Debaryomyces hansenii engineering bacterium as well as construction method and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a debaryomyces hansenii engineering bacterium as well as a construction method and application thereof. On the basis of wild debaryomyces hansenii, NRG1 coding is ineffective, and engineering bacteria are obtained; the thallus biomass of the engineering bacterium Dh delta NRG1 is obviously improved compared with that of wild debaryomyces hansenii. The invention provides a debaryomyces hansenii engineering strain, and provides a new strategy for low-cost and efficient industrial production of microbial protein. Meanwhile, the invention also discloses a new function of the NRG1 gene in microbial biomass regulation and control, and provides a new gene modification target for developing high-yield single-cell protein industrial strains.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to an engineered strain of Hansenula barley yeast, its construction method, and its application. Background Technology

[0002] Livestock and poultry manure is high in organic matter and is a carbon source with great application potential. Converting it into methane through anaerobic fermentation is an effective means of reducing livestock and poultry manure waste and utilizing it as a resource. However, while reducing waste and producing biogas / biomethane, it also generates a large amount of biogas slurry with high ammonia nitrogen concentrations.

[0003] Biogas slurry has a high ammonia nitrogen content, a low carbon-to-nitrogen ratio, and contains unknown growth inhibitors, which limits the utilization of biogas slurry by microorganisms. Even though there are some technologies that use microorganisms to treat biogas slurry and produce single-cell protein, they still have drawbacks such as long fermentation time, low yield or rate of single-cell protein, and low ammonia nitrogen utilization rate, making it difficult to put them into practical production applications.

[0004] Therefore, if we can specifically modify microorganisms to provide engineered bacteria that can more efficiently utilize ammonia nitrogen to produce bacterial proteins, it will have good application prospects. Summary of the Invention

[0005] The purpose of this invention is to provide an engineered strain of Hansenula barley yeast, its construction method, and its application.

[0006] To achieve the above-mentioned objectives, the technical solution adopted in this invention is: transcription factor NRG1, obtained by invalidating the encoding of the original transcription factor NRG1, the nucleotide sequence of the original transcription factor NRG1 is shown in SEQ ID No: 1.

[0007] Accordingly, the DNA encoding the transcription factor NRG1 as described in claim 1.

[0008] Accordingly, a recombinant plasmid containing nucleotides expressing the amino acids corresponding to the transcription factor NRG1. Accordingly, an expression plasmid containing the DNA.

[0009] Accordingly, the application of the transcription factor NRG1 or the DNA in increasing microbial biomass and / or somatic protein production and / or improving microbial ammonia nitrogen utilization, wherein the microorganism is *Hansophila baryensis*. Alternatively, it can be obtained by replacing the original transcription factor NRG1 in *Hansophila baryensis* with the aforementioned transcription factor NRG1.

[0010] Correspondingly, an engineered strain of *Debaryomyces hansenii* was obtained by either disabling the original transcription factor NRG1 encoding gene or knocking out the NRG1 encoding gene from the wild-type *Debaryomyces hansenii*. The wild-type *Debaryomyces hansenii* was deposited on July 15, 2021, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 22903.

[0011] Accordingly, the application of the engineered Hansenula barley yeast in biogas slurry treatment or ammonia nitrogen treatment involves inoculating the engineered Hansenula barley yeast into the biogas slurry or ammonia nitrogen environment to be treated. Alternatively, the application of the engineered Hansenula barley yeast in the production of cell protein.

[0012] This invention offers the following advantages: Based on wild-type *Hansenula d'Barry*, this invention prevents the normal translation of the NRG1 encoding gene, thereby obtaining the engineered strain DhΔNRG1. The cell biomass of DhΔNRG1 is significantly increased compared to wild-type *Hansenula d'Barry*. This invention provides a novel engineered *Hansenula d'Barry* strain, offering a new strategy for low-cost, high-efficiency industrial production of microbial proteins. Simultaneously, this invention also reveals a novel function of the NRG1 gene in microbial biomass regulation, providing a new genetic modification target for developing high-yield single-cell protein industrial strains. Attached Figure Description

[0013] Figure 1 This is a schematic diagram of the CRISPR / Cas9 gene editing vector pBP9-NRG1 for NRG1.

[0014] Figure 2 This is a gel electrophoresis image of BP9 digested with BbsI.

[0015] Figure 3 Gel electrophoresis image of positive transformants for colony PCR verification;

[0016] Figure 4 Sequencing peak diagram of the CRISPR / Cas9 gene editing vector pBP9-NRG1 for NRG1;

[0017] Figure 5 Gel electrophoresis image of the sgRNA target sequence region of the NRG1 gene amplified by PCR;

[0018] Figure 6 A sequence of sequencing peaks after CRISPR editing;

[0019] Figure 7 This is a schematic diagram of the growth curves of wild-type Hansenula barley yeast and engineered strain DhΔNRG1. Detailed Implementation

[0020] This invention provides a novel engineered strain of *Debaryomyces hansenii*. The wild-type *Debaryomyces hansenii* was deposited on July 15, 2021, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 22903; it is also disclosed in the inventor's prior patent CN 113913309B.

[0021] Based on wild-type *Hansenula baiji*, the engineered bacteria were obtained by knocking out the original transcription factor NRG1 coding gene, or by rendering the original transcription factor NRG1 coding gene ineffective. The ineffectiveness of the original transcription factor NRG1 coding gene means that the NRG1 gene cannot be translated normally to obtain the corresponding protein, or the protein obtained after translation loses its original normal function. Specifically, this can be achieved by knocking out one or more coding bases in NRG1 to terminate translation prematurely, or by directly knocking out the entire NRG1 coding gene. In this embodiment of the invention, the engineered bacteria were prepared by knocking out the 163rd base of the NRG1 coding gene. This invention found that, compared to the wild type, the engineered bacteria can utilize ammonia nitrogen in biogas slurry more efficiently, increasing bacterial biomass and obtaining bacterial protein.

[0022] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the data obtained are all average values ​​obtained after at least three repetitions, and each repetition is valid data.

[0023] Example 1: Construction of engineered Hansenula d'Barry yeast

[0024] 1. Construct a CRISPR / Cas9 gene editing vector for NRG1. The structure of this vector is as follows: Figure 1 As shown, the specific construction process is as follows:

[0025] (1) Using the EuPaGDT online tool (http: / / grna.ctegd.uga.edu / ), knockout target sites were designed; the NRG1 gene nucleotide sequence (SEQ ID NO: 1) was entered into the website to generate a 20bp sgRNA target sequence T1, the T1 sequence is as follows:

[0026] T1: 5'-TCATTGCACTGAGTGGATGG-3' (SEQ ID NO: 2)

[0027] The target sequence T1 was padded with the sticky ends formed by BP9 plasmid digestion with BbsI to generate the corresponding Oligo sequences NRG1-F (SEQ ID NO: 3) and NRG1-R (SEQ ID NO: 4), as follows:

[0028] NRG1-F: 5'-TGCGCAGTCATTGCACTGAGTGGATGG-3'

[0029] NRG1-R: 5'-AAACCCCATCCACTCAGTGCAATGACTG-3'

[0030] The above NRG1-F and NRG1-R sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as "Sangon Biotech"). The synthesized NRG1-F and NRG1-R primers were dissolved in water to 100 μM.

[0031] (2) Preparation of Oligo dimer: Prepare annealing reaction system (upstream primer NRG1-F 5μL, downstream primer NRG1-R 5μL, ddH2O 40μL); after mixing all components, centrifuge briefly, place in 100℃ water to cool and renature naturally to obtain Oligo dimer.

[0032] (3) Preparation of CRISPR / Cas9 linear vector backbone: BP9 plasmid was digested with BbsI restriction endonuclease and the linear vector backbone was recovered.

[0033] The BP9 plasmid refers to Pug6-pTEF1-Cas9-tCYC1-gRNA. The construction procedure can be found in the literature "A CRISPR / Cas9 method facilitates efficient oligo-mediated gene editing in Debaryomyceshansenii", DOI 10.1093 / synbio / ysab031. The overall construction method is as follows: the two main components of the CRISPR system are the Cas9 protein expression element (pDhTEF1-Cas9-tCYC1) and the sgRNA expression element (pSCR1-tRNA). GlyThe promoter for the Cas9 gene was determined to be TEF-1, derived from *Hansenula d'Barry*, and the terminator was CYC1, derived from *Saccharomyces cerevisiae*. The Cas9 gene (without introns) was derived from plasmid Peft-3::Cas9-SV40_NLS::tbb-2_3'UTR (Addgene#46168). The promoter for the sgRNA expression cassette was selected as the SCR1 promoter, and the terminator was polyT. The backbone of the *E. coli* and yeast shuttle vectors was selected as pUG6, containing ampicillin resistance and G418 resistance genes.

[0034] For the *Debaryomyces hansenii* used in this invention, the specific construction process has been modified in several ways: First, the backbone plasmid for the *E. coli* and yeast shuttle vector was pUG6, purchased from Miaoling Biotechnology (https: / / www.miaolingbio.com / plasmid / P0104); second, the promoter for the Cas9 gene was TEF-1, derived from the wild-type *Debaryomyces hansenii* used in this invention. The specific operations involved were as follows: Genomic DNA of *Debaryomyces hansenii* was extracted using a yeast genomic DNA extraction kit, and the promoter pTEF1 was obtained by PCR amplification using pTEF1-KpnI-F and pTEF1-EcoRI-R as primers.

[0035] SEQ ID NO: 5, pTEF1-KpnI-F (from D. hansenii):

[0036] 5'-AGAGCAGATTGTACTGAGAGTGCACGGTACCACAGCCATAACAACATATAGAT ACA-3'

[0037] SEQ ID NO: 6, pTEF1-EcoRI-R (from D. hansenii):

[0038] 5'-CGTGAATGTAAGCGTGACATAACTAATTACATGATTTGCTTAAT-3'

[0039] Prepare the enzyme digestion reaction system on ice (1 μL BbsI, 2 μL FastDigest Green Buffer, 2 μL BP9 plasmid (500 ng / μL), 15 μL ddH2O), gently pipette to mix, centrifuge briefly, incubate at 37°C for at least 6 hours, and recover the vector backbone (large fragment) according to the instructions of the AxyPrep DNA Gel Recovery Kit to obtain the CRISPR / Cas linear vector backbone.

[0040] The gel electrophoresis image after BP9 digestion with BBSI is shown below. Figure 2 As shown. Figure 2 From left to right: Wells 1-8; Well 1: Marker 10000 band sizes are 100bp, 250bp, 500bp, 750bp, 1000bp, 1500bp, 2000bp, 3000bp, 5000bp, and 10000bp respectively; Wells 2-7: BP9 after enzyme digestion, the size of the vector backbone band after enzyme digestion is 9448bp; Well 8: Marker 15000.

[0041] (4) Construct the Oligo dimer into the CRISPR / Cas9 linear vector backbone: Prepare the ligation reaction system on ice (0.6 μL CRISPR / Cas9 linear vector backbone, 0.2 μL Oligo dimer, 2 μL 10×T4 DNA ligase buffer, 0.5 μL T4 DNA ligase, and finally add ddH2O to 20 μL), mix well, centrifuge briefly, incubate overnight at 37°C, and inactivate at 65°C for 10 min.

[0042] (5) Transform the above reaction system into Escherichia coli: Take out competent E. coli DH5α cells (Beijing Qingke Biotechnology Co., Ltd.) from the -80℃ freezer and thaw them on ice; take 50 μL of competent cells, add 5 μL of the reaction system prepared in step (4), mix gently, and incubate on ice for 30 min; then place in a 42℃ water bath, heat shock for 45 s, and immediately place on ice to cool for 2-3 min; then add 800 μL of antibiotic-free LB liquid medium, and culture in a constant temperature shaker (37℃, 200 rpm) for 1 h, centrifuge at 5000 rpm for 5 min, and discard part of the supernatant; resuspend the bacterial cells with the remaining 100 μL of medium, and gently spread them evenly on an LB plate containing 100 μg / mL ampicillin using a sterile spreader, and incubate upside down in a 37℃ incubator until colonies appear.

[0043] Single colonies of the correct morphology and size were selected and transferred to LB liquid medium containing 100 μg / mL ampicillin. After turbidity, colony PCR was performed to amplify the portion containing the sgRNA expression element. The PCR reaction system was 25 μL, including 12.5 μL of 2×PCRMix, 1 μL of bacterial cells, 0.5 μL of upstream primer NRG1-F, 0.5 μL of downstream primer T7 promoter-pre-cut-R, and 10.5 μL of ddH2O. The PCR reaction conditions were as follows: 94℃ for 2 min; 94℃ for 30 s, 67℃ for 30 s, 72℃ for 70 s, 35 cycles; 72℃ for 2 min. The upstream primer NRG1-F (SEQ ID NO: 3) and the downstream primer T7 promoter-pre-cut-R (SEQ ID NO: 7) for colony PCR are as follows:

[0044] NRG1-F: 5'-TGCGCAGTCATTGCACTGAGTGGATGG-3'

[0045] T7 promoter-pre-cut-R: 5'-GAGACCGGCAGATCCGCGGC-3'

[0046] The PCR products were subjected to agarose gel electrophoresis, and the results are as follows: Figure 3 As shown. From left to right, wells 1-2 are labeled. Well 1: Marker2000 band sizes from bottom to top are 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp; Well 2: Region containing sgRNA expression elements amplified by PCR. The results indicate that the band size in Well 2 is correct.

[0047] The bacterial culture containing the positive band was sent to Sanger sequencing at Sangon Biotech, and positive strains were obtained through sequencing screening. The sequencing peak diagram of the NRG1 gene-editing vector is shown below. Figure 4 As shown in the figure. The results indicate that the sequencing was correct and the NRG1 gene editing vector was successfully constructed.

[0048] (6) Extracting plasmids to obtain the CRISPR / Cas9 gene editing vector pBP9-NRG1 for NRG1: Take positive bacterial culture, shake the bacteria, and extract plasmids (according to the instructions of the OMEGA plasmid extraction kit). The CRISPR / Cas9 gene editing vector pBP9-NRG1 for NRG1 was successfully obtained.

[0049] 2. Preparation of Hansenula d'Bary yeast competent cells, the specific process is as follows:

[0050] Wild-type *Hansenula d'Barry* was streaked onto YPD plates. A single colony was picked and inoculated into a test tube containing 5 mL of YPD liquid medium. The culture was incubated overnight at 30°C and 180 rpm until turbidity was reached. 50 μL of the culture was then inoculated into a 250 mL Erlenmeyer flask containing 50 mL of YPD liquid medium and incubated overnight at 28°C and 180 rpm until OD reached [value missing]. 600 When the pH reaches 0.6–1.0, immediately place the cells in an ice-water mixing bath for rapid cooling for 10 min. Then centrifuge the bacterial suspension at 4°C, 10000g for 3 min, and discard the supernatant. Gently resuspend the precipitate in 40 mL of 50 mM PB cell washing buffer (PB cell washing buffer, freshly prepared, preparation method: 50 mM pH = 7.5 phosphate (PB) buffer; before use, add 1 mL of 1 M DTT solution to every 40 mL of PB buffer, pH = 7.5), and incubate at 28°C for 20 min, inverting several times during incubation. Wash the cells twice with 40 mL of sterile ddH2O and resuspend them in 1 mL of pre-chilled 1 M sorbitol. Centrifuge the cell suspension at 4°C, 10000g for 3 min, aspirate and discard the supernatant; resuspend the cells in pre-chilled 1 M sorbitol solution to obtain competent Hansenula haematococcus cells.

[0051] 3. Electroporation of the NRG1 CRISPR / Cas9 gene editing vector into Hansenula bary yeast: The plasmid of the NRG1 gene editing vector constructed in step 1 was electroporated into competent Hansenula bary yeast cells from step 2. The specific electroporation process was as follows: 1 μg of plasmid was added to a 1.5 mL pre-chilled centrifuge tube, followed by 80 μL of competent cells, and the mixture was allowed to stand for 5 min. The mixture was then transferred to a pre-chilled 2 mm electroporation cup (BioRad), the electroporation chamber was inserted, the lid was closed, and electroporation was immediately performed using a MicroPulser electroporator (BioRad) at 2.3 kV. After a single electric shock, the cells were rapidly and gently resuspended in 800 μL of pre-cooled resuscitation solution (90 mL of resuscitation YPD solution: 1 g yeast extract, 2 g peptone, 18.2 g sorbitol, brought to a final volume of 90 mL, sterilized at 115°C for 20 min. Resuscitation solution: resuscitation YPD solution and 20% glucose mixed at a 9:1 volume ratio). The solution was transferred to clean 1.5 mL centrifuge tubes and incubated at 28°C for 0.5–1 h, inverting several times during this period. The culture was centrifuged at 10,000 g for 1 min, the supernatant was discarded, and 100 μL of sterile YPD medium was added. The mixture was vortexed until homogeneous, and 40 μL was gently spread onto a YPD selection plate containing G418 resistance. The plate was then incubated upside down at 28°C until colonies appeared.

[0052] YPD screening plates (450mL): Before use, add glucose: 5g yeast powder, 10g peptone, 27.3g sorbitol, and bring the volume to 450mL; dispense 90mL of liquid into 250mL Erlenmeyer flasks, add 1.5g agar powder per 100mL, and autoclave at 115℃ for 20min; before use, microwave to melt, cool to about 70℃, add 10mL of 20% glucose per 90mL, mix well, add 400μL of G418 sulfate stock solution (100mg / mL) below 60℃ to a final concentration of 400mg / L, mix thoroughly, and pour into plates.

[0053] 4. Obtaining and identifying NRG1 knockout strains: Single colonies were picked from screening plates and cultured in 1.5 mL of YPD liquid medium containing G418 resistance for 2 days. Validation primers NRG1-YF and NRG1-YR were designed, and the sgRNA target sequence region of the NRG1 gene was amplified by PCR. After verification by Sanger sequencing, the gene knockout yeast strains were obtained. The sequences of the validation primers NRG1-YF and NRG1-YR are as follows:

[0054] NRG1-YF:5'-GCGATTACACGAATATAAGGCATC-3'(SEQ ID NO: 8)

[0055] NRG1-YR:5'-GGCCACGGACAAAAATGTTTTC-3'(SEQ ID NO: 9)

[0056] Yeast cultured for 2 days was centrifuged at 5000 rpm for 5 min. The cell pellet was lysed using the alkaline lysis method and used as a PCR template. The PCR reaction mixture was 25 μL, containing 12.5 μL of 2×PCR Mix, 3 μL of cell lysis buffer, 0.5 μL of upstream primer NRG1-verification F, 0.5 μL of downstream primer NRG1-verification R, and 8.5 μL of ddH2O. PCR reaction conditions: 94℃ for 2 min; 94℃ for 30 s, 57℃ for 30 s, 72℃ for 17 s, 35 cycles; 72℃ for 2 min. The PCR products were subjected to agarose gel electrophoresis, and the results are shown below. Figure 5 As shown in the image. From left to right, wells 1-9 are labeled. Well 1: Marker2000 band sizes from bottom to top are 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp; Wells 2-8: NRG1 target sequence region amplified by PCR; Well 9: CK. PCR products with correct band size, clear and clean bands, and no extraneous bands were sent to Sanger sequencing by Sangon Biotech. The sequencing peak diagram after CRISPR editing is shown below. Figure 6 As shown in Table 1, the results indicate that the base A at the target sequence of the sgRNA was successfully knocked out.

[0057] Table 1. Wild-type and ΔNRG1 sequence comparison table

[0058] strain sequence wild type TCATTGCACTGAGTGGATGG DhΔNRG1 TCATTGCACTGAGTGG-TGG

[0059] The sequencing results were compared with the target gene sequence. Samples in which the bases at the target sequence were cleaved and the number of cleaved bases was not 3N were amplified and kept at -80℃ to obtain the engineered strain of Hansenula barley yeast: NRG1 knockout strain DhΔNRG1.

[0060] Example 2: Growth performance of engineered Hansenula haematobium yeast

[0061] Wild-type *Hansenula d'Barry* and the NRG1 knockout strain DhΔNRG1 were taken from a -80℃ freezer, activated by streaking on YPD plates, and single colonies were picked and inoculated into Erlenmeyer flasks containing 20 mL of YPD medium. The cultures were incubated overnight at 28℃ and 180 rpm until turbidity was achieved, yielding primary seed culture. The primary seed culture of both strains was then adjusted to OD values ​​using sterile YPD medium. 600 The value was 0.85, yielding secondary seed culture. The secondary seed culture was inoculated into chicken manure biogas slurry medium at a 10% (v / v) inoculation rate and cultured at 28℃ with shaking at 200 rpm for 72 h. Each group was repeated three times.

[0062] The chicken manure biogas slurry came from a biogas project in Shandong Province, a batch from July 2025. It had been ultrafiltered and stored at 4℃. Preparation method for the chicken manure biogas slurry culture medium: Take the chicken manure biogas slurry, sterilize it at 115℃ for 20 minutes, then add the sterilized biogas slurry, sterile water, and glucose according to the specific ammonia nitrogen concentration and C / N ratio, and adjust the pH to a suitable level with sulfuric acid; unless otherwise specified, the ammonia nitrogen concentration is 1400 mg / L, glucose is 16 g / L, pH = 7.5, and C / N = 4.57.

[0063] During the above culture process, the absorbance values ​​of wild-type Hansenula d'Bary yeast and DhΔNRG1 at a wavelength of 600 nm were measured at regular intervals using a microplate reader (the average value was taken), and growth curves were plotted. The results are as follows: Figure 7 As shown in the figure. The results showed that the knockout strain DhΔNRG1 grew faster in chicken manure slurry medium than the wild type.

[0064] After 72 hours of fermentation, the dry weight (DCW) of the cells was determined by drying and weighing. The results are shown in Table 2. The average biomass of DhΔNRG1 was 30.78% higher than that of the wild type.

[0065] Table 2. Bacterial cell dry weight comparison table

[0066] repeat Wild-type dry weight Dry weight of DhΔNRG1 cells Repeat 1 5.63g / L 6.99g / L Repeat 2 5.26g / L 6.84g / L Repeat 3 5.19g / L 7.20g / L

[0067] Example 3: Demonstration of the ability of engineered Hansendberry yeast to utilize biogas slurry

[0068] In this embodiment, the fermentation substrate is the chicken manure biogas slurry liquid culture medium of Example 2, but the ammonia nitrogen concentration and other parameters are adjusted according to the requirements of each group. If there are no special requirements, it is the same as Example 2.

[0069] 1. Effect of inoculation age on single-cell protein production. NRG1 knockout strain DhΔNRG1 seeds were taken from a -80℃ freezer, activated by streaking on YPD plates, and single colonies were picked and inoculated into test tubes containing 5 mL of YPD medium. The cultures were incubated overnight at 28℃ and 180 rpm until turbidity was achieved, yielding primary seed culture. The primary seed culture was inoculated into YPD medium at a rate of 0.05% (v / v) and cultured at 28℃ and 200 rpm for 12 h, 14 h, 16 h, 18 h, 20 h, 22 h, and 24 h, respectively, to obtain secondary seed cultures. Each secondary seed culture was inoculated into chicken manure biogas slurry medium at a rate of 10% (v / v) and cultured with shaking at 28℃ and 200 rpm for 72 h. After 72 h of culture, pH, DCW, residual ammonia nitrogen, and reducing sugar (glucose) content were measured. Each group was repeated three times, and the average value was taken. The results are shown in Table 3.

[0070] Table 3. Growth of DhΔNRG1 at different inoculation ages

[0071] Age at vaccination (h) pH DCW (g / L) Reducing sugar (g / L) Remaining ammonia nitrogen (mg / L) 12 8.10 6.83 0.01 659.99 14 8.41 6.48 0.00 724.91 16 8.38 7.47 0.00 697.05 18 8.32 7.91 0.00 667.21 20 8.29 7.89 0.00 661.21 22 8.28 8.02 0.00 647.27 24 8.29 7.95 0.00 647.01

[0072] Table 3 shows that the inoculation age of DhΔNRG1 seed culture significantly affects its DCW (dissolved cell size). When the inoculation age is less than 22 hours, the DCW of DhΔNRG1 in chicken manure biogas slurry medium generally increases with increasing inoculation age. However, when the inoculation age is greater than 22 hours, the DCW shows a flattening or decreasing trend with increasing inoculation age. This indicates that when the inoculation age is 22 hours, the number of DhΔNRG1 cells in the seed culture is moderate, and the cells are in an active metabolic state, enabling them to better adapt to the biogas slurry growth environment and achieve the highest fermentation biomass.

[0073] 2. Effect of pH on single-cell protein production. The initial pH of the chicken manure biogas slurry culture medium was adjusted to 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0 using H2SO4. Seed culture at 22 h inoculation age was inoculated into the chicken manure biogas slurry culture medium at each pH at an inoculation rate of 10% (v / v), and cultured at 28℃ and 200 rpm for 72 h. The results are shown in Table 4.

[0074] Table 4. Growth of DhΔNRG1 at different pH values

[0075] initial pH pH DCW (g / L) Reducing sugar (g / L) Remaining ammonia nitrogen (mg / L) 5.5 6.45 4.58 0.00 788.34 6.0 6.74 4.66 0.00 752.31 6.5 7.81 5.61 0.00 671.62 7.0 8.48 6.26 0.00 677.81 7.5 8.14 7.71 0.00 620.39 8.0 8.43 7.57 0.00 623.37 8.5 8.79 5.81 0.00 909.71 9.0 9.10 0.67 7.20 1040.11

[0076] Table 4 shows that DhΔNRG1 is difficult to tolerate highly alkaline biogas slurry with a pH of 8.5 or higher, and an overly acidic environment is not conducive to its growth. The content of DCW is highest when the initial pH is 7.5.

[0077] 3. Effect of ammonia nitrogen concentration on single-cell protein production. The C / N ratio of the chicken manure biogas slurry culture medium was controlled at 4.57. The initial ammonia nitrogen concentrations were adjusted to 800 mg / L, 1000 mg / L, 1200 mg / L, 1400 mg / L, 1600 mg / L, 1800 mg / L, 2000 mg / L, and 2200 mg / L (the amount of glucose in each group was adjusted accordingly to control the C / N ratio). The initial pH was adjusted to 7.5 with H2SO4. Seed culture from 22-h inoculated individuals was inoculated at a rate of 10% (v / v) into the chicken manure biogas slurry culture medium at different ammonia nitrogen concentrations and cultured at 28℃ and 200 rpm for 72 h. The results are shown in Table 5.

[0078] Table 5. Growth of DhΔNRG1 under different ammonia nitrogen concentrations

[0079] Ammonia nitrogen (mg / L) pH DCW (g / L) Reducing sugar (g / L) Remaining ammonia nitrogen (mg / L) Ammonia nitrogen utilization rate (%) 800 8.32 5.91 0.00 100.29 87.46 1000 8.43 6.74 0.00 302.11 69.79 1200 8.48 7.81 0.00 510.63 57.45 1400 8.50 8.22 0.00 597.87 57.30 1600 8.46 9.51 0.00 733.75 54.14 1800 8.49 10.14 0.00 816.11 54.66 2000 8.14 11.41 0.00 921.64 53.92 2200 8.66 2.14 11.25 1342.80 38.96

[0080] Table 5 shows that DhΔNRG1 is difficult to tolerate high ammonia nitrogen biogas slurry concentrations of 2200 mg / L. The ammonia nitrogen utilization rate reaches a maximum of 87.46% when the ammonia nitrogen concentration is 800 mg / L. The DCW content is highest at 11.41 g / L when the ammonia nitrogen concentration is 2000 mg / L.

[0081] 4. Effect of C / N ratio on single-cell protein production. In chicken manure biogas slurry culture medium with an ammonia nitrogen concentration of 2000 mg / L, the C / N ratio was adjusted to 1 / 1, 2 / 1, 3 / 1, 4 / 1, 5 / 1, 6 / 1, 7 / 1, 8 / 1, and 9 / 1 by adding anhydrous glucose. The initial pH was adjusted to 7.5 with H2SO4. Seed culture at 22 h inoculation age was inoculated into each chicken manure biogas slurry culture medium with a different C / N ratio at an inoculation rate of 10% (v / v), and cultured at 28℃ and 200 rpm for 72 h. The results are shown in Table 6.

[0082] Table 6. Growth of DhΔNRG1 under different C / N ratios

[0083]

[0084]

[0085] Wherein, SCP(%) refers to the single-cell protein content; substrate cell yield YX / S=ΔX / ΔS; ΔX is the increase in cell dry weight (g / L), and ΔS is the amount of substrate consumed (g / L).

[0086] As shown in Table 6, after 72 hours of culture, the highest DCW content (11.59 g / L) was observed when the C / N ratio was 6 / 1. Considering both DCW and cell yield, DhΔNRG1 showed the best economic benefits when the C / N ratio was 4 / 1, with a DCW content of 11.23 g / L.

[0087] 5. Effect of Fermentation Time on Single-Cell Protein Production. Based on the above experiments, the optimal bottle fermentation conditions for DhΔNRG1 in chicken manure biogas slurry were: inoculation age 22 h, initial pH = 7.5, initial ammonia nitrogen concentration 2000 mg / L, and initial C / N ratio 4 / 1. Under these optimal conditions, the culture was carried out at 28℃ and 200 rpm for 72 h. Samples were taken every 12 h to measure DCW, pH, ammonia nitrogen concentration, reducing sugar (glucose) concentration, and protein content in the culture medium. The results are shown in Table 7.

[0088] Table 7. Growth of DhΔNRG1 after different fermentation times.

[0089]

[0090] The results showed that the DCW gradually increased with increasing culture time, and the reducing sugar (glucose) was almost completely consumed by 36 hours. As the culture continued, the DCW hardly increased any further.

[0091] 6. Comparison with wild type. A secondary seed culture of wild-type Hansenula d'Barry yeast with an inoculation age of 22 h was prepared. The secondary seed culture of wild-type strain was inoculated into chicken manure biogas slurry medium under the optimal bottle fermentation conditions of DhΔNRG1 in chicken manure biogas slurry (the conditions in step 5) for fermentation. Different fermentation times were recorded, and the results are shown in Table 8.

[0092] Table 8. Fermentation of wild-type chicken manure biogas slurry culture medium

[0093]

[0094] The results showed that under the same conditions, the DhΔNRG1 engineered strain had a stronger comprehensive utilization capacity for ammonia nitrogen, producing more DCW and SCP. For example, at 60 hours, the DhΔNRG1 engineered strain produced 10.80 g / L of DCW, a 26.6% increase compared to the wild type (8.53 g / L). Meanwhile, comparing the remaining ammonia nitrogen and reducing sugar levels in the culture media in Tables 7 and 8 revealed that, at the same fermentation time, the DhΔNRG1 engineered strain consumed more ammonia nitrogen and relatively less reducing sugar compared to the wild type. This may be because NRG1 translation failure weakens the strain's regulatory effect on carbon source utilization preference. Wild-type yeast preferentially utilizes glucose as a carbon source, only switching to other carbon sources, such as acetic acid in the biogas slurry, after glucose is depleted. However, the DhΔNRG1 engineered strain can simultaneously utilize other carbon sources in the biogas slurry in the presence of glucose, making it more conducive to the conversion and utilization of ammonia nitrogen in the biogas slurry. However, it was also found that in the first 24 hours of fermentation, the DCW of the DhΔNRG1 engineered bacteria was slightly weaker than that of the wild type. This may be because the carbon metabolism pathway of the DhΔNRG1 engineered bacteria is dispersed, and some energy is used to synthesize enzymes that decompose other carbon sources, thus limiting the cell proliferation rate at the beginning of fermentation.

[0095] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Any modifications, alterations, substitutions, or variations made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention shall fall within the protection scope defined by the claims of the present invention.

Claims

1. Transcription factor NRG1, characterized in that: The original transcription factor NRG1 is obtained after the encoding of the original transcription factor NRG1 is disabled, and the nucleotide sequence of the original transcription factor NRG1 is shown as SEQ ID NO:

1.

2. DNA encoding the transcription factor NRG1 of claim 1.

3. A recombinant plasmid containing nucleotides expressing the amino acids corresponding to the transcription factor NRG1 of claim 1.

4. An expression plasmid containing the DNA of claim 2.

5. Use of the transcription factor NRG1 according to claim 1 or the DNA according to claim 2 for increasing the ammonia nitrogen utilization of a microorganism and / or increasing the biomass of a microorganism and / or producing microbial proteins, characterized in that: The microorganism is Hansenula dubuquensis.

6. An engineered strain of Debaryomyces hansenii, characterized in that: The engineering bacteria are obtained on the basis of wild-type Hansenula dubuquensis, after the encoding of the original transcription factor NRG1 is disabled, or after the encoding gene of the transcription factor NRG1 is knocked out.

7. An engineered strain of Debaryomyces hansenii, characterized in that: The engineering bacteria are obtained after the transcription factor NRG1 of claim 1 is used to replace the original transcription factor NRG1 in the wild-type Hansenula dubuquensis.

8. The engineered bacterium of claim 6 or 7, characterized in that: The wild-type Hansenula dubuquensis was preserved in the China General Microbiological Culture Collection Center on July 15, 2021, at an address of No. 1, Beichen West Road, Yard 3, Chaoyang District, Beijing, with a preservation number of CGMCC No. 22903.

9. The use of the engineered strain of Debaryomyces hansenii according to any one of claims 6 to 8 in the treatment of biogas slurry and / or ammonia, characterized in that: The Hansenula dubuquensis engineering bacteria are inoculated into the biogas slurry to be treated, and / or the Hansenula dubuquensis engineering bacteria are inoculated into the environment to be treated for ammonia nitrogen.

10. Use of the Hansenula dubuquensis engineering bacteria of any one of claims 6-8 in the production of bacterial proteins.

Images