Application of ZmCOP1a and ZmCOP1b proteins and coding genes thereof in regulation and control of plant yield
By regulating the expression or activity of ZmCOP1a and ZmCOP1b proteins, the problem of slowing maize yield growth was solved, a breakthrough in high-yield breeding was achieved, and loss-of-function alleles were provided for maize breeding, thus improving maize yield traits.
Patent Information
- Application Number
- CN202511579814.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-31
- Publication Date
- 2026-01-16
AI Technical Summary
In existing technologies, the growth rate of maize yield has slowed down, traditional hybrid breeding has reached a bottleneck period, and there is a lack of high-yield regulatory genes and molecular modules that can be quickly applied. In particular, the function of COP1 homologous genes in maize yield formation has not been fully elucidated.
By regulating the expression or activity of ZmCOP1a and ZmCOP1b proteins, recombinant vectors and gene editing technologies can be used to modulate the light signaling pathway in maize, thereby increasing or decreasing their expression levels or activities in maize and thus regulating plant yield.
It has achieved a significant increase in maize yield, broken through the limitations of traditional breeding, provided non-GMO loss-of-function alleles for high-yield breeding, shortened the breeding cycle, and improved traits such as ear length, kernel length, kernel width, number of kernels per ear, and kernel weight per ear.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of ZmCOP1a and ZmCOP1b proteins and their encoding genes in regulating plant yield. Background Technology
[0002] Maize is the world's highest-yielding food crop, and its yield level is directly related to food security and feed and energy supply. In the past two decades, the growth rate of global maize yield has slowed down, and traditional hybrid breeding has reached a bottleneck. There is an urgent need to discover high-yield regulatory genes and molecular modules that can be quickly applied.
[0003] Plant height, ear height, male and female ear development, and grain-filling efficiency are core agronomic traits that determine maize yield. These traits are synergistically regulated by endogenous carbon-nitrogen allocation, light signal transduction, and developmental timing. Existing research has largely focused on metabolic enzymes or transcription factors, but insufficient attention has been paid to the upstream regulatory nodes connecting environmental light signals and yield formation.
[0004] COP1 (CONSTITUTIVE PHOTOMORPHOGENIC 1) is a core E3 ubiquitin ligase in the light signaling pathway, negatively regulating photomorphogenesis by degrading downstream transcription factors. While the function and mechanism of COP1 are relatively clear in model plants, systematic reports are lacking regarding whether its homologs in crops participate in yield composition and whether there are loss-of-function alleles that can be used for breeding.
[0005] The maize genome contains two COP1 homologs, ZmCOP1a (Zm00001d018207) and ZmCOP1b (Zm00001d052138). Currently, only limited expression profile information is available, and the biological functions, mechanisms of action, and breeding potential of these genes in relation to plant height, ear height, ear and tassel development, and final grain yield remain unknown. Therefore, elucidating the functions of ZmCOP1a / b in maize yield formation and obtaining commercially viable loss-of-function or expression-regulating alleles is of significant practical importance for breeding high-yielding, high-density-tolerant, and lodging-resistant new varieties. Summary of the Invention
[0006] The main problem this invention aims to solve is to increase maize yield for use in maize breeding.
[0007] To address the problems existing in the prior art, the present invention provides the application of protein or gene expression substances or substances that regulate the activity or content of said proteins in regulating plant yield.
[0008] The application provided by this invention is the use of proteins or substances that regulate gene expression, or substances that regulate the activity or content of said proteins, in any of the following: 1) Application in regulating plant yield; 2) Application in the preparation of products that regulate plant yield; 3) Application in cultivating plants with altered yields; 4) Application in the preparation of products from plants with altered yields; 5) Applications in plant breeding; The protein is any of the following proteins: G1) A composition consisting of a protein whose amino acid sequence is SEQ ID No:2 and a protein whose amino acid sequence is SEQ ID No:4; G2) A protein whose amino acid sequence is SEQ ID No:2 or a protein whose amino acid sequence is SEQ ID No:4; G3) Proteins obtained by substituting and / or deleting and / or adding amino acid residues of G1) and G2) have more than 80% identity with the protein shown in A1) and have functions related to regulating plant yield. G4) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of G1) or G2).
[0009] The protein with the amino acid sequence described above, SEQ ID No:2, is named ZmCOP1a.
[0010] The protein with the amino acid sequence described above, SEQ ID No:4, is named ZmCOP1b.
[0011] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0012] In the aforementioned proteins, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0013] The protein mentioned in the above applications is derived from corn ( Zea mays L. ).
[0014] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the proteins ZmCOP1a and ZmCOP1b.
[0015] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).
[0016] In the above applications, the substances that regulate gene expression and the substances that regulate the activity or content of the protein can be biological materials related to the protein, and the biological materials can be any of the following: c1) The nucleic acid molecule that encodes the protein described above; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) Recombinant microorganisms containing the nucleic acid molecules described in c1), or recombinant microorganisms containing the expression cassette described in c2), or recombinant microorganisms containing the recombinant vector described in c3); c5) A transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2); c6) Transgenic plant tissue containing the nucleic acid molecules described in c1), or transgenic plant tissue containing the expression cassette described in c2); c7) A transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2); e1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the protein-coding genes mentioned above; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) Recombinant microorganisms containing the nucleic acid molecules described in e1), or recombinant microorganisms containing the expression cassette described in e2), or recombinant microorganisms containing the recombinant vector described in e3); e5) A transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2); e6) Transgenic plant tissue containing the nucleic acid molecules described in e1), or transgenic plant tissue containing the expression cassette described in e2); e7) A transgenic plant organ containing the nucleic acid molecule described in e1) or a transgenic plant organ containing the expression cassette described in e2).
[0017] In the above-mentioned biological materials, c1) the nucleic acid molecule is any of the following DNA molecules: d1) The nucleotide sequence is the DNA molecule shown in SEQ ID No:5; d2) The coding region sequence is the DNA molecule shown in SEQ ID No:1 in the sequence listing; d3) The nucleotide sequence is the DNA molecule shown in SEQ ID No:6; d4) The coding region sequence is the DNA molecule shown in SEQ ID No:3 in the sequence listing.
[0018] As a specific embodiment, the recombinant vector is the recombinant vectors pCAMBIA3301-ZmCOP1a-FL and pCAMBIA3301-ZmCOP1b-FL.
[0019] The structure of the pCAMBIA3301-ZmCOP1a-FL vector is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:7 between the BamHI and SacI restriction sites of the starting vector pCAMBIA3301, while keeping the other sequences of the pCAMBIA3301 vector unchanged. The pCAMBIA3301-ZmCOP1a-FL vector can express the ZmCOP1a protein, whose amino acid sequence is SEQ ID No:2.
[0020] The structure of the pCAMBIA3301-ZmCOP1b-FL vector is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:8 between the BamHI and SacI restriction sites of the starting vector pCAMBIA3301, while keeping the other sequences of the pCAMBIA3301 vector unchanged. The pCAMBIA3301-ZmCOP1b-FL vector can express ZmCOP1b, whose amino acid sequence is SEQ ID No:4.
[0021] The microorganisms mentioned in this article may be yeast, bacteria, algae, or fungi. Among them, bacteria may originate from the genus *Escherichia* (…). Escherichia Erwinia ( Erwinia Agrobacterium tumefaciens ( ), Agrobacterium tumefaciens Agrobacterium Flavobacterium ( Flavobacterium Alkalophytum genus ( Alcaligenes ), Pseudomonas ( Pseudomonas ), Bacillus spp. ( Bacillus (e.g., Agrobacterium tumefaciens EHA105).
[0022] The recombinant Agrobacterium may be EHA105 or GV3101.
[0023] Those skilled in the art can readily mutate the nucleotide sequences encoding the proteins ZmCOP1a and ZmCOP1b of this invention using known methods, such as directed evolution or point mutation. Artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the proteins ZmCOP1a and ZmCOP1b isolated in this invention, provided they encode and function as proteins ZmCOP1a and ZmCOP1b, are derived from and equivalent to the sequences of this invention.
[0024] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.
[0025] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.
[0026] In this document, the 80% or more of identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0027] The vectors described herein are known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cos plasmids), Ti plasmids, or viral vectors.
[0028] Existing plant expression vectors can be used to construct structures containing the aforementioned... ZmCOP1a and ZmCOP1bRecombinant gene expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthesis) and the untranslated regions transcribed at the 3' end of plant genes.
[0029] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.
[0030] This invention also provides a method for regulating plant yield.
[0031] The method for regulating plant yield provided by the present invention includes regulating plant yield by simultaneously regulating the expression of the encoding genes of proteins ZmCOP1a and ZmCOP1b, or regulating the activity and / or content of the proteins, or regulating the activity and / or content of the encoding genes of the proteins.
[0032] In this invention, the regulation can be increased, enhanced, or raised. The regulation can also be decreased, weakened, or reduced.
[0033] The present invention also provides a method for cultivating plants with altered yields.
[0034] The method for cultivating plants with increased yield provided by the present invention includes upregulating or enhancing or increasing the expression levels of the encoding genes of the proteins ZmCOP1a and ZmCOP1b in the target plant, and / or upregulating or enhancing or increasing the activity and / or content of the encoding genes of the proteins, thereby obtaining plants with increased yield.
[0035] In the above cultivation method, the upregulation, enhancement, or increase of the activity and / or content of the protein in the target plant, or / and the expression level of the protein encoding gene, can be obtained by introducing a recombinant expression vector containing nucleic acid molecules that upregulate, enhance, or increase the expression of the encoding genes of the proteins ZmCOP1a and ZmCOP1b into the recipient plant, thereby obtaining a target plant with increased plant yield.
[0036] In the above cultivation method, the inhibition, reduction, or silencing of the activity and / or content of the protein in the target plant, and / or the expression level of the gene encoding the protein, includes introducing a recombinant expression vector containing a nucleic acid molecule that inhibits, reduces, or silences the expression of the gene encoding the protein described above into the recipient plant, thereby obtaining a target plant with reduced plant yield; the gene encoding the protein described above.
[0037] The ZmCOP1a and ZmCOP1b The gene encodes the ZmCOP1a and ZmCOP1b proteins.
[0038] The importation refers to the use of recombination methods, including but not limited to Agrobacterium (…). Agrobacterium Introduced methods include mediated transformation, bio-projectile methods, electroporation, in-planta techniques, and more.
[0039] In this invention, the purpose of plant breeding may include cultivating plants with altered yields.
[0040] The increased yield is reflected in: ear length, grain length, grain width, number of grains per ear, weight of grains per ear, and weight of 100 grains.
[0041] In this invention, the proteins and / or the biological materials described above are also within the scope of protection claimed by this invention.
[0042] In this invention, the plant is any one of the following: C1) Monocotyledons; C2) Plants of the order Poales; C3) Gramineae plants; C4) Plants of the genus *Zea*; C5) Corn.
[0043] Maize photomorphology becomes a core regulatory factor ZmCOP1a ( Zm00001d018207 )and ZmCOP1b ( Zm00001d052138 The expression of this gene was significantly positively correlated with ear length, grain length, grain width, number of grains per ear, grain weight per ear, and yield traits of 100 grains; overexpression of this gene ( ZmCOP1-OE This improved its trait by 2.96–41.74%, while zmcop1a Single mutants showed a 2.75–24.29% reduction in the corresponding trait. zmcop1b The expression level decreased by 5.63–56.14%; the zmcop1a / b double mutant exhibited extreme female ear abortion and grain development defects, suggesting functional redundancy between the two mutants. ZmCOP1 regulates ear development and grain filling rate by coordinating light signals; its expression level can act as a "light signal-yield" molecular switch to achieve simultaneous improvement in plant architecture and grain yield.
[0044] Compared with the prior art, the present invention has the following advantages: (1) First explanation ZmCOP1a / b At the same time, it is regulating the elongation of maize female ears, the number of kernels and the weight of kernels, breaking through the previous limitation of only focusing on plant height / photomorphogenesis, and providing a new target for high-yield breeding with "one factor and multiple effects".
[0045] (2) Provide non-GMO, commercially viable loss-of-function alleles zmcop1a (R143*) and zmcop1b (Q299*) can be used directly for backcrossing or gene editing aggregation, with a short regulatory path and a breeding cycle that is 2–3 generations shorter than traditional QTL backcrossing.
[0046] (3) Construction ZmCOP1-OE The expression vector can simultaneously increase the number of grains per ear and the weight of 100 grains by more than 9%.
[0047] (4) Establish a quantitative model of “ZmCOP1 expression level - female ear traits - grain yield”, which can be superimposed with existing modules such as density tolerance and dehydration rate to realize multi-gene aggregation design, and is suitable for the breeding of high-yield maize varieties in different ecological zones. Attached Figure Description
[0048] Figure 1 Construction of ZmCOP1a and ZmCOP1b vectors and identification of transgenic lines. (a) Schematic diagram of the binary vectors used for ZmCOP1a and ZmCOP1b transformation. FL represents the 3×Flag tag; (b) Relative expression levels of ZmCOP1a and ZmCOP1b in transgenic maize lines. Samples were taken from the third leaf of V6 stage maize plants. Student's t-test was used. Double asterisks (**) indicate highly significant differences (P<0.01). Blue arrows mark lines used in subsequent studies.
[0049] Figure 2 Identification and amino acid sequence comparison of ZmCOP1a and ZmCOP1b mutants. (a, b) Genomic structure and mutation sites of ZmCOP1a(a); (b) Genomic structure and mutation sites of ZmCOP1b(b). Functional domains are labeled as follows: R for RING domain, CC for coil-coil domain, WD40 for WD40 repeat domain. An asterisk (*) indicates an introduced stop codon; red arrows mark nucleotide mutation sites; (c) Amino acid sequence alignment of ZmCOP1s.
[0050] Figure 3This is a double mutant phenotype. Morphological phenotypes of mature plants grown for 60 days under long-day (LD) conditions in July 2024 in Henan Province and for 65 days under short-day (SD) conditions in November 2023 in Hainan Province. Red arrows indicate male spikes. Scale bar = 20 cm, 5 mm, 2 cm.
[0051] Figure 4 ZmCOP1a and ZmCOP1b both regulate maize kernel size and yield. (a) Ear morphology of ZmCOP1a and ZmCOP1b lines grown for 87 days under short-day (SD, Hainan) conditions (B73, B104, single mutants, double mutants, and overexpression lines). Scale bar = 2 cm. (b) Ear length (n≥10) for the genotypes shown in (a); (c) and (d) kernel length (c) and width (d) phenotypes for the genotypes shown in (a). Scale bar = 1 cm; (e) Kernel length and width statistics for the genotypes shown in (a) (n≥50); (f) 100-kernel weight, number of kernels per ear, and kernel weight per ear (n≥10) for the genotypes shown in (a). One-way ANOVA was used, followed by multiple comparisons using Tukey's HSD test. The significance level was set at P<0.05. Detailed Implementation
[0052] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0053] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0054] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.
[0055] The B104 used in the following examples is from Wuhan Aidijing Biotechnology Co., Ltd.
[0056] In the examples below, B73 inbred lines and EMS-induced... zmcop1a (EMS4-080b8d) and zmcop1b(EMS4-11965c) is from the MEMD mutant library (http: / / maizeems.qlnu.edu.cn / ) and has been described in: Lu, X., Liu, J., Ren, W., Yang, Q., Chai, Z., Chen, R., Wang, L. et al. Gene-indexed mutations in maize. Mol. 717 Plant 11, (2018) 496-504. This biological material is available to the public from the applicant and is intended solely for the replication of experiments of this invention and may not be used for any other purpose.
[0057] Example 1: Obtaining ZmCOP1a and ZmCOP1b transgenic plants Two maize homologous genes were identified by BLAST searching the UniProt database (https: / / www.uniprot.org) using the amino acid sequence of Arabidopsis constituent photomorphogenetic 1 (COP1): ZmCOP1a (Gene ID) Zm00001d018207 )and ZmCOP1b (Gene ID) Zm00001d052138 ).
[0058] ZmCOP1a The coding sequence (CDS) of the gene in maize inbred line B73 is SEQ ID No:1, encoding the ZmCOP1a protein with the amino acid sequence SEQ ID No:2. The genomic gene encoding the ZmCOP1a protein in the genomic DNA of maize inbred line B73 is shown in SEQ ID No:5 of the sequence listing.
[0059] ZmCOP1b The coding sequence (CDS) of the gene in maize inbred line B73 is SEQ ID No:3, encoding the ZmCOP1b protein with the amino acid sequence SEQ ID No:4. The genomic gene encoding the ZmCOP1b protein in the genomic DNA of maize inbred line B73 is shown in SEQ ID No:6 of the sequence listing.
[0060] 1. Construction of overexpression plasmids Gene-specific primers ZmCOP1a / bF (5'-caggtcgactctagaggatccATGGGCGACTCCTCGGTGGC-3'), ZmCOP1a-R (5'-cgatcggggaaattcgagctcttacttgtcatcgtcatccttgtagtcgatgtcatgatctttataatcaccgtcatggtctttgtagtcg gtaccAGGAGCAAGTACAAGAACTTTTA-3') and ZmCOP1b-R (5'-cgatcggggaaattcgagctcttacttgtcatcgtcatccttgtagtcgatgtcatgatctttataatcaccgtcatggtctttgtagtcggtaccAGGAGCAAGTACATGAACTT-3'), amplified by PCR ZmCOP1a and ZmCOP1b The CDS region was determined. The PCR product was double-digested with BamHI and SacI and ligated into the corresponding site of the pCAMBIA3301 vector to obtain the binary expression vectors pCAMBIA3301-ZmCOP1a-FL and pCAMBIA3301-ZmCOP1b-FL (Figure 1a). The correctly sequenced plasmids were then infected with Agrobacterium and transformed into the maize B104 receptor by Wuhan Aidijing Biotechnology Co., Ltd.
[0061] The structure of the pCAMBIA3301-ZmCOP1a-FL vector is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:7 between the BamHI and SacI restriction sites of the starting vector pCAMBIA3301, while keeping the other sequences of the pCAMBIA3301 vector unchanged. The pCAMBIA3301-ZmCOP1a-FL vector can express the ZmCOP1a protein, whose amino acid sequence is SEQ ID No:2.
[0062] The structure of the pCAMBIA3301-ZmCOP1b-FL vector is described as follows: It is a recombinant vector obtained by inserting a DNA fragment with the sequence SEQ ID No:8 between the BamHI and SacI restriction sites of the starting vector pCAMBIA3301, while keeping the other sequences of the pCAMBIA3301 vector unchanged. The pCAMBIA3301-ZmCOP1b-FL vector can express ZmCOP1b, whose amino acid sequence is SEQ ID No:4.
[0063] 2. Transformation of maize overexpression strains The steps for converting ZmCOP1a and ZmCOP1b into corn are as follows: (1) Plasmid transformation Add 1 μL of recombinant plasmid to 50 μL of EHA105 Agrobacterium competent cells; mix thoroughly and transfer to an electroporation cuvette for electroporation. After electroporation, add 1 mL of LB liquid medium, mix thoroughly, and transfer to a 2 mL centrifuge tube. Incubate at 30°C and 180 rpm for 30 minutes with shaking. Inoculate 50 μL of the activated Agrobacterium culture onto LB solid medium and incubate in the dark at 30°C for 48 hours. Prepare OD. 600 Agrobacterium resuspension at 0.2.
[0064] (2) Maize genetic transformation Induction: When the young embryo of maize inbred line B104 grows to 1.5-2.0 mm, it is taken from the field. The silks of the young ear are disinfected with 75% alcohol. The silks are cut off and the outer husks are removed. When 1-2 layers of husks remain, the young ear is placed in 75% alcohol and the young embryo is picked out and placed in a triangular flask.
[0065] Agrobacterium infection: Pour the Agrobacterium suspension prepared in (1) into an Erlenmeyer flask containing embryos, infect for 10-15 minutes and then discard the bacterial solution. Inoculate the callus onto the co-culture medium and co-culture at 20°C for 2-3 days.
[0066] Callus screening: The co-cultured callus was inoculated onto the screening medium and cultured in the dark at 28°C for 7-10 days.
[0067] Differentiation and rooting: Positive callus was inoculated onto differentiation medium and cultured at 28°C under light for 15-20 days. After the buds differentiated to 2-5 cm, they were inoculated onto rooting medium and cultured at 30°C under light until the corn grew to 3-4 leaves. Samples were taken for positive plant detection.
[0068] Identification of positive plants: Maize genomic DNA was extracted using the CTAB method and PCR was performed using primers bar(277)+:5'-TGGGCAGCCCGATGACAGCGACCAC-3'; bar(277)-:5'-ACCGAGCCGCAGGAACCGCAGGAGT-3'.
[0069] Finally, maize plants overexpressing ZmCOP1a and ZmCOP1b were successfully obtained. ZmCOP1a-OE (#1, #2, #3, #7, #8, #12) and ZmCOP1b-OE (#1, #2, #7, #14, #19, ... Figure 1 (a) and (b)).
[0070] 3. Real-time quantitative polymerase chain reaction (qRT-PCR) Total RNA was extracted from different tissues using TRNzol universal reagents (Tiangen Biotech, Beijing, China). 2 μg of total RNA was taken and analyzed using PrimeScript. TM II. Reverse transcriptase (Takara Bio Inc., Japan) and oligo (dT) 18 Primers are used to reverse transcribe and synthesize cDNA.
[0071] The synthesized cDNA was diluted 5-fold and used as a template for qRT-PCR. The experimental procedure followed the previously reported method (Weimin Zhan, Lianhua Cui, Shuling Yang, Jingpeng Geng, Yong Shi, ShizhanChen, Jianping Yang, Yanpei Zhang. Light induces the circadian rhythm and chloroplast development during seedling de-etiolation in maize. Environmental and Experimental Botany. 2024, 226, 105935.). The internal reference genes for maize were... ZmUBQ ( Zm00001d015327 The primer sequences are: ZmUBQ-F: 5'-TAAGCTGCCGATGTGCCTGCGTCG-3', ZmUBQ-R: 5'-CTGAAAGACAGAACATAATGAGCACAG-3'. The relative expression level of the target gene was determined using a 23 -ΔΔCT Calculation by method.
[0072] Example 2: Study on the correlation between ZmCOP1a and ZmCOP1b in regulating plant yield, female ear and grain size. Samples to be tested: Wild-type maize B73, B104, and overexpression plants ZmCOP1a-OE (#7, #12) and ZmCOP1b-OE (#14, #19), single mutants zmcop1a (Including the R143 termination mutation); Single mutant zmcop1b (Including the Q299 termination mutation, Figure 2 (a)-(c)), double mutants obtained through single mutant hybridization zmcop1a / b.
[0073] EMS-induced mutants zmcop1a (EMS4-080b8d) and zmcop1b(EMS4-11965c) are all from the MEMD mutant library (http: / / maizeems.qlnu.edu.cn / ). To reduce genetic background interference, all mutants were backcrossed twice using the B73 inbred line as the recurrent parent, and homozygous mutants were screened from the obtained BC2F3 population.
[0074] Will zmcop1a and zmcop1b homozygous single mutant ( zmcop1a It contains the R143 termination mutation; zmcop1b It contains the Q299 termination mutation; Figure 2 The F1 generation was obtained by hybridization, and the F1 generation was self-crossed to produce the F2 population. Genotyping and sequencing were used to identify the F2 generation. zmcop1a / b The double homozygous mutant exhibits significant growth and development retardation, and defects in the development of both female and male ears. Figure 3 ).
[0075] Under short-day conditions (SD, Hainan Province, November 2023), a systematic evaluation was conducted over an 87-day period. ZmCOP1a and ZmCOP1b Functional differences under wild-type B73 and B104 backgrounds. The experiment covered single mutants, double mutants, and overexpression lines, focusing on elucidating their genetic regulatory effects on ear development and grain traits.
[0076] Compared to the B73 wild-type (WT) strain, ZmCOP1a , ZmCOP1b Loss-of-function mutants ( zmcop1a , zmcop1b The female ear length was shortened by 13.80% and 26.07%, respectively; the number of grains per ear decreased by 20.94% and 46.63%, respectively; the grain weight per ear decreased by 24.29% and 56.14%, respectively; the grain length was shortened by 3.77% and 10.81%, respectively; the grain width decreased by 2.75% and 5.635%, respectively; and the 100-grain weight decreased by 6.32% and 14.41%, respectively. zmcop1a / b The double mutants exhibited the most severe defects, suggesting partial functional redundancy between ZmCOP1a and ZmCOP1b; conversely, the ZmCOP1s overexpression lines (2.96%–41.74%) showed enhanced levels of all the aforementioned traits. Figure 4 Zea mays L. Escherichia Erwinia Agrobacterium Flavobacterium Alcaligenes Pseudomonas Bacillus ZmCOP1a ZmCOP1b ZmCOP1a ZmCOP1b Agrobacterium ZmCOP1a Zm00001d018207 ZmCOP1b Zm00001d052138 ZmCOP1-OE zmcop1a zmcop1b ZmCOP1a / b zmcop1a zmcop1b ZmCOP1-OE Figure 1 Figure 2 Figure 3 Figure 4 zmcop1a zmcop1b ZmCOP1a Zm00001d018207 ZmCOP1b Zm00001d052138 ZmCOP1a ZmCOP1b ZmCOP1a ZmCOP1b ZmCOP1a-OE Figure 1 ZmUBQ Zm00001d015327 ZmCOP1a-OE zmcop1a zmcop1b Figure 2 zmcop1a / b. zmcop1a zmcop1b zmcop1a zmcop1b zmcop1a zmcop1b Figure 2 zmcop1a / b Figure 3 ZmCOP1a ZmCOP1b ZmCOP1a ZmCOP1b zmcop1a z (a)-(f), Table 1). This result provides a genetic target with practical value for breeding high-yield maize.
[0077] Table 1. Statistics on Yield-Related Characteristics
[0078] Note: ↓ indicates a decrease; ↑ indicates an increase.
[0079] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. Use of a protein or a substance that regulates expression of a gene or a substance that regulates activity or content of the protein in any one of the following: U1) use in regulating yield of a plant; U2) use in the manufacture of a product for regulating yield of a plant; U3) use in breeding a plant with altered yield; U4) use in the manufacture of a product for breeding a plant with altered yield; U5) use in plant breeding; the protein is any one of the following: G1) a composition comprising a protein with an amino acid sequence of SEQ ID No: 2 and a protein with an amino acid sequence of SEQ ID No: 4; G2) a protein with an amino acid sequence of SEQ ID No: 2 or a protein with an amino acid sequence of SEQ ID No: 4; G3) a protein with 80% or more identity to the protein of A1) and having a function related to regulating yield of a plant, which is obtained by substitution and / or deletion and / or addition of amino acid residues to the protein of G1) or G2); G4) a fusion protein obtained by linking a protein tag to the N terminus or / and C terminus of the protein of G1) or G2).
2. Use according to claim 1, characterized in that: the protein is derived from corn.
3. Use according to claim 1 or 2, characterized in that: the substance that regulates expression of a gene or a substance that regulates activity or content of the protein is a biological material related to the protein, and the biological material is any one of the following: c1) a nucleic acid molecule encoding the protein of claim 1; c2) an expression cassette comprising the nucleic acid molecule of c1); c3) a recombinant vector comprising the nucleic acid molecule of c1) or an expression cassette of c2); c4) a recombinant microorganism comprising the nucleic acid molecule of c1) or an expression cassette of c2) or a recombinant vector of c3); c5) a transgenic plant cell line comprising the nucleic acid molecule of c1) or an expression cassette of c2); c6) a transgenic plant tissue comprising the nucleic acid molecule of c1) or an expression cassette of c2); c7) a transgenic plant organ comprising the nucleic acid molecule of c1) or an expression cassette of c2). e1) a nucleic acid molecule that inhibits or reduces or silences expression of a gene encoding the protein of claim 1 or 2; e2) an expression cassette comprising the nucleic acid molecule of e1); e3) a recombinant vector comprising the nucleic acid molecule of e1) or an expression cassette of e2); e4) a recombinant microorganism comprising the nucleic acid molecule of e1) or an expression cassette of e2) or a recombinant vector of e3); e5) a transgenic plant cell line comprising the nucleic acid molecule of e1) or an expression cassette of e2); e6) a transgenic plant tissue comprising the nucleic acid molecule of e1) or an expression cassette of e2); e7) a transgenic plant organ comprising the nucleic acid molecule of e1) or an expression cassette of e2).
4. Use according to claim 3, characterized in that: c1) the nucleic acid molecule is a DNA molecule as set forth in any one of d1) the nucleotide sequence is a DNA molecule as set forth in SEQ ID No: 5; d2) the coding region sequence is a DNA molecule as set forth in SEQ ID No: 1 in the sequence listing; d3) the nucleotide sequence is a DNA molecule as set forth in SEQ ID No: 6; d4) the coding region sequence is a DNA molecule as set forth in SEQ ID No: 3 in the sequence listing.
5. A method of modulating yield in a plant, comprising: controlling the activity and / or content of the protein as set forth in claim 1 or 2, or / and controlling the expression amount of the gene encoding the protein as set forth in claim 1 or 2 in a plant of interest, to regulate the yield of the plant.
6. A breeding method for breeding a plant with altered yield, comprising controlling the activity and / or content of the protein as set forth in claim 1 or 2, or / and controlling the expression amount of the gene encoding the protein as set forth in claim 1 or 2 in a plant of interest, to obtain a plant with altered yield.
7. The method of claim 6, wherein: controlling the activity and / or content of the protein as set forth in claim 1 or 2, or / and, controlling the expression amount of the gene encoding the protein as set forth in claim 1 or 2 in a plant of interest, comprises introducing into a recipient plant a recombinant expression vector comprising a nucleic acid molecule that up-regulates or enhances or increases the expression of the gene encoding the protein as set forth in claim 1 or 2, to obtain a plant of interest with increased yield; the gene encoding the protein as set forth in claim 1 or 2.
8. The method of claim 6, wherein: controlling the activity and / or content of the protein as set forth in claim 1 or 2, or / and, controlling the expression amount of the gene encoding the protein as set forth in claim 1 or 2 in a plant of interest, comprises introducing into a recipient plant a recombinant expression vector comprising a nucleic acid molecule that inhibits or reduces or silences the expression of the gene encoding the protein as set forth in claim 1 or 2, to obtain a plant of interest with decreased yield; the gene encoding the protein as set forth in claim 1 or 2.
9. The protein as set forth in claim 1 or 2 and / or the biological material as set forth in claim 3 or 4.
10. Use according to any one of claims 1 to 4, or method according to any one of claims 5 to 8, characterized in that: the plant is any one of: C1) a monocotyledonous plant; C2) a plant of the order Poales; C3) a plant of the family Poaceae; C4) a plant of the genus Zea; C5) a plant of the species Zea mays.