Calcium ion signal research model for in-vivo nematode intestine preparation and construction method
By constructing an NHX-2 promoter-driven YC3.60 fluorescent protein probe in Caenorhabditis elegans, the problems of low detection sensitivity and trauma in existing technologies are solved, providing a highly sensitive calcium ion signal research model suitable for multicellular calcium ion signal research.
Patent Information
- Application Number
- CN202511568218.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-30
- Publication Date
- 2026-01-16
AI Technical Summary
Existing technologies using microelectrodes and calcium ion fluorescent dyes to detect intracellular calcium ion levels have low sensitivity, cause trauma to experimental animals, and are subject to interference during detection.
A YC3.60 fluorescent protein probe driven by the NHX-2 promoter was constructed in Caenorhabditis elegans using transgenic technology. The fluorescent protein particles were integrated into the nematode genome via microinjection. The fluorescent protein probe was specifically expressed in intestinal cells, and stable nematode lines were obtained by UV cross-linking screening for calcium ion signaling studies.
It achieves high-sensitivity detection of in vivo multicellular calcium ion signals, avoids trauma to experimental animals, and provides a live model of spontaneous calcium oscillation and periodic calcium ion signal regulation, which is suitable for the study of calcium ion signals.
Smart Images

Figure CN121344091A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological model construction technology, and in particular to a calcium ion signal research model and construction method made from the in vivo nematode intestine. Background Technology
[0002] Calcium ions play a vital role in living organisms, participating in bone development and growth, learning and memory, the catalytic activity of some enzymes, and cell signal transduction. Calcium channels are widely distributed on the cell surface and in subcellular structures such as the endoplasmic reticulum and mitochondria, and changes in calcium ion levels significantly impact cellular life activities. As a small messenger molecule, calcium ions exhibit rapid changes in their intracytoplasmic concentration, a phenomenon unattainable by many other messenger molecules. Therefore, studying calcium ion signaling is of great significance. Classical experimental models for studying calcium ion signaling facilitate experimental procedures, commonly including single-cell models, cell populations, and experimental animal and plant models, with the former two being more frequently used; in vivo multicellular models remain relatively rare. The nematode model organism exhibits a rhythmic calcium ion signal that regulates defecation behavior, making it a valuable in vivo model for studying calcium ion signaling.
[0003] The nematode *C. elegans*, used as a model organism for scientific research, has a short growth cycle, rapid reproduction rate, tiny size, simple structure, is easy to culture, and is transparent, making it widely used in research in life sciences, medicine, and other fields. This article will focus on the characteristic calcium ion signaling within the intestinal cells of *C. elegans*, using it as a model for studying calcium ion signaling. *C. elegans* intestinal cells are relatively large, extending from the pharynx to the tail, but are composed of only 20 cells. These cells have functions such as digesting and absorbing nutrients, storing nutrients, and providing immune function. *C. elegans* excretion is a periodic behavior, occurring approximately once per minute, with a stable rhythm, regulated by periodic calcium ion activity within the intestinal cells. This periodic calcium ion signal, also known as calcium oscillation, is spontaneously generated by the terminal intestinal cells, then transmitted forward while simultaneously inducing muscle contraction, thereby completing the excretory action of squeezing the intestine. Since this calcium ion signal is spontaneously generated and not controlled by neurons, this periodic calcium ion signaling behavior has become a hot topic in calcium ion signaling research, making the in vivo *C. elegans* intestinal tissue an excellent model for studying calcium ion signaling. Meanwhile, the intercellular transmission of calcium ion signals, the muscle contraction caused by calcium ions, and the activation of neurons by calcium ion signals can also be studied using this model.
[0004] To study the role of calcium ion signals, it is first necessary to detect dynamic changes in intracellular calcium ion levels. Previous methods have used microelectrodes and fluorescent calcium ion dyes to study these changes. However, microelectrode technology has low sensitivity for calcium ion detection and can cause significant trauma to experimental animals. Fluorescent calcium ion dyes also have several drawbacks: they stain not only intestinal cells but also all cells in the body, causing interference during detection; furthermore, relatively little dye enters the cells, resulting in low detection sensitivity. Summary of the Invention
[0005] The purpose of this invention is to address the shortcomings of existing technologies that use microelectrodes and calcium ion fluorescent dyes to study intracellular calcium ion levels. Microelectrode technology has low sensitivity for calcium ion detection and can cause significant trauma to experimental animals. The use of calcium ion fluorescent dyes also has several drawbacks: not only are intestinal cells stained, but all cells in the body are stained, leading to interference during experimental detection. Furthermore, relatively little dye enters the cells, resulting in low detection sensitivity.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A method for constructing a calcium ion signaling research model using an in vivo nematode gut sample includes the following steps:
[0008] S1: Nematode culture;
[0009] S2: Constructing probe plasmids for transgenic applications:
[0010] First, the NHX-2 promoter was synthesized chemically, and HindIII and BamHI restriction sites were attached to both ends of the NHX-2 promoter, respectively; then YC3.60 was amplified using PCR technology.
[0011] Then, the nhx-2 promoter sequence was first inserted into the plasmid, and then YC3.60 was inserted after the promoter.
[0012] S3: Transgenic Integration with Genome: Transgenic nematodes were microinjected, followed by second and third-generation screening to obtain nematodes with intestinal cells carrying green fluorescent protein.
[0013] Preferably, the PCR amplification primers for YC3.60 in S2 are as follows:
[0014] F: 5' CGGGGTACCCGCTCGAGCATGCATCTAGA 3'
[0015] R: 5'CCGGAATTCggcaaacaacagatggctgg 3'.
[0016] Preferably, the method for inserting the nhx-2 promoter into the plasmid in S2 is as follows: the plasmid vector pPD95.75 and the promoter sequence are digested with Hand III and BamHI, and then ligated with T4 DNA ligase.
[0017] Preferably, the YC3.60 insertion treatment method in S2 is as follows: the plasmid vector pPD95.75 and the YC3.60 fragment PCR product are digested with Kpnl and EcoRI, and then the obtained YC3.60 fragment is ligated with the plasmid vector to prepare a recombinant plasmid.
[0018] Preferably, the plasmid is pPD95.75 plasmid.
[0019] Preferably, after the transgene microinjection in S3, 6-8 nematodes with good intestinal cell fluorescence expression are selected and cultured in 5 cm NGM dishes. After 4 days of culture at 21 degrees Celsius, 20 offspring nematodes that have not yet laid eggs are selected and placed into 5 cm NGM dishes. A total of 200 nematodes are selected and placed into 10 separate culture dishes. The nematodes are irradiated with ultraviolet crosslinker for 30 seconds. After 5 hours, the nematodes are transferred to new culture dishes and cultured for 24 hours. The mother nematodes are then removed, and the eggs are left to continue culturing. After 3 days, the fluorescence expression of the nematodes is observed. Nematodes with fluorescence expression and good phenotype are selected and cultured separately. If all intestinal cells in the next generation show fluorescence expression, nematodes with good phenotype are selected and cultured again. These nematodes are the nematode strains with successful integration of the nhx-2::YC3.60 nematode genome.
[0020] Preferably, the power of the ultraviolet crosslinker is 300 J / cm. 2 .
[0021] This application also provides a calcium ion signal research model made from the in vivo nematode intestine, which is constructed using the construction method described above.
[0022] Compared with the prior art, this application has the following beneficial effects:
[0023] 1. Nematode intestinal cells exhibit typical calcium signal-mediated physiological behavior. The nematode intestinal tissue has a simple structure, consisting of 10 cells arranged on each side. These intestinal cells mediate periodic excretion, which is regulated by calcium ion signals. Calcium ion signals are spontaneously generated from the caudal intestinal cells, propagating forward and simultaneously causing muscle contraction, manifesting as excretion. This spontaneously generated periodic calcium ion signaling phenomenon can serve as a model for studying the principles of spontaneous calcium oscillations, periodic rhythm regulation, transcellular calcium ion transmission, calcium ion-induced muscle contraction, and the interaction between calcium ions and neurons. It is a viable in vivo multicellular calcium ion signaling research model.
[0024] 2. The pPD95.75 plasmid was used as the vector. This plasmid is a commonly used transgenic vector for nematodes.
[0025] 3. Using the NHX-2 promoter, the probe gene was specifically expressed in nematode intestinal cells, with no significant expression in other tissues. The promoter determines the tissue specificity of gene expression. The NHX-2 promoter is widely distributed in intestinal cells, and its high expression in intestinal cells indicates it is a promoter specific to intestinal cells, with high expression levels in both nematode larvae and adults.
[0026] 4. Use YC3.60 as the fluorescent protein probe for detecting calcium ions. This probe can more accurately measure calcium ion signals, eliminate adverse interferences during the imaging process, and provide more realistic results. Only when the CFP fluorescence intensity of the probe decreases while the YFP fluorescence intensity increases does it indicate an increase in calcium ion concentration.
[0027] 5. A relatively simple and low-cost microinjection method was used to transgenerate nematodes. Subsequently, ultraviolet mutagenesis was used to integrate the exogenous gene into the nematode genome, thereby achieving stable transfection of the fluorescent protein probe. Attached Figure Description
[0028] Figure 1 The synthesis steps for the nhx-2 promoter sequence and YC3.60;
[0029] Figure 2 The process of creating a probe plasmid for nematode intestinal calcium ion fluorescent protein is described, where A is the insertion of the promoter nhx-2 (solid short arrow fragment) into the plasmid, and B is the insertion of the YC3.60 fragment (solid long arrow fragment) into the promoter;
[0030] Figure 3 The nhx-2::YC3.60 nematode line prepared in this application can achieve stable expression of the nematode intestinal cell calcium ion fluorescent probe protein. The scale bar is 80 micrometers.
[0031] Figure 4 This nematode strain was used for intestinal cell calcium ion fluorescence imaging analysis. In the left image, as calcium ion concentration increased, it bound to the fluorescent probe and underwent the FRET reaction, resulting in a decrease in CFP intensity and an increase in YFP intensity. The right image shows the changes in calcium ion levels seen in the left image. Detailed Implementation
[0032] The present invention will be further described in detail below with reference to specific embodiments.
[0033] The experimental materials involved in this application and their sources:
[0034] serial number Experimental materials source 1 Mineral oil, cholesterol, agarose Sigma Aldrich (Shanghai) Trading Co., Ltd. 2 Caenorhabditis elegans, OP 50 The CGC (Center for Nematode Research) in the United States 3 LB medium, coverslips, NGM nematode medium, M9 nematode buffer, DH 5α Escherichia coli, alcohol Shanghai Ruichu Biotechnology Co., Ltd. 4 Injection needle SUTTER INSTRUMENT (USA) 5 Restriction endonucleases, Platinum™ Taq high-fidelity DNA polymerase, T4 DNA ligase, pPD95.75 plasmid vector Thermo Fisher Scientific (China) Co., Ltd. 6 Tiangen plasmid recovery kit, gel recovery kit Tiangen Biotech (Beijing) Co., Ltd. 7 PCR primers, DNA fragment synthesis Shanghai Sangon Biotech Co., Ltd. 8 plasmid pGC1::YC3.60 Addgene USA
[0035] This application provides a calcium ion signal research model constructed using the in vivo nematode gut, and the model construction method is as follows:
[0036] S1: Nematode culture:
[0037] 1. Preparation of growth medium
[0038] 1.1. Preparation of food sources for bacteria
[0039] In the laboratory, *C. elegans* is typically fed with *E. coli* strain OP 50. *E. coli* OP 50 is a uracil auxotroph; its growth on NGM plates is restricted, ceasing reproduction after reaching a certain point. When the nematodes consume the bacteria, they resume growth to replenish the population, preventing overgrowth and eliminating vicious competition within the population. Therefore, it does not release toxins that could negatively impact nematode growth and development. The OP 50 bacteria are also provided by the CGC (Cephalomyelitis Genome Center) in the United States. Single-clone strains are isolated using the streak plating method and cultured overnight (approximately 8 hours) on LB medium. This bacterial suspension is then ready for plating.
[0040] 1.2. Preparation of NGM culture dishes
[0041] In the laboratory, *C. elegans* was cultured on OP50-coated non-GM agar using 35 mm diameter culture dishes. The label for the nematode culture dishes should not be on the lid, but rather on the bottom plate. NGM plate preparation: In a 2 L Erlenmeyer flask, add 3 g sodium chloride, 17 g agar, and 2.5 g peptone, along with 1 mL of 1 M calcium chloride, 1 mL of 1 M magnesium sulfate, and 25 mL of 1 M KPO4 buffer. Add 972 mL of water. After mixing, heat to boiling, cool, and add 1 mL of 5 mg / mL cholesterol ethanol solution. Mix well and, in a clean bench, transfer the mixture into 35 mm nematode culture dishes, filling the dish to approximately 3-4 mm (about 2 / 3 of the dish's height). After cooling, spread the OP50 bacterial suspension. Unspread culture dishes can be stored at 4°C for 1-2 weeks until use.
[0042] 1.3.OP 50 coated NGM board
[0043] Using a pipette under a laminar flow hood, apply approximately 0.05 mL of *E. coli* OP 50 liquid culture onto an NGM plate. Be careful not to spread the culture to the edge of the plate, as nematodes tend to spend most of their time in the bacteria. If the culture extends to the edge, the nematodes may crawl to the sides of the plate, dry out, and die. The culture should be spread in the center of the medium. Allow the *E. coli* OP 50 plate to grow at room temperature or 37°C for 8 hours (cool the plate to room temperature before adding the nematodes). It can be used for 2-3 weeks when stored at 4°C.
[0044] 2. Culture Caenorhabditis elegans in petri dishes
[0045] 2.1. Transferring nematodes growing on NGM plates
[0046] *Caenorhabditis elegans* is a tiny nematode, with adults approximately 1 mm in length, requiring a stereomicroscope for observation. A 10x eyepiece and objective lens are used. The nematodes are picked up using a platinum wire attached to one end of a chopstick-like metal rod. The platinum wire heats and cools rapidly, is oxidation-resistant, and can be frequently calcined in a flame to avoid contaminating the nematode stock. Once the nematode is located under the stereomicroscope, the tip of the wire is slowly lowered, the side of the nematode is gently wiped, and then it is lifted. The picked nematode is then placed on a fresh petri dish, the tip of the platinum wire is slowly lowered, the surface of the agar is gently touched, and the nematode is held in place to allow it to crawl off the wire.
[0047] 2.2. Nematode propagation
[0048] Incubate at 20°C, subculturing approximately every three days, placing two to three worms on each new petri dish. The incubation temperature can be maintained between 16°C and 25°C, with 20°C being the most common. *C. elegans* grows 2.1 times faster at 25°C than at 16°C, and 1.3 times faster at 20°C than at 16°C. Stock plates of *C. elegans* can be maintained for several months at 11°C or 16°C.
[0049] S2: Constructing probe plasmids for transgenic applications:
[0050] Please see Figure 1 First, the exogenous gene, YC3.60, is obtained. After obtaining the exogenous gene, it is inserted into the plasmid. The specific steps are as follows:
[0051] The NHX-2 promoter in this application was developed by Shanghai Sangon Biotech Co., Ltd. Specifically, as follows... Figure 1 As shown in the figure above, the nhx-2 promoter was synthesized chemically, with Hind III (AAGCTT) and BamHI (GGATCC) restriction sites (bolded parts in the figure) attached to both ends of the nhx-2 promoter. The sequence of the nhx-2 promoter is shown in SEQ ID NO: 01 (DNA sequence: ttatcatcacaggcactgacgacactgccaaagttttacaagctaatttATTAGCGCTCT).
[0052] Then, the fluorescent protein probe gene (YC3.60) was amplified using PCR technology, such as... Figure 1As shown in the figure below, KpnI (GGTACC) and EcoRI (GAATTC) restriction sites were added to both ends (the bolded parts in the figure). To improve the restriction efficiency, a three-base fragment was added to the end of the restriction site as a protective base. The YC3.60 gene cDNA sequence was obtained from plasmid pGC1::YC3.60, and the sequence length is 1962 bp (sequence number as SEQ ID NO: 02).
[0053] The valid cDNA sequences for YC3.60 in this application were purchased from Addgene.
[0054] The following primers were used for PCR amplification to obtain the following:
[0055] F: 5' CGGGGTACCCGCTCGAGCATGCATCTAGA 3'
[0056] R: 5'CCGGAATTCggcaaacaacagatggctgg 3'.
[0057] The YC3.60 sequence was amplified using a high-fidelity PCR enzyme.
[0058] The YC3.60 is a calcium ion fluorescent probe, with cyan fluorescent protein (CFP) at one end and yellow fluorescent protein (YFP) at the other. When calcium ions bind to the middle part, the overall conformation of the protein changes, and the structures at both ends approach each other and undergo fluorescence resonance energy transfer (FRET). The energy transfer from CFP to YFP causes the energy of CFP to decrease and the energy of YFP to increase. This is reflected in the decrease in the fluorescence intensity of CFP and the increase in YFP. Therefore, in calcium ion fluorescence imaging analysis, only when the intensity of CFP decreases and the intensity of YFP increases does it indicate an increase in calcium ion concentration. This allows for more accurate detection of dynamic changes in calcium ions.
[0059] Please see Figure 2 When inserting a foreign gene into a plasmid, the nhx-2 promoter sequence (the solid short arrow fragment) is first inserted into the plasmid. Figure 2 A), and then insert the fluorescent protein probe gene sequence YC3.60 (solid long arrow fragment) after the promoter ( Figure 2 B).
[0060] Specifically, in one embodiment, the method for inserting the nhx-2 promoter sequence into the plasmid is as follows:
[0061] The pPD95.75 plasmid and the chemically synthesized nhx-2 sequence were digested with restriction endonucleases Hind III and BamHI to obtain a linear fragment. Then, the nhx-2 fragment was ligated to the plasmid fragment using T4 DNA ligase to obtain the pPD95.75 plasmid with the nhx-2 promoter.
[0062] The fluorescent protein probe (YC3.60) is inserted into the plasmid in the following manner:
[0063] The pPD5.75 plasmid containing the promoter and the YC3.60 sequence obtained by PCR were then digested with restriction endonucleases KpnI and EcoRI. The digested sequence was then ligated with the plasmid fragment to obtain a plasmid containing the promoter nhx-2 and the YC3.60 sequence, which can be used for transgenic injection into nematodes.
[0064] The specific PCR, enzyme digestion, and enzyme ligation conditions are as follows:
[0065] 1. PCR
[0066] The target fragment was amplified by PCR using Thermo Fisher Scientific Platinum™ Taq high-fidelity DNA polymerase. Reaction volume (25 µL):
[0067] 10 × Platinum™ Taq High-Fidelity DNA Polymerase Buffer 2.5 µL dNTP Mix (10 mM) 0.5 µL Upstream primer (10 µM) 0.5 µL Downstream primer (10 µM) 0.5 µL Platinum™ Taq High-Fidelity DNA Polymerase 0.5 µL Template DNA 1 µL <![CDATA[50 mM MgSO4]]> 1 µL <![CDATA[ddH2O was supplemented to 25 µL]]>
[0068] The reaction steps are as follows:
[0069] step temperature time Pre-variation 94℃ 2 min transsexual 94℃ 15 s annealing 54-60℃ 30 s extend 68℃ 60 s / kb Keep 4℃ ~
[0070] 2. Enzyme digestion reaction: Use a 20 µL double digestion system.
[0071] 10×buffer 2 µL Restriction endonuclease 1 1 µL Restriction endonuclease 2 1 µL DNA fragments 2 µL <![CDATA[Make up to 20 µL with ddH2O]]> Reaction in a water bath at 37°C for 2 hours
[0072] 3. T4 ligase ligation reaction:
[0073] 10 µL system:
[0074] 10×T4 ligase buffer 1 µL T4 DNA ligase 1 µL Target fragment 2 µL carrier 1 µL <![CDATA[Make up to 10 µL with ddH2O]]> 22℃ water bath environment for 2 hours
[0075] S3: Transgenic and Genome Integration
[0076] In one embodiment, transgenic microinjection, followed by second- and third-generation screening, is used to select for the transmission of worms whose intestinal cells carry green fluorescent protein.
[0077] The genetic modification process is as follows:
[0078] Nematode transgenic injection and operation process
[0079] One day before injection, 40 L4-stage nematodes were transferred to freshly inoculated NGM agar plates with OP50. They were incubated overnight at 20°C to develop into young adults with fully developed reproductive lines.
[0080] One hour before injection, the nematodes were moved to 15°C to reduce their agility, making them easier to inject. 0.5 µl of DNA solution was added to a tipped capillary tube for microinjection, and the capillary tube was screwed into the needle holder of the micromanipulator. The capillary force collected the solution at the needle tip.
[0081] Place approximately 50 µL of mineral oil onto a dried 2% agarose pad. Under a stereomicroscope, transfer 3–5 nematodes into the oil and gently press the animals onto the agarose surface using the tip of an eyelash. Place the agarose pad on the microscope stage for microinjection and begin the injection procedure quickly, as the animals will dry and die within approximately 10–20 minutes.
[0082] Injection procedure
[0083] The TransferMan NK 2 microscopy operating system uses an injection robotic arm mounted on an inverted microscope. The arm is electrically operated and controlled by a joystick. An injection needle holder is mounted on the arm, tilted downwards at a 45-degree angle. The glass needle for injection is mounted on the needle holder, and a high-pressure air pump is connected to the other end of the holder to provide power for the injection. The needle can be moved omnidirectionally by the joystick. The joystick controls have a "coarse" mode and a "fine" mode, allowing for rapid and precise movements similar to the coarse and fine adjustments of the microscope.
[0084] Locate the nematode in the mineral oil droplet on the agarose pad under a 10x objective lens. Adjust the position of the slide containing the agarose pad so that the injection needle and the nematode's gonads are at a 45-degree angle.
[0085] In "Coarse" mode, move the needle with the joystick to the vicinity of the nematode's gonad. Switch to 40x objective lens and, in "Fine" mode, gently touch the needle tip to the dry agar plate. The glass needle tip will break, allowing the internal fluid to flow out. Then, align the needle tip and the cytoplasmic core of the nematode's distal gonad with each other on the focal plane. Gently move the needle tip horizontally towards the cytoplasmic core of the nematode's distal gonad until the needle tip penetrates it. Press the "Inject" button to release the DNA solution into the gonad. Inject only a small amount; do not inject too much. After injection, withdraw the needle tip and return it to its initial position. Add 2 drops of M9 buffer to the oil droplet containing the injected nematode. After a few minutes, the nematode's activity will recover. Transfer it to a culture dish coated with OP50 and culture for 3-5 days. Observe whether the offspring have a transgenic phenotype. A single transgenic treatment typically requires the injection of 15 to 20 nematodes.
[0086] After transgenic microinjection, 6-8 nematodes with good intestinal cell fluorescence expression were selected and cultured in 5 cm NGM dishes. After 4 days of culture at 21°C, 20 offspring nematodes that had not yet laid eggs were picked and cultured in 5 cm NGM dishes. A total of 200 nematodes were picked and cultured in 10 separate dishes. A UV crosslinker with a power of 300 J / cm was used for crosslinking. 2 The nematodes were irradiated for 30 seconds. After 5 hours, the nematodes were transferred to new culture dishes and cultured for 24 hours. The mother nematodes were then removed, and the eggs were left to continue culturing. After 3 days, the fluorescence expression of the nematodes was observed. Nematodes with fluorescence expression and good phenotype were selected and cultured separately. If all intestinal cells of the next generation showed fluorescence expression, nematodes with good phenotype were selected for further culture. These nematodes are the successfully integrated nematode strains of nhx-2::YC3.60 nematode.
[0087] This strain of nematode can stably express a calcium ion fluorescently labeled protein probe.
[0088] The probe used in this application contains two different fluorescent proteins, CFP and YFP. Imaging analysis requires simultaneous monitoring of both fluorescent signals, which necessitates the use of a spectroscope. The fluorescence emitted from the sample location is split into two paths: CFP and YFP. A CCD (Charge-coupled Device) camera is used to record the intensity changes of these two paths, and ImagePro Plus (IPP) is used for imaging analysis and data analysis to further calculate the changes in calcium ion levels.
[0089] Please see Figure 3 Nematode intestinal cells are relatively large, and the intestinal body is composed of two rows of 20 intestinal cells, occupying most of the worm's volume, making it easy to observe, image, analyze, and manipulate under a microscope.
[0090] Furthermore, the nematode strain described in this application exhibits stable expression of the fluorescent probe protein for calcium ions in its intestinal cells. This protein is expressed in both larval and mature nematode intestinal cells, and only in the nematode gut. Using this strain as an experimental model for calcium ion signal studies significantly reduces the workload of nematode passage, eliminating the need for picking nematodes under a fluorescence microscope and performing routine passage procedures. Moreover, the expression level and distribution of the nematode probe remain relatively stable.
[0091] And, as Figure 4 As shown, the nematode strain intestinal cells provided in this application can be used for microscopic imaging analysis of calcium ion level changes, overcoming the interference of nematode muscle movement on calcium ion imaging analysis and accurately recording changes in calcium ion levels. Thus, the nematodes do not need to be anesthetized or even fixed, remaining in their natural physiological state.
[0092] In summary, the nematode strains provided in this application can be used for research on multicellular calcium ion transport, intracellular calcium ion periodic oscillations, the origin of spontaneous calcium signals, calcium ion-induced muscle contraction, and the interaction between calcium ions and neurons. They can also be used to study organelle functions such as mitochondria. Mitochondria are one of the cell's calcium reservoirs and participate in calcium ion signal regulation. Due to limitations in experimental techniques, research on the subcellular structure mitochondria is relatively limited. Although mitochondria are well-known, their functional mechanisms remain largely unknown. Calcium ion channels on mitochondria are highly active, and calcium ion signaling can serve as a breakthrough point for mitochondrial function research.
[0093] In this application, YC3.60 is introduced into nematodes via transgenic technology. A promoter specifically expressed in intestinal cells is used to link the gene for this fluorescent probe protein into the nematode. After transfection, this fluorescent probe is specifically expressed in intestinal cells, with little or no expression in other tissues. This application also uses ultraviolet radiation to act on these nematodes. Through selection and passage, nematode lines that stably inherit the fluorescent protein gene are ultimately screened. These lines can serve as a model for studying calcium ion signaling in nematode intestinal cells. Furthermore, the unique calcium-regulated physiological behavior of nematode intestinal cells can be used to study calcium oscillations, periodic behavior, and intercellular calcium transfer.
Claims
1. A method for constructing a model for calcium ion signaling studies made from the intestine of a nematode of a body, characterized by: Comprising the following steps: S1: nematode culture; S2: constructing a transgenic probe plasmid: First, synthesize the nhx-2 promoter by chemical synthesis, and connect Hind III and BamH I enzyme cutting sites at both ends of the nhx-2 promoter; then use PCR technology to amplify YC3.60; Then, insert the nhx-2 promoter sequence into the plasmid, and then insert YC3.60 behind the promoter; S3: transgene and genome integration: microinject the transgene into nematodes, and then screen the second and third generations to obtain nematodes with green fluorescent protein in intestinal cells.
2. The method of claim 1, wherein the method is used to construct a model for studying calcium signaling in the intestine of a nematode. The PCR amplification primers of YC3.60 in S2 are as follows: F: 5' CGGGGTACCCGCTCGAGCATGCATCTAGA 3' R: 5' CCGGAATTCGGCAAACAACAGATGGCTGG 3'.
3. The method for constructing a calcium ion signal research model using an in vivo nematode gut as described in claim 2, characterized in that: The method for inserting the nhx-2 promoter into the plasmid in S2 is as follows: use Hand III and BamH I to double-enzyme cut the plasmid vector pPD95.75 and the promoter sequence, and then use T4 DNA ligase for enzyme connection.
4. The method for constructing a calcium ion signal research model using an in vivo nematode gut as described in claim 3, characterized in that: The method for inserting YC3.60 in S2 is as follows: use Kpnl and EcoR I to double-enzyme cut the plasmid vector pPD95.75 and the YC3.60 fragment PCR product, and then connect the obtained YC3.60 fragment and the plasmid vector to make a recombinant plasmid.
5. The method for constructing a calcium ion signal research model using an in vivo nematode gut as described in claim 4, characterized in that: The plasmid is pPD95.75 plasmid.
6. The method for constructing a calcium ion signal research model using an in vivo nematode gut as described in claim 5, characterized in that: After the transgene microinjection in S3 is completed, 6-8 nematodes with good intestinal cell fluorescence expression are selected and cultured in a 5 cm NGM culture dish, and after 4 days of culture at 21 degrees Celsius, 20 nematodes of the next generation that have not laid eggs are picked and placed in a 5 cm NGM culture dish, a total of 200 nematodes are picked and placed in 10 culture dishes, the nematodes are irradiated using an ultraviolet crosslinking instrument for 30s, and after 5 hours the nematodes are picked and placed in new culture dishes, and after 24 hours of culture, the parent nematodes are picked out and the eggs are left to continue culture; after 3 days, the fluorescence expression of the nematodes is observed, and nematodes with good fluorescence expression and phenotype are picked out and cultured separately; if the intestinal cells of the next generation all have fluorescence expression, nematodes with good phenotype are picked out and continue to be cultured, and these nematodes are the nematode strains with successful genome integration of nhx-2::YC3.
60.
7. The method of claim 6, wherein the method further comprises: The power of the ultraviolet crosslinking instrument is 300 J / cm 2 . 8. A model for calcium ion signaling studies made from the intestine of a nematode of a body, characterized by: Obtained using the construction method of any one of claims 1-7.