Application of GmNFYA11 gene in improvement of soybean quality

By regulating the expression of the GmNFYA11 gene, and using recombinant vectors and genetically engineered bacteria, the synergistic enhancement of oil and protein and the optimization of fatty acid composition in soybeans were achieved. This solved the problem of negative correlation between oil and protein and quality improvement in high-oil soybean breeding, and provided genetic resources for high-oil and high-protein superior varieties.

CN121344080AActive Publication Date: 2026-01-16XIANGHU LABORATORY +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511918456.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-17
Publication Date
2026-01-16
Estimated Expiration
2045-12-17

AI Technical Summary

Technical Problem

In high-oil soybean breeding, there is a negative correlation between oil and protein content, and it is difficult to improve oil quality in a synergistic way, resulting in low efficiency of traditional breeding methods.

Method used

By positively regulating the expression of the GmNFYA11 gene, and using recombinant vectors and genetically engineered bacteria to introduce it into soybeans, the composition of soybean oil, protein, and fatty acids is regulated, thereby achieving synergistic enhancement of oil and protein and optimization of fatty acid composition.

Benefits of technology

It achieved a synergistic increase in soybean oil and protein content, significantly improved total fatty acid content and optimized fatty acid composition, broke the negative correlation between oil and protein, and provided genetic resources for high-oil and high-protein superior varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121344080A_ABST
    Figure CN121344080A_ABST
Patent Text Reader

Abstract

The invention provides an application of a GmNFYA11 gene in the aspect of improving the content of soybean oil. Specifically, according to the research, a GmNFYA11 gene with a function of positively regulating and controlling grease synthesis is cloned from a soybean cultivar 'Williams 82', and an overexpression plant of the gene is constructed. Experimental results show that compared with a wild type, the oil content, the protein content, the total fatty acid content, the fatty acid components and the like of the transgenic soybean overexpressed with the GmNFYA11 are remarkably improved, and it is proved that the GmNFYA11 plays an important positive regulation role in the soybean oil accumulation process. Based on the transformant, the soybean oil character can be effectively improved through a genetic engineering means, a new way is provided for cultivating high-oil-content soybean varieties and directionally improving the soybean oil accumulation level, and the transformant has important significance for optimizing soybean quality, guaranteeing grain and oil supply safety and promoting efficient development of the soybean oil industry.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, and more particularly to a... GmNFYA11 Application of genes in improving soybean quality. Background Technology

[0002] Soybeans, as one of the world's most important oilseed crops, provide essential oils for the food, chemical, and energy sectors. Currently, continuously increasing the oil content of soybean seeds through breeding techniques is of great significance for improving oil yield per unit area, ensuring national food and oil supply security, and promoting agricultural efficiency.

[0003] However, high-oil soybean breeding has long faced two major technical bottlenecks: First, there is a significant trade-off between oil and protein content. Given limited resource allocation in soybean seeds, the biosynthetic pathways of oil and protein compete for substrates, making it difficult to maintain protein levels while increasing oil content using traditional breeding methods. This inherent negative correlation severely restricts the breeding of superior varieties that are both high in oil and high in protein, forcing breeders to make trade-offs between these two key quality traits.

[0004] Secondly, synergistic improvement of oil quality is difficult. Ideal edible oils require good oxidative stability and nutritional health value, which are closely related to their fatty acid composition. For example, high oleic acid and low linolenic acid are important quality improvement targets. However, in traditional breeding, relying solely on natural variation to achieve synergistic improvement of total fatty acid content and enrichment of specific beneficial components (such as oleic acid) is not only slow but also inefficient. Summary of the Invention

[0005] In view of the shortcomings of the prior art, the present invention provides a GmNFYA11 Application of genes in improving soybean quality.

[0006] The specific technical solution is as follows: In one aspect, the present invention provides GmNFYA11 Use of genes or related biological materials in at least one of the following: A1) Regulating soybean quality or preparing products that regulate soybean quality; A2) Cultivate soybeans with improved quality or prepare products with improved soybean quality; A3) Preparation of genetically modified soybeans; The GmNFYA11 The nucleotide sequence of the gene coding region is shown in SEQ ID NO.1.

[0007] Furthermore, the biomaterial includes one or more of the following: A1) contains the aboveGmNFYA11 Recombinant vectors of genes, genetically engineered bacteria, or transgenic soybean cell lines; A2) Contains negative regulation GmNFYA11 Nucleic acid molecules expressing genes, recombinant vectors, genetically engineered bacteria, or transgenic soybean cell lines.

[0008] Furthermore, the regulation of soybean quality includes: altering the soybean oil content; And / or, change protein content levels; And / or, change the total fatty acid content; And / or, change the fatty acid composition.

[0009] Furthermore, the methods for regulating soybean quality include: through positive regulation GmNFYA11 Gene expression is used to improve soybean quality; Or, through negative regulation GmNFYA11 Gene expression can reduce soybean quality.

[0010] In one aspect, the present invention provides a positive regulation GmNFYA11 Application of gene-expressing biological materials in the cultivation of soybeans with improved quality; GmNFYA11 The nucleotide sequence of the gene coding region is shown in SEQ ID NO.1.

[0011] Furthermore, the biomaterial includes: containing positive regulatory... GmNFYA11 Recombinant vectors for gene expression, genetically engineered bacteria, or transgenic soybean cell lines.

[0012] Furthermore, the carrier described in this invention is preferably a pBA002-3×Flag carrier.

[0013] Furthermore, the genetically engineered bacteria described in this invention are preferably Agrobacterium. Even further, the genetically engineered bacteria described in this invention are Agrobacterium EHA105.

[0014] Furthermore, the genetically engineered bacteria described in this invention infect the cotyledonary nodes of germinating soybean seeds.

[0015] Furthermore, the quality improvement includes: increasing the soybean oil content; And / or, maintain protein content levels; And / or, increase the total fatty acid content; And / or, modify the fatty acid composition.

[0016] Furthermore, the fatty acid component includes: palmitic acid; And / or, stearic acid; And / or, oleic acid; And / or, linoleic acid; And / or, linolenic acid.

[0017] In one aspect, the present invention provides a method for improving soybean quality, comprising: Positive regulation GmNFYA11 Gene-expressing biological materials are transferred into soybeans.

[0018] In one aspect, the present invention provides a method for cultivating soybeans with improved quality, comprising: Positive regulation GmNFYA11 Gene-expressing biological materials are transferred into soybeans.

[0019] Compared with the prior art, the present invention has the following beneficial effects: (1) The transfer provided by the present invention GmNFYA11 The genetically modified soybean "Williams 82" achieves a synergistic increase in soybean oil and protein content, effectively overcoming the usually present negative correlation between the two.

[0020] (2) It significantly increased the total fatty acid content and optimized the fatty acid composition, providing key gene resources for breeding high-oil and high-quality soybean varieties with excellent comprehensive traits. Attached Figure Description

[0021] Figure 1 As in Example 1 GmNFYA11 A schematic diagram of a plant expression vector.

[0022] Figure 2 In Example 2, the following is used Bar Results of PCR amplification of genomic DNA from wild-type (WT) and transgenic lines using gene-specific primers.

[0023] Figure 3 The results show the glufosinate resistance identification of the transgenic soybean plants in Example 2.

[0024] Figure 4 In the transgenic soybean plants of Example 2 GmNFYA11 Results of gene mRNA expression level analysis.

[0025] Figure 5 The results show the oil and protein content of the transgenic soybean seeds in Example 3; wherein, Figure 5 A represents the oil content of genetically modified soybean seeds; Figure 5 B represents the protein content of genetically modified soybean seeds.

[0026] Figure 6 The results show the total fatty acid content of the genetically modified soybean seeds in Example 4.

[0027] Figure 7 The results show the fatty acid composition of the genetically modified soybean seeds in Example 4. Detailed Implementation

[0028] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be noted that the following detailed descriptions are exemplary and are only some embodiments of the present invention, not all embodiments.

[0029] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0030] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and are commercially available. Experimental methods not specifying detailed conditions are performed according to conventional experimental methods or the operating instructions recommended by the supplier.

[0031] In this invention, the GmNFYA11 The nucleotide sequence of the gene coding region is shown in SEQ ID NO.1, and the specific sequence information is as follows: SEQ ID NO.1: 5’ -ATGCCAGGGAAACCTGACACTGATGATTGGCGTGTAGAGCGTGGGGAGCAGATTCAGTTTCAGTCTTCCATTTACTCTCATCATCAGCCTTGGTGGCGCGGAGTGGGGGAAAATGCCTCCAAATCATCTTCAGATGATCAGTTAAATGGTTCAATCGTGAATGGTATCACGCGGTCTGAGACCAATGATAAGTCAGGCGGAGGTGTTGCCAAAGAATACCAAAACATCAAACATGCCATGTTGTCAACCCCATTTACCATGGAGAAACATCTTGCTCCAAATCCCCAGATGGAACTTGTTGGTCATTCAGTTGTTTTAACATCTCCTTATTCAGATGCACAGTATGGTCAAATCTTGACTACTTACGGGCAACAAGTTATGATAAATCCTCAGTTGTATGGAATGCATCATGCTAGAATGCCTTTGCCACTTGAAATGGAAGAGGAGCCTGTTTATGTCAATGCGAAGCAGTATCATGGTATTTTGAGGCGAAGACAGTCACGTGCTAAGGCTGAGATTGAAAAGAAAGTAATCAAAAACAGGAAGCCATACCTCCATGAATCCCGTCACCTTCATGCAATGAGAAGGGCAAGAGGCAACGGTGGTCGCTTTCTCAACACAAAGAAGCTTGAAAATAACAATTCTAATTCCACTTCAGACAAAGGCAACAATACTCGTGCAAACGCCTCAACAAACTCGCCTAACACTCAACTTTTGTTCACCAACAATTTGAATCTAGGCTCATCAAATGTTTCACAAGCCACAGTTCAGCACATGCACACAGAGCAGAGTTTCACTATAGGTTACCATAATGGAAATGGTCTTACAGCACTATACCGTTCACAAGCAAATGGGAAAAAGGAGGGAAACTGCTTTGGTAAAGAGAGGGACCCTAATGGGGATTTCAAATAA-3’。

[0032] Example 1 GmNFYA11 Construction of Overexpression Vector and Soybean Genetic Transformation 1.1 Target GeneGmNFYA11 Cloning Using the cDNA of the soybean cultivar "Williams 82" as a template, a design was created. GmNFYA11 Primers for specific amplification of gene coding region sequences are as follows: GmNFYA11 -F (SEQ ID NO.2): 5'-GAGAACACGGGGGACTCTAGAATGCCAGGGAAACCTGACAC-3'; GmNFYA11 -R (SEQ ID NO.3): 5'-ATCTTTGTAATCCATCTCGAGTTTGAAATCCCCATTAG-3'.

[0033] Using Vazyme's Phanta ® Amplification was performed using a Max Super-Fidelity DNA Polymerase (P505) high-fidelity enzyme reaction system. The PCR reaction system is shown in Table 1: Table 1

[0034] The PCR amplification program was as follows: 98℃ pre-denaturation for 5 min; 95℃ for 30 s, 57℃ for 30 s, 72℃ for 1 min, for a total of 33 cycles; extension at 72℃ for 10 min.

[0035] 1.2 GmNFYA11 Preparation of gene expression vectors The pBA002-3×Flag empty vector was linearized by double digestion with restriction endonucleases Xba I and Xho I. The digestion reaction system is shown in Table 2, and the reaction was carried out at 37℃ for 3 hours. The linearized vector fragment was recovered after agarose gel electrophoresis of the digestion products.

[0036] Table 2

[0037] 1.3 Agrobacterium-mediated transformation and soybean genetic transformation pBA002- GmNFYA11 -3×Flag recombinant vector (e.g.) Figure 1The target gene was introduced into Agrobacterium tumefaciens EHA105 (as shown in the image) and spread on YEP solid plates containing 50 μg / mL rifampicin and kanamycin. The plates were cultured at 28°C for 36-48 hours to obtain engineered Agrobacterium tumefaciens containing the target vector. The target gene was then introduced into the soybean variety “Williams 82” using the cotyledon transformation method (referencing Huang Yanzhong, 2020, with slight modifications). The simplified steps are as follows: Mature seeds of soybean “Williams 82” were sterilized with chlorine and then soaked in water overnight. Cotyledonary nodes were then extracted as explants. The explants were soaked in Agrobacterium tumefaciens solution for 30 minutes. After culturing for 5 days, the explants were transferred to differentiation and selection medium containing 5 μg / mL glufosinate for induction and selection of resistant shoots. Once the shoots reached an appropriate size, they were transferred to rooting medium to induce rooting. Finally, healthy regenerated plants were transplanted to a greenhouse.

[0038] Example 2 GmNFYA11 Molecular and functional identification of positive transgenic soybean plants 2.1 Bar PCR identification of genes Total genomic DNA was extracted from leaves of transgenic plants (OE445, OE825) and wild-type (WT) controls. Using this DNA as a template, selection marker genes were analyzed. Bar PCR amplification was performed using specific primers (SEQ ID No. 4 and SEQ ID No. 5), and the primer sequences are as follows: Bar -F (SEQ ID NO.4): 5'-TCTGCACCATCGTCAACCACTAC-3'; Bar -R (SEQ ID NO.5): 5'-ACCCACGTCATGCCAGTTCC-3'.

[0039] Amplification was performed using the 2 × Rapid Taq Master Mix enzyme reaction system from Vazyme. The PCR reaction system is shown in Table 3.

[0040] Table 3

[0041] PCR amplification program: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 55℃ for 15 s, 72℃ for 15 s, for a total of 33 cycles; 72℃ final extension for 5 min.

[0042] The amplification products were detected by 1.5% agarose gel electrophoresis. The results are as follows: Figure 2 As shown, transgenic positive plants can amplify those of the expected size.Bar The gene band was observed, while the wild-type control did not show this band, which preliminarily proves that the exogenous T-DNA has been successfully integrated into the soybean genome.

[0043] 2.2 Resistance identification of glufosinate To further verify Bar Functional expression of the gene was assessed, and herbicide resistance was tested on the positive plants and WT plants identified by PCR. At 14 days of seedling age, a 200 mg / L glufosinate-ammonium aqueous solution was evenly applied to the newly emerging leaves, and the phenotype was observed 3 days later.

[0044] The results are as follows Figure 3 As shown, the leaves of transgenic positive plants grew normally without obvious symptoms of damage; while the leaves of WT plants showed obvious yellowing, wilting, and even necrosis. This result indicates that exogenous... Bar The gene was successfully expressed in the transgenic plants and produced functional proteins, conferring glufosinate resistance to the plants.

[0045] 2.3 RT-qPCR analysis of gene expression levels Leaves from 14-day-old transgenic positive plants and WT plants were flash-frozen in liquid nitrogen, and total RNA was extracted using the Kangwei Century Biotechnology Co., Ltd. ultrapure RNA extraction kit. The RNA was then processed using Yeasen's Hifair reverse transcription assay. ® The Ⅲ 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) kit reverse transcribes 1 μg of total RNA into first-strand cDNA, which is used as a qPCR template.

[0046] Using Yeasen's Hieff UNICON ® Universal Blue qPCR SYBR Green MasterMix was used for qRT-PCR. The RT-qPCR reaction system is shown in Table 4.

[0047] Table 4

[0048] Amplification program: 95℃ for 2 min; 95℃ for 10 s, 60℃ for 30 s, 40 cycles; 95℃ for 15 s; 60℃ for 1 min; 95℃ for 15 s. RT-qPCR primer sequences are shown in Table 5.

[0049] Table 5

[0050] Use 2 -ΔΔCtThe method calculates the relative expression levels of genes, and the results are as follows: Figure 4 As shown, compared with WT, the transgenic lines GmNFYA11_OE445 and GmNFYA11 in GmNFYA11_OE825 The mRNA levels were significantly increased, with expression levels 127.6-fold and 26.8-fold higher than those of WT, indicating successful acquisition. GmNFYA11 Overexpression in soybean plants.

[0051] Example 3 GmNFYA11 Analysis of quality traits of genetically modified soybean seeds Mature seeds from each strain were dried in a 30°C oven to constant weight (approximately 48 hours) to eliminate the interference of moisture content on the measurement results. At least three biological replicates were set up for each strain. Samples were scanned using an Infratec 1241 near-infrared cereal analyzer (FOSS, Sweden), acquiring near-infrared spectra for each sample within a specific wavenumber range. The instrument's built-in quantitative analysis models for soybean seed oil and protein content automatically analyzed the acquired spectra and directly output the percentage content (%) of each component.

[0052] Fat content: Compared to WT, GmNFYA11 Overexpression lines ( GmNFYA11_OE445 , GmNFYA11_OE825 The oil content of the seeds increased significantly, with the absolute content increasing by 1.68% to 2.77%. Figure 5 A). This indicates that GmNFYA11 Overexpression of [a substance] effectively promoted oil accumulation in soybean seeds.

[0053] Protein content: While the oil content increased significantly, the seed protein content of each transgenic line did not decrease significantly compared with WT. Figure 5 B). This result is crucial, indicating that... GmNFYA11 Overexpression increases lipid content without sacrificing protein content, thus breaking the usual antagonistic relationship between the two.

[0054] Example 4 GmNFYA11 Determination of total fatty acid content and fatty acid composition in genetically modified soybean seeds Soybean seed samples were ground into a fine powder. An appropriate amount of sample was added to 5 mL of dichloromethane-methanol solution (2:1 v / v), vortexed, and washed with 2 mL of gold standard solution. The lower layer was collected and dried under nitrogen. 2 mL of n-hexane and an internal standard were added, and the mixture was methylated for 0.5 hours. 2 mL of gold standard solution was added, and 1000 μL of the supernatant was collected, dried under nitrogen, and reconstituted with n-hexane. The supernatant was then added to a sample vial for GC-MS analysis. Peak areas and retention times were extracted using MSD ChemStation software. Standard curves were plotted, and the content and composition of each fatty acid in the sample were calculated.

[0055] The results of total fatty acid content and component analysis are as follows: Figure 6 and Figure 7 As shown, GmNFYA11 Overexpression lines ( GmNFYA11_OE445 GmNFYA11_OE825 and GmNFYA11 The total fatty acid content of the seeds was significantly increased by 14.48% - 17.28% compared to WT. GmNFYA11_OE445 Genetically modified soybean seeds ( GmNFYA11_OE825 and GmNFYA11_OE445 The contents of palmitic acid (16:0), stearic acid (18:0) and oleic acid (18:1) in the sample were all significantly increased. GmNFYA11_OE445 The linoleic acid (18:2) content of the strain was significantly increased; GmNFYA11_OE825 and GmNFYA11 The linolenic acid (18:3) content in the strain was significantly reduced. This indicates... GmNFYA11 Overexpression can promote the accumulation of palmitic acid, stearic acid, oleic acid, and linoleic acid in soybeans. GmNFYA13 The overexpression lines had higher total fatty acid content and significantly altered fatty acid composition. This compositional change indicates... ​ Overexpression may alter carbon flow by regulating the expression of key enzyme genes in the fatty acid synthesis pathway, ultimately achieving optimization of fatty acid composition while increasing total lipid content, providing important genetic resources and theoretical basis for breeding high-yield and high-quality new soybean varieties.

Claims

1. GmNFYA11 Use of a gene or biological material related thereto in at least one of the following: A1) modulating soybean quality or preparing a product for modulating soybean quality; A2) breeding soybean with improved quality or preparing a product for improving soybean quality; A3) preparing transgenic soybean; The GmNFYA11 The nucleotide sequence of the coding region of the gene is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The biological material comprises one or more of the following: A1 ) a recombinant vector, genetically engineered bacteria or transgenic soybean cell line comprising said GmNFYA11 gene; A2) nucleic acid molecules, recombinant vectors, genetically engineered bacteria or transgenic soybean cell lines containing a negative regulator GmNFYA11 of gene expression.

3. Use according to claim 1 or 2, characterized in that, The modulating soybean quality comprises: changing soybean oil content; and / or, changing protein content level; and / or, changing total fatty acid content; and / or, changing fatty acid composition.

4. Use according to claim 3, characterized in that, The approaches to modulating soybean quality include: increasing soybean quality by up-regulating the expression of genes GmNFYA11 that positively regulate soybean quality; or, by down-regulating GmNFYA11 expression of the gene to reduce soybean quality.

5. Upregulation GmNFYA11 The use of a biological material for the expression of a gene in soybeans of improved quality, characterized in that, The GmNFYA11 The nucleotide sequence of the coding region of the gene is shown as SEQ ID NO.

1.

6. Use according to claim 5, characterized in that, The biological material comprises a recombinant vector, genetically engineered bacteria or transgenic soybean cell line containing a positively regulated GmNFYA11 gene expression.

7. Use according to claim 5, characterized in that, The improved quality comprises: increasing soybean oil content; and / or, maintaining protein content level; and / or, increasing total fatty acid content; and / or, improving fatty acid composition.

8. Use according to claim 7, characterized in that, The fatty acid composition comprises: palmitic acid; and / or, stearic acid; and / or, oleic acid; and / or, linoleic acid; and / or, linolenic acid.

9. A method for improving the quality of soybean, characterized by, Comprises: upregulating GmNFYA11 biomaterials that modulate gene expression into soybeans.

10. A method of growing soybeans of improved quality, characterized by, Comprises: upregulating GmNFYA11 biomaterials that modulate gene expression into soybeans.

Citation Information

Patent Citations

  • Application of soybean transcription factor GmMYB172 in vegetable oil and fat metabolism regulation

    CN104059136A

  • Application of soybean transcription factor GmZF351 in vegetable oil and fat metabolism regulation

    CN104120135A

  • Protein GmZF 392 derived from soybeans and applications of related biomaterials in regulation and control of plant fat

    CN104152485A

  • Transcription factor GmMYB331 related to regulation and control of seed oil content as well as coding gene and application of transcription factor GmMYB331

    CN117070551A