments, the polypeptide comprises the amino acid sequence shown in SEQ ID NO: 1.

[0098] In some embodiments, the substance is administered to the erythroid precursor in vitro. In some embodiments, the substance is administered in vivo to a subject in need of the erythroid precursor.

[0099] In some implementations, the subject needs to be treated for a disease associated with erythroid differentiation defects. In some implementations, the disease associated with erythroid differentiation defects is a myelodysplastic syndrome, such as refractory anemia or refractory cytopenia, erythroid dysplasia, bone marrow failure, or megaloblastic anemia.

[0100] A method for delivering a reagent to cells is also provided, comprising: a. To prepare aggregates comprising the MED26 polypeptide or an active fragment thereof and the reagent; and b. Bring the cells into contact with the aggregate. The MED26 polypeptide or its active fragment thereby delivers the reagent to the cells.

[0101] Condensates have been studied as a potential delivery system for a variety of substances due to their ability to encapsulate molecules within droplets.

[0102] In some embodiments, the reagent is a small molecule for gene editing, such as a protein, peptide, RNA, DNA, or CRISPR component. In some embodiments, the condensate provides a protective environment that increases the stability, solubility, and / or controlled release of the reagent. In some embodiments, the reagent is a nucleic acid, such as one or more RNA or DNA molecules.

[0103] In some embodiments, the nucleic acid encodes one or more components for gene editing. In some embodiments, the gene editing includes CRISPR gene editing, and the nucleic acid encodes one or more of CRISPR RNA (crRNA), tracrRNA hybridized with the crRNA, and Cas endonucleases (such as Cas9, Cas12, Cas13). Preferably, the nucleic acid encodes a single guide RNA comprising the crRNA and the tracrRNA, and / or a Cas endonuclease. More preferably, the nucleic acid encodes the single guide RNA and the Cas9 endonuclease.

[0104] In some embodiments, the nucleic acid is a DNA molecule, such as plasmid DNA. The reagent is a DNA molecule, such as circular DNA (e.g., plasmid DNA) or linear DNA (e.g., antisense DNA).

[0105] In some embodiments, the nucleic acid is RNA, such as mRNA. The reagent is RNA, such as mRNA, siRNA, antisense RNA, linear RNA, circular RNA, or tRNA. The RNA may be chemically modified by one or more methods.

[0106] In some embodiments, the MED26 polypeptide or its active fragment comprises an amino acid sequence that is at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 97%, 98%, 99%, or 100% sequence identical to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16. In some embodiments, the MED26 polypeptide or its active fragment comprises an amino acid sequence having at least 75%, such as at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, or SEQ ID NO: 16. In some embodiments, the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO: 2.

[0107] In some embodiments, the step of preparing the aggregate includes mixing the reagent with the MED26 peptide or an active fragment thereof in an aqueous buffer.

[0108] In some embodiments, the buffer solution further comprises polyethylene glycol (PEG). In some embodiments, the buffer solution comprises 1–30% (w / v) PEG, such as 2–20% (w / v) PEG, e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, or 15% (w / v) PEG, preferably 10% (w / v) PEG. In some embodiments, the step of preparing the agglomerate comprises mixing the reagent with 1–200 μM, preferably 5–150 μM, e.g., 5, 10, 25, 50, 75, 100, 125, or 150 μM, more preferably 10 μM of the MED26 peptide or its active fragment.

[0109] combination This article also provides combinations of substances (e.g., drug combinations) that increase the pausing of RNA polymerase II mediated by the MED26 peptide.

[0110] It also provides a method for promoting erythroid differentiation in erythroid precursor cells, which includes a substance that increases the pausing of RNA polymerase II mediated by the MED26 polypeptide or a composition containing the substance.

[0111] As used herein, “carrier” includes pharmaceutically acceptable carriers, excipients, or stabilizers that are non-toxic to cells or mammals exposed thereto at the doses and concentrations used. Typically, physiologically acceptable carriers are aqueous pH buffers. Non-limiting examples of physiologically acceptable carriers include: buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid; low molecular weight (less than about 10 residues) peptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium ions; and / or nonionic surfactants such as Tween. TM Polyethylene glycol (PEG) and PLURONICS TM .

[0112] As used herein, the term "effective amount" or "therapeutic effective amount" of a material refers to the minimum concentration required to achieve at least a measurable improvement or prevention of a particular disease. Effective amounts as used herein can vary due to factors such as the patient's disease state, age, sex, and weight, and the material's ability to elicit the expected response in an individual. An effective amount also refers to a dose at which any toxic or adverse effects of treatment are less than its beneficial therapeutic effect. In the context of cancer, an effective amount comprises an amount sufficient to shrink a tumor and / or reduce its growth rate (e.g., inhibit tumor growth) or to prevent or delay the proliferation of other undesirable cells in cancer. In some embodiments, an effective amount refers to an amount sufficient to delay cancer development. In some embodiments, an effective amount refers to an amount sufficient to prevent or delay cancer recurrence. In some embodiments, an effective amount refers to an amount sufficient to reduce an individual's recurrence rate. An effective amount may be administered once or multiple times. For the purposes of this disclosure, an effective amount of a drug, compound, or combination of drugs refers to an amount sufficient to directly or indirectly achieve prevention or treatment. As understood in the clinical context, an effective amount of a drug, compound, or combination of drugs may be achieved in combination with another drug, compound, or combination of drugs, or may not be achieved in combination with another drug, compound, or combination of drugs. Therefore, an "effective amount" can be considered in the context of administering one or more therapeutic substances, and if the desired result may or has been achieved when combined with one or more other substances, the single substance may be considered to have been administered in an effective amount.

[0113] Example The following embodiments of the present invention are provided to further illustrate the essence of the invention. It should be understood that the following embodiments do not limit the invention, and the scope of the invention should be determined by the appended claims.

[0114] Example 1. Expression of MED26 during erythropoiesis Since the mediator complex plays a crucial role in the regulation of multiple transcriptional steps, its expression in human CD34+ erythroid culture was investigated. CD34+ cells were purified from human cord blood (Beijing Cord Blood Bank) using the MACS MicroBead kit (Miltenyi Biotec, Bergisch-Gladbach, Germany). The two-stage erythroid differentiation protocol was modified from previous studies (38). The basal medium contained IMDM (Gibco, Waltham, MA, USA), 5% human AB serum (Wokavi Biotech, Beijing, China), 10% FBS (Gibco), 10 ng / mL heparin (Sigma, St. Louis, Missouri, USA), 10 μg / mL insulin (Sigma), 2 mM L-glutamine (Gibco), 3 IU / mL erythropoietin (Amgen, Thousand Oaks, California, USA), and 300 μg / mL total transferrin (Sigma). Phase I culture medium was supplemented with 50 ng / mL recombinant human SCF (Stem Cell Technologies, Vancouver, British Columbia, Canada) and 10 ng / mL recombinant human IL-3 (Stem Cell Technologies). Phase II culture medium was supplemented with only 50 ng / mL recombinant human SCF. Cells were cultured in Phase I medium for 8 days, then transferred to Phase II medium for 6–8 days. All mouse and human cells were cultured at 37°C, 5% (v / v) CO2, and 90% (v / v) humidification.

[0115] During the terminal stage of erythroid differentiation, the protein levels of most intermediate subunits decreased significantly, while the protein level of MED26 was surprisingly persistently detectable. Figure 1A Consistent with this, immunofluorescence imaging of primary erythroblasts isolated from the fetal livers of E14.5 mice showed that MED1 levels decreased from early to late erythropoiesis, while MED26 remained detectable (data not shown). Given that MED26 remains relatively enriched in the terminal stages of erythropoiesis and that the mediator complex plays a crucial role in transcriptional regulation, MED26 may play a unique function in late erythropoiesis.

[0116] Example 2. MED26 exhibits the ability to form biomolecular condensates.

[0117] During erythropoiesis, not only were the levels of most mediator subunits, including MED1, decreased, but the levels of representative transcriptional condensate-forming proteins, such as BRD4 and RPB1, were also significantly reduced. Figure 1A (B). In summary, the above results indicate that transcriptomic condensates have a unique assemblages during terminal erythroid differentiation.

[0118] Subsequently, the OptoDroplet assay was used to detect whether MED26 and other mediator subunits possessed aggregate-forming ability. The OptoDroplet assay was performed according to the method described in existing literature (35). Plasmids containing the specified mediator subunits were transfected into 293T cells using Lipo2000 reagent. The transfected 293T cells were cultured at 37°C for 48 hours. During blue light activation and imaging, images of the cells were acquired every 2 seconds using two laser wavelengths: 488 nm and 568 nm. Proteins with phase-separation ability aggregate after blue light excitation ( Figure 1C This experiment revealed that MED1, MED4, MED26, and MED28 all possess the ability to form droplets. Figure 1C Furthermore, structural evidence shows that most regions of these proteins are in a disordered state.

[0119] The fluorescence recovery after bleaching (FRAP) assay was used to determine whether MED26 exhibits droplet properties in vivo. Briefly, the FRAP experiment was performed on a rotating microscope equipped with a 63× oil immersion lens. MED26 droplets were bleached at 480 nm (corresponding to GFP) with 80% laser intensity for 30 cycles. Fluorescence recovery was recorded accordingly, and the fluorescence intensity of the photobleached region was normalized to the intensity of the unbleached region. The FRAP experiment showed that MED26 fused with enhanced green fluorescent protein (EGFP-MED26) could form aggregates in K562 erythroleukemia cells, and the signal recovered rapidly after photobleaching. Figure 1D ).

[0120] To verify the intrinsic aggregation-forming ability of MED26, the putative EGFP-MED26-IDR was expressed and purified. The DNA sequence of the target gene's IDR was cloned into the prokaryotic expression vector pET28a, whose backbone contained a 5' 6×His tag followed by an mCherry or EGFP linker and a synthetic amino acid linker GAPGSAGSAAGGSG (SEQ ID NO: 18). The DNA sequence was inserted into the backbone according to the reading frame and ended with a stop codon. For protein expression, the plasmid was first transformed into Rosetta competent cells (Qingke, Beijing, China); fresh colonies were inoculated into 15 mL of LB medium containing kanamycin and chloramphenicol and cultured overnight at 37°C. The bacterial culture was then transferred to 500 mL of medium and cultured until the optical density (OD) reached approximately 0.3. The cells were pre-cooled to 16°C, then induced with 1 mM IPTG, and then cultured overnight at 16°C and 130 rpm in a shaker. The bacterial pellet was collected. Store frozen at 80°C for later use.

[0121] The bacterial pellet was resuspended in buffer A (50 mM Tris, pH 7.5, 500 mM NaCl) containing a mixture of 10 mM imidazole, lysozyme, and protease inhibitor. The cell resuspended cells were lysed thoroughly on ice for approximately 30 minutes, followed by sonication (15 seconds on, 60 seconds off, 10 cycles) until the lysate was slightly clear. The lysate was centrifuged at 12,000 g for 30 minutes to remove insoluble impurities. The supernatant was incubated with 1 mL of pre-equilibrated Ni-NTA agarose at 4°C for at least 1.5 h. The mixture was transferred to a chromatography column and washed with 15 column volumes of buffer A containing 10 mM imidazole. The purified protein was then eluted sequentially with 2 column volumes of buffer A containing 50 mM imidazole, 2 column volumes of buffer A containing 100 mM imidazole, and 3 column volumes of buffer A containing 250 mM imidazole. The composition and purity of each fraction were analyzed by SDS-PAGE electrophoresis followed by Coomassie brilliant blue staining. The fraction containing the target protein was concentrated to an appropriate volume and... Store at 80°C.

[0122] For droplet formation experiments with or without congesting agents, phosphate-buffered saline (PBS) containing 10% PEG8000 or a low-salt buffer containing 50 mM Tris-HCl (pH 7.5) and 25 mM NaCl without congesting agents was used. Recombinant protein was displaced into the droplet formation buffer using Amicon ultrafiltration centrifuge tubes (30 kDa MWCO, Millipore, Burlington, Massachusetts, USA). The protein solution was immediately loaded into a homemade reaction chamber containing coverslips with two parallel double-sided adhesive tapes and a slide. The slides were then imaged using an Andor confocal microscope (Oxford Instruments, Abingdon, UK) equipped with a 63× objective lens.

[0123] Regardless of the presence of a congestant (10% PEG8000), EGFP-MED26-IDR was observed to form phase-separated droplets in vitro. Figure 1E and 1F The fusion event of MED26 droplets was captured using time-lapse imaging, indicating their fluidity (data not shown). Droplet formation experiments were then conducted using different concentrations of EGFP-MED1-IDR, EGFP-MED26-IDR, and EGFP. The results showed that MED26-IDR had a lower phase separation saturation concentration than MED1-IDR. Figure 1E ).

[0124] Furthermore, MED26-IDR droplets are sensitive to 1,6-HD and high-salt treatments, indicating that hydrophobic and electrostatic interactions contribute to droplet formation. Figure 1FIn summary, the above results confirm that the core mediator complex subunit MED26 can undergo phase separation in vitro and in vivo, and suggest that during terminal erythroid differentiation, the transcription condensate transforms into a "MED26-enriched form".

[0125] Example 3. MED26 plays a key role in hematopoietic development in mice and humans. To investigate the in vivo function of Med26, a [structure / system] was constructed. Med26 Conditional knockout (cKO) mice were used to investigate their role in the hematopoietic system. To construct Med26 conditional knockout mice, the Med26 gene was modified using CRISPR / Cas9 technology. Flox sequences were inserted flanking the Med26 gene locus. The simplified procedure was as follows: sgRNA, Cas9, and the flux sequence donor were microinjected into fertilized eggs of C57BL / 6JGpt mice. F0 generation positive mice were obtained by transplantation of the fertilized eggs, and confirmed by PCR and sequencing. Stable F1 generation mouse models were obtained by mating F0 generation positive mice with C57BL / 6JGpt mice. Mx1-iCre mice were also constructed using CRISPR / Cas9 technology, with the Mx1-iCre-polyA gene fragment inserted into the H11 site of the mouse. The simplified procedure was similar to that for constructing Med26 conditional knockout mice. Med26 flox / flox;wt / wt (control) or Med26flox / flox;Mx1-iCre / wt (cko) mice were obtained through natural breeding. To induce iCre expression in vivo, mice were injected with 10 μg g-1 polyinosinic-polycytidylic acid (pIpC-HMW, InvivoGen). One week later, the mice were sacrificed and the target organ was isolated for subsequent analysis.

[0126] Following pIpC injection to induce Cre, recombination occurred at the Med26 locus, and its protein expression was downregulated. Figure 2A cKO mice showed smaller body size, whiter fur, and poorer survival rates. Figure 2B Prussian blue staining of spleen sections showed greater iron deposition in cKO mice, indicating that the spleen cleared increased abnormal erythroblasts. Figure 2C Peripheral blood complete blood count (CBC) analysis showed that cKO mice had lower mean erythrocyte volume (MCV) and mean erythrocyte hemoglobin (MCH) compared to wild-type mice, but similar RBC, HGB, and hematocrit. Figure 2D Giemsa staining of peripheral blood smears also revealed the presence of irregularly shaped RBCs and sparse reticulocytes. Figure 2E Med26 cKO mice lack erythroid precursors in their bone marrow (especially in S3 phase). Figure 2F This phenotype is related to the main erythroid transcription factor. Gata1 The results were consistent with those of cKO mice (37).

[0127] Next, the erythroid regeneration capacity of cKO mice was assessed under phenylhydrazine (PHZ)-induced acute hemolytic anemia conditions. In short, 6-8 week old Med26 mice were used. flox / flox ;wt / wt (control) or Med26 flox / flox Mx1-iCre / wt (cko) mice were randomly grouped according to body weight and pretreated with pIpC (5 μg g⁻¹) for 1 day (day -1). On day 0, the mice were injected with phenylhydrazine (PHZ, Sigma) (60 mg kg⁻¹). Whole blood samples were collected daily from day 1 to 7 for complete blood cell count (CBC) analysis. The results showed that, consistent with significant spleen shrinkage, sparse reticulocytes in peripheral blood, and reduced S3 phase erythroblasts in bone marrow, cKO mice could not recover after PHZ treatment. Figure 2G These results indicate that MED26 is essential for erythropoiesis under both normal and stress conditions. Analysis of hematopoietic stem and progenitor cells (HSPCs) and white blood cell (WBC) combinations in cKO mice also showed that MED26 deficiency impaired LT-HSCs, ST-HSCs, MPPs, CMPs, GMPs, MEPs, B cells, and neutrophils. Figure 2H and 2I ).

[0128] To examine the knockdown effect of MED26 in human cells, CD34+ cells were isolated from human umbilical cord blood using the method described above. For gene knockdown in CD34+ cells, a miR-30-based shRNA vector was used; as previously described, this vector inserts the target gene... EcoR I and Xho Constructed from site I ( 60 Knockdown of MED26 was observed to significantly eliminate the colony-forming ability of human CD34+HSPCs. Figure 3A -D). The above results all demonstrate that Med26 is crucial for erythrocyte production in mice and humans.

[0129] Example 4. MED26's aggregate-forming ability is essential for erythropoiesis. To investigate the function of MED26 in erythroid development, gain-of-function experiments were conducted in primary human erythroid culture systems. To overexpress the gene in CD34+ cells, the coding sequence was amplified by PCR and cloned into the MSCV-3XFlag-T2A-copGFP vector. BamH I and Not I site. Results showed that MED26 overexpression promoted erythroid differentiation but inhibited enucleation ( Figure 4A -C).

[0130] In addition, to investigate whether the function of MED26 in erythropoiesis is mediated by its phase-separation ability, the function of the truncated MED26 was first assessed using the OptoDroplet assay. Figure 4D The results showed that the truncated form containing amino acids 88-480 (aa), i.e., the putative IDR region, had aggregate-forming ability. Figure 4D Interestingly, the aa at positions 1-480 formed more pronounced aggregates than all other truncated forms, indicating that the aa at positions 1-87 promotes the phase separation ability of MED26 IDR. In vitro experiments further confirmed that the aa at positions 88-480 of MED26, rather than positions 1-87 or 480-600, possesses phase separation ability. Figure 4E Previous reports indicated that positions 1-87 (aa) are TFIIS domains, and positions 480-600 (aa) contain surfaces that interact with the remaining mediator complex (36, 39). Subsequently, overexpression of these three fragments of MED26 in human CD34+ HSPCs showed that, compared to the full-length MED26, positions 88-480 (aa) alone were sufficient to promote erythroid differentiation. Figure 4F In summary, these results indicate that the phase-separation ability of MED26 is a key regulatory factor promoting erythroid differentiation.

[0131] Example 5. Transcriptional condensates enriched with MED26 are preferentially associated with RNA polymerase II pausing. To further elucidate the molecular basis of MED26 function, the CUT&Tag signal of MED26 in human CD34+ erythroid cultured cells on day 4 was analyzed and compared with the signal of MED1, which is generally considered to be a representative subunit of the mediator. The CUT&Tag assay was performed as previously described (59) and in accordance with the manufacturer's instructions (Vazyme, Nanjing, China). Briefly, 100,000 cells were freshly collected and captured with concanavalin A (ConA) magnetic beads at room temperature. The cell / ConA bead complex was permeabilized and incubated overnight at 4°C with primary antibody (1:100 dilution). Secondary antibody was added to the solution and incubated at room temperature for 1 hour. After washing away the secondary antibody, pA / G-Tn5 was added to the cell suspension and incubated at room temperature for 1 hour. Subsequently, adapters were inserted into the Tn5-tagged genome using TruPrep Tag Buffer L (TTBL). Genomic DNA was extracted using DNA magnetic beads, and the labeled DNA fragments were amplified by PCR for 16 cycles using next-generation sequencing (NGS) adapters. Adapter dimers in the PCR products were removed using DNA washing magnetic beads (Vazyme, Nanjing, China). The library was quantified prior to sequencing.

[0132] Surprisingly, the results showed that approximately 60% of the chromatin loci occupied by MED1 or MED26 did not exhibit colocalization. Figure 5A Interestingly, MED26 co-localized better with GATA1 and GATA2 than with MED1, suggesting a potential functional association between MED26 and GATA factors. Aggregates rich in MED1 or MED26 were observed in primary human erythroblasts and other cell types. The signal ratio of MED26 to MED1 at the transcription start site (TSS) of their occupied sites was then calculated. While most genes occupied by MED1 and / or MED26 had relatively constant MED26 / MED1 signal ratios, a significant number of genes showed differential MED26 / MED1 ratios, indicating that chromatin occupancy of MED26 and MED1 is not always correlated. The highest 10% ratio was defined as “MED26-enriched chromatin sites”, and the lowest 10% ratio was defined as “MED26-deficient chromatin sites”. Figure 5B -C).

[0133] To elucidate how MED26 enrichment affects transcription, CUT & Tag experiments and precise nuclear ligation sequencing (PRO-seq) of Pol II were performed on day 4 in human CD34+ erythroid culture cells. The results showed that at MED26-deficient chromatin sites, Pol II exhibited more cross-genome signaling, while at MED26-enriched chromatin sites, Pol II was significantly enriched in the TSS region and transcribed at a higher proportion of short RNAs, indicating that Pol II was in a paused state. Figure 5D -E). To better characterize this phenomenon, the pausing index (PI) was calculated, defined as the ratio of "TSS region readings" to "genome body region readings" after normalization according to genome region length (40). Analysis revealed that MED26-enriched sites had significantly higher PIs (p < 2.2 × 10⁻⁶) compared to MED26-deficient sites. -16 ), and longer gene length (p = 4.092 × 10), -10 And similar exon numbers (p = 0.09774) Figure 5F The same conclusion can be drawn from the CUT & Tag experiments of Ser5 phosphorylation (Rpb1-S5) and Rpb1-S2 of RNA polymerase II. Figure 5F Based on overall quantitative analysis, it was found that Pol II transcription in MED26-enriched transcriptomic condensates had a higher pause index, lower elongation efficiency, and a higher proportion of short RNA genes.

[0134] Example 6. MED26 recruits pausing factors to form biomolecular condensates To investigate how MED26 mediates transcriptional pausing, immunoprecipitation mass spectrometry (IP-MS) was used to identify interacting proteins between MED1 and MED26. HEK293T cells transfected with bait-labeled plasmids (3XFlag, 3XFlag-MED1, or 3XFlag-MED26) were collected, resuspended in lysis buffer (Beyotime, China), and incubated on ice for 30 minutes. Soluble protein complexes were analyzed by 15,000... g The sample was collected after centrifugation for 15 minutes; the supernatant was then incubated with anti-Flag agarose beads (Sigma) at 4°C for 1.5 hours. After washing five times with lysis buffer, the protein complex was eluted with 100 μg / mL 3XFlag peptide (Beyotime, China), denatured with 2×SDS loading buffer, and analyzed by SDS-PAGE electrophoresis followed by Coomassie brilliant blue staining. PAGE gel bands of the target protein at the expected molecular weight were cut to appropriate sizes, digested with trypsin, and analyzed using a Q Exactive Plus mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) to identify interacting proteins. Mass spectrometry data were compared with the human-sourced, audited Swiss-Prot database using Proteome Discoverer 2.2 software. NSAF calculations were performed for each detected protein (32, 61-63). The NSAF of protein k is proportional to the amount of protein present in the sample, calculated using the following formula:

[0135] Where SpC = spectrum count, L = amino acid length of the protein, and i = all proteins detected in the MudPIT run.

[0136] While MED26 and MED1 undergo immunoprecipitation similarly to most other mediator subunits (head, middle, and tail modules) and the elongation complex, MED26 interacts much less with the CDK8 kinase module than MED1, consistent with previous studies (30). Notably, MED26 interacts far more with transcriptional pausing factors (NELF, DSIF, and PAF complexes) than MED1, supporting the idea that MED26 is involved in transcriptional pausing. Figure 6A -B). To determine whether the recruitment of the pausing factor depends on the phase separation of MED26, mCherry fused with the disordered region of PAF1 was purified. Figure 6C In vitro droplet formation experiments not only showed that positions 1-480 of MED26 can recruit the pausing factor PAF1 (… Figure 6DThe presence of pausing factors, in turn, promotes the formation of MED26 condensates. Previous studies have shown that positions 1-87 of MED26 contain a TFIIS domain, which can interact with TFIIS interaction motifs (TIMs) ubiquitously present in the disordered regions of transcription regulators (41). In fact, the PAF1 complex subunits PAF1, LEO1, and CTR9 all contain TIM sequences. Therefore, the TFIIS and IDR domains of MED26 may both be key segments promoting condensate formation. To investigate whether the IDR of MED26 contributes to the recruitment of pausing factors, EGFP fused with various truncated forms of MED26 was constructed, and the recruitment of PAF1-mCherry was detected. The results showed that the ability of MED26 to recruit PAF1 depends on its IDR, and this IDR cannot be replaced by the IDR domain of FUS ( Figure 6E These observations suggest that the IDR domain of MED26 plays a unique role in recruiting PAF1. In summary, both the IDR and TFIIS domains of MED26 are essential for the recruitment of pausing factors, and the presence of pausing factors enhances MED26 aggregate formation.

[0137] To investigate how MED26 enrichment affects transcription during erythropoiesis, the CUT&Tag assay was used to analyze the ratio of MED26 to MED1 chromatin occupancy in primary human CD34+ erythroblasts on days 4 and 16. The results revealed that the ratio of MED26 to MED1 increased in both erythroid and non-erythroid genes during differentiation, with a more significant increase in the ratio at the erythroid level compared to the non-erythroid level on day 16. Figure 6F -G).

[0138] Subsequently, PRO-seq experiments were performed on erythrocytes cultured in vitro on day 4 or day 16. PRO-seq libraries were prepared according to the aforementioned method ( 58 In short, 2×10 7The nuclei of CD34 cells cultured in vitro and permeabilized on day 4 or 16 were added to a 2× nuclear ligation (NRO) reaction mixture and incubated at 37°C for 3 minutes. Nascent RNA was extracted and fragmented by alkaline hydrolysis in 0.2 N NaOH on ice for 10 minutes, and neutralized with 1× volume of 1 M Tris-HCl at pH 6.8. The fragmented nascent RNA was buffer-exchanged, purified with streptavidin magnetic beads, and ligated with the inverse 3' RNA adapter VRA3 (5'p-GAUCGUCGGACUGUAGAACUCUGAAC (SEQ ID NO: 19)- / 3' inverse dT / ). The product was enriched by a second round of streptavidin enrichment. Subsequently, the RNA product was treated with RppH (Thermo Fisher Scientific) and polynucleotide kinase (PNK, NEB) to achieve 5' end repair. Before the third round of streptavidin magnetic bead enrichment, the 5'-repaired RNA was ligated to the reverse 5' RNA adapter VRA5 (5'-CUGAACAAGCAGAAGACGGCAUACGA (SEQ ID NO: 20)-3'). The RNA was reverse transcribed using RT primers (5'AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA (SEQ ID NO: 21)-3'). The cDNA product was amplified for 18 cycles, and libraries larger than 150 bp (insertion fragment >70 bp) were purified from PAGE gels. The library was quantified before NGS.

[0139] The results revealed that PI was present in non-erythroid genes (p<2.2 x 10⁻⁶). -16 ) and erythroid genes (p<2.2 x 10) -16 There were increases at all locations, and these increases were accompanied by an increase in the MED26 to MED1 ratio during erythroid development. Figure 6G -H). To examine whether increased transcriptional pausing promotes erythropoiesis, 5,6-dichloro-1-β-D-rifuranosylbenzimidazole (DRB), which inhibits transcriptional elongation by inhibiting CDK9, was added to human erythrocytes cultured to day 6 (42). Compared with the mimic group, the addition of DRB increased CD71. + CD235a + The number of erythroblasts ( Figure 6I In summary, MED26 enrichment was found to be associated with increased transcriptional pausing during the terminal erythroid stage, which may promote erythroid development.

[0140] Example 7. MED26 coagulation-mediated mRNA delivery mRNA therapy holds immense potential as a revolutionary approach in the medical field. Its ability to utilize the body's natural cellular mechanisms to synthesize proteins can provide targeted and precise treatment for a variety of diseases. Therefore, the potential of the MED26 condensate for intracellular mRNA transport was evaluated.

[0141] Aggregates were prepared by adding MED26 (amino acids 1-480; SEQ ID NO: 2) and mRNA to ddH2O and gently mixing for 30-60 seconds. Phase separation diagrams were determined by microscopic observation of a range of MED26 (amino acids 1-480; SEQ ID NO: 2) concentrations (0.1-100 μM) and mRNA concentrations (0.01-0.6 μM).

[0142] PEG was dissolved in ddH2O at a series of concentrations (0, 2, 5, 10, 15, 20%, wt / v). MED26 (amino acids 1-480; SEQ ID NO: 2) (10 μM) and EGFP mRNA (0.1 μM) were added to the polyethylene glycol (PEG) solution and gently mixed for 30-60 seconds to form a coagulate. 1×10 5 One Jurkat cell was suspended in 20 μL of Opti-MEM and mixed with 40 μL of co-coagulation solution. After incubation for 2 hours in a 96-well plate at 37°C and 5% CO2, 200 μL of cell culture medium (RPMI-1640, 10% FBS, antibiotics) was added, and the cells were cultured for 18 hours.

[0143] For adherent cells, 5×10⁶ cells were placed in the culture medium the day before treatment. 4 Two 293T cells were seeded in 96-well plates. After removing the culture medium, the cells were washed once with Opti-MEM to remove FBS, and then incubated for 2 hours with 20 μL of Opti-MEM and 40 μL of co-aggregate (10% PEG formulation). Subsequently, 200 μL of cell culture medium (DMEM, 10% FBS, antibiotic) was added, and the cells were cultured for 18 hours before analysis. Expression efficiency was assessed by flow cytometry (Cytoflex LX). GFP fluorescence images were acquired using a TSKON TS2-FL.

[0144] Mouse monocyte / macrophage-like cell line RAW264.7 was treated with MED26-mRNA condensates, and the various stages of cellular uptake were revealed by electron microscopy. This process exhibited characteristics of micropinocytosis and phagocytosis, including stages such as non-contact, attachment to the cell surface, encapsulation of the co-condensate by flattened membrane protrusions, and partial membrane endocytosis. Figure 7 ).

[0145] PEG is widely used as a congestion agent and dehydration inducer to promote LLPS. Detection of Cy5-labeled mRNA revealed that coagulations formed in PEG solutions exhibited higher cell entry efficiency in a concentration-dependent manner. Figure 8 The relationship between PEG concentration and expression efficiency during the formation of MED26-mRNA co-aggregates was also investigated. Figure 8 The results showed that when the co-aggregate was assembled in PEG solution, the expression level of the mRNA-encoded protein was higher, and high expression was achieved in PEG solutions at concentrations of 10% or higher. The MED26-EGFP mRNA co-aggregate was efficiently transfected into 293T cells, and its EGFP mRNA expression efficiency was comparable to that of Lipofectamine MessengerMAX reagent. Figure 9A -B). Importantly, the MED26 coagulate demonstrated a significant ability to deliver mRNA into Jurkat cells, outperforming the Lipofectamine MessengerMAX reagent (B). Figure 9A -B).

[0146] The primary function of the MED26 protein is to participate in gene transcription within the cell nucleus. To retain its delivery capability while rendering it nonfunctional, a series of truncated forms of the MED26 protein were designed and purified. Figure 10A All tested truncated variants were able to form coagulates with mRNA. Therefore, their delivery efficiency was compared and screened in Jurkat cells. Figure 10B Considering the removal of nuclear localization sequences and expression efficiency, the amino acid fragment from positions 135 to 480 of MED26, such as MED26 (positions 135-480; SEQ ID NO: 12), was selected for subsequent experiments. To determine the optimal concentration of MED26 (positions 135-480; SEQ ID NO: 12) protein, the delivery efficiency of different protein concentrations was evaluated under 0.1 μM mRNA conditions. It was found that 10 μM protein was sufficient to achieve high mRNA delivery efficiency in Jurkat cells. Figure 10C Higher concentrations of MED26-generated coagulates also successfully delivered mRNA to Jurkat cells. Figure 10D ).

[0147] Furthermore, the MED26 coagulates are not limited to carrying a single mRNA; confocal microscopy revealed complete colocalization of the two mRNAs within the MED26 coagulates (data not shown). FACS analysis and confocal microscopy confirmed the presence of EGFP mRNA and tdTomato mRNA in Jurkat cells (…). Figure 11 The expression of ) in 293T cells was highly correlated with that in 293T cells.

[0148] Example 8. Internalization mechanism and duration of MED26 co-aggregates Confocal observations indicated that MC38 cells exhibited deformation and extended pseudo-stools to take up MED26 coagulates, a characteristic feature of macropinocytosis. Figure 12A To gain a deeper understanding of the internalization mechanism of MED26 coagulates, their relationship with the localization of early endosomes was investigated. 5 × 10⁻⁶ 4 Two 293T cells were seeded in confocal culture dishes (SolarBio) and transfected for 16 hours with a plasmid expressing early endosome-GFP (Rab5a, BacMam 2.0, CellLight, Thermo Fisher Scientific). Subsequently, the cells were treated with MED26 (positions 135-480; SEQ ID NO: 12)-luciferase mRNA (Cy5-labeled) co-aggregate for 30 minutes, followed by replacement with DMEM medium (10% FBS, antibiotics). Images were acquired using a laser scanning confocal microscope (Zeiss LSM980).

[0149] Twenty minutes after transfection with MED26 coagulation, most coagulation signals in 293T cells did not colocalize with Rab5 signals. Figure 12A Even after another 40 minutes, no significant colocalization was observed. Figure 12B This suggests that its internalization mechanism does not involve the endosome.

[0150] To further confirm that the MED26 coagulate was not trapped in the endosome compartment, 293T cells were stained with LysoTracker 3 hours after transfection to reveal acidic organelles such as lysosomes. Figure 12C Images taken 4 hours after transfection clearly show that almost all co-aggregates did not co-localize with lysosomes and maintained high fluorescence intensity. These results strongly suggest that the internalization and endocytosis of MED26 co-aggregates, which have micron-sized and droplet-like characteristics, are significantly different.

[0151] Because it is not captured by endosomes and does not need to escape from them, the GFP signal can be detected as early as 30 minutes after transfection, reaches its peak 8 hours ago, and has a fairly high expression rate in Jurkat cells. Figure 12D GFP fluorescence intensity reached its maximum 1 day post-transfection and then declined. Simultaneously, intracellular mRNA levels decreased rapidly within 1 day. MED26 protein was almost undetectable 1 day post-transfection (Figure 12E). These data indicate that MED26 protein cannot be maintained intracellularly for an extended period.

[0152] Example 9. MED26 coagulation-mediated siRNA delivery and gene knockdown In this study, the efficient delivery of siRNA via MED26 co-aggregates was investigated. For single-gene siRNA knockdown experiments, 293T-GFP cells stably expressing GFP were pre-loaded at 2.5 × 10⁶ cells per well one day in advance. 5 Cells were seeded at a density of 10 μM in 24-well cell culture plates. A coagulation mixture was prepared by thoroughly mixing 10 μM MED26 (positions 135-480; SEQ ID NO: 12), 10% PEG, and 1 μM siRNA for 30–60 seconds. The existing medium in each well was removed, and 200 μL of the coagulation mixture and 100 μL of opti-MEM medium were added to each well. The culture plates were then incubated statically in a cell culture incubator for 2 hours. After transfection, 1 mL of complete DMEM growth medium was added to each well, and the culture plates were further incubated at 37°C for 72 hours to evaluate the knockdown effect of the siRNA on the target gene.

[0153] For multi-gene co-knockdown experiments, siRNAs targeting different genes were thoroughly mixed, and a co-aggregate was prepared using the siRNA mixture to a final concentration of 1 μM. All other transfection conditions remained unchanged.

[0154] 72 hours after transfection with MED26 co-concentrates carrying siGFP, GFP fluorescence intensity and GFP mRNA levels were significantly reduced in GFP-stable 293T cells (data not shown). Furthermore, other siRNA targets were validated in 293T-GFP cells, and all targets showed significant knockdown efficiency. Figure 13A Due to MED26's high loading capacity, its function in simultaneously knocking down multiple genes was evaluated. Cell transfection with MED26 co-concentrates loaded with four siRNAs showed significant target gene knockdown effects, indicating that MED26 co-concentrates have the potential for simultaneous multi-gene knockdown. Figure 13B ).

[0155] Example 10. MED26 coagulation-mediated DNA delivery and pDNA-based genome editing CRISPR / Cas9-mediated gene knockout using plasmid DNA (pDNA) is simple, cost-effective, and efficient. First, the delivery capability of the MED26 co-concentrate for pDNA was initially evaluated. The MED26-GFP pDNA co-concentrate was successfully transfected into Jurkat cells, showing superior results compared to Lipofectamine 3000. Figure 14A Transfection efficiency was comparable when delivering small plasmids in 293T cells, but notably, the MED26 co-aggregate exhibited superior performance in delivering large plasmids. Figure 14BFurthermore, when using two pDNA co-transfected cells simultaneously, the MED26 co-aggregate performed better than Lipofectamine 3000. Figure 14C -D). To assess transfection efficiency, an integrated plasmid encoding the sgRNA and Cas9-tdTomato fusion protein sequence was selected for the MED26 coagulate. Figure 14E Subsequently, the formulations of MED26 protein and pDNA were optimized, and the optimal concentrations of 10 μM MED26 and 20 μg / μL pDNA were determined.

[0156] Next, the efficiency of MED26 co-conjugate-mediated gene editing was evaluated. Jurkat cells were exposed to MED26 co-conjugate containing CRISPR / Cas9 pDNA targeting DNA methyltransferase 1 (DNMT1), hemoglobin subunit β (HBB), and hypoxanthine phosphoribosyltransferase 1 (HPRT1), as well as a mixture of these three target pDNAs. To assess genome editing efficiency, cells were treated with MED26 co-conjugate containing an integration plasmid (containing gRNA targeting specific targets). Cells were harvested 48 hours after transfection, and genomic DNA was extracted using QuickExtract™ DNA extraction solution (Lucigen). Target genomic sites were amplified by nested PCR using PrimeSTAR® MaxDNA polymerase (Takara) and primers listed in Table 1, and purified using the TaKaRaMiniBEST agarose gel DNA extraction kit (Takara). Subsequently, 200 ng of PCR product was used for T7EN1 assays according to recommended procedures (Vazyme Biotech) to assess insertion / deletion frequencies. Digestion products were analyzed using 2% agarose gel electrophoresis, and images were acquired using a gel imaging system (Tanon). The percentage of insertions and deletions was measured using ImageJ software and calculated using the following formula: Insertion missing (%) = 100 × [1 - (1 - splitting fraction)] 1 / 2 The cutting fraction is defined as the sum of the intensities of each digested product divided by the sum of the intensities of each digested product and the intensities of the undigested products.

[0157] Forty-eight hours post-transfection, approximately 73.9%, 67.9%, 59.6%, and 58.1% of cells expressed tdTomato, indicating the proportion of cells expressing the target sgRNA and Cas9. Figure 14F ).

[0158] In the single-target group, the insertion / deletion efficiencies analyzed at DNMT1, HBB, and HPRT1 sites were 23.8%, 17.55%, and 34.79%, respectively. Figure 14GNotably, in the three-target samples, the genome editing rates at DNMT1, HBB, and HPRT1 sites were 16.43%, 10.29%, and 28.05%, respectively, indicating significant potential for simultaneous multi-gene editing (data not shown). Due to its ability to carry larger and more plasmids, the MED26 co-concentrate showed higher plasmid expression efficiency in 293T cells than the Lipofectamine 3000 reagent. Figure 14H Therefore, MED26 coagulates mediated higher genome editing efficiency at DNMT1, HBB, HPRT1, and multiple target loci. Figure 14I ).

[0159] Table 1. Primer sequences

[0160] Our designed integrated CRISPR / Cas9 pDNA successfully transfected three targets into Jurkat cells with high transfection rates. Notably, the MED26 co-aggregate enables multiplex gene editing via single-step transfection, particularly in the difficult-to-transfect Jurkat cells, without requiring Cas9 protein or gRNA. Furthermore, the co-aggregate can combine different gene classes, such as pDNA and siRNA, into a single co-aggregate (data not shown), providing more options for multi-target drug discovery.

[0161] References 1. P. Wong et al., Gene induction and repression during terminalerythropoiesis are mediated by distinct epigenetic changes. Blood 118, e128-138 (2011). 2. D. Hnisz, K. Shrinivas, RA Young, AK Chakraborty, PASharp, A Phase Separation Model for Transcriptional Control. Cell 169, 13-23(2017). 3. P. Cramer, Organization and regulation of gene transcription.Nature 573, 45-54 (2019). 4. J. Palis, Primitive and definitive erythropoiesis in mammals.Front Physiol 5, 3 (2014). 5. S. M. Hattangadi, P. Wong, L. Zhang, J. Flygare, H. F. Lodish,From stem cell to red cell: regulation of erythropoiesis at multiple levelsby multiple proteins, RNAs, and chromatin modifications. Blood 118, 6258-6268(2011). 6. H. Lodish, J. Flygare, S. Chou, From stem cell to erythroblast:regulation of red cell production at multiple levels by multiple hormones.IUBMB Life 62, 492-496 (2010). 7. Y. Mei, Y. Liu, P. Ji, Understanding terminal erythropoiesis: Anupdate on chromatin condensation, enucleation, and reticulocyte maturation.Blood Rev 46, 100740 (2021). 8. M. Moras, S. D. Lefevre, M. A. Ostuni, From Erythroblasts toMature Red Blood Cells: Organelle Clearance in Mammals. Front Physiol 8, 1076(2017). 9. P. Valent et al., Normal and pathological erythropoiesis inadults: from gene regulation to targeted treatment concepts. Haematologica103, 1593-1603 (2018). 10. Z. C. Murphy et al., Regulation of RNA polymerase II activity isessential for terminal erythroid maturation. Blood 138, 1740-1756 (2021). 11. J. Malik, J. A. Lillis, T. Couch, M. Getman, L. A. Steiner, TheMethyltransferase Setd8 Is Essential for Erythroblast Survival andMaturation. Cell Rep 21, 2376-2383 (2017). 12. P. Kapoor-Vazirani, J. D. Kagey, P. M. Vertino, SUV420H2-mediatedH4K20 trimethylation enforces RNA polymerase II promoter-proximal pausing byblocking hMOF-dependent H4K16 acetylation. Mol Cell Biol 31, 1594-1609(2011). 13. S. Bottardi et al., Ikaros interacts with P-TEFb and cooperateswith GATA-1 to enhance transcription elongation. Nucleic Acids Res 39, 3505-3519 (2011). 14. R. Kurita et al., Establishment of immortalized human erythroidprogenitor cell lines able to produce enucleated red blood cells. PLoS One 8,e59890 (2013). 15. P. Li et al., Phase transitions in the assembly of multivalentsignalling proteins. Nature 483, 336-340 (2012). 16. S. Boeynaems et al., Protein Phase Separation: A New Phase inCell Biology. Trends Cell Biol 28, 420-435 (2018). 17. S. F. Banani, H. O. Lee, A. A. Hyman, M. K. Rosen, Biomolecularcondensates: organizers of cellular biochemistry. Nat Rev Mol Cell Biol 18,285-298 (2017). 18. M. Boehning et al., RNA polymerase II clustering through carboxy-terminal domain phase separation. Nat Struct Mol Biol 25, 833-840 (2018). 19. Y. E. Guo et al., Pol II phosphorylation regulates a switchbetween transcriptional and splicing condensates. Nature 572, 543-548 (2019). 20. H. Lu et al., Phase-separation mechanism for C-terminalhyperphosphorylation of RNA polymerase II. Nature 558, 318-323 (2018). 21. B. R. Sabari et al., Coactivator condensation at super-enhancerslinks phase separation and gene control. Science 361, (2018). 22. A. Boija et al., Transcription Factors Activate Genes through thePhase-Separation Capacity of Their Activation Domains. Cell 175, 1842-1855e1816 (2018). 23. J. Soutourina, Transcription regulation by the Mediator complex.Nat Rev Mol Cell Biol 19, 262-274 (2018). 24. S. Sato et al., A set of consensus mammalian mediator subunitsidentified by multidimensional protein identification technology. Mol Cell14, 685-691 (2004). 25. L. El Khattabi et al., A Pliable Mediator Acts as a FunctionalRather Than an Architectural Bridge between Promoters and Enhancers. Cell178, 1145-1158 e1120 (2019). 26. J. W. Yin, G. Wang, The Mediator complex: a master coordinator oftranscription and cell lineage development. Development 141, 977-987 (2014). 27. M. Stumpf et al., The mediator complex functions as a coactivatorfor GATA-1 in erythropoiesis via subunit Med1 / TRAP220. Proc Natl Acad Sci U SA 103, 18504-18509 (2006). 28. M. Stumpf et al., Specific erythroid-lineage defect in miceconditionally deficient for Mediator subunit Med1. Proc Natl Acad Sci U S A107, 21541-21546 (2010). 29. S. I. Kim, E. H. Bresnick, Transcriptional control oferythropoiesis: emerging mechanisms and principles. Oncogene 26, 6777-6794(2007). 30. S. Malik, R. G. Roeder, Dynamic regulation of pol IItranscription by the mammalian Mediator complex. Trends Biochem Sci 30, 256-263 (2005). 31. H. Takahashi et al., The role of Mediator and Little ElongationComplex in transcription termination. Nat Commun 11, 1063 (2020). 32. H. Takahashi et al., Human mediator subunit MED26 functions as adocking site for transcription elongation factors. Cell 146, 92-104 (2011). 33. H. Takahashi et al., MED26 regulates the transcription of snRNAgenes through the recruitment of little elongation complex. Nat Commun 6,5941 (2015). 34. H. M. Bourbon, Comparative genomics supports a deep evolutionaryorigin for the large, four-module transcriptional mediator complex. NucleicAcids Res 36, 3993-4008 (2008). 35. Y. Shin et al., optoDroplets—Spatiotemporal Control ofIntracellular Phase Transitions Using Light-Activated optoDroplets. Cell 168,159-171 e114 (2017). 36. X. Chen et al., Structures of the human Mediator and Mediator-bound preinitiation complex. Science 372,(2021). 37. L. Gutierrez et al., Ablation of Gata1 in adult mice results inaplastic crisis, revealing its essential role in steady-state and stresserythropoiesis. Blood 111, 4375-4385 (2008). 38. H. Y. Lee et al., PPAR-alpha and glucocorticoid receptorsynergize to promote erythroid progenitor self-renewal. Nature 522, 474-477(2015). 39. R. Peruzzini et al., 1H, 15N and 13C assignments of the N-terminal domain of the Mediator complex subunit MED26. Biomol NMR Assign 10,233-236 (2016). 40. D. S. Day et al., Comprehensive analysis of promoter-proximal RNApolymerase II pausing across mammalian cell types. Genome Biol 17, 120(2016). 41. K. Cermakova et al., A ubiquitous disordered protein interactionmodule orchestrates transcription elongation. Science 374, 1113-1121 (2021). 42. K. Yankulov, K. Yamashita, R. Roy, J. M. Egly, D. L. Bentley, Thetranscriptional elongation inhibitor 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole inhibits transcription factor IIH-associatedprotein kinase. J Biol Chem 270, 23922-23925 (1995). 43. B. Gaertner, J. Zeitlinger, RNA polymerase II pausing duringdevelopment. Development 141, 1179-1183 (2014). 44. S. Alberti, A. Gladfelter, T. Mittag, Considerations andChallenges in Studying Liquid-Liquid Phase Separation and BiomolecularCondensates. Cell 176, 419-434 (2019). 45. A. G. Larson et al., Liquid droplet formation by HP1alphasuggests a role for phase separation in heterochromatin. Nature 547, 236-240(2017). 46. A. R. Strom et al., Phase separation drives heterochromatindomain formation. Nature 547, 241-245 (2017). 47. M. Yu et al., Visualizing the disordered nuclear transportmachinery in situ. Nature, (2023). 48. A. Molliex et al., Phase separation by low complexity domainspromotes stress granule assembly and drives pathological fibrillization. Cell163, 123-133 (2015). 49. D. S. W. Protter, R. Parker, Principles and Properties of StressGranules. Trends Cell Biol 26, 668-679 (2016). 50. M. Boehning et al., RNA polymerase II clustering through carboxy-terminal domain phase separation. Nature Structural&Molecular Biology 25,833-+ (2018). 51. X. Han et al., Roles of the BRD4 short isoform in phaseseparation and active gene transcription. Nat Struct Mol Biol 27, 333-341(2020). 52. F. X. Chen, E. R. Smith, A. Shilatifard, Born to run: control oftranscription elongation by RNA polymerase II. Nat Rev Mol Cell Biol 19, 464-478 (2018). 53. X. Bai et al., TIF1gamma controls erythroid cell fate byregulating transcription elongation. Cell 142, 133-143 (2010). 54. A. A. Perreault, J. D. Brown, B. J. Venters, ErythropoietinRegulates Transcription and YY1 Dynamics in a Pre-established ChromatinArchitecture. iScience 23, 101583 (2020). 55. D. J. Taatjes, A. M. Naar, F. Andel, 3rd, E. Nogales, R. Tjian,Structure, function, and activator-induced conformations of the CRSPcoactivator. Science 295, 1058-1062 (2002). 56. D. J. Taatjes, R. Tjian, Structure and function of CRSP / Med2; apromoter-selective transcriptional coactivator complex. Mol Cell 14, 675-683(2004). 57. F. A. Ran et al., Genome engineering using the CRISPR-Cas9system. Nat Protoc 8, 2281-2308 (2013). 58. D. B. Mahat et al., Base-pair-resolution genome-wide mapping ofactive RNA polymerases using precision nuclear run-on (PRO-seq). Nat Protoc11, 1455-1476 (2016). 59. H. S. Kaya-Okur et al., CUT&Tag for efficient epigenomicprofiling of small samples and single cells. Nat Commun 10, 1930 (2019). 60. C. Fellmann et al., An optimized microRNA backbone for effectivesingle-copy RNAi. Cell Rep 5, 1704-1713 (2013). 61. L. Florens et al., Analyzing chromatin remodeling complexes usingshotgun proteomics and normalized spectral abundance factors. Methods 40,303-311 (2006). 62. Y. Zhang, Z. Wen, M. P. Washburn, L. Florens, Refinements tolabel free proteome quantitation: how to deal with peptides shared bymultiple proteins. Anal Chem 82, 2272-2281 (2010). 63. A. C. Paoletti et al., Quantitative proteomic analysis ofdistinct mammalian Mediator complexes using normalized spectral abundancefactors. Proc Natl Acad Sci U S A 103, 18928-18933 (2006). 64. S. Pott, J. D. Lieb, What are super-enhancers? Nat Genet 47, 8-12(2015). 65. D. Hnisz et al., Super-enhancers in the control of cell identityand disease. Cell 155, 934-947 (2013). 66. L. S. Ludwig et al., Transcriptional States and ChromatinAccessibility Underlying Human Erythropoiesis. Cell Rep 27, 3228-3240 e3227(2019). 67. B. D. Pope et al., Topologically associating domains are stableunits of replication-timing regulation. Nature 515, 402-405 (2014)。

Claims

1. A method for promoting erythroid differentiation, comprising administering to erythroid precursor cells a substance that increases the suspension of RNA polymerase II mediated by the mediator complex subunit 26 (MED26) polypeptide in the cells.

2. The method of claim 1, wherein the substance increases the interaction between MED26 and transcriptional pausing factors in the cell, such as negative elongation factor (NELF), DRB sensitivity inducible factor (DSIF), or factors in the polymerase-associated factor (PAF) complex, particularly PAF1.

3. The method according to claim 1, wherein the substance increases the occupancy of MED26 at superenhancer sites, for example, superenhancers selected from the CDK6, BCL2, HMGA1, MYB, RPS14, RPL36AL, and RPL27 genes.

4. The method according to any one of the preceding claims, wherein the substance comprises a MED26 polypeptide or an active fragment thereof, or a nucleic acid encoding the active fragment.

5. The method of claim 4, wherein the active fragment comprises an inherent disorder region (IDR) of the MED26 polypeptide, and more specifically, the active fragment comprises a polypeptide having at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:

17.

6. The method of claim 5, wherein the active fragment comprises the TFIIS domain and intrinsically disordered region (IDR) of the MED26 polypeptide, and more specifically, the active fragment comprises a polypeptide having at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:

2.

7. The method according to any one of the preceding claims, wherein the substance comprises a MED26 polypeptide or a nucleic acid encoding the MED26 polypeptide, more specifically, the MED26 polypeptide comprises a polypeptide having at least 90%, for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:

1.

8. A method for promoting erythroid differentiation, comprising administering to an erythroid precursor a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 17 or a polynucleotide encoding the polypeptide.

9. The method of claim 8, wherein the polypeptide comprises the amino acid sequence shown in SEQ ID NO:

2.

10. The method of claim 9, wherein the polypeptide comprises the amino acid sequence shown in SEQ ID NO:

1.

11. The method according to any one of the preceding claims, wherein the erythroid precursor is a hematopoietic stem and progenitor cell (HSPC), such as a CD34+ HSPC.

12. The method according to any one of claims 1-10, wherein the erythroid precursor is an erythroblast, for example, an erythroblast derived from CD34+ HSPCs.

13. The method according to any one of the preceding claims, wherein the substance is applied in vitro to the erythroid precursor.

14. The method according to any one of the preceding claims, wherein the substance is administered in vivo to a subject in need of an erythroid precursor.

15. The method of claim 14, wherein the subject requires treatment for a disease associated with erythroid differentiation deficiency.

16. The method of claim 15, wherein the disease associated with erythroid differentiation defect is a myelodysplastic syndrome, such as refractory anemia or refractory cytopenia, erythroid dysplasia, bone marrow failure, or megaloblastic anemia.

17. A method for identifying substances that promote erythroid differentiation, comprising: a. Provide a composition comprising the MED26 peptide or an active fragment thereof; b. Contact the composition with the test substance; and c. Assess whether the test substance enhances the ability of MED26 to mediate RNA polymerase II pausing.

18. The method of claim 17, wherein the evaluation step includes evaluating the ability of the test substance to promote the formation of MED26 aggregates, interact with transcriptional pausing factors, and / or occupy super-enhancer sites.

19. A composition comprising a substance that increases the pausing of RNA polymerase II mediated by the MED26 polypeptide.

20. A method for delivering a reagent to cells, comprising: a. Prepare aggregates comprising the MED26 polypeptide or its active fragment and the reagent; as well as b. Contact the cells with the aggregate. The MED26 polypeptide or its active fragment thereby delivers the reagent to the cells.

21. The method of claim 20, wherein the reagent is a nucleic acid, such as one or more RNA or DNA molecules.

22. The method according to claim 20 or 21, wherein the MED26 polypeptide or its active fragment comprises an amino acid sequence having at least 75%, for example at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

16.

23. The method of claim 22, wherein the MED26 polypeptide or its active fragment comprises an amino acid sequence having at least 75%, for example at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO:

15.

24. The method of claim 22, wherein the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15 or SEQ ID NO:

16.

25. The method of claim 22, wherein the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO:

12.

26. The method of claim 22, wherein the MED26 polypeptide or its active fragment comprises the amino acid sequence of SEQ ID NO:

2.

27. The method according to any one of claims 21-26, wherein the nucleic acid encodes one or more components for gene editing.

28. The method of claim 27, wherein the gene editing comprises CRISPR gene editing, and the nucleic acid encodes one or more of CRISPR RNA (crRNA), tracrRNA hybridized with said crRNA, and Cas endonuclease (e.g., Cas9, Cas12, Cas13), preferably, the nucleic acid encodes a single guide RNA comprising said crRNA and said tracrRNA and / or said Cas endonuclease, more preferably, the nucleic acid encodes said single guide RNA and Cas9 endonuclease.

29. The method according to claim 27 or 28, wherein the nucleic acid is a DNA molecule, such as plasmid DNA.

30. The method according to claim 27 or 28, wherein the nucleic acid is RNA, such as mRNA.

31. The method according to any one of claims 21-26, wherein the reagent is a DNA molecule, such as circular DNA (e.g., plasmid DNA) or linear DNA (e.g., antisense DNA).

32. The method according to any one of claims 21-26, wherein the reagent is RNA, such as mRNA, siRNA, antisense RNA, linear RNA, circular RNA or tRNA.

33. The method according to any one of claims 20-32, wherein the step of preparing the aggregate comprises mixing the reagent with the MED26 polypeptide or an active fragment thereof in an aqueous buffer.

34. The method of claim 33, wherein the buffer further comprises polyethylene glycol (PEG).

35. The method of claim 34, wherein the buffer solution comprises 1-30% (w / v) PEG, such as 2-20% (w / v) PEG, e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14% or 15% (w / v) PEG, preferably 10% (w / v) PEG.

36. The method according to any one of claims 20-35, wherein the step of preparing the aggregate comprises mixing the reagent with 1-200 μM, preferably 5-150 μM, such as 5, 10, 25, 50, 75, 100, 125 or 150 μM, more preferably 10 μM of the MED26 polypeptide or its active fragment.

Images