Primer probe, kit and detection method for detecting wheat leaf blight bacteria based on Real-time MIRA
By using the Real-time MIRA detection method, a combination of specific primers and fluorescent probes was employed to achieve isothermal rapid amplification and real-time fluorescence interpretation of wheat leaf blight pathogens, solving the problem of long detection cycles in existing technologies and improving detection efficiency and accuracy.
Patent Information
- Application Number
- CN202511903878.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-17
- Publication Date
- 2026-01-16
AI Technical Summary
In scenarios involving rapid screening and on-site treatment, existing technologies, such as conventional PCR and quantitative real-time PCR, have long detection cycles for wheat leaf blight pathogens, making it difficult to balance detection efficiency and accuracy.
The Real-time MIRA detection method was used, employing specific upstream primer AT-F1 and downstream primer AT-R1, combined with the fluorescent probe AT-P for isothermal rapid amplification. The fluorescent probe AT-P was labeled with FAM fluorescence and quenched by BHQ1, with a C3spacer blocking group at the 3′ end. A/B buffer and a 50 μL standard reaction system were used for real-time signal acquisition at 39℃ for 30 s and 40 cycles.
This method enables rapid and accurate detection of wheat leaf blight pathogens, reduces background interference from nonspecific amplification, improves the specificity and reliability of detection results, and meets the needs of rapid screening.
Smart Images
Figure CN121344249A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of fungal detection technology, specifically to a primer probe, kit, and detection method for detecting wheat leaf blight fungus based on Real-time MIRA. Background Technology
[0002] Wheat leaf blight (Alternaria triticina) is a significant quarantine fungal disease affecting wheat. It primarily infects wheat leaves, causing symptoms such as leaf spot and leaf blight, leading to severe yield losses. In severe cases, yield losses can exceed 60%, and in susceptible varieties, infection during the booting stage can result in near-total loss. Its main hosts are bread wheat and durum wheat, but it can also infect oats, barley, rye, and other crops. This disease occurs in more than twenty countries and regions across Asia, Europe, Africa, North America, and South America. Infected seeds are the primary route of long-distance transmission. The risk of pathogen introduction via host introduction is increasing, placing higher demands on the rapid and accurate detection of wheat leaf blight at ports of entry and related quarantine sites.
[0003] Currently, common methods for detecting wheat leaf blight pathogens include isolation and culture, conventional PCR, and quantitative real-time PCR. Among these, PCR methods are widely used due to their advantages of high specificity, high sensitivity, and ability to provide detection results; however, their amplification cycle is relatively long, making it difficult to balance detection efficiency and timeliness in scenarios requiring rapid customs clearance screening or rapid on-site handling.
[0004] Therefore, there is an urgent need to develop a suitable isothermal rapid amplification real-time fluorescence detection system for wheat leaf blight, and to develop reproducible and scalable primer / probe configurations and matching kits to meet the comprehensive requirements of quarantine detection for speed and accuracy. Summary of the Invention
[0005] This invention provides a primer probe and kit for detecting wheat leaf blight based on Real-time MIRA.
[0006] The present invention solves the above-mentioned technical problems through the following technical solution:
[0007] A primer probe for detecting wheat leaf blight based on Real-time MIRA includes:
[0008] The primer probe includes an upstream primer AT-F1, a downstream primer AT-R1, and a fluorescent probe AT-P, wherein:
[0009] AT-F1 is an oligonucleotide primer with the following nucleotide sequence (5′→3′): TGAGCGTATAGCCTCGTGAGATATGTGGTAG;
[0010] AT-R1 is an oligonucleotide primer with the following nucleotide sequence (5′→3′): TAGAGTGTTCAATGTAGCCGCAGCGATGATATG;
[0011] AT-P is an oligonucleotide fluorescent probe, which includes, from the 5′ end to the 3′ end, a first nucleotide fragment S1, a fluorescently labeled thymine deoxynucleotide FAM-dT, a tetrahydrofuran (THF) site, a quenched thymine deoxynucleotide BHQ1-dT, and a second nucleotide fragment S2, and the 3′ end of AT-P is connected to a C3spacer blocking group.
[0012] The nucleotide sequence (5′→3′) of S1 is: TCAGAATACCGCGGTCGTCGCATCTGAAA, and the nucleotide sequence (5′→3′) of S2 is: AATGGGATCATTGTG; the fluorescent label is FAM, and the quenching label is BHQ1.
[0013] A real-time fluorescence MIRA detection kit for detecting wheat leaf blight pathogen, the detection kit comprising at least: primers and probes; and amplification reaction components for multi-enzyme isothermal rapid amplification;
[0014] The primers and probes include upstream primer AT-F1, downstream primer AT-R1, and fluorescent probe AT-P.
[0015] In one specific embodiment, the amplification reaction components include buffer A and buffer B.
[0016] In one specific embodiment, the total volume of the reaction system used to construct the detection kit is 50 μL, and includes: 1.0 μL DNA template, 2 μL upstream primer (10 μmol / L), 2 μL downstream primer (10 μmol / L), 0.6 μL probe (10 μmol / L), 29.4 μL buffer A, 2.5 μL buffer B, and 12.5 μL ddH2O.
[0017] A detection method for wheat leaf blight pathogen based on real-time fluorescence MIRA includes the following steps:
[0018] Extract genomic DNA from the sample to be tested;
[0019] The genomic DNA is mixed with the primer and probe combination described in claim 1 and the multi-enzyme isothermal rapid amplification reaction components to obtain the amplification reaction system;
[0020] Amplification was performed under isothermal conditions and fluorescence signals were acquired in real time.
[0021] The presence of wheat leaf blight pathogens in the sample is determined based on the fluorescence signal.
[0022] In one specific embodiment, the reaction procedure for real-time acquisition of fluorescence signals is: 39°C, 30s, 40 cycles.
[0023] This invention provides a primer probe, detection kit, and detection method for detecting wheat leaf blight pathogens based on Real-time MIRA. Addressing the limitations of existing isolation and culture methods and conventional PCR / quantitative PCR detection in scenarios such as port quarantine, which suffer from long cycles and insufficient applicability for rapid on-site screening, this invention achieves isothermal rapid amplification and real-time fluorescence interpretation of target nucleic acids through the synergistic effect of specific upstream and downstream primers AT-F1 and AT-R1, and a fluorescent probe AT-P with FAM fluorescent labeling / THF cleavage site / BHQ1 quenching labeling and a C3spacer blocking group at the 3′ end. Based on the isothermal amplification mechanism at 37-42℃, the invention utilizes A / B buffer amplification reaction components and a 50 μL standardized reaction system, employing a 39℃, 30℃... The real-time signal acquisition program with 40 cycles enables the detection process to obtain clear and interpretable amplification curves without the need for complex temperature control cycles, thereby significantly improving detection timeliness and ease of operation. At the same time, since the primer probes are designed based on the target sequence and combined with the "fluorescence-quenching-cleavage" probe structure, they can effectively reduce background interference caused by non-specific amplification, improve detection specificity and result reliability, and meet the needs for rapid, accurate and scalable molecular detection of wheat leaf blight pathogen. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0025] Figure 1 The diagram shown illustrates the specificity detection results of this invention.
[0026] Figure 2 The results shown are the sensitivity detection results of the present invention;
[0027] Figure 3 The image shows the CPA4 gene sequence of wheat leaf blight pathogen according to the present invention (the red line indicates the primer region, and the green line indicates the probe region). Detailed Implementation
[0028] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.
[0029] In this document, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.
[0030] In this document, when values are described as ranges, it should be understood that such disclosure includes disclosure of all possible subranges within that range, as well as the specific numerical values falling within that range, regardless of whether the specific numerical value or specific subrange is explicitly specified.
[0031] In this article, the terms "multiple" or "more than" are used unless otherwise specified, referring to a quantity greater than or equal to 2. For example, "one or more" means one or more types.
[0032] In this document, the terms "preferred" and "more preferred" are used only to describe implementation methods or embodiments with better effects, and should be understood as not constituting a limitation on the scope of protection of this invention.
[0033] In this document, terms such as "further" are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of this invention.
[0034] In this article, the term "and / or" describes an association between objects, indicating that three relationships can exist. For example, A and / or B means: A or B, or A and B.
[0035] In this document, the term "about" means a specified value of + / - 10%, preferably + / - 5%, and more preferably + / - 1%.
[0036] In this article, the terms “include,” “including,” “have,” “contain,” etc., are all open-ended terms, meaning that they include but are not limited to.
[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar to or equivalent to those described herein may be used in the implementation or testing of this invention.
[0038] Example 1: Design, screening and preparation of primer and probe sequences
[0039] Primer design: Based on the gene sequence of wheat leaf blight pathogen CPA4 (carboxypeptidase-like protein A4), specific primers and probes were designed through sequence alignment analysis, as shown in Table 1. All primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0040] Table 1. Primer and probe sequences
[0041] Primer and probe Sequence (5′-3′) AT-F1 TGAAGCGTATAGCCTCGTGAGATATGTGGTAG AT-R1 TAGAGTGTTCAATGTAGCCGCAGCGATGATATG AT-P TCAGAATACCGCGGTCGTCGCATCTGAAA[FAM-dT][THF][BHQ1-dT]AATGGGATCATTGTG[C3spacer]
[0042] Wherein: FAM-dT is a thymidine nucleotide carrying a fluorescein group, THF is tetrahydrofuran, BHQ1-dT is a thymidine nucleotide carrying a fluorescence quenching group BHQ1, and C3-Spacer is an intercalary arm introduced at the 3' end to prevent chain elongation.
[0043] Main reagents and instruments:
[0044] The DNA isothermal rapid amplification kit was purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd., the DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd., and the real-time fluorescence PCR instrument was an ABI Q7 fluorescence quantitative PCR instrument.
[0045] The reaction mixture (50 μL) consisted of: 1.0 μL DNA template, 2 μL each of forward and reverse primers (10 μmol / L), 0.6 μL probe (10 μmol / L), 29.4 μL buffer A, 2.5 μL buffer B, and 12.5 μL ddH2O. The quantitative PCR program was: 39℃, 30 s, 40 cycles.
[0046] Example 2: Detection of different test samples using the primer set of the present invention
[0047] Tested strains: A total of 40 strains were tested, including one strain of *Phytophthora blight* from CBS (Central Bureau for Schimmelcultures, Netherlands), one strain of *Phytophthora basal rot* from ATCC (American Type Culture Collection), and the remaining 38 strains were isolated and identified by our laboratory from imported samples of barley, wheat, sorghum, oats, and soybeans. The strain numbers and sources are shown in Table 1.
[0048] Table 2 Test strains
[0049] Table 1 Test strains
[0050] Strain nameName Strain No. Country of origin Host Alternaria triticina CBS121461 Iran Triticum A. infectoria 9775-1、10326-5、9866-2、2720-3、 Australia barley 10877-2 Russia barley 7886-5 Argentina barley 245-10、8220-7 Canada barley 323-7、5389-4 France barley 6260-3 Ukraine barley 3868-8、7729-12 Australia wheat 1808-10、1993-8 Canada wheat A. alternate 7249-5、7250-3、 Argentina sorghum 3465-1 Brazil soybeans 1054-5、1284-7 Brazil corn Alternaria sp. 7753-9 Ukraine barley 3657-11 Russia barley 6193-7 Brazil soybeans 6586-5、6649-3 Uruguay soybeans 4512-1、5289-6、5364-8、5655-10、6120-1、6612-11、6638-9、 Argentina sorghum 3888-1、4084-7 USA corn 7304-10 Australia wheat 2935-2 Australia oat Oculimacula yallundae ATCC16769 U.K. Triticum Bipolaris sorokiniana 7249-4、 Argentina sorghum Epicoccum tritici 7729-9 Australia barley
[0051] Main reagents and instruments:
[0052] The DNA isothermal rapid amplification kit was purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd., the DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd., and the real-time fluorescence PCR instrument was an ABI Q7 fluorescence quantitative PCR instrument.
[0053] Primer and probe sequences are as described in Table 1 above;
[0054] DNA extraction: The test strain was cultured on PDA medium for 5 days, mycelium was scraped off, genomic DNA was extracted using a DNA extraction kit, and the DNA concentration was measured using a nucleic acid analyzer.
[0055] Specificity and sensitivity detection:
[0056] Following the instructions of the DNA isothermal rapid amplification kit, the designed primers and probes were used to specifically detect 40 tested bacterial strains, with sterile water serving as a blank control. The reaction system (50 μL) consisted of: 1.0 μL DNA template, 2 μL each of forward and reverse primers (10 μmol / L), 0.6 μL probe (10 μmol / L), 29.4 μL buffer A, 2.5 μL buffer B, and 12.5 μL ddH2O. The quantitative PCR program was: 39℃, 30 s, 40 cycles.
[0057] The DNA of wheat leaf blight pathogen was diluted to 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 100 fg / μL as templates. 1 μL of each was used for real-time fluorescent PCR amplification to evaluate the sensitivity of the fluorescent MIRA method.
[0058] Results and Analysis
[0059] like Figure 1 The results showed that the DNA of 40 tested strains was detected by the fluorescent MIRA method. Only the wheat blight pathogen sample showed a fluorescent amplification curve, while the other strain samples were negative, indicating that the primer probe has good specificity for wheat blight pathogen.
[0060] Example 3: Primer and probe sensitivity detection
[0061] like Figure 2 As shown in the figures, 1-3: the DNA concentrations of *Wheat Leaf Blight* were 1 ng / μL, 100 pg / μL, and 10 pg / μL, respectively. The fluorescent MIRA method detected increased fluorescence signals at DNA concentrations of 1 ng / μL, 100 pg / μL, and 10 pg / μL, indicating a positive result. DNA concentrations of 1 pg / μL and 100 fg / μL did not produce typical amplification curves and were therefore considered negative. The results indicate that the detection limit of the fluorescent MIRA method is 10 pg / μL.
[0062] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on its differences from other embodiments. Similar or identical parts between embodiments can be referred to interchangeably. For the apparatus disclosed in the embodiments, since they correspond to the methods disclosed in the embodiments, the description is relatively simple; relevant parts can be referred to the method section.
[0063] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A primer probe for detecting Pyrenophora tritici-repentis based on Real-time MIRA, characterized by, Comprising: The primer probe comprises an upstream primer AT-F1, a downstream primer AT-R1 and a fluorescent probe AT-P, wherein: The AT-F1 is an oligonucleotide primer, and the nucleotide sequence (5'→3') thereof is: TGAAGCGTATAGCCTCGTGAGATATGTGGTAG; The AT-R1 is an oligonucleotide primer, and the nucleotide sequence (5'→3') thereof is: TAGAGTGTTCAATGTAGCCGCAGCGATGATATG; The AT-P is an oligonucleotide fluorescent probe, and sequentially comprises a first nucleotide fragment S1, a fluorescently labeled thymine deoxynucleotide FAM-dT, a tetrahydrofuran THF site, a quenchedly labeled thymine deoxynucleotide BHQ1-dT, a second nucleotide fragment S2 from 5' end to 3' end, and the 3' end of the AT-P is connected with a C3 spacer blocking group; The nucleotide sequence (5'→3') of the S1 is: TCAGAATACCGCGGTCGTCGCATCTGAAA, and the nucleotide sequence (5'→3') of the S2 is: AATGGGATCATTGTG; the fluorescent label is FAM, and the quenched label is BHQ1.
2. A real-time fluorescent MIRA detection kit for detecting Pyrenophora tritici-repentis, characterized by, The detection kit at least comprises: the primer probe of claim 1; and an amplification reaction component for multi-enzyme constant temperature rapid amplification.
3. The test kit according to claim 2, characterized in that, The amplification reaction component comprises an A buffer and a B buffer.
4. The test kit according to claim 3, characterized in that, The total volume of the reaction system for construction of the detection kit is 50 μL, and comprises: 1.0 μL of DNA template, 2 μL of upstream primer (10 μmol / L), 2 μL of downstream primer (10 μmol / L), 0.6 μL of probe (10 μmol / L), 29.4 μL of A buffer, 2.5 μL of B buffer, and 12.5 μL of ddH2O.
5. A detection method for detecting Pyrenophora tritici based on real-time fluorescent MIRA, characterized by, Comprising the following steps: Extracting genomic DNA of the sample to be tested; Combining the genomic DNA with the primer probe of claim 1 and the multi-enzyme constant temperature rapid amplification reaction component to obtain an amplification reaction system; Carrying out amplification under constant temperature conditions and collecting fluorescence signals in real time; Determining whether the wheat leaf blight fungus exists in the sample to be tested according to the fluorescence signals.
6. The detection method according to claim 5, characterized in that, The reaction program for collecting fluorescence signals in real time is: 39℃, 30s, 40 cycles.