Preparation method and application of quantum dot labeled rift valley heat replication defective virion

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a preparation method and application of virions. According to the invention, a reverse genetic technology is utilized to construct a rift valley heat replication defective virus-like particle for visual tracking of virus infection dynamics. The virion is only subjected to amplification passage in NSm-Gn-Gc expression cells, only one round of infection occurs in other cells, amplification passage cannot be performed, the infectivity of the rift valley fever virus is reduced, and the operation difficulty and the exposure risk are reduced. According to the quantum dot-labeled particles, real-time visualization of infection dynamics is realized, and dynamic characteristics of virus invasion links are accurately quantified. The content of the invention can be expanded to animal models for tracking tissue organs that a single virion initially targets when invading a host in a non-replication state. A novel technical platform is established for exploring an infection replication mechanism of the rift valley fever virus, and an important reference is provided for tracking research of other high-pathogenicity viruses.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to methods for preparing viral particles and their applications. Background Technology

[0002] Rift Valley fever virus (RVFV) is an enveloped, segmented, single-stranded RNA virus with a genome consisting of three independent RNA segments (S, M, and L). The S segment encodes the viral non-structural protein NSs and the viral nucleoprotein NP; the M segment encodes the structural proteins Gn and Gc, and the non-structural protein NSm; and the L segment encodes the RNA-dependent RNA polymerase protein L. Rift Valley fever is a mosquito-borne zoonotic disease caused by Rift Valley fever virus RVFV. Infection can cause abortion in ruminant females, high mortality rates in young animals, and hemorrhagic fever in humans. In humans, most cases present with self-limiting, flu-like symptoms, but some cases develop into severe illness. The disease is most prevalent during mosquito seasons, and a characteristic lesion is liver damage.

[0003] Since its discovery in 1931, Rift Valley fever has expanded its geographical distribution, spreading from the African continent to multiple regions such as Madagascar, the Comoros Islands, Saudi Arabia, and Yemen. The virus has been reported in more than 30 countries, with outbreaks in 14. Importantly, the discovery of insect vectors for RVFV transmission in Europe and the Americas has opened the door for RVFV to emerge in new locations, potentially leading to significant epidemics and economic losses (HARTLEY DM, RINDERKNECHT JL, NIPP TL, et al. Potential effects of Rift Valley fever in the United States[J]. Emerg Infect Dis, 2011, 17(8):e1.;KONRAD SK, MILLER S NA temperature-limited assessment of the risk of Rift Valley fever transmission and establishment in the continental United States of America[J]. Geospat Health, 2012, 6(2):161-170.). RVFV is listed as a Category A priority pathogen by the National Institute of Allergy and Infectious Diseases and is considered a potential bioterrorism threat due to its susceptibility to inhalation infection (Department of Health and Human Services. Posession, use, and transfer of select agents and toxins. Final rule[J]. Fed Regist, 2005, 73(201):61363-61366.).

[0004] In 2015, the World Health Organization (WHO) Pathogen Prioritization Workshop listed Rift Valley Fever (RVF) as a “serious emerging disease likely to cause a public health emergency, for which there are no or no preventive and treatment solutions” (WHO.WHO publishes list of top emerging diseases likely to cause major epidemics[EB / OL].(2015-12-10)[2021-12-25].). Meanwhile, the journal *Science* listed Rift Valley Fever as one of the top ten research priorities based on the need for vaccines and treatments (COHEN J. Unfilled vials: scientifically feasible vaccines against major diseases are stalled for lack of funds[J].Science,2016,35 1 (6268):16-19.). With increasingly close global economic and trade ties and the spread of transmission media, RVF outbreaks continue to spread.

[0005] Rift Valley fever is listed as a notifiable disease by the World Organisation for Animal Health (OIE), and my country's Ministry of Agriculture and Rural Affairs classifies it as a Class A infectious disease. Research on live RVFV virus requires BSL-3 / ABSL-3 laboratories, whose construction and maintenance costs far exceed those of ordinary BSL-2 laboratories. From the initial high investment in laboratory construction to the ongoing costs of maintenance, reagents, and manpower, and the hidden expenses of compliance approvals and risk management, every aspect is cost-inefficient due to the core requirement of "safety and controllability." This high cost makes basic RVFV research difficult to conduct in ordinary research institutions. Furthermore, conducting research in biosafety level 3 or higher laboratories requires skilled technical operators and complex safety equipment, and the operation process also carries significant exposure risks and safety hazards. Therefore, there is an urgent need for efficient and safe research platforms to expand Rift Valley fever virus research, deeply explore the pathogenic mechanism of Rift Valley fever virus in cells, and provide safe and effective novel genetically engineered vaccines.

[0006] Currently, there are no specific treatments for Rift Valley fever (RVF), and vaccination is crucial for its prevention and control. There are currently no commercially available human vaccines for Rift Valley fever; only inactivated, vector-based, or live attenuated vaccines are administered to animals in endemic areas. Vaccines based on classic live attenuated viruses, naturally attenuated live viruses, or inactivated viruses have not been fully approved in non-RVF endemic areas due to their adverse properties (ALHAJ M. Safety and efficacy profile of commercial veterinary vaccines against Rift Valley fever: a review study[J]. J Immunol Res, 2016, 2016: 7346294.). Therefore, there is an urgent need to develop safer candidate vaccines.

[0007] Murakami et al. developed a novel, single-cycle replicable scMP-12 viral particle using the MP-12 strain of RVFV virus as the original strain. This viral particle contains a deletion of the nucleotide sequence encoding the Gn-Gc protein at 3597-3611 bp in the M segment, effectively knocking out the putative fusion peptide and the signal peptide targeting the endoplasmic reticulum on the Gc protein. Simultaneously, a gene sequence encoding green fluorescent protein was inserted into the S segment for indication. The VLPs produced by primary cells infected with this viral particle were non-infectious, and intracranial inoculation experiments in mice showed that the scMP-12 viral particle no longer possessed neurotoxicity. (Development of a novel, single-cycle replicable rift valley Fever vaccine. PLoS Negl TropDis. 2014;8(3):e2746.). Although the above study yielded a non-toxic and highly safe scMP-12 viral particle, this viral particle can only be used for vaccine preparation and drug development. Since its original strain MP-12 is a weakened strain obtained by continuous passage screening of wild-type RVFV virus ZH548 under the stress of 5-fluorouracil inducer, its genotype differs from that of wild-type RVFV strain. Therefore, scMP-12 virus particles are not applicable to basic research on RVFV virus, such as the pathogenic mechanism, genome and gene function, and host immune response.

[0008] To date, research on the life cycle of Rift Valley fever virus remains significantly insufficient, particularly in the technical bottleneck of tracking individual viral particles during infection. Traditional virological research methods primarily rely on population-level average data. While these methods can provide an overall trend of viral infection, they struggle to reveal the dynamic behavior and heterogeneity of individual viral particles during infection. This technical limitation severely restricts our in-depth understanding of the Rift Valley fever virus infection mechanism. Compared to lipophilic dyes or viral expression techniques such as GFP, quantum dots are photostable fluorescent semiconductor nanocrystals. Their small size allows them to encapsulate viral particles, and their emission spectrum is narrower than that of GFP, while their laser spectrum is broader. The technique of labeling single live viral particles with quantum dots is relatively complete and has high coupling efficiency, enabling real-time observation of virus-infected live cells. Currently, there are two main methods for labeling live viruses with quantum dots: the first is labeling viral nucleic acids using quantum dot-labeled viral nucleic acid complementary probes coupled to viral nucleic acids; the second is activating viral surface proteins with chemical reagents or fusing AP tags with viral proteins using reverse genetics, allowing quantum dots to bind to viral proteins. The use of quantum dots for labeling provides a powerful tool for deepening the biological foundation of Rift Valley fever virus research and lays a solid foundation for the development of vaccines and antiviral drugs, which is of profound significance.

[0009] Therefore, there is an urgent need to construct an RVFV virus particle that can be studied and manipulated in a BSL-2 laboratory, which would greatly simplify experimental procedures, reduce experimental costs, and promote basic research, vaccine development, and drug development in RVF biology. Summary of the Invention

[0010] This invention utilizes reverse genetics to construct a Rift Valley fever replication-deficient virus-like particle for visually tracking viral infection dynamics. This virus particle amplifies and passages only in cells expressing NSm-Gn-Gc protein; in other cells, it only undergoes one round of infection and cannot amplify or passage, thus reducing the infectivity of Rift Valley fever virus and enabling manipulation in a level-two laboratory. Based on this, the invention was completed.

[0011] In a first aspect, the present invention provides quantum dot-labeled Rift Valley heat replication defective virus particles, wherein the quantum dot-labeled Rift Valley heat replication defective virus particles are obtained through the following steps, specifically including: S01, Constructing the NSm-Gn-Gc heterologous expression system: The gene sequence encoding the NSm-Gn-Gc protein of the M segment of Rift Valley fever virus was ligated with a transfer plasmid to obtain a recombinant lentiviral plasmid; the gene sequence encoding the NSm-Gn-Gc protein is shown in SEQ ID NO.25. The obtained recombinant lentiviral plasmid and helper plasmid were co-transfected into HEK293 cells, and after incubation and culture, the lentivirus was collected by sedimentation. The collected lentiviruses were used to infect host cells, and a heterologous expression system that stably expressed NSm-Gn-Gc was obtained through screening. S02, constructing a Rift Valley Heat Replication-Defective Virus Genome Plasmid: Using the pBR322 vector as a backbone, the transcription vector pBR322-T7 was obtained by inserting the T7 promoter, hepatitis D virus ribozyme and T7 terminator through homologous recombination. Using the transcription vector pBR322-T7 obtained above as a backbone, pBR-T7-L-AP, pBR-T7-M-ΔG-mCherry and pBR-T7-S-ΔNSs-eGFP plasmids were constructed through homologous recombination; The pBR-T7-L-AP plasmid was prepared by inserting the L segment of Rift Valley fever virus into the pBR322-T7 vector and adding the AP tag into the pBR322-T7-RVFV L plasmid. The pBR-T7-M-ΔG-mCherry plasmid was prepared by replacing the open reading frame encoding the NSm-Gn-Gc protein in the M segment of Rift Valley fever virus with a gene sequence encoding a fluorescent protein. The pBR-T7-S-ΔNSs-eGFP plasmid was prepared by replacing the gene sequence encoding NSs protein in the S segment of Rift Valley fever virus with the gene sequence encoding fluorescent protein. S03, Rescue of Replication-Defective Viral Particles: The pBR-T7-L-AP, pBR-T7-M-ΔG-mCherry, and pBR-T7-S-ΔNSs-eGFP plasmids constructed in S02 were co-transfected into BSR-T7-G cells, cultured, and filtered to obtain RVFV-deficient viral replication particles that lack NSm-Gn-Gc and NSs proteins and express dual-color fluorescent protein with an AP tag on the L gene. These are Rift Valley Fever Replication-Defective Viral Particles with AP Tags. S04, D-biotin is linked to the lysine residue of the AP tag, and quantum dot-labeled streptavidin (QDs605-SA) is added. The quantum dot-labeled streptavidin is then labeled onto the biotinylated rdRVFV-AP to obtain QD-rdRVFV-AP, which is a quantum dot-labeled Rift Valley fever replication defective virus particle.

[0012] Furthermore, in step S01, the gene sequence encoding the NSm-Gn-Gc protein of the Rift Valley fever virus M segment is derived from the virulent strain ZH501.

[0013] Furthermore, in step S01, the transfer vector is a transfer plasmid belonging to a second-generation lentivirus packaging system.

[0014] Furthermore, the transfer plasmid is preferably the pSIN4-EF1α-IRES-Puro plasmid.

[0015] Furthermore, in step S01, the HEK293 cells are selected from any one of HEK293T cells, HEK293FT cells, or HEK293F cells.

[0016] Preferably, the HEK293 cells are HEK293T cells.

[0017] Furthermore, in step S01, the host cell is a BSR-T7 cell.

[0018] Furthermore, in step S01, the heterologous expression system is BSR-T7-G cells.

[0019] Further, in step S01, the auxiliary plasmid is selected from one or more of psPAX2, pMD2.G, pMDLg, Rev, VSV-g, pCAG-dR8.9 and / or pCMV-VSV-G.

[0020] Preferably, the helper plasmids are psPAX2 and pMD2.G.

[0021] Furthermore, in step S02, the RNA sequence of the L segment of the Rift Valley fever virus is derived from the virulent strain ZH501.

[0022] Furthermore, in step S02, the RNA sequence of the S segment of the Rift Valley fever virus is derived from the virulent strain ZH501.

[0023] Further, in step S02, the AP tag nucleotide sequence is as shown in SEQ ID NO.3.

[0024] Further, in step S02, the nucleotide sequence of the pBR-T7-L-AP plasmid is shown in SEQ ID NO.4.

[0025] Secondly, the present invention provides the application of quantum dot-labeled Rift Valley fever replication-defective virus particles in the preparation of vaccines and drugs for the prevention or treatment of Rift Valley fever virus, wherein the quantum dot-labeled Rift Valley fever replication-defective virus particles have single-cycle replication capability.

[0026] Furthermore, the method for preparing the quantum dot-labeled Rift Valley thermal replication defective virus particles includes the following steps: S01, Constructing the NSm-Gn-Gc heterologous expression system: The gene sequence encoding the NSm-Gn-Gc protein of the M segment of Rift Valley fever virus was ligated with a transfer plasmid to obtain a recombinant lentiviral plasmid; the gene sequence encoding the NSm-Gn-Gc protein is shown in SEQ ID NO.25. The obtained recombinant lentiviral plasmid and helper plasmid were co-transfected into HEK293 cells, and after incubation and culture, the lentivirus was collected by sedimentation. The collected lentiviruses were used to infect host cells, and a heterologous expression system that stably expressed NSm-Gn-Gc was obtained through screening. S02, constructing a Rift Valley Heat Replication-Defective Virus Genome Plasmid: Using the pBR322 vector as a backbone, the transcription vector pBR322-T7 was obtained by inserting the T7 promoter, hepatitis D virus ribozyme and T7 terminator through homologous recombination. Using the transcription vector pBR322-T7 obtained above as a backbone, pBR-T7-L-AP, pBR-T7-M-ΔG-mCherry and pBR-T7-S-ΔNSs-eGFP plasmids were constructed through homologous recombination; The pBR-T7-L-AP plasmid was prepared by inserting the L segment of Rift Valley fever virus into the pBR322-T7 vector and adding the AP tag into the pBR322-T7-RVFV L plasmid. The pBR-T7-M-ΔG-mCherry plasmid was prepared by replacing the open reading frame encoding the NSm-Gn-Gc protein in the M segment of Rift Valley fever virus with a gene sequence encoding a fluorescent protein. The pBR-T7-S-ΔNSs-eGFP plasmid was prepared by replacing the gene sequence encoding NSs protein in the S segment of Rift Valley fever virus with the gene sequence encoding fluorescent protein. S03, Rescue of Replication-Defective Viral Particles: The pBR-T7-L-AP, pBR-T7-M-ΔG-mCherry, and pBR-T7-S-ΔNSs-eGFP plasmids constructed in S02 were co-transfected into a heterologous expression system, and cells were cultured. After filtration, RVFV-deficient viral replication particles expressing dual-color fluorescent protein with NSm-Gn-Gc and NSs protein deletion and AP tag on the L gene were obtained, which are the Rift Valley Fever Replication-Defective Viral Particles with AP Tag; S04, D-biotin is linked to the lysine residue of the AP tag, and quantum dot-labeled streptavidin (QDs605-SA) is added. The quantum dot-labeled streptavidin is then labeled onto the biotinylated rdRVFV-AP to obtain QD-rdRVFV-AP, which is a quantum dot-labeled Rift Valley fever replication defective virus particle.

[0027] Furthermore, in step S01, the gene sequence encoding the NSm-Gn-Gc protein of the Rift Valley fever virus M segment is derived from the virulent strain ZH501.

[0028] Furthermore, in step S01, the transfer vector is a transfer plasmid belonging to a second-generation lentivirus packaging system.

[0029] Preferably, the transfer plasmid is pSIN4-EF1α-IRES-Puro plasmid.

[0030] Furthermore, in step S01, the HEK293 cells are selected from any one of HEK293T cells, HEK293FT cells, or HEK293F cells.

[0031] Preferably, the HEK293 cells are HEK293T cells.

[0032] Furthermore, in step S01, the host cell is a BSR-T7 cell.

[0033] Furthermore, in step S01, the heterologous expression system is BSR-T7-G cells.

[0034] Furthermore, in step S01, the auxiliary plasmid is selected from one or more of psPAX2, pMD2.G, pMDLg, Rev, VSV-g, pCAG-dR8.9 and / or pCMV-VSV-G.

[0035] Preferably, the helper plasmids are psPAX2 and pMD2.G.

[0036] Furthermore, in step S02, the RNA sequence of the L segment of the Rift Valley fever virus is derived from the virulent strain ZH501.

[0037] Furthermore, in step S02, the RNA sequence of the S segment of the Rift Valley fever virus is derived from the virulent strain ZH501.

[0038] Furthermore, in step S02, the AP tag nucleotide sequence is as shown in SEQ ID NO.3.

[0039] Furthermore, in step S02, the nucleotide sequence of the pBR-T7-L-AP plasmid is shown in SEQ ID NO.4.

[0040] Thirdly, the present invention provides the application of quantum dot-labeled Rift-Replication Defective Viral Particles as described in the first aspect of the present invention in imaging.

[0041] Furthermore, the imaging is live-cell imaging.

[0042] The quantum dot-labeled rift-replication-defective virus-like particles prepared by this invention have the following advantages: 1. Reduced Operational Difficulty and Exposure Risk: Conventional Rift Valley fever virus live virus research must be conducted in biosafety level 3 or higher facilities, which is costly and carries significant safety risks. Our results show that replication-deficient viruses cannot complete a second round of replication in wild-type cell lines and do not produce infectious viral particles. Therefore, these viruses can be safely handled in a biosafety level 2 (BSL-2) laboratory environment, significantly reducing the technical threshold and operational risks. These replication-deficient viruses still retain the ability to infect cells and can replicate in trans-complementary cell lines (which provide essential viral proteins), thus highly mimicking the behavior of wild-type viruses.

[0043] 2. Real-time Visualization of Infection Dynamics: This invention combines Rift-Trapped Replication-Defective Virus with quantum dot labeling technology to achieve real-time visualization of infection dynamics. This method provides, for the first time, precise dynamic data on intracellular viral transport at the single-virus level, revealing the virus's microtubule-dependent transport mechanism. Traditional population-based research methods can only obtain average data, masking individual differences between viral particles; while single-virus tracking technology reveals significant infection heterogeneity—even viral particles prepared in the same batch exhibit differences: some particles successfully enter cells and replicate, while others do not. This technology can accurately quantify the dynamic characteristics of each stage of viral invasion.

[0044] 3. New Technology Platform: The invention can be extended to animal models to track the initial target tissues and organs of a single viral particle when it invades the host in a non-replicating state. This study establishes a novel technology platform for exploring the infection and replication mechanism of Rift Valley fever virus and provides important reference for tracking research on other highly pathogenic viruses. Attached Figure Description

[0045] Figure 1 Gel electrophoresis image of the pSIN4-EF1α-NSmGnGc-IRES-Puro cloning plasmid.

[0046] Figure 2 The results of Western blot identification of the BSR-T7-G cell line are shown in the figure.

[0047] Figure 3 The image shows the IFA identification results of the BSR-T7-G cell line.

[0048] Figure 4 This is an image showing the electrophoresis results of positive clones.

[0049] Figure 5 This is a schematic diagram illustrating the construction of three types of plasmids.

[0050] Figure 6 The sequencing results are for the pBR322-T7-L-AP plasmid.

[0051] Figure 7 For microgenomic detection on BSR-T7.

[0052] Figure 8 For the rescue and propagation of rdRVFV-AP.

[0053] Figure 9 To detect the size of rdRVFV-AP genomic segments by RT-PCR.

[0054] Figure 10 The growth kinetics curves for rdRVFV-AP are shown.

[0055] Figure 11 rdRVFV-AP virus particles were purified by sucrose density gradient centrifugation.

[0056] Figure 12 This is an electron microscope image of rdRVFV-AP.

[0057] Figure 13 This study aimed to demonstrate the co-localization of QDs605 quantum dots and Gn protein on the surface of BHK-21 cells with adsorbed QD-rdRVFV-AP.

[0058] Figure 14 To detect the coupling of QDs605-SA with the L protein of QD-rdRVFV-AP viral particles using Western blotting.

[0059] Figure 15 A series of dynamic images showing the co-localization of QD-rdRVFV-AP (red) and MAP4-eGFP-labeled microtubules (green). Detailed Implementation

[0060] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0061] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments can be purchased through conventional commercial channels unless otherwise specified.

[0062] Terminology Explanation The RVFV virus strain ZH-501 used in this invention is the original wild-type reference strain of Rift Valley fever virus. It was isolated from the blood of a patient presenting with acute febrile illness during a major Rift Valley fever outbreak in Egypt in 1977. Due to its high virulence, this strain has become the standard strain for laboratory research.

[0063] In this invention, the genome of the RVFV virus strain ZH-501 consists of three independent RNA segments: the L segment (GenBank: DQ375406.1), the M segment (GenBank: DQ380200.1), and the S segment (GenBank: DQ380149.1).

[0064] The gene sequence encoding the NSm-Gn-Gc protein described in this invention is shown in SEQ ID NO.25.

[0065] Example 1: Construction of a BSR-T7-G cell line stably expressing NSm-Gn-Gc protein 1. Construction of recombinant lentiviral plasmids The L segment (GenBank: DQ375406.1), M segment (GenBank: DQ380200.1), and S segment (GenBank: DQ380149.1) gene sequences of RVFV strain ZH-501 were synthesized by Shanghai Jereh Biotechnology Co., Ltd.

[0066] Using the synthesized RVFV-ZH501-M as a template, and with Primer NSm-F:TGTCGTGAGGAATTCATGTATGTTTTATTA and Primer Gc-R:GCATGCGGATCCTTACTATGAGGCCTTCTT as upstream and downstream primers, the NSm-Gn-Gc gene fragment was amplified and recovered by PCR. The NSm-Gn-Gc gene fragment was ligated into the pSIN4-EF1α-IRES-Puro vector, and the ligation product was transformed into Stbl2 competent cells and incubated. Single colonies were picked, and colony PCR was performed using Primer NSm-F and Primer Gc-R as primers to obtain positive clones.

[0067] like Figure 1 As shown, the plasmid was extracted and sequenced. The obtained positive clone plasmid was named pSIN4-EF1α-NSm-Gn-Gc-IRES-Puro (nucleotide sequence: SEQ ID NO.1), which means that the plasmid carries the complete open reading frame (ORF) encoding the NSm-Gn-Gc protein of the RVFV-ZH501 M segment.

[0068] 2. Lentiviral Packaging HEK293T cells were passaged into well plates, and transfection was performed when the cell density reached 70%–80%. The transfection reagent Lipofectamine was used. TM LTX Reagent with PLUS TM Using Reagent (Invitrogn), 8 μg of pSIN4-EF1α-NSm-Gn-Gc-IRES-Puro plasmid, 8 μg of psPAX2 plasmid, and 6 μg of pMD2.G plasmid were co-transfected into HEK293T cells. Four hours later, the medium was replaced with DMEM containing 2% FBS. Forty-eight hours later, the cell supernatant was collected by centrifugation, and Lenti-X Concentrator reagent (Clontech) was added. The lentivirus in the supernatant was allowed to settle overnight, and the pellet was collected by centrifugation and resuspended in 3 mL of DMEM containing 2% FBS.

[0069] 3. Determination of the optimal screening concentration of puromycin for BSR-T7 cells The minimum sensitive concentration of puromycin to BSR-T7 cells was determined using a serial dilution method. BSR-T7 cells were seeded into wells of DMEM cell culture medium containing 10% FBS and free of puromycin. After 24 hours, the medium was aspirated and replaced with fresh medium containing puromycin at concentrations ranging from 1 μg / mL to 10 μg / mL, changing the medium every 2 days. Cell death was observed after 6-7 days. It was found that puromycin concentrations above 6 μg / mL caused complete cell death, thus the optimal selection concentration of puromycin for BSR-T7 cells was determined to be 5 μg / mL.

[0070] 4. Lentiviral infection of BSR-T7 cells and selection of puromycin-positive cell clones BSR-T7 cells were loaded at 3×10 6BSR-T7 cells were seeded at a density of 100 mm in 100 mm cell culture dishes. Lentiviral infection with MOI=5 was performed using polybrene reagent (Sigma) at 8 μg / mL as an adjuvant. Twelve hours post-infection, the medium was replaced with fresh DMEM containing 2% FBS. Twenty-four hours post-infection, the medium was replaced with DMEM containing 10% FBS and 5 μg / mL puromycin. Cells were then observed every 24 hours. Exfoliated cells were washed away with PBS and replaced with fresh medium containing 5 μg / mL puromycin until drug-resistant clones appeared, i.e., drug-resistant cells stably expressing NSm-Gn-Gc protein survived in medium containing 5 μg / mL puromycin. Cell suspensions were prepared by trypsin digestion, and single clones were sorted by flow cytometry into 96-well cell culture plates with 200 μL of DMEM containing 10% FBS per well. After 24 hours, the culture medium was replaced with DMEM medium containing 5 μg / ml puromycin and 10% FBS. Once monoclonal colonies formed, they were transferred to 48-well plates containing 10% FBS for further culture. After 24 hours, the medium was replaced again with DMEM medium containing 5 μg / ml puromycin and 10% FBS. Once monoclonal colonies formed, they were transferred to 24-well plates containing 10% FBS. Similarly, after 24 hours of culture, the medium was replaced with DMEM medium containing 5 μg / ml puromycin and 10% FBS for continued culture. Once monoclonal colonies formed, they were transferred to 6-well plates containing 10% FBS. The resulting cell lines were analyzed for NSm-Gn-Gc protein expression levels using Western blot. Cells with high expression levels were expanded and cryopreserved, and named the BSR-T7-G cell line.

[0071] 5. Identification of the BSR-T7-G cell line 5.1 Western blot detection and identification Collect 3×10 5One positive monoclonal cell was added, and 100 μL of cell lysis buffer was added, and the cells were lysed at room temperature for 5 min. The lysed cell sample was centrifuged at 4°C, and 60 μL of supernatant was collected. 20 μL of 4× protein loading buffer was added, and the mixture was incubated at 90°C for 10 min. The sample was separated by 10% SDS-PAGE. After electrophoresis, the protein on the protein gel was transferred to a PVDF membrane (Merck-Millipore) using a semi-dry transfer method. The PVDF membrane was blocked overnight at 4°C in PBS containing 5% BSA. The membrane was washed three times with PBST for 5 min each time, and then incubated at 37°C for 2 hours with 1:1000 diluted rabbit anti-Gc serum, mouse anti-Gn serum, and rabbit anti-NSm serum. The membrane was then washed three times with PBST for 5 min each time. Goat anti-mouse Dylight-IgG (Bio-Lon) and goat anti-rabbit Dylight-IgG (Immunoway) diluted 1:10000 were used as secondary antibodies. After incubation at 37°C for 1 hour, the cells were washed three times with PBST for 5 minutes each time. The results were detected by an Odyssey infrared fluorescence scanner.

[0072] Western blotting results are as follows: Figure 2 As shown, Western blotting analysis revealed that Gn was observed at 65 kDa, Gc at 55 kDa, and NSm at 15 kDa. The protein molecular weights were consistent with expectations, indicating that the Gn-Gc-NSm protein derived from the RVFV ZH501 strain was correctly expressed in this cell line.

[0073] 5.2 Identification by indirect immunofluorescence detection 1×10 4 The cells were evenly seeded into the cell culture plate, and the cells were allowed to grow to 1×10⁶ cells per cell culture plate. 5 Cells were fixed with 4% paraformaldehyde at room temperature for 10 min, followed by washing with PBS three times for 5 min each time. Cells were then incubated with 0.2% Triton X-100 for 10–20 min, followed by washing with PBS three times for 5 min each time. Cells were then blocked with 5% skim milk at room temperature for 1 hour, followed by washing with PBST three times for 5 min each time. Rabbit anti-Gc serum, mouse anti-Gn serum, and rabbit anti-NSm serum diluted 1:500 were added and the cells were incubated at room temperature for 1 hour. Secondary antibodies were prepared using goat anti-mouse IgG DyLight 568 (Abcam) diluted 1:1000 and goat anti-rabbit IgG DyLight 568 (Abcam). Cells were incubated at room temperature in the dark for 30 min, followed by washing with PBST three times for 5 min each time, and observed under an inverted fluorescence microscope.

[0074] like Figure 3As shown, the cell line was identified using the NSm-Gn-Gc specific antibody prepared in our laboratory. The cell line can fully express RVFV NSm-Gn-Gc. When the BSR-WT cell line was used as a control, no expression of RVFV NSm-Gn-Gc was observed in the cells.

[0075] In summary, this invention successfully constructed a BSR-T7-G cell line capable of stably expressing NSm-Gn-Gc protein.

[0076] Example 2: Construction of a replication-defective virus genome with an AP tag Cell culture BSR-T7 cells, BHK-21, Vero E6, HEK293T, and BSR-T7-G cell lines were cultured in DMEM containing 10% BSA at 37°C in a 5% CO2 incubator.

[0077] BSR-T7-G is a cell line that stably expresses the NSm-Gn-Gc protein of the Rift Valley fever virus strain ZH-501.

[0078] 2. Plasmid construction The pBR322-T7 (nucleotide sequence: SEQ ID NO.2) vector was preserved in our laboratory. This vector uses the low-copy cloning vector pBR322 as its backbone, and introduces the T7 promoter after the Sal I restriction site at the 5' end, and introduces the hepatitis D virus ribozyme (Rib) and the T7 transcription termination signal (T7 terminator) before the EcoRI restriction site at the 3' end.

[0079] Positive clone plasmid pBR-T7-L-AP: An AP tag sequence and a linker peptide were introduced at amino acid position 1852 of the RNA-dependent RNA polymerase L protein encoded by the L segment of the viral genome. The target fragment ZH501-L-1 was amplified using KODFX Neo high-fidelity enzyme (Toyobo) with Primer LF and Primer LbioR as upstream and downstream primers (Table 1); the target fragment ZH501-L-2 was amplified using KODFX Neo high-fidelity enzyme (Toyobo) with Primer LbioF and Primer LR as upstream and downstream primers (Table 1). The PCR products were recovered using a gel extraction kit (Novizan) and ligated to pBR322-T7 cells using the ClonExpress Ultra One Step Cloning Kit (Novizan). The ligation products were transformed into Stbl2 competent cells (Shanghai Weidi Biotechnology Co., Ltd.).

[0080] Single colonies were picked and colony PCR was performed using Primer LF and Primer LR as upper and lower primers, respectively, to obtain positive clones. Figure 4 (Electrophoresis results image), plasmids were extracted and sequenced. Figure 5 As shown, the obtained positive clone plasmid was named pBR-T7-L-AP (nucleotide sequence: SEQ ID NO.4), based on Figure 6 The sequencing results shown indicate that a recombinant plasmid with the AP tag sequence inserted into the L segment open reading frame was successfully constructed. That is, the plasmid carries the L segment of Rift Valley fever virus and the AP tag, the nucleotide sequence of which, SEQ ID NO.3, is (5'-GTCTGAACGATATCTTCGAGGCTCAGAAAATCGAATGGCACGAA-3').

[0081] Positive clone plasmid pBR-T7-M-ΔG-mCherry: PCR amplification was performed using pCAGG-mCherry as a template and Primer MF and Primer mCR as upstream and downstream primers. Using the synthesized RVFV-ZH501-M as a template and Primer UF and Primer MR as upstream and downstream primers, PCR amplification was performed. After recovering the two PCR products, they were ligated with pBR322-T7 cells, and the ligation products were transformed into Stbl2 competent cells. Colonies were picked for bacterial identification and sequencing.

[0082] like Figure 5 As shown, the positive clone plasmid was named pBR-T7-M-ΔG-mCherry (nucleotide sequence: SEQ ID NO.5), which means that the complete ORF sequence encoding the NSm-Gn-Gc gene in the M segment was deleted and replaced by the mCherry gene sequence.

[0083] Positive clone plasmid pBR-T7-S-ΔNSs-eGFP: Using the synthesized RVFV-ZH501-S as a template, and Primer SF and Primer NR as upstream and downstream primers, PCR amplification was performed, and the PCR products were recovered. Using pCAGGs-eGFP as a template, and Primer SR and Primer GF as upstream and downstream primers, PCR amplification was performed, and the PCR products were recovered. The two PCR products, pBR322-T7, were ligated, and the ligation product was transformed into Stbl2 competent cells. Colonies were picked for bacterial identification and sequencing.

[0084] like Figure 5As shown, the positive clone plasmid was named pBR-T7-S-ΔNSs-eGFP (nucleotide sequence: SEQ ID NO. 6), which means that the NSs gene sequence in the S segment is deleted and replaced by the eGFP gene sequence.

[0085] Table 1 Primer information for constructing positive clone plasmids Note: The italicized parts are homologous arm sequences, and the underlined parts are virus-specific sequences.

[0086] Example 3: Rescue and Identification of Replication-Defective Virus Replicons with AP Tags 1. Rescue of replication-defective virus replicons with AP tags One day before transfection, BSR-T7-G cells were passaged into 6-well plates. Transfection was performed when the cell density reached 70%–80%. Using Lipofectamine™ LTX Reagent with PLUSTM Reagent (Invitrogn), 1 μg each of plasmids pBR-T7-L-AP, pBR-T7-M-ΔG-mCherry, and pBR-T7-S-ΔNSs-eGFP were co-transfected into BSR-T7-G cells. Six hours after transfection, the medium was replaced with fresh DMEM containing 10% FBS. Fluorescence expression was observed under an inverted fluorescence microscope. Five days after transfection, the supernatant was collected and seeded into fresh BSR-T7-G cells. Five days after seeding, the virus in the supernatant was collected, centrifuged at 2000 rpm for 20 minutes to remove cell debris, and then filtered through a 0.45 μm PVDF membrane. The obtained viral particles are RVFV defective viral replicons that express dual-color fluorescent protein, with NSm-Gn-Gc and NSs proteins missing and the L gene carrying an AP tag. These are named replication-defective RVFV-AP (rdRVFV-AP) and denoted as generation P0.

[0087] like Figure 7 As shown, to verify the function of AP-tagged L protein, the pBR-T7-L-AP and pBR-T7-S-ΔNSs-eGFP plasmids were co-transfected into BSR-T7 cells using a microgenome experimental system. Only these two plasmids are required for the microgenome. Green fluorescence expression was observed 48 hours after transfection, indicating that the AP-tagged L protein can still function as an RNA polymerase.

[0088] like Figure 8As shown, plasmids pBR-T7-L-AP, pBR-T7-M-ΔG-mCherry, and pBR-T7-S-ΔNSs-eGFP were co-transfected into BSR-T7-G cells to obtain a replication-defective virus with an AP tag, namely, a replication-defective viral complex particle (rdRVFV-AP) with AP tagging, which is characterized by deletion of the NSm-Gn-Gc and NSs genes, expression of dual-color fluorescent protein, and encoding L protein ORF, and is denoted as generation P0.

[0089] 2. Large-scale culture of rdRVFV-AP virus particles When T225 cm 2 When the BSR-T7-G cell density in the cell culture flask reached 70%, rdRVFV-AP was inoculated. 1000 ml of cell culture supernatant was collected, centrifuged at 1500 rpm for 10 min at 4 °C, and the supernatant was collected again. The supernatant was then centrifuged at 30000 rpm for 3 h at 4 °C, and the precipitate was collected and resuspended in 4 ml PBS. The resuspended precipitate was purified by sucrose density gradient centrifugation using 20%, 40%, and 60% sucrose solutions. After centrifugation at 30000 rpm for 2 h at 4 °C, virus particles between 40% and 60% were collected and resuspended in 12 ml PBS. The residual sucrose solution was removed by centrifugation at 30000 rpm for 2 h at 4 °C, the precipitate was collected, resuspended in PBS, the concentration was determined, and the precipitate was aliquoted for testing or stored at -80 °C.

[0090] like Figure 8 As shown, when P0 generation rdRVFV-AP was seeded into wild-type BSR-T7 cells, dual-color fluorescence was observed under an inverted fluorescence microscope. After 48 hours, the collected cell supernatant was seeded into new wild-type BSR-T7 cells, and no fluorescence was observed. When P0 generation was seeded into wild-type BSR-T7 cells and cultured for 3 days, P1 generation was obtained, and fluorescence was visible in P1 generation. When P1 generation was seeded into new wild-type BSR-T7 cells and cultured for 3 days, P2 generation was obtained, and fluorescence was not visible in P2 generation.

[0091] Therefore, rdRVFV-AP has only one infection capability in cells that do not express NSm-Gn-Gc protein and cannot produce progeny viral particles, making it a replication-defective virus.

[0092] 3. Virus titer determination Virus titer is measured using TCID 50 The assay was performed using the (50% tissue culture infection dose) method. BSR-T7-G cells were spaced at 1 × 10⁻⁶ cells per well. 5Cells were seeded at a density of 100 μL in 48-well plates and incubated for 24 hours before viral infection. The viral stock solution was serially diluted 10-fold, with five replicates for each dilution, and 100 μL of diluted virus solution was inoculated into each well. After three days of incubation, positive wells were identified by observing the expression of green fluorescent protein, and the TCID was calculated using the Reed-Muench method. 50 value.

[0093] 4. Genome identification of rdRVFV-AP rdRVFV-AP RNA was extracted using the Tiangen Virus RNA Extraction Kit, reverse transcribed using the Gen Star Reverse Transcription Kit, and amplified by PCR using KOD FX Neo high-fidelity enzyme (Toyobo). Primers for the L, M, and S segments are shown in Table 2. The PCR products were identified by nucleic acid gel electrophoresis and then sent to a sequencing company for sequencing.

[0094] Table 2 Primer information for rdRVFV genome PCR amplification like Figure 9 As shown, RNA from rdRVFV-AP viral particles was extracted, and each segment was amplified by RT-PCR. The PCR products were identified by nucleic acid gel electrophoresis, and the size of each segment was as expected. Sequencing results showed that the genome was consistent with the original template genome and there were no mutations.

[0095] 5. Determination of the growth kinetics curve of rdRVFV-AP To determine the growth kinetics of rdRVFV-AP, BSR-T7-G cells were infected with an MOI of 0.01. After 1 h, the cells were washed twice with sterile PBS, and then cultured in DMEM containing 2% FBS at 37 °C. Cell supernatant was collected for 5 consecutive days, and vRNA was extracted. The copy number of the NP gene was detected by qPCR, and the viral growth kinetics curve was plotted.

[0096] like Figure 10 As shown, the viral titer reached its peak in the supernatant 4 days after cell infection, and then decreased. Approximately 1000 ml of cell culture supernatant was collected, and after ultracentrifugation and sucrose density gradient separation, the fraction located at the interface between the 40% and 60% sucrose solutions was aspirated. Figure 11 ), for use in subsequent experiments.

[0097] 6. Electron microscopy observation Take 200 μL of the purified rdRVFV-AP, perform negative staining with 2% phosphotungstic acid, and then image it using a Hitachi H-7650 transmission electron microscope.

[0098] like Figure 12As shown, the ultrapure rdRVFV-AP was stained using the phosphotungstic acid staining method and observed under a transmission electron microscope. The electron microscope images show that the virus structure consists of enveloped, spherical particles with a diameter of approximately 80–100 nm. The electron microscopic observations morphologically confirm the successful virus rescue. Example 4: Preparation and Identification of SA-QDs605-Labeled Biotinylated rdRVFV-AP 1. Preparation of SA-QDs605-labeled biotinylated rdRVFV-AP The Avi-tagged protein biotin labeling kit (Beyotime Biotechnology Co., Ltd.) utilizes the BirA protein, a key component of which specifically links biotin D-biotin to the lysine residue of the AP tag in the presence of ATP, achieving biotinylation of iRVFV-AP. During the biotinylation process, quantum dot-labeled streptavidin (QDs605-SA) (Wuhan Jiayuan Co., Ltd.) is simultaneously added. Streptavidin has a high affinity for biotin. Using the biotin-avidin system, the quantum dot-labeled streptavidin is labeled onto the biotinylated rdRVFV-AP, yielding QD-rdRVFV-AP, which is stored at 4 °C.

[0099] 2. QD-rdRVFV-AP Immunofluorescence Identification BHK-21 cells were pre-cooled at 4°C for 30 minutes and then inoculated at 3×10⁻⁶ cells per cell line. 5 BHK-21 cells or Vero E6 cells were seeded in a glass-bottomed confocal culture dish (Beyotime Biotechnology Co., Ltd.). After 16 h, SYTO™ deep red nucleic acid dye (Invitrogen) was added, and the cells were incubated at 37°C for 30 min to label the nuclei. The dish was then kept at 4°C for 30 min, the supernatant was discarded, and QD-rdRVFV-AP was added, followed by incubation at 4°C for 1 h. The dish was washed three times with PBS solution containing 3% BSA, and then fixed with 4% paraformaldehyde fixative (Solepro) at room temperature in the dark for 20 min. The cells were permeabilized with 0.1% Triton X-100 solution (Biosharp Biotechnology Co., Ltd.), blocked with PBS solution containing 5% BSA at room temperature for 1 h, and then the RVFV Gn mouse monoclonal antibody prepared in our laboratory was used as the primary antibody, and DyLight488 fluorescently labeled goat anti-mouse IgG (Abbkine) was used as the secondary antibody. The cells were then photographed using a high-resolution live-cell confocal microscope (LSM800, ZEISS).

[0100] like Figure 13 As shown, immunofluorescence detection using antibodies targeting RVFV Gn protein revealed significant co-localization of Gn protein and quantum dots on viral particles adsorbed on the cell surface.

[0101] 3. Western Blot Identification of QD-rdRVFV-AP QD-rdRVFV-AP was mixed with 5x instant-sediment SDS-PAGE protein loading buffer (SL11706, Coolabor) and incubated at 95°C for 5 min. The sample was then added to an 8% pre-prepared protein gel, transferred to 0.22 μM PVDF for transfer, and blocked in 5% skim milk at room temperature for 1 h. The membrane was incubated overnight at 4°C with laboratory-made NP (1:2000), L rabbit polyclonal antibody (1:500), and mouse Strep monoclonal antibody (Solepro). After incubation at room temperature for 1 h with DyLight 680-Labeled antibody to rabbit IgG (H+L) (5230-0402, KLP) and DyLight 800-labeled antibody to mouse IgG (H+L) (5230-0415, KPL), the membrane was washed three times and analyzed using a near-infrared fluorescence scanning imaging system (Odyssey CLX, LI-COR).

[0102] Western blot analysis of viral particles showed the presence of streptavidin signals at the migration sites corresponding to the L protein band. Figure 14 This confirms that quantum dots successfully bind to the virus via streptavidin. In summary, these results demonstrate the successful construction of quantum dot-labeled RVFV, suitable for subsequent single-virus tracing experiments.

[0103] Example 5: QD-rdRVFV-AP applied to live-cell imaging After entering the cell, viral particles rapidly and directionally move into the host cell. Previous studies have shown that many viruses, such as Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV), Influenza A Virus (IAV), and Classical Swine Fever Virus (CSFV), rely on microfilaments and microtubules for intracellular transport. To investigate whether RVFV also utilizes microtubules for intracellular transport, this invention uses QD-rdRVFV-AP to track the trajectory of the virus after it enters the cell.

[0104] Vero E6 cells were transfected with plasmid pcDNA3.1-3XMYC-MAP4-EGFP, which was purchased from the Miaoling plasmid platform. MAP4 cells tagged with GFP bind to all microtubules, and their overall distribution is clearly visible under a fluorescence microscope. Twenty-four hours after transfection, QD-rdRVFV-AP was added and incubated at 4°C to allow viral adsorption. One hour later, the cells were washed five times with pre-cooled PBS containing 3% BSA and placed on ice. The stage and cell incubator of the high-resolution live-cell confocal microscope were set to 37°C, and viral internalization was initiated with 5% CO2. Live-cell imaging was immediately performed, selecting three viewing angles and capturing images every 30 seconds. Real-time live-cell imaging continuously monitored the viral transport process after entry into the cells.

[0105] like Figure 15 As shown, imaging analysis revealed that quantum dot-labeled viral particles exhibited distinct directional movement along microtubules towards the cytoplasm. QD-rdRVFV-AP was observed to migrate along MAP4-labeled microtubules towards the perinuclear region of Vero-E6 cells.

[0106] In the initial stages following adsorption and endocytosis, QD-rdRVFV-AP exhibits relatively slow movement. As the viral particles undergo microtubule-mediated transport, their movement gradually accelerates. This indicates that the directional movement of RVFV within the cell depends on the cellular microtubule cytoskeleton system, a mechanism that facilitates more efficient viral transport to the endoplasmic reticulum for replication and transcription.

Claims

1. A quantum dot-labeled Rift Valley fever replicon defective viral particle, which is obtained by the following steps, specifically comprising: S01, connecting a gene sequence encoding NSm-Gn-Gc protein of a Rift Valley fever virus M segment to a transfer plasmid to obtain a recombinant lentivirus plasmid; the gene sequence encoding NSm-Gn-Gc protein is shown as SEQ ID NO. 25; co-transfecting the obtained recombinant lentivirus plasmid and a helper plasmid into HEK293 cells, collecting lentivirus and infecting host cells to obtain a heterologous expression system stably expressing NSm-Gn-Gc; S02, obtaining a transcription vector pBR322-T7 by inserting a T7 promoter, a hepatitis B virus ribozyme and a T7 terminator into a pBR322 vector as a backbone; constructing pBR-T7-L-AP, pBR-T7-M-ΔG-mCherry and pBR-T7-S-ΔNSs-eGFP plasmids with pBR322-T7 as a backbone; S03, co-transfecting the pBR-T7-L-AP, pBR-T7-M-ΔG-mCherry and pBR-T7-S-ΔNSs-eGFP plasmids constructed in S02 into BSR-T7-G cells to obtain an RVFV defective virus replicon particle expressing double-color fluorescent proteins with NSm-Gn-Gc and NSs protein deletion and an AP tag on the L gene, i.e. a Rift Valley fever replicon defective viral particle with an AP tag; S04, connecting D-biotin to the lysine residue of the AP tag and labeling quantum dot-labeled streptavidin (QDs605-SA) to the biotinylated rdRVFV-AP to obtain QD-rdRVFV-AP, i.e. a quantum dot-labeled Rift Valley fever replicon defective viral particle. 2.The quantum dot-labeled Rift Valley fever replicon defective viral particle of claim 1, wherein the gene sequence encoding NSm-Gn-Gc protein of the Rift Valley fever virus M segment is derived from a virulent strain ZH501; in step S01, the transfer vector belongs to a transfer plasmid in a second-generation lentivirus packaging system; the HEK293 cells are selected from any one of HEK293T cells, HEK293FT cells or HEK293F cells; the host cells are BSR-T7 cells; the heterologous expression system is BSR-T7-G cells; and the helper plasmid is selected from one or more of psPAX2, pMD2.G, pMDLg, Rev, VSV-g, pCAG-dR8.9 and / or pCMV-VSV-G. 3.The quantum dot-labeled Rift Valley fever replicon defective viral particle of claim 2, wherein in step S01, the transfer plasmid is a pSIN4-EF1α-IRES-Puro plasmid; the HEK293 cells are HEK293T cells; and the helper plasmid is psPAX2 and pMD2.G. 4.The quantum dot labeled Rift Valley Fever replicon particle of claim 1, wherein in step S02, the pBR-T7-L-AP plasmid is prepared by inserting the L segment of the Rift Valley Fever virus into a pBR322-T7 vector; the AP tag is added to the pBR322-T7-RVFV L plasmid; the pBR-T7-M-ΔG-mCherry plasmid is prepared by replacing the open reading frame encoding NSm-Gn-Gc protein in the M segment of the Rift Valley Fever virus with a gene sequence encoding a fluorescent protein; the pBR-T7-S-ΔNSs-eGFP plasmid is prepared by replacing the gene sequence encoding NSs protein in the S segment of the Rift Valley Fever virus with a gene sequence encoding a fluorescent protein; the RNA sequence of the L segment of the Rift Valley Fever virus is derived from a virulent strain ZH501; the RNA sequence of the S segment of the Rift Valley Fever virus is derived from a virulent strain ZH501; the AP tag nucleotide sequence is shown in SEQ ID NO. 3; and the nucleotide sequence of the pBR-T7-L-AP plasmid is shown in SEQ ID NO.

4. 5.Use of a quantum dot labeled Rift Valley Fever replicon particle in the preparation of a vaccine or a medicament for preventing or treating Rift Valley Fever virus, wherein the quantum dot labeled Rift Valley Fever replicon particle has single-cycle replicability; and the quantum dot labeled Rift Valley Fever replicon particle is as defined in any one of claims 1-4. 6.Use of the quantum dot labeled Rift Valley Fever replicon particle of claim 1 in imaging. 7.The use of claim 6, wherein the imaging is live cell imaging.

Images