Magnetic bead method nucleic acid extraction kit and nucleic acid extraction method

Abstract

The invention discloses a magnetic bead method nucleic acid extraction kit and a nucleic acid extraction method. The kit comprises a lysis solution I, a lysis solution II, a washing solution I, a washing solution II, an eluent and a magnetic bead solution, wherein the magnetic bead solution contains magnetic beads with different particle sizes. According to the method, the effects of specific release, adsorption and impurity removal of the nucleic acid are achieved through a two-step lysis system composed of the lysis solution I and the lysis solution II in combination with the magnetic bead particle size gradient distribution design, and the extracted nucleic acid is high in concentration and good in purity, can be compatible with various samples and is suitable for automatic high-throughput detection; and a high-stability and broad-spectrum nucleic acid extraction solution can be provided for clinical diagnosis and molecular detection. In addition, the kit does not need to use toxic reagents such as chloroform, and the safety is better than that of a traditional extraction method.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of gene detection services, and specifically relates to sample nucleic acid extraction. BACKGROUND

[0002] Nucleic acid extraction is the most critical link in molecular diagnosis, gene detection and biomedical research. The advantages and disadvantages of nucleic acid extraction technology will directly affect the safety and success of downstream experiments. With the explosive growth of the demand for precision medicine and on-site rapid testing, the requirements for high concentration, high purity, high throughput and sample type compatibility of nucleic acid extraction technology are constantly increasing.

[0003] Traditional nucleic acid extraction methods, such as phenol-chloroform extraction, CTAB method, chromatography column method, etc., generally have the disadvantages of complex operation steps, long time consumption, non-automated operation, low extraction efficiency and toxicity. Compared with traditional nucleic acid extraction methods, magnetic bead method for nucleic acid extraction has the advantages of simplicity, rapidity, reliability and automation. Although the magnetic bead method gradually replaces the traditional nucleic acid extraction method due to its advantages of simple operation, high throughput and automation compatibility, it still faces significant challenges. For example, existing commercial kits are designed for single samples, and the sample compatibility is limited. When processing other complex samples, the nucleic acid yield is prone to fluctuation, and the concentration of the extracted nucleic acid is low, which cannot meet the needs of subsequent detection. SUMMARY

[0004] The present application provides a magnetic bead method for nucleic acid extraction and a nucleic acid extraction method to overcome the deficiencies in the prior art.

[0005] The first object of the present application is to provide a magnetic bead method for nucleic acid extraction.

[0006] The second object of the present application is to provide the use of the kit in extracting sample nucleic acid.

[0007] The third object of the present application is to provide the use of the kit in preparing a sample nucleic acid extraction product.

[0008] The fourth object of the present application is to provide the use of the kit in preparing a PCR detection product.

[0009] The fifth object of the present application is to provide a method for extracting nucleic acid using the kit.

[0010] The above objects of the present application are achieved by the following technical solutions: The application provides a magnetic bead method nucleic acid extraction kit, comprising a lysis solution I, a lysis solution II, a washing solution I, a washing solution II, an elution solution and a magnetic bead solution; wherein the magnetic bead solution contains magnetic beads with different particle sizes.

[0011] The application provides a magnetic bead method nucleic acid extraction kit, which contains a lysis solution I, a lysis solution II, a washing solution I, a washing solution II, an elution solution and a magnetic bead solution; The lysis solution I contains guanidine hydrochloride with a concentration of 0.5 M-1 M, sodium citrate with a concentration of 10 mM-30 mM, Triton X-100 and chondroitin sulfate with a mass-volume ratio of 0.1%-0.5%, and has a pH of 6.0-7.0. The lysis solution II contains guanidine thiocyanate with a concentration of 3 M-5 M, Tris-HCl with a concentration of 40 mM-60 mM, ethylenediaminetetraacetic acid with a concentration of 30 mM-50 mM, sodium chloride with a concentration of 1 M-3 M, N-lauroylsarcosine sodium with a mass-volume ratio of 0.1%-0.5%, polylysine with a concentration of 0.01%-0.1%, chitosan with a concentration of 5%-10% and N-isopropyl acrylamide-co-methacrylic acid with a concentration of 3%-6%, and has a pH of 5.0-6.0. The magnetic bead solution contains magnetic beads with particle sizes of 80-120 nm, 180-220 nm and 480-520 nm, respectively, and the concentrations of the magnetic beads with different particle sizes are 0.5-1.0 mg / mL, 0.6-1.8 mg / mL and 0.6-2.5 mg / mL, respectively. The washing solution I contains ethanol with a volume percentage of 78%-82%, Tris-HCl with a concentration of 8 mM-12 mM and N-isopropyl acrylamide-co-methacrylic acid with a mass-volume ratio of 0.5%-1.5%, and has a pH of 7.0-8.0. The washing solution II contains ethanol with a volume percentage of 78%-82% and Tris-HCl with a concentration of 10 mM-20 mM. The elution solution contains Tris-HCl with a concentration of 10 mM-30 mM, ethylenediaminetetraacetic acid with a concentration of 0.1 mM-1 mM, and has a pH of 7.0-9.0.

[0012] Preferably, the lysis buffer I contains guanidine hydrochloride at a concentration of 0.8 M to 1 M, sodium citrate at a concentration of 20 mM to 30 mM, Triton X-100 and chondroitin sulfate at a mass-volume ratio of 0.2% to 0.5%, and has a pH of 6.5 to 6.8.

[0013] More preferably, the lysis buffer I contains guanidine hydrochloride at a concentration of 0.8 M, sodium citrate at 20 mM, Triton X-100 and chondroitin sulfate at a mass-volume ratio of 0.2%, and has a pH of 6.5.

[0014] Preferably, the lysis buffer II contains 4 M to 5 M guanidine thiocyanate, 50 mM to 60 mM Tris-HCl, 40 mM to 50 mM ethylenediaminetetraacetic acid, 2 M to 3 M sodium chloride, 0.1% to 0.5% sodium N-lauroyl sarcosinate, 0.08% to 0.1% polylysine, 8% to 10% chitosan, and 5% to 6% N-isopropylacrylamide-co-methacrylic acid, with a pH of 5.4 to 5.6.

[0015] More preferably, the lysis buffer II contains 4 M guanidine thiocyanate, 50 mM Tris-HCl, 40 mM ethylenediaminetetraacetic acid, 2 M sodium chloride, 0.1% N-lauroyl sarcosinate sodium, 0.08% polylysine, 8% chitosan, and 5% N-isopropylacrylamide-co-methacrylic acid, with a pH of 5.6.

[0016] Preferably, the washing solution I contains 80% ethanol by volume, 10 mM Tris-HCl, and 0.5%–1.0% N-isopropylacrylamide-co-methacrylic acid by mass / volume ratio, and has a pH of 7.0–7.2.

[0017] More preferably, the washing solution I contains 80% ethanol by volume, 10 mM Tris-HCl and 1.0% N-isopropylacrylamide-co-methacrylic acid by mass-volume ratio, and has a pH of 7.2.

[0018] Preferably, the washing solution II contains 80% ethanol and 10 mM Tris-HCl by volume.

[0019] Preferably, the eluent contains 10 mM Tris-HCl, 0.1–1 mM ethylenediaminetetraacetic acid, and has a pH of 8.0–8.2.

[0020] More preferably, the eluent contains 10 mM Tris-HCl, 1 mM ethylenediaminetetraacetic acid, and has a pH of 8.0.

[0021] Preferably, the magnetic bead solution contains magnetic beads with particle sizes of 100 nm, 200 nm and 500 nm, and the concentrations of the magnetic beads with different particle sizes are 0.5–1.0 mg / mL, 0.6–1.8 mg / mL and 0.6–2.5 mg / mL, respectively.

[0022] More preferably, the magnetic bead solution contains magnetic beads with particle sizes of 100 nm, 200 nm and 500 nm, and the concentrations of the magnetic beads with different particle sizes are 0.8–1.0 mg / mL, 0.6–1.0 mg / mL and 0.6–1.0 mg / mL, respectively.

[0023] More preferably, the magnetic bead solution contains magnetic beads with particle sizes of 100 nm, 200 nm and 500 nm, and the concentrations of the magnetic beads with different particle sizes are 0.8 mg / mL, 0.6 mg / mL and 0.6 mg / mL, respectively.

[0024] Optionally, the magnetic beads are siloxane magnetic beads.

[0025] The present invention also provides a method for extracting nucleic acid using the kit, comprising the following steps: mixing the sample from which nucleic acid is to be extracted with lysis buffer I and lysis buffer II and magnetic bead solution respectively, washing with washing buffer I and washing buffer II respectively, and eluting with water or elution buffer to obtain nucleic acid solution.

[0026] Specifically, the method for extracting nucleic acids using the kit includes the following steps: S1. Place the sample from which nucleic acid is to be extracted into a centrifuge tube. Add 0.8–1.2 μL of proteinase K and 20–30 μL of lysis buffer I per 15 μL of sample. After adding proteinase K and lysis buffer I, shake vigorously to mix. Incubate at 54–58°C with constant shaking. Add magnetic bead solution at a ratio of 8–12 μL per 15 μL of sample and mix well. Use a magnetic separator to adsorb the magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator. The concentration of proteinase K is 15–25 mg / mL. S2. Add 20-30 μL of lysis buffer II to a centrifuge tube containing supernatant at a ratio of 15 μL of sample. Shake at 54-58°C. Use a magnetic separator to adsorb magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator. S3. Add 20-30 μL of washing buffer I to a centrifuge tube containing supernatant at a ratio of 15 μL of sample. Invert the centrifuge tube several times, use a magnetic separator to adsorb magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator. S4. Add 20-30 μL of washing buffer II to a centrifuge tube containing supernatant at a ratio of 15 μL of sample. Invert the centrifuge tube several times, use a magnetic separator to adsorb magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator. S5. Add 3-8 μL of elution buffer per 15 μL of sample, then gently mix the centrifuge tube and incubate at 68-72°C for 3-5 minutes. S6. Using a magnetic separator to pick up magnetic beads, carefully transfer the elution buffer containing the separated DNA into a new centrifuge tube.

[0027] More specifically, the method for extracting nucleic acid using the kit includes the following steps: S1. Place the sample to be extracted for nucleic acid in a centrifuge tube, add 1 μL of proteinase K and 25 μL of lysis buffer I per 15 μL of sample, and then vigorously shake to mix. Shake at a constant temperature of 54-58°C. Add magnetic bead solution at a ratio of 10 μL per 15 μL of sample and mix. Use a magnetic separator to adsorb the magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator. S2. Add lysis buffer II to a centrifuge tube containing supernatant at a ratio of 25 μL per 15 μL of sample. Shake at 54–58°C. Use a magnetic separator to adsorb magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator. S3. Add washing buffer I to a centrifuge tube containing supernatant at a ratio of 25 μL per 15 μL sample. Invert the centrifuge tube several times, use a magnetic separator to adsorb magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator. S4. Add washing buffer II to a centrifuge tube containing supernatant at a ratio of 25 μL per 15 μL of sample. Invert the centrifuge tube several times, use a magnetic separator to adsorb the magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator. S5. Add 5 μL of elution buffer per 15 μL of sample, then gently mix the centrifuge tube and incubate at 68–72°C for 3–5 minutes. S6. Using a magnetic separator to pick up magnetic beads, carefully transfer the elution buffer containing the separated DNA into a new centrifuge tube.

[0028] Optionally, the sample may be whole blood, oropharyngeal swab, nasopharyngeal swab, cervical exfoliated cells, serum, plasma, sputum, saliva, or urine.

[0029] In addition to manual extraction, the kit can also be used in conjunction with a nucleic acid extractor for nucleic acid extraction.

[0030] Specifically, the nucleic acid is DNA.

[0031] This invention employs a two-step lysis system consisting of lysis buffer I and lysis buffer II. First, a low-concentration guanidine hydrochloride ionizing salt is combined with the mild detergent Triton X-100 to gently lyse the cell membrane, releasing intracellular nucleic acids while maintaining their macromolecular structural integrity, and simultaneously removing some impurities (such as lipids and polysaccharides). Then, a high-concentration guanidine thiocyanate ionizing salt is combined with sodium N-lauroyl sarcosinate, chitosan, and PNIPAM-co-AA (N-isopropylacrylamide-co-methacrylic acid) to thoroughly disintegrate the nuclear membrane, releasing the target nucleic acid and further removing inhibitors such as proteins. This two-step lysis reduces mechanical or chemical damage, maintains the integrity of nucleic acids, and improves purity and concentration even for complex samples such as sputum and saliva.

[0032] This invention controls the particle size gradient distribution of magnetic beads, retaining the high adsorption capacity of small magnetic beads while utilizing larger magnetic beads to reduce the risk of aggregation. In low-viscosity samples, small magnetic beads dominate adsorption, while larger magnetic beads help reduce aggregation of small beads; in high-viscosity samples, large magnetic beads maintain dispersion, while small magnetic beads fill in nucleic acid capture sites that large magnetic beads might miss due to rapid sedimentation. Therefore, the particle size gradient distribution of magnetic beads can enhance the nucleic acid recovery rate in samples and also enhance adaptability to diverse samples.

[0033] This invention seeks protection for the use of the kit in extracting nucleic acids from samples.

[0034] The present invention also claims protection for the use of the kit in the preparation of sample nucleic acid extraction products.

[0035] Optionally, the sample may be one or more of the following: whole blood, oropharyngeal swab, nasopharyngeal swab, cervical exfoliated cells, serum, plasma, sputum, saliva, or urine.

[0036] The present invention also seeks protection for the use of the kit in the preparation of PCR detection products.

[0037] Specifically, the PCR detection product also includes reagents required for the PCR reaction.

[0038] The present invention has the following beneficial effects: This invention provides a magnetic bead-based nucleic acid extraction kit, comprising lysis buffer I, lysis buffer II, washing buffer I, washing buffer II, elution buffer, and a magnetic bead solution; wherein the magnetic bead solution contains magnetic beads of different particle sizes. Based on the kit of this invention, this invention also provides a nucleic acid extraction method. Through a two-step lysis system composed of lysis buffer I and lysis buffer II, combined with a magnetic bead size gradient distribution design, nucleic acids can be released in a targeted, stepwise manner, reducing interference from impurities and maintaining the integrity of the nucleic acids. This method is suitable for the extraction of various samples and can be used with automated extraction systems. It is simple, convenient, and safe to operate, meeting the requirements for large-scale sample extraction. Furthermore, the kit of this invention eliminates the need for toxic reagents such as chloroform and phenol. Pre-packaged reagents are used in reagent plates, making it compatible with fully automated nucleic acid extractors, enabling high-throughput processing of large batches of samples, reducing manual operation steps, and thus significantly reducing harm to the environment and operators. Attached Figure Description

[0039] Figure 1 The electrophoretic detection results are shown for nucleic acids extracted using the magnetic bead nucleic acid extraction kits described in Examples 1-3 and Comparative Examples 1-11, respectively.

[0040] Figure 2 The amplification curves were obtained by amplifying the nucleic acids extracted from Examples 1-3 and Comparative Examples 1-11 using the same method.

[0041] Figure 3 The amplification curves were obtained by amplifying the nucleic acids of different samples extracted from Table 6 using the same method. Detailed Implementation

[0042] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0043] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0044] Example 1: A nucleic acid extraction kit and method using magnetic beads 1. Magnetic bead-based nucleic acid extraction kit The magnetic bead-based nucleic acid extraction kit described in this embodiment includes lysis buffer I, lysis buffer II, washing buffer I, washing buffer II, elution buffer, and magnetic bead solution; The lysis buffer I contains 0.5 M guanidine hydrochloride, 10 mM sodium citrate, 0.1% Triton X-100 by mass and volume, and 0.1% chondroitin sulfate by mass and volume, with a pH of 6.2. The lysis buffer II contains 3 M guanidine thiocyanate, 40 mM Tris-HCl, 30 mM EDTA (ethylenediaminetetraacetic acid), 1 M sodium chloride, 0.1% N-lauroyl sarcosinate sodium, 0.01% polylysine, 5% chitosan, and 3% PNIPAM-co-AA (poly-N-isopropylacrylamide-co-methacrylic acid), with a pH of 5.8. The washing solution I contains 80% ethanol by volume, 10 mM Tris-HCl and 0.5% PNIPAM-co-AA by mass / volume, with a pH of 7.0. The washing solution II contains 80% ethanol and 10 mM Tris-HCl by volume. The eluent contains 10 mM Tris-HCl, 0.1 mM EDTA, and has a pH of 8.2. The magnetic bead solution contains silanol magnetic beads of different sizes; wherein the concentrations of magnetic beads with sizes of 100, 200, and 500 nm are 1 mg / mL, 1 mg / mL, and 1 mg / mL, respectively.

[0045] 2. Nucleic acid extraction methods Based on the aforementioned magnetic bead-based nucleic acid extraction kit, the present invention also provides a nucleic acid extraction method, comprising the following steps: S1. Take 300 μL of sample into a 1.5 mL centrifuge tube, add 20 μL of proteinase K (20 mg / mL) and 500 μL of lysis buffer I, shake vigorously for 15-20 seconds, place in a preheated 56°C constant temperature shaker and shake at 1400 rpm for 5 min, remove the centrifuge tube from the 56°C constant temperature shaker, add 200 μL of well mixed magnetic beads, gently invert the centrifuge tube to mix, place at room temperature for 5 min, inverting every 1 min to mix, use a magnetic separator to adsorb the magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator; S2. Add 500 μL of lysis buffer II to the centrifuge tube that has already had its supernatant removed, place it in a preheated 56°C constant temperature shaker and shake at 1400 rpm for 5 min, use a magnetic separator to remove the magnetic beads, remove the supernatant, and remove the centrifuge tube from the magnetic separator. S3. Add 500 μL of washing solution I to the centrifuge tube to which the supernatant has been removed. Invert the centrifuge tube several times to ensure that the magnetic beads are completely dispersed. Use a magnetic separator to pick up the magnetic beads, remove the supernatant, and remove the centrifuge tube from the magnetic separator. S4. Add 500 μL of washing buffer II to the centrifuge tube to which the supernatant has been discarded. Invert the centrifuge tube several times to ensure that the magnetic beads are completely dispersed. Use a magnetic separator to pick up the magnetic beads, discard the supernatant, and remove the centrifuge tube from the magnetic separator. S5. After drying at room temperature with the cap open for 5 min, add 100 μL of elution buffer and gently mix the centrifuge tube. Incubate at 70°C for 3 minutes. S6. Use a magnetic separator to pick up magnetic beads, and carefully transfer the elution buffer containing the separated DNA into a new centrifuge tube for further testing or store at -20±5℃.

[0046] The sample is one of the following: whole blood, oropharyngeal swab, nasopharyngeal swab, cervical exfoliated cells, serum, plasma, sputum, saliva, or urine.

[0047] In addition to manual extraction, the magnetic bead-based nucleic acid extraction kit can also be used with a nucleic acid extractor, as detailed below: S1. Reagent aliquoting; aliquot each reagent from the above kit into pre-allocated reagent plates of a 96 (8×12) well plate; the first and seventh wells of the pre-allocated reagent plate contain lysis buffer II, the second and eighth wells contain lysis buffer I, the third and ninth wells contain washing buffer I, the fourth and tenth wells contain washing buffer II, the fifth and eleventh wells contain elution buffer, and the sixth and twelfth wells contain magnetic bead solution; as shown in Table 1 below: Table 1 shows the dispensing details of each reagent in the pre-dispensed reagent plate of the nucleic acid extraction kit.

[0048] S2. Add 300 μL of sample and 20 μL of proteinase K (20 mg / mL) to columns 2 and 8 respectively. S3. Turn on the HBNP-4803A fully automated nucleic acid extractor or a similar instrument, place the pre-packaged reagent plate containing the sample into the extractor, and insert the magnetic rod sleeve; S4. Select the corresponding nucleic acid extraction program and run the extraction program; the extraction program used in this invention is shown in Table 2: Table 2 Nucleic Acid Extraction Procedure

[0049] S5. After the automated process is completed, remove the pre-packaged reagent plate and magnetic sleeve, and take out the nucleic acid solution extracted from column 5 / 11 for the next step of detection or store it at -20±5℃.

[0050] Example 2: A nucleic acid extraction kit using magnetic beads The magnetic bead-based nucleic acid extraction kit described in this embodiment includes lysis buffer I, lysis buffer II, washing buffer I, washing buffer II, elution buffer, and magnetic bead solution; The lysis buffer I contains 1 M guanidine hydrochloride, 30 mM sodium citrate, 0.5% Triton X-100 by mass and volume, and 0.5% chondroitin sulfate by mass and volume, with a pH of 6.8. The lysis buffer II contains 5 M guanidine thiocyanate, 60 mM Tris-HCl, 50 mM EDTA, 3 M sodium chloride, 0.5% N-lauroyl sarcosinate sodium, 0.1% polylysine, 10% chitosan, and 6% PNIPAM-co-AA, with a pH of 5.4. The washing solution I contains 80% ethanol by volume, 10 mM Tris-HCl and 1.5% PNIPAM-co-AA by mass / volume, with a pH of 7.5. The washing solution II contains 80% ethanol and 20 mM Tris-HCl by volume. The eluent contains 30 mM Tris-HCl, 1 mM EDTA, and pH 8.4; The magnetic bead solution contains silanol magnetic beads of different sizes; wherein the concentrations of magnetic beads with sizes of 100, 200, and 500 nm are 0.5 mg / mL, 1.8 mg / mL, and 2.5 mg / mL, respectively.

[0051] The method for extracting nucleic acids using the kit is the same as in Example 1.

[0052] Example 3: A nucleic acid extraction kit using magnetic beads The magnetic bead-based nucleic acid extraction kit described in this embodiment includes lysis buffer I, lysis buffer II, washing buffer I, washing buffer II, elution buffer, and magnetic bead solution; The lysis buffer I contains 0.8 M guanidine hydrochloride, 20 mM sodium citrate, 0.2% Triton X-100 by mass and volume, and 0.2% chondroitin sulfate by mass and volume, with a pH of 6.5. The lysis buffer II contains 4 M guanidine thiocyanate, 50 mM Tris-HCl, 40 mM EDTA, 2 M sodium chloride, 0.1% N-lauroyl sarcosinate sodium, 0.08% polylysine, 8% chitosan, and 5% PNIPAM-co-AA, with a pH of 5.6. The washing solution I contains 80% ethanol by volume, 10 mM Tris-HCl and 1% PNIPAM-co-AA by mass / volume, with a pH of 7.2. The washing solution II contains 80% ethanol and 10 mM Tris-HCl by volume. The eluent contains 10 mM Tris-HCl, 1 mM EDTA, and pH 8.0; The magnetic bead solution contains silanol magnetic beads of different sizes; wherein the concentrations of magnetic beads with sizes of 100, 200, and 500 nm are 0.8 mg / mL, 0.6 mg / mL, and 0.6 mg / mL, respectively.

[0053] The method for extracting nucleic acids using the kit is the same as in Example 1.

[0054] Comparative Example 1 The difference between the magnetic bead-based nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that it does not contain lysis buffer I; otherwise, it is the same as in Example 3.

[0055] Comparative Example 2 The difference between the magnetic bead-based nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that it does not contain lysis buffer II; otherwise, it is the same as in Example 3.

[0056] Comparative Example 3 The difference between the magnetic bead-based nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that the lysis buffer II does not contain polylysine; otherwise, they are the same as in Example 3.

[0057] Comparative Example 4 The difference between the magnetic bead-based nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that the lysis buffer II does not contain chitosan; otherwise, they are the same as in Example 3.

[0058] Comparative Example 5 The difference between the magnetic bead-based nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that the lysis buffer II does not contain PNIPAM-co-AA, while the rest is the same as in Example 3.

[0059] Comparative Example 6 The difference between the magnetic bead-based nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that the lysis buffer II does not contain sodium N-lauroyl sarcosinate; otherwise, it is the same as in Example 3.

[0060] Comparative Example 7 The difference between the magnetic bead nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that the magnetic bead solution contains only magnetic beads with a particle size of 100 nm.

[0061] Comparative Example 8 The difference between the magnetic bead nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that the magnetic bead solution contains only magnetic beads with a particle size of 200 nm.

[0062] Comparative Example 9 The difference between the magnetic bead nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that the magnetic bead solution contains only magnetic beads with a particle size of 500 nm.

[0063] Comparative Example 10 The difference between the magnetic bead-based nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that the lysis buffer II does not contain sodium N-lauroyl sarcosinate and polylysine; otherwise, it is the same as in Example 3.

[0064] Comparative Example 11 The difference between the magnetic bead-based nucleic acid extraction kit described in this comparative example and the kit described in Example 3 is that the lysis buffer II does not contain chitosan and PNIPAM-co-AA, while the rest is the same as in Example 3.

[0065] Test Example 1: Nucleic Acid Extraction Efficiency Test This invention utilizes the magnetic bead-based nucleic acid extraction kits described in Examples 1-3 and Comparative Examples 1-11 to extract nucleic acids from saliva samples of the same healthy individuals. The method for extracting nucleic acids using the magnetic bead-based nucleic acid extraction kits described in Examples 1-3 and Comparative Examples 3-11 is the same as in Example 1. The method for extracting nucleic acids using the magnetic bead-based nucleic acid extraction kits described in Comparative Examples 1-2 is as follows: (1) The reagents in the magnetic bead nucleic acid extraction kit described in Comparative Examples 1 and 2 were aliquoted into pre-filled reagent plates of a 96-well (8×12) plate. The first and seventh columns of the pre-filled reagent plates contained lysis buffer II / I, the second and eighth columns contained washing buffer I, the third and ninth columns contained washing buffer II, the fifth and eleventh columns contained elution buffer, and the sixth and twelfth columns contained magnetic bead solution; as shown in Table 3: Table 3

[0066] (2) Add 300 μL of saliva sample to each of the 1st and 7th columns; (3) Turn on the HBNP-4803A fully automated nucleic acid extractor, put the pre-packaged reagent plate containing the sample into the extractor, and insert the magnetic rod sleeve; (4) Select the corresponding nucleic acid extraction program and run the extraction program; the nucleic acid extraction program is shown in Table 4: Table 4 Nucleic Acid Extraction Procedure

[0067] (5) After the automated process is completed, remove the pre-packaged reagent plate and magnetic sleeve, and take out the nucleic acid solution extracted from column 5 / 11 for the next step of detection or store it at -20±5℃.

[0068] Nucleic acid (DNA) was extracted from the saliva samples using the magnetic bead-based nucleic acid extraction kits described in Examples 1-3 and Comparative Examples 1-11. 2 μL of the extracted nucleic acid solution was then analyzed using a Nanodrop 2000 fluorescence spectrophotometer to obtain the A260 / A280 and A260 / A230 ratios. For pure DNA samples, the A260 / A280 ratio should be 1.8 ≤ A260 / A280 ≤ 2.0. If the A260 / A280 ratio is lower than 1.8, it indicates the presence of proteins or phenolic substances. The A260 / A230 ratio should be greater than 2.0. If the ratio is lower than 2.0, it indicates the presence of contaminants such as carbohydrates or guanidine salts in the sample. Simultaneously, 5 μL of the extracted nucleic acid solution was analyzed by agarose gel electrophoresis. Uniform bands indicate good nucleic acid integrity, while multiple bands indicate numerous breaks and poor integrity. Brighter bands indicate higher concentrations, while fainter bands indicate lower concentrations.

[0069] The concentration and purity of nucleic acids extracted using the magnetic bead-based nucleic acid extraction kits described in Examples 1-3 and Comparative Examples 1-11 are shown in Table 5. The agarose gel electrophoresis results are as follows: Figure 1 As shown.

[0070] Table 5. Concentration and purity of nucleic acids extracted from saliva samples.

[0071] As shown in Table 5, when extracting nucleic acid from the same sample, the nucleic acid concentration extracted using the magnetic bead nucleic acid extraction kit described in Example 3 of this invention is higher, and the purity is better, with less influence from proteins or phenolic substances and fewer contaminants such as guanidine salts. Figure 1 It can be seen that when extracting nucleic acid from the same sample, the nucleic acid band extracted using the magnetic bead nucleic acid extraction kit described in Example 3 is the brightest and has no fragmented small fragments, with better integrity and concentration.

[0072] To determine whether the extracted nucleic acids could be used for subsequent PCR detection, the present invention used the nucleic acids extracted in Examples 1-3 and Comparative Examples 1-11 as templates, and prepared reaction systems according to the human internal reference gene (RNaseP) amplification kit, and performed fluorescent PCR detection. The primers and probes used for detection are shown below; wherein, the 5' end of the probe is modified with ROX and the 3' end is modified with BHQ2.

[0073] Upstream primer (RNase P-F): AATTTCGGCACGAGGTGGGAC; Downstream primer (RNase P-R): TGATAGCCAAGGTGAGCGG; Probe (RNase P-P): TGGACCTGCGAGCGGGTTCTGACCT; The amplification procedure is as follows: 55℃, 15 min; 95℃, 30 s; 95℃, 5 s; 60℃, 20 s, repeat 45 times.

[0074] Amplification results as follows Figure 2 As shown, the nucleic acid extracted from saliva samples in Examples 1-3 and Comparative Examples 1-11 all showed amplification curves, with the nucleic acid amplification results obtained using the nucleic acid extraction kit described in Example 3 of this invention being the best.

[0075] Test Example 2: Nucleic acid extraction efficiency test on different samples In addition, the present invention used the magnetic bead nucleic acid extraction kit described in Example 3 to extract nucleic acids from different samples (including whole blood, oropharyngeal swabs, nasopharyngeal swabs, cervical exfoliated cells, serum, plasma, sputum, saliva and urine) from healthy individuals, and tested the concentration and purity of the extracted nucleic acids. Each sample was repeated 3 times, and the results are shown in Table 6.

[0076] Table 6. Concentration and purity of nucleic acids extracted from samples using the kit described in Example 3.

[0077] Currently, most nucleic acid extraction kits struggle to achieve DNA concentrations exceeding 200 ng / μL when extracting nucleic acids from samples such as whole blood. Table 6 shows that, when extracting nucleic acids from different samples, the nucleic acid concentration extracted using the magnetic bead-based nucleic acid extraction kit described in Example 3 of this invention is stable and of high purity. Furthermore, when extracting nucleic acids from samples such as whole blood, the DNA concentration obtained is consistently higher than 200 ng / μL.

[0078] Referring to the method described in Test Example 1, this invention used nucleic acids extracted from different samples obtained in Table 6 as templates, prepared reaction systems according to the human internal reference gene (RNaseP) amplification kit, and performed fluorescent PCR detection. The amplification results are as follows: Figure 3 As shown, the results indicate that all extracted nucleic acids from various samples have amplification curves and good amplification repeatability, meaning that nucleic acids of various sample types extracted using the magnetic bead nucleic acid extraction kit described in Example 3 of this invention can be stably detected.

[0079] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A magnetic bead method nucleic acid extraction kit, characterized by, The lysis solution I, the lysis solution II, the washing solution I, the washing solution II and the magnetic bead solution are contained. The lysis solution I contains 0.5 M-1 M guanidine hydrochloride, 10 mM-30 mM sodium citrate, 0.1%-0.5% Triton X-100 and 0.1%-0.5% chondroitin sulfate by mass volume ratio, and has a pH of 6.0-7.

0. The lysis solution II contains 3 M-5 M guanidine thiocyanate, 40 mM-60 mM Tris-HCl, 30 mM-50 mM ethylenediaminetetraacetic acid, 1 M-3 M sodium chloride, 0.1%-0.5% N-lauroylsarcosine sodium by mass volume ratio, 0.01%-0.1% polylysine, 5%-10% chitosan and 3%-6% N-isopropyl acrylamide-co-methacrylic acid, and has a pH of 5.0-6.

0. The washing solution I contains 78%-82% ethanol by volume percentage, 8 mM-12 mM Tris-HCl and 0.5%-1.5% N-isopropyl acrylamide-co-methacrylic acid by mass volume ratio, and has a pH of 7.0-8.

0. The washing solution II contains 78%-82% ethanol by volume percentage and 10 mM-20 mM Tris-HCl. The magnetic bead solution contains magnetic beads with particle sizes of 80-120 nm, 180-220 nm and 480-520 nm, respectively, and the concentrations of the magnetic beads with different particle sizes are 0.5-1.0 mg / mL, 0.6-1.8 mg / mL and 0.6-2.5 mg / mL, respectively.

2. The kit according to claim 1, characterized in that, The elution solution further contains 10 mM-30 mM Tris-HCl and 0.1 mM-1 mM ethylenediaminetetraacetic acid, and has a pH of 7.0-9.

0.

3. The kit according to claim 1 or 2, characterized in that, The proteinase K is further contained.

4. Use of the kit according to any one of claims 1 to 3 for the extraction of nucleic acids from a sample, characterized in that, The sample is one or more of whole blood, oropharyngeal swab, nasopharyngeal swab, cervical exfoliated cell, serum, plasma, sputum, saliva and urine.

5. Use of the kit according to any one of claims 1 to 3 for the preparation of a product for the extraction of nucleic acids from a sample, characterized in that, The sample is one or more of whole blood, oropharyngeal swab, nasopharyngeal swab, cervical exfoliated cell, serum, plasma, sputum, saliva and urine.

6. Use of the kit of any one of claims 1-3 in the preparation of a PCR detection product.

7. Use according to claim 6, characterized in that, The PCR detection product further comprises reagents required for PCR reaction.

8. A method for extracting nucleic acid using the kit according to any one of claims 1 to 3, characterized by, The sample to be extracted for nucleic acid is mixed and reacted with the lysis solution I and the lysis solution II and the magnetic bead solution, respectively, and then washed with the washing solution I and the washing solution II, respectively, and eluted with water or the elution solution to obtain a nucleic acid solution.

9. The method of claim 8, wherein, The sample is one or more of whole blood, oropharyngeal swab, nasopharyngeal swab, cervical exfoliated cell, serum, plasma, sputum, saliva and urine.

10. The method of claim 8, wherein, The method is performed by using a nucleic acid extractor. The lysis solution I, the lysis solution II, the washing solution I, the washing solution II and the magnetic bead solution are contained. The lysis solution I contains 0.5 M-1 M guanidine hydrochloride, 10 mM-30 mM sodium citrate, 0.1%-0.5% Triton X-100 and 0.1%-0.5% chondroitin sulfate by mass volume ratio, and has a pH of 6.0-7.

0. The lysis solution II contains 3 M-5 M guanidine thiocyanate, 40 mM-60 mM Tris-HCl, 30 mM-50 mM ethylenediaminetetraacetic acid, 1 M-3 M sodium chloride, 0.1%-0.5% N-lauroylsarcosine sodium by mass volume ratio, 0.01%-0.1% polylysine, 5%-10% chitosan and 3%-6% N-isopropyl acrylamide-co-methacrylic acid, and has a pH of 5.0-6.

0. The washing solution I contains 78%-82% ethanol by volume percentage, 8 mM-12 mM Tris-HCl and 0.5%-1.5% N-isopropyl acrylamide-co-methacrylic acid by mass volume ratio, and has a pH of 7.0-8.

0. The washing solution II contains 78%-82% ethanol by volume percentage and 10 mM-20 mM Tris-HCl. The magnetic bead solution contains magnetic beads with particle sizes of 80-120 nm, 180-220 nm and 480-520 nm, respectively, and the concentrations of the magnetic beads with different particle sizes are 0.5-1.0 mg / mL, 0.6-1.8 mg / mL and 0.6-2.5 mg / mL, respectively. The elution solution further contains 10 mM-30 mM Tris-HCl and 0.1 mM-1 mM ethylenediaminetetraacetic acid, and has a pH of 7.0-9.

0. The proteinase K is further contained. The sample is one or more of whole blood, oropharyngeal swab, nasopharyngeal swab, cervical exfoliated cell, serum, plasma, sputum, saliva and urine. The sample is one or more of whole blood, oropharyngeal swab, nasopharyngeal swab, cervical exfoliated cell, serum, plasma, sputum, saliva and urine.

6. Use of the kit of any one of claims 1-3 in the preparation of a PCR detection product. The PCR detection product further comprises reagents required for PCR reaction. The sample to be extracted for nucleic acid is mixed and reacted with the lysis solution I and the lysis solution II and the magnetic bead solution, respectively, and then washed with the washing solution I and the washing solution II, respectively, and eluted with water or the elution solution to obtain a nucleic acid solution. The sample is one or more of whole blood, oropharyngeal swab, nasopharyngeal swab, cervical exfoliated cell, serum, plasma, sputum, saliva and urine. The method is performed by using a nucleic acid extractor.

Images