Immunogenic compositions and uses thereof

Abstract

The disclosure features compositions comprising a polyribonucleotide having one or more expression enhancing elements or spacer elements. The polyribonucleotides described herein can increase the stability of the polyribonucleotides and / or can increase the expression of a polynucleotide cargo encoded by the polyribonucleotides.

Description

BACKGROUND

[0001] Vaccination has made a tremendous contribution to human and animal health. Since the invention of the first vaccine in 1796, vaccines have been recognized as the most successful method for preventing a variety of infectious diseases by eliciting an immune response in a subject. According to the World Health Organization, immunization currently prevents 2-3 million deaths per year in all age groups. Today, vaccines have been developed to prevent and control the spread of more than 20 infectious diseases including diphtheria, tetanus, pertussis, influenza, and measles, and have led to the complete eradication of smallpox. There remains a need to develop new and improved immunogenic compositions and uses thereof. SUMMARY

[0002] In one aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) one or more expression-enhancing elements; (c) a polyribonucleotide cargo encoding an immunogen; and (d) a second post-circularization element; wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0003] In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a polyribonucleotide cargo encoding an immunogen; (c) one or more expression-enhancing elements; and (d) a second post-circularization element; wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0004] In some embodiments, the one or more expression enhancing elements comprise a fusion of a translational enhancer and a spacer element containing a polyA region. In some embodiments, the spacer element comprises 5 to 200 ribonucleotides in length (e.g., 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides in length). In some embodiments, the one or more expression enhancing elements comprise a translational enhancer. In some embodiments, the translational enhancer is from a plant virus. In some embodiments, the translational enhancer is from a mammalian virus. In some embodiments, the translational enhancer is a human translational enhancer. In some embodiments, the translational enhancer is selected from the group comprising a BYDV-like element (BTE), a translational enhancer element (TED), a PMV / PEMV-like translational enhancer (PTE), an I-shaped structure (ISS), a Y-shaped structure (YSS), a t-shaped structure (TSS), a dumbbell-shaped structure, a viral RNA UTR (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, Hepatitis B virus post-transcriptional regulatory element, a human genomic fragment, a histone mRNA sequence, a cyclin D mRNA sequence, or an eIF4g adaptor sequence. In some embodiments, the translational enhancer binds to eIF4g.

[0005] In some embodiments, the translational enhancer comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the translational enhancer comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides.

[0006] In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide that does not have a translation enhancer. In some embodiments, the circular polyribonucleotide is capable of being detected for at least 2-fold longer after administration to a subject compared to a polyribonucleotide that does not have a translation enhancer. In some embodiments, the circular polyribonucleotide comprises a polynucleotide cargo encoding an immunogen, wherein the immunogen has at least 4-fold greater expression compared to a polyribonucleotide that does not have a translation enhancer.

[0007] In some embodiments, the one or more expression enhancing elements comprise a fusion of a stabilizing element and a spacer element comprising a poly-A region. In some embodiments, the spacer element comprises a length of 5 to 200 ribonucleotides (e.g., a length of 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides). In some embodiments, the expression enhancing element comprises a stabilizing element. In some embodiments, the stabilizing element is an untranslated region (UTR). In some embodiments, the stabilizing element is a 3’ UTR. In some embodiments, the stabilizing element is a 5’ UTR. In some embodiments, the UTR is from a gene encoding transmembrane-associated membrane protein 1 (TRAM1), transmembrane p24 transport protein 2 (TMED2), vesicle-associated membrane protein 3 (VAMP3), PDZ3 domain interacting protein containing CXXC repeats (CRIP), adaptor-related protein complex 2 subunit alpha 2 (AP2A2), proteasome 26S subunit, non-ATPase 5 (PSMD5), glutathione peroxidase 4 (GPX4), or AMP-activated protein kinase non-catalytic subunit beta 1 (PRKAB1). In some embodiments, the UTR is a UTR from human beta actin, DDB2, TP53I3, FcIgG, LSP1, AES, DRB4, or mitochondrially encoded 12S rRNA. In some embodiments, the stabilizing element comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the stabilizing element comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides. In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide without a stabilizing element. In some embodiments, the circular polyribonucleotide is capable of being detected for at least 2-fold longer compared to a polyribonucleotide without a stabilizing element after administration of the circular polyribonucleotide to a subject.In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 2-fold greater expression compared to a polyribonucleotide without the stability element.

[0008] In some embodiments, the circular polyribonucleotide further comprises one or more spacer elements comprising a poly-A region. In some embodiments, the spacer element is between 50 and 500 (e.g., 50 to 450, 50 to 400, 50 to 350, 50 to 300, 50 to 250, 50 to 200, 50 to 150, 50 to 100, 50 to 80, 55 to 500, 60 to 500, 70 to 500, 80 to 500, 90 to 500, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 50 to 300, 50 to 200, 60 to 300, and 60 to 200) ribonucleotides in length. In some embodiments, the spacer element is between 100 and 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 100 to 300, 100 to 200, 110 to 300, and 110 to 200) ribonucleotides in length. In some embodiments, the spacer element is between 110 and 500 (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides in length. In some embodiments, the spacer element is between 120 and 500 (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides in length.In some embodiments, the spacer element is between 100 and 300 (e.g., 100 and 280, 100 and 260, 100 and 240, 100 and 220, 100 and 200, 100 and 180, 100 and 160, 100 and 140, 100 and 120, 110 and 300, 115 and 300, 120 and 300, 140 and 300, 160 and 300, 180 and 300, 200 and 300, 220 and 300, 240 and 300, 260 and 300, 110 and 200, and 280 and 300) ribonucleotides in length. In some embodiments, the spacer is between 10 and 200 (e.g., between 10 and 175, between 10 and 150, between 10 and 125, between 10 and 100, between 10 and 75, between 10 and 50, between 10 and 25, between 25 and 200, between 50 and 200, between 75 and 200, between 100 and 200, between 150 and 200, between 175 and 200, and between 25 and 100) ribonucleotides in length. In some embodiments, the spacer element is about 120 ribonucleotides in length. In some embodiments, the spacer element is about 50 ribonucleotides in length.

[0009] In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the 5' to 3' order: (a) a first post-circularization element; (b) a first expression enhancing element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second expression enhancing element; and (e) a second post-circularization element; wherein the first post-circularization element and the second post-circularization element together form a circularization junction. In some embodiments, the first expression enhancing element comprises a fusion of a translation enhancer and a spacer element. In some embodiments, the spacer element comprises a length of 5 to 200 ribonucleotides (e.g., a length of 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides). In some embodiments, the second expression enhancing element comprises a fusion of a translation enhancer and a spacer element. In some embodiments, the spacer element comprises a length of 5 to 200 ribonucleotides (e.g., a length of 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides). In some embodiments, the first expression enhancing element comprises a translation enhancer. In some embodiments, the second expression enhancing element comprises a translation enhancer. In some embodiments, the translation enhancer is from a plant virus. In some embodiments, the translation enhancer is from a mammalian virus. In some embodiments, the translation enhancer is a human translation enhancer. In some embodiments, the translation enhancer is selected from the group comprising: BTE, TED, PTE, ISS, YSS, TSS, dumbbell structure, viral RNA UTRs (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, Hepatitis B virus post-transcriptional regulatory element, human genomic segment, histone mRNA sequence, cyclin D mRNA sequence, or eIF4g adaptor sequence. In some embodiments, the translation enhancer binds to eIF4g. In some embodiments, the translation enhancer comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides.In some embodiments, the translation enhancer comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides. In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide without a translation enhancer. In some embodiments, the circular polyribonucleotide is capable of being detected for at least 2-fold longer compared to a polyribonucleotide without a translation enhancer after administration of the circular polyribonucleotide to a subject. In some embodiments, the circular polyribonucleotide comprises a polynucleotide cargo encoding an immunogen, wherein the immunogen has at least 4-fold greater expression compared to a polyribonucleotide without a translation enhancer.

[0010] In some embodiments, the first expression enhancing element comprises a fusion of a stabilizing element and a spacer element comprising a poly-A region. In some embodiments, the spacer element comprises between 5 and 200 ribonucleotides in length (e.g., between 5 and 150, 5 and 100, 5 and 50, 5 and 20, 20 and 200, 50 and 200, 100 and 200, 150 and 200, and 50 and 150 ribonucleotides in length). In some embodiments, the first expression enhancing element comprises a stabilizing element. In some embodiments, the spacer element comprises between 5 and 200 ribonucleotides in length (e.g., between 5 and 150, 5 and 100, 5 and 50, 5 and 20, 20 and 200, 50 and 200, 100 and 200, 150 and 200, and 50 and 150 ribonucleotides in length). In some embodiments, the second expression enhancing element comprises a stabilizing element. In some embodiments, the stabilizing element is a UTR. In some embodiments, the UTR is from a gene encoding TRAM1, TMED2, VAMP3, CRIP, AP2A2, proteasome 26S subunit, PSMD5, GPX4, or PRKAB1. In some embodiments, the UTR is a UTR from human beta actin, DDB2, TP53I3, Fc IgG, LSP1, AES, DRB4, or mitochondrially encoded 12S rRNA. In some embodiments, the stabilizing element is a 3’ UTR. In some embodiments, the stabilizing element is a 5’ UTR. In some embodiments, the stabilizing element comprises between 50 and 2000 (e.g., 50 and 1500, 50 and 1000, 50 and 500, 50 and 100, 50 and 1250, 50 and 1250, 50 and 750, 100 and 2000, 500 and 2000, 750 and 2000, 1000 and 2000, 1250 and 2000, 1500 and 2000, 1750 and 2000, 100 and 1000, and 500 and 1500) ribonucleotides. In some embodiments, the stabilizing element comprises between 60 and 800 (e.g., 60 and 700, 60 and 600, 60 and 500, 60 and 400, 60 and 400, 60 and 300, 60 and 300, 60 and 200, 60 and 100, 100 and 800, 200 and 800, 300 and 800, 400 and 800, 500 and 800, 600 and 800, 700 and 800, and 200 and 500) ribonucleotides. In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide without a stabilizing element. In some embodiments, the circular polyribonucleotide is capable of being detected for at least 2-fold longer compared to a polyribonucleotide without a stabilizing element after administration of the circular polyribonucleotide to a subject.In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 2-fold greater expression compared to a polyribonucleotide without the stability element.

[0011] In some embodiments, the circular polyribonucleotide further comprises one or more spacer elements comprising a poly-A region. In some embodiments, the spacer element is between 100 and 500 (e.g., 100 and 450, 100 and 400, 100 and 350, 100 and 300, 100 and 250, 100 and 200, 100 and 150, 120 and 500, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, and 450 and 500) ribonucleotides in length. In some embodiments, the spacer element is between 120 and 500 (e.g., 120 and 450, 120 and 400, 120 and 350, 120 and 300, 120 and 250, 120 and 200, 120 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, and 450 and 500) ribonucleotides in length. In some embodiments, the spacer element is between 100 and 300 (e.g., 100 and 280, 100 and 260, 100 and 240, 100 and 220, 100 and 200, 100 and 180, 100 and 160, 100 and 140, 100 and 120, 120 and 300, 140 and 300, 160 and 300, 180 and 300, 200 and 300, 220 and 300, 240 and 300, 260 and 300, and 280 and 300) ribonucleotides in length.

[0012] In another aspect, the present disclosure provides a circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) a spacer element; (c) a polyribonucleotide cargo encoding an immunogen; (d) an expression-enhancing element; and (e) a second post-circularization element, and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0013] In another aspect, the present disclosure provides a circular polyribonucleotide comprising, in the following order from 5’ to 3’: (a) a first post-circularization element; (b) an expression-enhancing element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a spacer element; and (e) a second post-circularization element, and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0014] In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a first expression-enhancing element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second expression-enhancing element; and (e) a second post-circularization element, and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0015] In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a first spacer element of at least 100 ribonucleotides in length; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element; and (e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0016] In another aspect, the disclosure provides a circular polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a first spacer element of at least 100 ribonucleotides in length; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element of at least 100 ribonucleotides in length; and (e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0017] In some embodiments, the first spacer element is between 50 and 500 (e.g., 50 to 450, 50 to 400, 50 to 350, 50 to 300, 50 to 250, 50 to 200, 50 to 150, 50 to 100, 50 to 80, 55 to 500, 60 to 500, 70 to 500, 80 to 500, 90 to 500, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 50 to 300, 50 to 200, 60 to 300, and 60 to 200) ribonucleotides in length. In some embodiments, the first spacer element is between 100 and 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides in length. In some embodiments, the second spacer element is between 50 and 500 (e.g., 50 to 450, 50 to 400, 50 to 350, 50 to 300, 50 to 250, 50 to 200, 50 to 150, 50 to 100, 50 to 80, 55 to 500, 60 to 500, 70 to 500, 80 to 500, 90 to 500, 110 to 500, 115 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, 450 to 500, 50 to 300, 50 to 200, 60 to 300, and 60 to 200) ribonucleotides in length. In some embodiments, the second spacer element is between 100 and 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides in length.In some embodiments, the first spacer element and the second spacer element each comprise between 110 and 500 (e.g., 110 and 450, 110 and 400, 110 and 350, 110 and 300, 110 and 250, 110 and 200, 110 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, and 450 and 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each comprise between 120 and 500 (e.g., 120 and 450, 120 and 400, 120 and 350, 120 and 300, 120 and 250, 120 and 200, 120 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, and 450 and 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each are 150 and 500 (e.g., 150 and 450, 150 and 400, 150 and 350, 150 and 300, 150 and 250, 150 and 200, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, or 450 and 500) ribonucleotides in length. In some embodiments, the first spacer element and the second spacer element each are 200 and 500 (e.g., 200 and 450, 200 and 400, 200 and 350, 200 and 300, 200 and 250, 250 and 500, 300 and 500, 350 and 500, 400 and 500, or 450 and 500) ribonucleotides in length. In some embodiments, the first spacer element and the second spacer element each are 100 and 300 (e.g., 100 and 280, 100 and 260, 100 and 240, 100 and 220, 100 and 200, 100 and 180, 100 and 160, 100 and 140, 100 and 120, 120 and 300, 140 and 300, 160 and 300, 180 and 300, 200 and 300, 220 and 300, 240 and 300, 260 and 300, and 280 and 300) ribonucleotides in length. In some embodiments, the first spacer element and the second spacer element each are 100 and 200 (e.g., 100 and 190, 100 and 180, 100 and 170, 100 and 160, 100 and 150, 100 and 140, 100 and 130, 100 and 120, 100 and 110, 110 and 200, 120 and 200, 130 and 200, 140 and 200, 150 and 200, 160 and 200, 170 and 200, 180 and 200, and 90 and 200) ribonucleotides in length.In some embodiments, each of the first and second spacer elements is 110 to 300 (e.g., 110 to 280, 110 to 260, 110 to 240, 110 to 220, 110 to 200, 110 to 180, 110 to 160, 110 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides in length. In some embodiments, each of the first and second spacer elements is 120 to 300 (e.g., 120 to 280, 120 to 260, 120 to 240, 120 to 220, 120 to 200, 120 to 180, 120 to 160, 120 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides in length. In some embodiments, each of the first and second spacer elements is 150 to 300 (e.g., 150 to 290, 150 to 280, 150 to 270, 150 to 260, 150 to 250, 150 to 240, 150 to 230, 150 to 220, 150 to 210, 150 to 200, 150 to 190, 150 to 180, 150 to 170, 150 to 160, 160 to 300, 170 to 300, 180 to 300, 190 to 300, 200 to 300, 210 to 300, 220 to 300, 230 to 300, 240 to 300, 250 to 300, 260 to 300, 270 to 300, 280 to 300, and 290 to 300) ribonucleotides in length.

[0018] In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is between 0 and 100 (e.g., 0 to 10, 0 to 20, 0 to 30, 0 to 40, 0 to 50, 0 to 60, 0 to 70, 0 to 80, 0 to 90, 10 to 100, 20 to 100, 30 to 100, 40 to 100, 50 to 100, 60 to 100, 70 to 100, 80 to 100, 90 to 100, 5 to 10, 5 to 20, 10 to 30, or 5 to 50) nucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is between 0 and 50 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50) nucleotides. In some embodiments, the first spacer element and the second spacer element are the same number of ribonucleotides in length.

[0019] In some embodiments, the first spacer or the second spacer element consists of: (i) a poly-A region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine residues; (ii) a poly-AC region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or cytosine residues; (iii) a poly-AU region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or uridine residues; or (iii) a poly-AG region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or guanosine residues.

[0020] In some embodiments, the circular polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide that does not have the first or second spacer element. In some embodiments, the circular polyribonucleotide is detectable for at least 2-fold longer after administration to a subject compared to a polyribonucleotide that does not have the first or second spacer element. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression compared to a polyribonucleotide that does not have the first or second spacer element.

[0021] In some embodiments, the polyribonucleotide cargo encoding an immunogen comprises an expression sequence. In some embodiments, the polyribonucleotide cargo encoding an immunogen comprises an IRES operably linked to an expression sequence. In some embodiments, the expression sequence further comprises a 3’ untranslated region or a 5’ untranslated region. In some embodiments, the expression sequence encodes an immunogen.

[0022] In some embodiments, the polyribonucleotide comprises between 500 and 20,000 (e.g., between 500 and 15,000, 500 and 10,000, 500 and 5,000, 500 and 1,000, 1,000 and 20,000, 5,000 and 20,000, 10,000 and 20,000, and 15,000 and 20,000) ribonucleotides. In some embodiments, the polyribonucleotide comprises between 2,000 and 20,000 (e.g., between 2,000 and 5,000, 2,000 and 7,500, 2,000 and 10,000, 2,000 and 12,500, 2,000 and 15,000, 2,000 and 17,500, 5,000 and 20,000, 7,500 and 20,000, 10,000 and 20,000, 12,500 and 20,000, 15,000 and 20,000, and 17,500 and 20,000) ribonucleotides.

[0023] In some embodiments, the circularization junction comprises a splice junction. In some embodiments, the first post-circularization element comprises a first exon segment and the second post-circularization element comprises a second exon segment, and wherein the first exon segment and the second exon segment are connected by the splice junction. In some embodiments, the circularization junction comprises an oligonucleotide splint that hybridizes to the first post-circularization element and hybridizes to the second post-circularization element. In some embodiments, the oligonucleotide splint is a DNA splint or an RNA splint. In some embodiments, the first post-circularization element comprises a region that is capable of hybridizing to a first region of the oligonucleotide splint, and the second post-circularization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint.

[0024] In an aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) one or more expression enhancing elements; (c) a polyribonucleotide cargo encoding an immunogen; and (d) a second post-circularization element; wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0025] In an aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a polyribonucleotide cargo encoding an immunogen; (c) one or more expression enhancing elements; and (d) a second post-circularization element; wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0026] In some embodiments, the one or more expression enhancing elements comprise a fusion of a translational enhancer and a spacer element comprising a poly-A region. In some embodiments, the spacer element comprises a length of 5 to 200 ribonucleotides (e.g., a length of 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides). In some embodiments, the one or more expression enhancing elements comprise a translational enhancer. In some embodiments, the translational enhancer is from a plant virus. In some embodiments, the translational enhancer is from a mammalian virus. In some embodiments, the translational enhancer is a human translational enhancer. In some embodiments, the translational enhancer is selected from the group comprising BTE, TED, PTE, ISS, YSS, TSS, dumbbell, viral RNA UTRs (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, Hepatitis B virus post-transcriptional regulatory element, human genomic fragments, histone mRNA sequences, cyclin D mRNA sequences, or eIF4g adaptor sequences. In some embodiments, the translational enhancer binds to eIF4g. In some embodiments, the translational enhancer comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the translational enhancer comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides.

[0027] In some embodiments, the linear polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide without a translational enhancer. In some embodiments, the linear polyribonucleotide is detectable for at least 2-fold longer compared to a polyribonucleotide without a translational enhancer after administration of the linear polyribonucleotide to a subject. In some embodiments, the linear polyribonucleotide is a polynucleotide cargo encoding an immunogen, wherein the immunogen has at least 4-fold greater expression compared to a polyribonucleotide without a translational enhancer.

[0028] In some embodiments, the one or more expression enhancing elements comprise a fusion of a stability element and a spacer element comprising a poly-A region. In some embodiments, the spacer element comprises between 5 and 200 ribonucleotides in length (e.g., between 5 and 150, 5 and 100, 5 and 50, 5 and 20, 20 and 200, 50 and 200, 100 and 200, 150 and 200, and 50 and 150 ribonucleotides in length). In some embodiments, the expression enhancing element comprises a stability element. In some embodiments, the stability element is a UTR. In some embodiments, the UTR is from a gene encoding TRAM1, TMED2, VAMP3, CRIP, AP2A2, proteasome 26S subunit, PSMD5, GPX4, or PRKAB1. In some embodiments, the UTR is a UTR from human beta actin, DDB2, TP53I3, Fc IgG, LSP1, AES, DRB4, or mitochondrially encoded 12S rRNA. In some embodiments, the stability element is a 3’ UTR. In some embodiments, the stability element is a 5’ UTR.

[0029] In some embodiments, the stability element comprises between 50 and 2000 (e.g., 50 and 1500, 50 and 1000, 50 and 500, 50 and 100, 50 and 1250, 50 and 1250, 50 and 750, 100 and 2000, 500 and 2000, 750 and 2000, 1000 and 2000, 1250 and 2000, 1500 and 2000, 1750 and 2000, 100 and 1000, and 500 and 1500) ribonucleotides. In some embodiments, the stability element comprises between 60 and 800 (e.g., 60 and 700, 60 and 600, 60 and 500, 60 and 400, 60 and 400, 60 and 300, 60 and 300, 60 and 200, 60 and 100, 100 and 800, 200 and 800, 300 and 800, 400 and 800, 500 and 800, 600 and 800, 700 and 800, and 200 and 500) ribonucleotides.

[0030] In some embodiments, the linear polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide without a stability element. In some embodiments, the linear polyribonucleotide is detectable for at least 2-fold longer compared to a polyribonucleotide without a stability element after administration of the linear polyribonucleotide to a subject. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 2-fold greater expression compared to a polyribonucleotide without a stability element.

[0031] In some embodiments, the linear polyribonucleotide further comprises one or more spacer elements comprising a poly-A region. In some embodiments, the spacer element is between 100 and 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 110 to 500, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides in length. In some embodiments, the spacer element is between 110 and 500 (e.g., 110 to 450, 110 to 400, 110 to 350, 110 to 300, 110 to 250, 110 to 200, 110 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides in length. In some embodiments, the spacer element is between 120 and 500 (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides in length. In some embodiments, the spacer element is between 100 and 300 (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 110 to 300, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides in length.

[0032] In another aspect, the disclosure provides a linear polyribonucleotide comprising, in 5' to 3' order: (a) a first post-circularization element; (b) a first expression enhancing element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second expression enhancing element; and (e) a second post-circularization element; wherein the first post-circularization element and the second post-circularization element together form a circularization junction. In some embodiments, the first expression enhancing element comprises a fusion of a translation enhancer and a spacer element. In some embodiments, the spacer element comprises a length of 5 to 200 ribonucleotides (e.g., a length of 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides). In some embodiments, the second expression enhancing element comprises a fusion of a translation enhancer and a spacer element. In some embodiments, the spacer element comprises a length of 5 to 200 ribonucleotides (e.g., a length of 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides). In some embodiments, the first expression enhancing element comprises a translation enhancer. In some embodiments, the second expression enhancing element comprises a translation enhancer. In some embodiments, the translation enhancer is from a plant virus. In some embodiments, the translation enhancer is from a mammalian virus. In some embodiments, the translation enhancer is a human translation enhancer. In some embodiments, the translation enhancer is selected from the group comprising BTE, TED, PTE, ISS, YSS, TSS, dumbbell structure, viral RNA UTRs (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, Hepatitis B virus post-transcriptional regulatory element, human genomic segment, histone mRNA sequence, cyclin D mRNA sequence, or eIF4g adaptor sequence. In some embodiments, the translation enhancer binds to eIF4g.

[0033] In some embodiments, the translation enhancer comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the translation enhancer comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides.

[0034] In some embodiments, the linear polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide that does not have a translation enhancer. In some embodiments, the linear polyribonucleotide is detectable for at least 2-fold longer compared to a polyribonucleotide that does not have a translation enhancer after administration of the linear polyribonucleotide to a subject. In some embodiments, the linear polyribonucleotide is a polynucleotide cargo encoding an immunogen, wherein the immunogen has at least 4-fold greater expression compared to a polyribonucleotide that does not have a translation enhancer.

[0035] In some embodiments, the first expression enhancing element comprises a fusion of a stability element and a spacer element comprising a polyA region. In some embodiments, the spacer element comprises a length of 5 to 200 ribonucleotides (e.g., a length of 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides). In some embodiments, the first expression enhancing element comprises a stability element. In some embodiments, the second expression enhancing element comprises a fusion of a stability element and a spacer element. In some embodiments, the spacer element comprises a length of 5 to 200 ribonucleotides (e.g., a length of 5 to 150, 5 to 100, 5 to 50, 5 to 20, 20 to 200, 50 to 200, 100 to 200, 150 to 200, and 50 to 150 ribonucleotides). In some embodiments, the second expression enhancing element comprises a stability element. In some embodiments, the stability element is a UTR. In some embodiments, the UTR is from a gene encoding TRAM1, TMED2, VAMP3, CRIP, AP2A2, proteasome 26S subunit, PSMD5, GPX4, or PRKAB1. In some embodiments, the UTR is a UTR from human beta actin, DDB2, TP53I3, FcIgG, LSP1, AES, DRB4, or mitochondrially encoded 12S rRNA. In some embodiments, the stability element is a 3’ UTR. In some embodiments, the stability element is a 5’ UTR.

[0036] In some embodiments, the stability element comprises between 50 and 2000 (e.g., 50 to 1500, 50 to 1000, 50 to 500, 50 to 100, 50 to 1250, 50 to 1250, 50 to 750, 100 to 2000, 500 to 2000, 750 to 2000, 1000 to 2000, 1250 to 2000, 1500 to 2000, 1750 to 2000, 100 to 1000, and 500 to 1500) ribonucleotides. In some embodiments, the stability element comprises between 60 and 800 (e.g., 60 to 700, 60 to 600, 60 to 500, 60 to 400, 60 to 400, 60 to 300, 60 to 300, 60 to 200, 60 to 100, 100 to 800, 200 to 800, 300 to 800, 400 to 800, 500 to 800, 600 to 800, 700 to 800, and 200 to 500) ribonucleotides.

[0037] In some embodiments, the linear polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide without a stability element. In some embodiments, the linear polyribonucleotide is detectable for at least 2-fold longer after administration to a subject compared to a polyribonucleotide without a stability element. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 2-fold greater expression compared to a polyribonucleotide without a stability element.

[0038] In some embodiments, the linear polyribonucleotide further comprises one or more spacer elements comprising a poly-A region. In some embodiments, the spacer element is between 100 and 500 (e.g., 100 to 450, 100 to 400, 100 to 350, 100 to 300, 100 to 250, 100 to 200, 100 to 150, 120 to 500, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides in length. In some embodiments, the spacer element is between 120 and 500 (e.g., 120 to 450, 120 to 400, 120 to 350, 120 to 300, 120 to 250, 120 to 200, 120 to 150, 150 to 500, 200 to 500, 250 to 500, 300 to 500, 350 to 500, 400 to 500, and 450 to 500) ribonucleotides in length. In some embodiments, the spacer element is between 100 and 300 (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides in length.

[0039] In another aspect, the present disclosure provides a linear polyribonucleotide comprising, in 5’ to 3’ order: (a) a first post-circularization element; (b) a spacer element; (c) a polynucleotide cargo encoding an immunogen; (d) an expression-enhancing element; and (e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0040] In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) an expression enhancing element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a spacer element; and (e) a second post-circularization element, and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0041] In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a first expression enhancing element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second expression enhancing element; and (e) a second post-circularization element, and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0042] In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a first spacer element of at least 100 ribonucleotides in length; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element; and (e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0043] In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a first spacer element of at least 100 ribonucleotides in length; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element; and (e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0044] In another aspect, the disclosure provides a linear polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a first spacer element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element of at least 100 ribonucleotides in length; and (e) a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0045] In some embodiments, the first spacer element is between 100 and 500 (e.g., 100 and 450, 100 and 400, 100 and 350, 100 and 300, 100 and 250, 100 and 200, 100 and 150, 110 and 500, 110 and 450, 110 and 400, 110 and 350, 110 and 300, 110 and 250, 110 and 200, 110 and 150, 120 and 500, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, and 450 and 500) ribonucleotides in length. In some embodiments, the first spacer element is between 100 and 300 (e.g., 100 and 250, 100 and 200, 100 and 150, 110 and 300, 120 and 300, 150 and 300, 200 and 300, and 250 and 300) ribonucleotides in length. In some embodiments, the second spacer element is between 100 and 500 (e.g., 100 and 450, 100 and 400, 100 and 350, 100 and 300, 100 and 250, 100 and 200, 100 and 150, 110 and 500, 120 and 500, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, and 450 and 500) ribonucleotides in length. In some embodiments, the first spacer element and the second spacer element each comprise between 110 and 500 (e.g., 110 and 450, 110 and 400, 110 and 350, 110 and 300, 110 and 250, 110 and 200, 110 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, and 450 and 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each comprise between 120 and 500 (e.g., 120 and 450, 120 and 400, 120 and 350, 120 and 300, 120 and 250, 120 and 200, 120 and 150, 150 and 500, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, and 450 and 500) ribonucleotides. In some embodiments, the first spacer element and the second spacer element each are 150 and 500 (e.g., 150 and 450, 150 and 400, 150 and 350, 150 and 300, 150 and 250, 150 and 200, 200 and 500, 250 and 500, 300 and 500, 350 and 500, 400 and 500, or 450 and 500) ribonucleotides in length.In some embodiments, each of the first and second spacer elements is 200 to 500 (e.g., 200 to 450, 200 to 400, 200 to 350, 200 to 300, 200 to 250, 250 to 500, 300 to 500, 350 to 500, 400 to 500, or 450 to 500) ribonucleotides in length. In some embodiments, each of the first and second spacer elements is 100 to 300 (e.g., 100 to 280, 100 to 260, 100 to 240, 100 to 220, 100 to 200, 100 to 180, 100 to 160, 100 to 140, 100 to 120, 120 to 300, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides in length. In some embodiments, each of the first and second spacer elements is 100 to 200 (e.g., 100 to 190, 100 to 180, 100 to 170, 100 to 160, 100 to 150, 100 to 140, 100 to 130, 100 to 120, 100 to 110, 110 to 200, 120 to 200, 130 to 200, 140 to 200, 150 to 200, 160 to 200, 170 to 200, 180 to 200, and 90 to 200) ribonucleotides in length. In some embodiments, each of the first and second spacer elements is 110 to 300 (e.g., 110 to 280, 110 to 260, 110 to 240, 110 to 220, 110 to 200, 110 to 180, 110 to 160, 110 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides in length. In some embodiments, each of the first and second spacer elements is 120 to 300 (e.g., 120 to 280, 120 to 260, 120 to 240, 120 to 220, 120 to 200, 120 to 180, 120 to 160, 120 to 140, 140 to 300, 160 to 300, 180 to 300, 200 to 300, 220 to 300, 240 to 300, 260 to 300, and 280 to 300) ribonucleotides in length.In some embodiments, each of the first and second spacer elements is 150 to 300 (e.g., 150 to 290, 150 to 280, 150 to 270, 150 to 260, 150 to 250, 150 to 240, 150 to 230, 150 to 220, 150 to 210, 150 to 200, 150 to 190, 150 to 180, 150 to 170, 150 to 160, 160 to 300, 170 to 300, 180 to 300, 190 to 300, 200 to 300, 210 to 300, 220 to 300, 230 to 300, 240 to 300, 250 to 300, 260 to 300, 270 to 300, 280 to 300, and 290 to 300) ribonucleotides in length. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 100 (e.g., 0 to 10, 0 to 20, 0 to 30, 0 to 40, 0 to 50, 0 to 60, 0 to 70, 0 to 80, 0 to 90, 10 to 100, 20 to 100, 30 to 100, 40 to 100, 50 to 100, 60 to 100, 70 to 100, 80 to 100, 90 to 100, 5 to 10, 5 to 20, 10 to 30, or 5 to 50) nucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50) nucleotides. In some embodiments, the first and second spacer elements are the same number of ribonucleotides in length.

[0046] In some embodiments, the first or second spacer element consists of: (i) a poly-A region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine residues; (ii) a poly-AC region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or cytosine residues; (iii) a poly-AU region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or uridine residues; or (iv) a poly-AG region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) adenosine or guanosine residues.

[0047] In some embodiments, the polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide without the first or second spacer element. In some embodiments, the polyribonucleotide is detectable for at least 2-fold longer after administration of the polyribonucleotide to a subject compared to a polyribonucleotide without the first or second spacer element. In some embodiments, the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression compared to a polyribonucleotide without the first or second spacer element.

[0048] In some embodiments, the polynucleotide cargo encoding an immunogen comprises an expression sequence. In some embodiments, the polynucleotide cargo encoding an immunogen comprises an IRES operably linked to an expression sequence. In some embodiments, the expression sequence further comprises a 3’ untranslated region or a 5’ untranslated region. In some embodiments, the expression sequence encodes an immunogen.

[0049] In some embodiments, the polyribonucleotide comprises between 500 and 20,000 (e.g., between 500 and 15,000, between 500 and 10,000, between 500 and 5,000, between 500 and 1,000, between 1,000 and 20,000, between 5,000 and 20,000, between 10,000 and 20,000, and between 15,000 and 20,000) ribonucleotides. In some embodiments, the polyribonucleotide comprises between 2,000 and 20,000 (e.g., between 2,000 and 5,000, between 2,000 and 7,500, between 2,000 and 10,000, between 2,000 and 12,500, between 2,000 and 15,000, between 2,000 and 17,500, between 5,000 and 20,000, between 7,500 and 20,000, between 10,000 and 20,000, between 12,500 and 20,000, between 15,000 and 20,000, and between 17,500 and 20,000) ribonucleotides.

[0050] In some embodiments, the circularization junction comprises a splice junction. In some embodiments, the first circularization post-element comprises a first exon segment and the second circularization post-element comprises a second exon segment, and wherein the first exon segment and the second exon segment are joined by the splice junction. In some embodiments, the circularization junction comprises an oligonucleotide splint that hybridizes to the first circularization post-element and hybridizes to the second circularization post-element. In some embodiments, the oligonucleotide splint is a DNA splint or an RNA splint. In some embodiments, the first circularization post-element comprises a region that is capable of hybridizing to a first region of the oligonucleotide splint, and the second circularization post-element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint. In some embodiments, the first circularization element comprises a first catalytic intron segment, a first splice site dinucleotide, and a first exon segment; and the second circularization element comprises a second catalytic intron segment, a second splice site dinucleotide, and a second exon segment. In some embodiments, the first catalytic intron segment and the second catalytic intron segment are together capable of self-splicing, thereby covalently joining the first exon region and the second exon region to produce a circular polyribonucleotide. In some embodiments, the first catalytic intron segment and the second catalytic intron segment are from a Anabaena pre-tRNA-Leu gene or a Tetrahymena pre-rRNA. In some embodiments, the first circularization element comprises a region that is capable of hybridizing to a first region of an oligonucleotide splint, and the second circularization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint. In another aspect, the present disclosure provides a DNA vector comprising an RNA polymerase promoter operably linked to a sequence encoding any one of the linear polyribonucleotides described herein.

[0051] In another aspect, the disclosure provides a circular polyribonucleotide produced from a linear polyribonucleotide or DNA vector described herein. In another aspect, the disclosure provides a pharmaceutical composition comprising any of the linear polyribonucleotides, circular polyribonucleotides, or DNA vectors described herein, and a pharmaceutically acceptable excipient.

[0052] In another aspect, the disclosure provides a method of expressing an immunogen in a cell or subject, the method comprising providing to the cell or the subject any of the linear polyribonucleotides, circular polyribonucleotides, DNA vectors, or pharmaceutical compositions described herein.

[0053] In another aspect, the disclosure provides a method of producing a circular polyribonucleotide from any of the linear polyribonucleotides described herein, the method comprising providing the linear polyribonucleotide under conditions suitable for self-splicing of the linear polyribonucleotide to produce a circular polyribonucleotide.

[0054] Definitions

[0055] To facilitate an understanding of this disclosure, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present disclosure. The terms “a,” “an,” and “the” are not intended to refer to only a singular entity, but include the general class of which a specific example can be used for illustration. The term “or” is used to refer to “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.” The terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, unless otherwise indicated in the claims.

[0056] As used herein, the term “about” refers to a value within ±10% of the recited value.

[0057] As used herein, the term “adaptive immune response” refers to a humoral or cell-mediated immune response. For purposes of the present disclosure, a “humoral immune response” refers to an immune response mediated by antibody molecules, while a “cellular immune response” is an immune response mediated by T lymphocytes and / or other white blood cells.

[0058] As used herein, the term “adjuvant” refers to a composition (e.g., a compound, polypeptide, nucleic acid, or lipid) that increases an immune response, e.g., increases a specific immune response against an immunogen. Increasing an immune response includes potentiating or expanding the specificity of either or both antibody and cellular immune responses.

[0059] As used herein, any value provided in a range of values includes the upper and lower limits, and any value contained within the recited upper and lower limits.

[0060] As used herein, the term "between" refers to all values greater than or equal to the initial value and less than or equal to the endpoint, such that the range of values between the two values includes the endpoints of the range. For example, between 1 and 5 refers to all values > 1 and < 5, such that the endpoints of 1 and 5 are included in the intended range.

[0061] As used herein, the term "carrier" is a compound, composition, reagent, or molecule that facilitates transport or delivery of a composition (e.g., a circular polyribonucleotide) into a cell through covalent modification of the circular polyribonucleotide, via a partial or complete encapsulating agent, or a combination thereof. Non-limiting examples of carriers include a carbohydrate carrier (e.g., anhydride-modified plant glycogen or glycogen-type material), a nanoparticle (e.g., a nanoparticle encapsulating or covalently linked / bonded to a circular polyribonucleotide), a liposome, a fusosome, an exosome, a protein carrier (e.g., a protein covalently linked to a circular polyribonucleotide), or a cationic carrier (e.g., a cationic lipopolymer or a transfection reagent).

[0062] As used herein, the terms "circRNA," "circular polyribonucleotide," "circular RNA," and "circular polyribonucleotide molecule" are used interchangeably and mean a polyribonucleotide molecule having a structure without free ends (i.e., without free 3' and / or 5' ends), such as a polyribonucleotide molecule forming a circular or looped structure through covalent (e.g., covalently closed) or non-covalent bonds. A circular polyribonucleotide can be, for example, a covalently closed polyribonucleotide.

[0063] As used herein, the term "circularization efficiency" is a measure of the resulting circular polyribonucleotide relative to its non-circular starting material.

[0064] As used herein, the terms "disease," "disorder," and "condition" each refer to a state of health, e.g., typically diagnosed or treated by a medical professional.

[0065] As used herein, the term "epitope" refers to a portion or all of an immunogen recognized, targeted, or bound by an antibody or T cell receptor. An epitope can be a linear epitope, e.g., a contiguous sequence of nucleic acids or amino acids. An epitope can be a conformational epitope, e.g., an epitope containing amino acids that form the epitope in the folded conformation of a protein. A conformational epitope can contain non-contiguous amino acids from the primary amino acid sequence. For another example, a conformational epitope includes a nucleic acid that forms an epitope in the folded conformation of an immunogenic sequence based on its secondary or tertiary structure.

[0066] As used herein, the term “expression enhancing element” refers to a component of a polyribonucleotide construct that increases expression of an immunogen cargo encoded by the polyribonucleotide compared to a polyribonucleotide construct lacking the expression element. For example, in embodiments, the expression enhancing element is a translation enhancer or a stability element. In embodiments, the expression enhancing element increases expression of an immunogen cargo by increasing the length of time a circRNA persists before degradation, or it increases the concentration of an immunogen cargo expressed over a fixed period of time.

[0067] As used herein, the term “expression sequence” is a nucleic acid sequence that encodes a product (e.g., an immunogen). Exemplary expression sequences that encode an immunogen can include a variety of nucleotide triplets, each of which can encode an amino acid and is referred to as a “codon.”

[0068] As used herein, the term “fragment” with respect to an immunogen or nucleic acid sequence refers to a contiguous, less than the whole portion of the sequence of the immunogen or nucleic acid. For example, an immunogen fragment refers to a contiguous, less than the whole portion (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the entire length) of a sequence (such as a sequence disclosed herein). It is understood that all content of the present disclosure contemplates fragments of all polypeptides disclosed herein.

[0069] As used herein, the term “fusion” refers to a single contiguous molecule containing two or more different elements. For example, a fusion element described herein can include a translation enhancer fused (e.g., linked or associated) with a stability element, a translation enhancer fused (e.g., linked or associated) with a spacer element, or a stability element fused (e.g., linked or associated) with a spacer element. The fusion element can have functional properties derived from each of the original elements. In some embodiments, the translation enhancer is linked at its 5’ end to the spacer element. In some embodiments, the translation enhancer is linked at its 3’ end to the spacer element. In some embodiments, the stability element is linked at its 5’ end to the spacer element. In some embodiments, the stability element is linked at its 3’ end to the spacer element. In some embodiments, the translation enhancer is linked at its 5’ end to the stability element. In some embodiments, the translation enhancer is linked at its 3’ end to the translation stability.

[0070] As used herein, the term "GC content" refers to the percentage of guanine (G) and cytosine (C) in a nucleic acid sequence. The formula for calculating GC content is (G+C) / (A+G+C+U) x 100% (for RNA) or (G+C) / (A+G+C+T) x 100% (for DNA). Likewise, the term "uridine content" refers to the percentage of uridine (U) in a nucleic acid sequence. The formula for calculating uridine content is U / (A+G+C+U) x 100%. Likewise, the term "thymidine content" refers to the percentage of thymidine (T) in a nucleic acid sequence. The formula for calculating thymidine content is T / (A+G+C+T) x 100%.

[0071] "Heterologous" means occurring in a context that is different from that in which it occurs in nature (naturally). A "heterologous" polynucleotide sequence indicates that the polynucleotide sequence is used in a manner different from the way in which it is found in the native genome of the sequence. For example, a "heterologous promoter" is used to drive transcription of a sequence that is not naturally transcribed by that promoter; thus, a "heterologous promoter" sequence is typically included in an expression construct by recombinant nucleic acid technology. The term "heterologous" is also used to refer to a given sequence that is placed in a non-naturally occurring relationship with another sequence; for example, a heterologous coding or non-coding nucleotide sequence is typically inserted into a genome by genome transformation technology, resulting in a genetically modified genome or a recombinant genome.

[0072] As used herein, the term "impurity" is an unwanted substance present in a composition, e.g., a pharmaceutical composition as described herein. In some embodiments, an impurity is a process-related impurity. In some embodiments, an impurity is a product-related substance in a final composition other than a desired product, e.g., an active pharmaceutical ingredient (e.g., a circular polyribonucleotide) as described herein. As used herein, the term "process-related impurity" is an unwanted substance in a final composition, formulation, or product, other than a linear polyribonucleotide as described herein, that is used, present, or generated in the manufacture of the composition, formulation, or product. In some embodiments, a process-related impurity is an enzyme used in the synthesis or circularization of a polyribonucleotide. As used herein, the term "product-related substance" is a substance or byproduct produced during the synthesis of a composition, formulation, or product, or any intermediate thereof. In some embodiments, a product-related substance is a deoxyribonucleotide fragment. In some embodiments, a product-related substance is a deoxyribonucleotide monomer. In some embodiments, a product-related substance is one or more of: a derivative or fragment of a polyribonucleotide as described herein, e.g., a 10, 9, 8, 7, 6, 5, or 4 ribonucleic acid, monoribonucleic acid, diribonucleic acid, or triribonucleic acid fragment.

[0073] As used herein, the term“innate immune system stimulator” refers to an agent that induces an innate immune response, in part, by inducing expression of one or more genes involved in innate immunity, including but not limited to Type I interferons (e.g., IFN a, INF b, and / or IFN g), proinflammatory cytokines (e.g., IL-1, IL-12, IL-18, TNF-a, and / or GM-CSF), retinoic acid-inducible gene-I (RIG-I, also known as DDX58), melanoma differentiation-associated gene 5 (MDA5, also known as IFIH1), 2'-5'oligoadenylate synthetase 1 (OAS1), OAS-like protein (OASL), and / or protein kinase R (PKR). Innate immune system stimulators act as adjuvants (e.g., when administered in combination with or formulated with a ribonucleotide encoding an immunogen). Innate immune system stimulators can be a separate molecular entity (e.g., not encoded by or incorporated as a sequence into a polyribonucleotide), such as STING (e.g., caSTING), TLR3, TLR4, TLR9, TLR7, TLR8, TLR7, RIG-I / DDX58, and MDA-5 / IFIH1, or a constitutively active mutant thereof. Innate immune system stimulators can be encoded by (e.g., expressed from) a polyribonucleotide. A polyribonucleotide can alternatively or further comprise a ribonucleotide sequence that acts as an innate immune system stimulator (e.g., a GU-rich motif, an AU-rich motif, a structured region including dsRNA, or an aptamer).

[0074] As used herein, the term "immunogen" refers to any molecule or molecular structure that comprises one or more epitopes that are recognized, targeted, or bound by an antibody or T cell receptor. In particular, an immunogen induces an immune response in a subject (e.g., is immunogenic as defined herein). An immunogen is capable of inducing an immune response in a subject, wherein the immune response refers to a series of molecular, cellular, and biological events induced when the immunogen encounters the immune system. The immune response can be a humoral and / or cellular immune response. These can include the production of antibodies as well as the expansion of B and T cells. To determine whether an immune response has occurred and to follow its progress, the appearance of immune response material in an immunized subject to a particular immunogen can be monitored. The immune response to most immunogens induces the production of both specific antibodies and specific effector T cells. In some embodiments, the immunogen is foreign to the host. In some embodiments, the immunogen is not foreign to the host. An immunogen can include all or a portion of a polypeptide, polysaccharide, polynucleotide, or lipid. An immunogen can also be a mixture of polypeptides, polysaccharides, polynucleotides, and / or lipids. For example, an immunogen can be a post-translationally modified polypeptide. A "polypeptide immunogen" refers to an immunogen that includes a polypeptide. A polypeptide immunogen can also include one or more post-translational modifications, and / or can form a complex with one or more other molecules, and / or can be in a tertiary or quaternary structure, each of which can determine or influence the immunogenicity of the polypeptide.

[0075] As used herein, the term "immunogenicity" refers to the potential to induce a response to a substance that exceeds a predetermined threshold in a particular immune response assay. The assay can be, for example, the expression of certain inflammatory markers, the production of antibodies, or an assay of immunogenicity as described herein. In some embodiments, an immune response can be induced when the immune system of an organism or certain types of immune cells are exposed to an immunogen.

[0076] Antibodies in the plasma or serum of a subject can be evaluated to assess immunogenicity responses using total antibody assays, confirmatory assays, titration and isotype analysis of antibodies, and neutralizing antibody assessments. Total antibody assays measure all antibodies generated as part of an immune response in the serum or plasma of a subject who has been administered an immunogen. The most common assay for detecting antibodies is ELISA (enzyme-linked immunosorbent assay), which detects antibodies in a subject's serum that bind to a target antibody, including IgM, IgD, IgG, IgA, and IgE. Immunogenicity responses can be further assessed by confirmatory assays. Confirmatory assays can be used to confirm the results of total antibody assays following total antibody assessments. Competition assays can be used to confirm that antibodies specifically bind to a target, and that positive findings in a screening assay are not the result of non-specific interactions between the test serum or reagent and other substances in the assay.

[0077] Immunogenic responses can be assessed by isotype analysis and titration. Isotype assays can be used to assess only the isotype of the relevant antibody. For example, the expected isotypes can be IgM and IgG, which can be specifically detected and quantified by isotype analysis and titration, and then compared to the total antibody present.

[0078] Immunogenic responses can be assessed by neutralizing antibody assays (nAb). Neutralizing antibody assays (nAb) can be used to determine whether the antibodies produced in response to the immunogen neutralize the immunogen, thereby inhibiting the immunogen from exerting an effect on the target and leading to aberrant pharmacokinetic behavior. nAb assays are typically cell-based assays in which target cells are incubated with the antibody. A variety of cell-based nAb assays can be used, including but not limited to cell proliferation, viability, antibody-dependent cell-mediated cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC), cytopathic effect inhibition (CPE), apoptosis, ligand-stimulated cell signaling, enzyme activity, reporter gene assays, protein secretion, metabolic activity, stress, and mitochondrial function. Detection readouts include absorbance, fluorescence, luminescence, chemiluminescence, or flow cytometry readouts. Ligand binding assays can also be used to measure the binding affinity of the immunogen and the antibody in vitro to evaluate neutralizing efficacy.

[0079] In addition, the induction of a cellular immune response can be assessed by measuring T cell activation in a subject using cell markers on T cells obtained from the subject. A blood sample, lymph node biopsy sample, or tissue sample can be collected from the subject, and then one or more (e.g., 2, 3, 4, or more) of the following activation markers can be evaluated in T cells from this sample: CD25, CD71, CD26, CD27, CD28, CD30, CD154, CD40L, CD134, CD69, CD62L, or CD44. The same methods can also be used to assess T cell activation in in vivo animal models. The assay can also be performed to evaluate T cell activation by adding the immunogen to T cells in vitro (e.g., T cells obtained from a subject, animal model, repository, or commercial source) and measuring the above markers. Similar methods can be used to assess the effect on activation of other immune cells, such as eosinophils (markers: CD35, CD11b, CD66, CD69, and CD81), dendritic cells (markers: IL-8, MHC class II, CD40, CD80, CD83, and CD86), basophils (CD63, CD13, CD4, and CD203c), and neutrophils (CD11b, CD35, CD66b, and CD63). Flow cytometry, immunohistochemistry, in situ hybridization, and other assays that allow for the measurement of cell markers can be used to assess these markers. Comparison of results before and after immunogen administration can be used to determine its effect.

[0080] As used herein, the term “inducing an immune response” refers to eliciting, amplifying, or sustaining an immune response in a subject. Inducing an immune response can refer to an adaptive immune response or an innate immune response. Induction of an immune response can be measured as discussed above.

[0081] As used herein, the terms “linear RNA,” “linear polyribonucleotide,” and “linear polyribonucleotide molecule” are used interchangeably and mean a single ribonucleotide molecule or a polyribonucleotide molecule having a 5’ end and a 3’ end. One or both of the 5’ end and 3’ end can be a free end or can be linked to another moiety. In some embodiments, a linear RNA has a 5’ end or 3’ end that is modified or protected from degradation (e.g., protected by a 5’ end protecting agent or a 3’ end protecting agent). In some embodiments, a linear RNA has a 5’ or 3’ end that is non-covalently linked. Linear RNAs include RNAs that have not undergone cyclization (e.g., are pre-cyclized) and are useful as starting material for cyclization.

[0082] As used herein, the term “linear counterpart” is a polyribonucleotide molecule (and fragment thereof) having the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage in between of sequence similarity) as a circular polyribonucleotide and having two free ends (i.e., an uncyclized form of a cyclized polyribonucleotide (and fragment thereof)). In some embodiments, a linear counterpart (e.g., a pre-cyclization form) is a polyribonucleotide molecule (and fragment thereof) having the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage in between of sequence similarity) as a circular polyribonucleotide and the same or similar nucleic acid modifications and having two free ends (i.e., an uncyclized form of a cyclized polyribonucleotide (and fragment thereof)). In some embodiments, a linear counterpart is a polyribonucleotide molecule (and fragment thereof) having the same or similar nucleotide sequence (e.g., 100%, 95%, 90%, 85%, 80%, 75%, or any percentage in between of sequence similarity) as a circular polyribonucleotide and different nucleic acid modifications or no nucleic acid modifications and having two free ends (i.e., an uncyclized form of a cyclized polyribonucleotide (and fragment thereof)). In some embodiments, a fragment of a polyribonucleotide molecule that is a linear counterpart is any portion of a linear counterpart polyribonucleotide molecule that is shorter than the linear counterpart polyribonucleotide molecule. In some embodiments, a linear counterpart further comprises a 5’ cap. In some embodiments, a linear counterpart further comprises a poly-A tail. In some embodiments, a linear counterpart further comprises a 3’ UTR. In some embodiments, a linear counterpart further comprises a 5’ UTR.

[0083] As used herein, the term "modified ribonucleotide" is a nucleotide having at least one modification to the sugar, nucleobase, or internucleoside linkage.

[0084] The term "pharmaceutical composition" is intended to encompass a circular polyribonucleotide comprised in a pharmaceutical composition can be used for the treatment of the human or animal body (e.g., veterinary use) by therapy. Thus, this means equivalent to "a circular polyribonucleotide for use in therapy".

[0085] The term "poly-A based spacer element" or "poly-A spacer element" refers to a spacer element comprising an untranslated contiguous region of a nucleic acid molecule that is at least 4 nucleotides in length and consists of one or more individual adenine (A) residues in combination with one or more (A), thymine (T), cytosine (C), guanine (G), or uracil (U) residues. For example, in some embodiments, the poly-A based spacer element is a poly-A region, which can be a sequence of adenine residues. In other embodiments, the poly-A based spacer element is a poly-AT region, which is a combination of adenine and thymine residues. In other embodiments, the poly-A based spacer element is a poly-AU region, which can be a combination of adenine and uracil residues. In some embodiments, the poly-A based spacer element is a poly-AG region, which is a combination of adenine and guanine residues. The poly-A based spacer element comprises between 50% and 100% (e.g., between 50% and 90%, 50% and 80%, 50% and 70%, 50% and 60%, 60% and 100%, 70% and 100%, 80% and 100%, 90% and 100%, 70% and 90%, or 60% and 80%) adenine residues.

[0086] As used herein, the term "polynucleotide" means a molecule comprising one or more nucleic acid subunits or nucleotides, and can be used interchangeably with "nucleic acid" or "oligonucleotide." A polynucleotide can comprise one or more nucleotides selected from adenosine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), or variants thereof. A nucleotide can comprise a nucleoside and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphate (PO3) groups. A nucleotide can comprise a nucleobase, a five-carbon sugar (ribose or deoxyribose), and one or more phosphate groups. A ribonucleotide is a nucleotide in which the sugar is ribose. A polyribonucleotide or ribonucleic acid or RNA can refer to a macromolecule comprising a plurality of ribonucleotides polymerized via phosphodiester bonds. A deoxyribonucleotide is a nucleotide in which the sugar is deoxyribose. In some examples, a polynucleotide is a deoxyribonucleic acid (DNA), a ribonucleic acid (RNA), or a derivative or variant thereof. In some cases, a polynucleotide is, by way of example and not limitation, a short interfering RNA (siRNA), a microRNA (miRNA), a plasmid DNA (pDNA), a short hairpin RNA (shRNA), a small nuclear RNA (snRNA), a messenger RNA (mRNA), a pre-mRNA, an antisense RNA (asRNA), and encompasses nucleotide sequences and any structural embodiments thereof, such as single-stranded, double-stranded, triple-stranded, helices, hairpins, and the like. In some cases, a polynucleotide molecule is circular. A polynucleotide can have a variety of lengths. A nucleic acid molecule can have a length of at least about 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1 kilobase (kb), 2 kb, 3 kb, 4 kb, 5 kb, 10 kb, 50 kb, or more. A polynucleotide can be isolated from a cell or tissue. As embodied herein, a polynucleotide sequence can include an isolated and purified DNA / RNA molecule, a synthetic DNA / RNA molecule, and a synthetic DNA / RNA analog.

[0087] “Deoxynucleotides,” “deoxyribonucleic acids,” and “DNA” mean a macromolecule comprising a plurality of deoxyribonucleotides polymerized via phosphodiester bonds. The nucleotides can be nucleoside monophosphates or nucleoside polyphosphates. Nucleotides mean deoxyribonucleotide polyphosphates comprising a detectable tag, such as a luminescent tag, or a marker, e.g., a fluorophore, such as, for example, deoxyribonucleotide triphosphates (dNTPs), which can be selected from deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), uridine triphosphate (dUTP), and deoxythymidine triphosphate (dTTP) dNTPs. Nucleotides can include any subunit that can be incorporated into a growing nucleic acid chain. Such subunits can be A, C, G, T, or U, or any other subunit that is specific for one or more complementary A, C, G, T, or U, or is complementary to a purine (i.e., A or G or variants thereof) or a pyrimidine (i.e., C, T, or U or variants thereof).

[0088] A polynucleotide, such as a polyribonucleotide or polydeoxyribonucleotide, can include one or more nucleotide variants, including one or more non-standard nucleotides, one or more unnatural nucleotides, one or more nucleotide analogs, and / or modified nucleotides. Examples of modified nucleotides include, but are not limited to, diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, 3-(3-amino-3-carboxypropyl) uridine, 2,6-diaminopurine, and the like. In some cases, nucleotides can include modifications in their phosphate moiety, including modifications to the triphosphate moiety. Non-limiting examples of such modifications include longer phosphate chains (e.g., phosphate chains having 4, 5, 6, 7, 8, 9, 10, or more phosphate moieties) and modifications with thiol moieties (e.g., alpha-thio triphosphates and beta-thio triphosphates). Nucleic acid molecules can also be modified at the base moiety (e.g., at one or more atoms that typically serve to form hydrogen bonds with complementary nucleotides and / or at one or more atoms that typically do not serve to form hydrogen bonds with complementary nucleotides), sugar moiety, or phosphate backbone. Nucleic acid molecules can also contain amine-modified groups, such as aminoallyl 1-dUTP (aa-dUTP) and amino hexyl propenamide-dCTP (aha-dCTP), to allow covalent attachment of amine-reactive moieties, such as N-hydroxysuccinimidyl esters (NHS).Substitutions of standard DNA base pairs or RNA base pairs in the oligonucleotides of the present disclosure can provide higher density (in bits per cubic millimeter), higher security (resistance to accidental or purposeful synthesis of natural toxins), easier discrimination photo-programmed polymerases, or lower secondary structure. Such alternative base pairs compatible with natural and mutant polymerases for de novo and / or amplification synthesis are described in Betz K, Malyshev DA, Lavergne T, Welte W, Diederichs K, Dwyer TJ, Ordoukhanian P, Romesberg FE, Marx A. Nat. Chem. Biol. 2012 Jul;8(7):612-4, which is incorporated herein by reference for all purposes.

[0089] As used herein, "polypeptide" means a polymer of amino acid residues (natural or non-natural) most often linked together by peptide bonds. As used herein, the term refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides can include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments of the foregoing, and other equivalents, variants, and analogs. Polypeptides can be single molecules or multimeric complexes, such as dimers, trimers, or tetramers. They can also include single-chain or multi-chain polypeptides, such as antibodies or insulin, and can be associated or linked. Disulfide bridges are most often found in multi-chain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more of the amino acid residues are artificial chemical mimetics of the corresponding naturally occurring amino acid.

[0090] As used herein, the term "polyribonucleotide cargo" herein includes any sequence comprising at least one polyribonucleotide. In embodiments, the polyribonucleotide cargo comprises one or more expression sequences, wherein each expression sequence encodes an immunogen. In embodiments, the polyribonucleotide cargo comprises one or more non-coding sequences, such as a polyribonucleotide having a regulatory or catalytic function. In embodiments, the polyribonucleotide cargo comprises a combination of expression sequences and non-coding sequences. In embodiments, the polyribonucleotide cargo comprises one or more polyribonucleotide sequences described herein, such as one or more regulatory elements, internal ribosome entry site (IRES) elements, or spacer elements.

[0091] As used herein, the term “prevent” means to reduce the likelihood of developing a disease, disorder, or condition, or alternatively, to reduce the severity or frequency of symptoms in a subsequently developed disease or disorder. The polyribonucleotides described herein can be administered to a subject at increased risk of developing a disease or disorder relative to the general population in order to prevent development of the disease or condition or to reduce the severity of the disease or condition. The polyribonucleotides described herein can be administered as a prophylactic (e.g., prior to the development of any symptoms or manifestations of the disease or disorder).

[0092] As used herein, the terms “purify,” “purifying,” and “purification” refer to one or more steps or processes to remove impurities (e.g., process-related impurities (e.g., enzymes), process-related substances (e.g., deoxyribonucleotide fragments, deoxyribonucleotide monomers)) or byproducts (e.g., linear RNA) from a sample containing a mixture of circular RNA and linear RNA and other substances to produce a composition containing an enriched population of circular RNA, wherein the level of impurities (e.g., process-related impurities (e.g., enzymes), process-related substances (e.g., deoxyribonucleotide fragments, deoxyribonucleotide monomers)) or byproducts (e.g., linear RNA) is reduced compared to the original mixture, or linear RNA or substances are reduced by 40% or more (e.g., 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, or 99% or more) by mass relative to the starting mixture.

[0093] As used herein, the terms“pure” and“purity” refer to the extent to which an analyte (e.g., a circular RNA) is isolated and free of other components. In the context of nucleic acids (e.g., polyribonucleotides), the purity of an isolated nucleic acid (e.g., a circular RNA) can be expressed in terms of a population of nucleic acids that is free of any contaminants, impurities, or byproducts (e.g., linear RNAs and other materials). For example, the purity of a population of circular RNAs can be determined using, for example, pure circular RNA as a reference, indicating how much of the population is circular RNA, by total mass of the isolated material. Purity levels found in the present disclosure can be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, greater than 95%, or greater than 99% (w / w). In some embodiments, the level of contaminants or impurities or byproducts does not exceed about 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% (w / w). Purity can be determined by detecting the level of a particular analyte (e.g., a circular RNA) or a particular impurity or byproduct (e.g., a linear RNA) using gel electrophoresis, spectrophotometry (e.g., ThermoFisher Scientific’s NanoDrop), or other techniques suitable for measuring the purity of a population of nucleic acids, and calculating the percentage of the analyte relative to the total nucleic acid content (e.g., as determined by assays known in the art) (w / w).

[0094] As used herein, the phrase“substantially free of one or more impurities or byproducts” refers to the characteristic of a sample (such as a sample containing an enriched population of circular RNAs) containing no or minimal amounts of one or more impurities or byproducts (e.g., one or more impurities or byproducts disclosed herein). The minimal amounts of one or more impurities or byproducts can be no more than 20% (w / w) (e.g., no more than 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w), or less). In another example, a sample or an enriched population of circular RNAs is substantially free of one or more impurities or byproducts if the one or more impurities or byproducts are present in an amount of less than 15% (w / w) (e.g., no more than 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w), or less). In another example, a sample or an enriched population of circular RNAs is substantially free of one or more impurities or byproducts if the one or more impurities or byproducts are present in an amount of less than 10% (w / w) (e.g., no more than 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w), or less). In another example, a sample or an enriched population of circular RNAs is substantially free of one or more impurities or byproducts if the one or more impurities or byproducts are present in an amount of less than 5% (w / w) (e.g., no more than 4%, 3%, 2%, 1% (w / w), or less). In yet another example, a sample or an enriched population of circular RNAs is substantially free of one or more impurities or byproducts if the one or more impurities or byproducts are present in an amount of less than 1% (no more than 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% (w / w), or less).

[0095] As used herein, the term“regulatory element” is a portion of a nucleic acid sequence that modifies the expression of an expression sequence within a circular polyribonucleotide.

[0096] As used herein, the term“replication element” is a sequence and / or motif that can be used to replicate or initiate transcription of a circular polyribonucleotide.

[0097] As used herein, the term“RNA equivalent” refers to an RNA sequence that is an RNA equivalent of a DNA sequence. Thus, an RNA equivalent of a DNA sequence refers to a DNA sequence in which each thymidine (T) residue is replaced with a uridine (U) residue. It is specifically contemplated that any one of these DNA sequences can be converted to the corresponding RNA sequence and included in the RNA molecules described herein.

[0098] As used herein, the term "sequence identity" is determined by aligning two peptide or two nucleotide sequences using a global or local alignment algorithm. Sequences can be referred to as "essentially identical" or "essentially similar" when they have at least some minimum percentage of sequence identity, for example, when optimally aligned (e.g., by the program GAP using default parameters) they have at least some minimum percentage of sequence identity. GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizing the number of gaps. Generally, the default parameters for GAP are used, with a gap creation penalty = 50 (nucleotides) / 8 (proteins) and gap extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides, the default scoring matrix used is the nwsgapdna.cmp scoring matrix, while for proteins, the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scoring of percent sequence identity can be determined using a computer program, such as the GCG Wisconsin Software Package, Version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752, or EmbossWin Version 2.10.0 (using the program "needle"). Alternatively or additionally, percent identity can be determined by searching a database using algorithms such as FASTA, BLAST, etc. Sequence identity refers to sequence identity over the entire length of the sequence.

[0099] "Signal sequence" refers to a polypeptide sequence, for example, between 10 and 45 amino acids in length, which is present at the N-terminus of the polypeptide sequence of a nascent protein, targets the polypeptide sequence to the secretory pathway.

[0100] As used herein, the term "spacer element" refers to any contiguous nucleotide sequence (e.g., a contiguous nucleotide sequence of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. A spacer element can be present between any of the nucleic acid elements described herein. A spacer element can also be present within a nucleic acid element described herein.

[0101] As used herein, the term "stability element" refers to a polynucleotide element that increases the stability of a polynucleoglycoside compared to a polynucleoglycoside lacking the stability element. A stability element can increase the stability of a polynucleoglycoside such that the polynucleoglycoside degrades more slowly.

[0102] As used herein, the term “subject” refers to an organism, such as an animal, a plant, or a microorganism. In embodiments, the subject is a vertebrate animal (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In embodiments, the subject is a human. In embodiments, the subject is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a water buffalo, a bison, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is a bird, such as a member of the order Galliformes (e.g., a chicken, a turkey, a pheasant, a quail), the order Anseriformes (e.g., a duck, a goose), the subclass Archaeognatha (e.g., a termite, a silverfish), the order Columbiformes (e.g., a dove, a pigeon), or the order Psittaciformes (e.g., a parrot). In embodiments, the subject is an invertebrate animal, such as an arthropod (e.g., an insect, an arachnid, a crustacean), a nematode, an annelid, a helminth, or a mollusk. In embodiments, the subject is an invertebrate agricultural pest or an invertebrate that parasitizes an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm (which can be a dicot or a monocot) or a gymnosperm (e.g., a conifer, a cycad, a ginkgo, a gnetophyte), a fern, a horsetail, a clubmoss, or a liverwort. In embodiments, the subject is a eukaryotic alga (single-celled or multicellular). In embodiments, the subject is a plant of agricultural or horticultural importance, such as an inter-row crop, a fruit-producing plant and tree, a vegetable, a tree, and an ornamental plant (including an ornamental flower, shrub, tree, ground cover, and turf grass).

[0103] As used herein, the term “translation enhancer” refers to a polyribonucleotide element that allows translation of an mRNA directly or through interaction with an RNA-binding protein via recruitment of ribosomes, translation initiation factors. A polyribonucleotide comprising a translation enhancer can, for example, exhibit increased stability and / or increased expression of a polyribonucleotide cargo encoding an immunogen compared to a polyribonucleotide lacking a translation enhancer.

[0104] As used herein, the term “termination element” is a moiety that terminates translation of an expression sequence in a circular polyribonucleotide, such as a nucleic acid sequence.

[0105] As used herein, the term “total ribonucleotide molecules” means the total amount of any ribonucleotide molecules, including linear polyribonucleotide molecules, circular polyribonucleotide molecules, monomeric ribonucleotides, other polyribonucleotide molecules, fragments thereof, and modified variants thereof, as measured by the total mass of the ribonucleotide molecules.

[0106] As used herein, the term "translation efficiency" is the rate or amount of protein or peptide produced from a ribonucleotide transcript. In some embodiments, translation efficiency can be expressed as the amount of protein or peptide produced from a given amount of transcript encoding the protein or peptide, e.g., in a given time period, e.g., in a given translation system, e.g., an in vitro translation system (like rabbit reticulocyte lysate) or an in vivo translation system (like a eukaryotic or prokaryotic cell).

[0107] As used herein, the term "translation initiation sequence" is a nucleic acid sequence that initiates translation of an expressed sequence in a circular polyribonucleotide.

[0108] As used herein, the term "treat" or "treating" refers to the treatment of a disease or disorder (e.g., an infectious disease, a cancer, a poisoning, or an allergic reaction) in a subject. The effects of treatment can include reversing, alleviating, curing, inhibiting the progress of, reducing the severity of, reducing the likelihood of recurrence of, stabilizing (i.e., not worsening), and / or preventing the spread of one or more symptoms or manifestations of the disease or disorder, as compared to the state and / or condition of the disease or disorder in the absence of treatment.

[0109] As used herein, a "variant" refers to a polypeptide comprising at least one alteration, e.g., substitution, insertion, deletion, and / or fusion, at one or more residue positions as compared to a parent or wild-type polypeptide. A variant can comprise 1 to 10, 10 to 20, 20 to 50, 50 to 100, or more alterations. BRIEF DESCRIPTION OF DRAWINGS

[0110] Figures 1A-1F is a schematic of exemplary linear and circular polyribonucleotide constructs having one or more spacer elements and / or one or more expression-enhancing elements.

[0111] Figure 2 is a table showing the circularization efficiency (circRNA%) of single spacer or dual spacer design constructs having one or more spacer elements between 50 and 300 nucleotides in length, wherein the constructs encode a Gluc polypeptide or human erythropoietin.

[0112] Figure 3A is a table of translation enhancers (including motifs and sequences).

[0113] Figure 3BTable 1 is a table showing the circularization efficiency (circRNA%) of single and dual design constructs with spacer elements and / or translational enhancers and encoding Gluc polypeptides.

[0114] Figure 4A Figure 1 is a bar graph showing the expression of Gluc at 24 and 48 hours post transfection in HeLa cells transfected with circular RNAs with spacer elements and encoding Gluc polypeptides.

[0115] Figure 4B Figure 2 is a graph showing the expression of EPO at 24 and 48 hours post transfection in HeLa cells transfected with circular RNAs with spacer elements and encoding human erythropoietin.

[0116] Figure 5 Figure 3 is a bar graph showing the expression of Gluc at 24 hours post transfection in HeLa cells transfected with circular RNAs with single or dual spacer designs and encoding Gluc polypeptides.

[0117] Figure 6A Figure 4 is a bar graph showing the expression of Gluc at 4, 24 and 48 hours post transfection in HeLa cells transfected with circular RNAs with dual spacer designs and encoding Gluc polypeptides.

[0118] Figure 6B Figure 5 is a bar graph showing the expression of EPO at 4, 24 and 48 hours post transfection in HeLa cells transfected with circular RNAs with dual spacer designs and encoding human erythropoietin.

[0119] Figure 7A Figure 6 is a bar graph showing the expression of Gluc in A549 cells transfected with circular RNAs with spacer elements and translational enhancers and encoding Gluc polypeptides.

[0120] Figure 7B Figure 7 is a bar graph showing the expression of EPO at 24 hours post transfection in A549 cells transfected with circular RNAs with spacer elements and translational enhancers and encoding human erythropoietin.

[0121] Figure 8 Figure 8 is a bar graph showing the expression of EPO at day 1 and day 2 post transfection in HEK cells transfected with circular polyribonucleotides with translational enhancers and encoding human erythropoietin.

[0122] Figure 9 Figure 9 is a bar graph showing the expression of EPO at day 1 and day 2 post transfection in HeLa cells transfected with circular polyribonucleotides with translational enhancers and encoding human erythropoietin.

[0123] Figure 10 is a bar graph showing in vivo expression of EPO encoded by a circular polyribonucleotide comprising a translational enhancer.

[0124] Figure 11 is a graph showing expression of EPO at 24 hours post-transfection in A549 cells transfected with a circular polyribonucleotide having a CVB3 IRES with spacer element and / or translational enhancer and encoding human erythropoietin.

[0125] Figure 12 is a graph showing expression of EPO at 24 hours post-transfection in A549 cells transfected with a circular polyribonucleotide having an EMCV IRES with spacer element and / or translational enhancer and encoding human erythropoietin.

[0126] Figure 13 is a graph showing expression of EPO at 24 hours post-transfection in A549 cells transfected with a circular polyribonucleotide having multiple spacer elements and multiple translational enhancers and encoding human erythropoietin and SARS-CoV-2 RBD polypeptide.

[0127] Figure 14A and Figure 14B is a graph showing the time course of expression of EGFPd2 in A549 cells transfected with a circular RNA having a spacer element and a translational enhancer and encoding an EGFPd2 polypeptide. Figure 14A Expression of EGFPd2 is shown over time. Figure 14B Area under the curve from 0 to 24 hours is shown.

[0128] Figures 15A-15C is a bar graph showing expression of EPO at 24 hours post-transfection in A549 cells transfected with a circular RNA having a spacer element and a translational enhancer and encoding human erythropoietin.

[0129] Figure 16A and Figure 16B is a bar graph showing expression of EPO at 24 hours post-transfection in A549 cells transfected with a circular RNA having a spacer element and a translational enhancer and encoding human erythropoietin.

[0130] Figures 17A-17C is a bar graph showing HiBiT expression at 24 hours post-transfection in HEK cells transfected with a circular RNA having a spacer element and a translational enhancer and encoding Factor 9-albumin-HiBiT polypeptide.

[0131] Figure 18A and Figure 18Bis a bar graph showing Gluc expression in HeLa cells transfected with different concentrations of circular RNAs with spacer elements and minimal or full-length eIF4g aptamer translation enhancer and encoding Gluc polypeptide at 48 hours post-transfection.

[0132] Figure 19 is a bar graph showing CFTR expression in HEK293T cells transfected with one of twelve (12) different circular RNAs encoding CFTR.

[0133] Figure 20 is a bar graph showing SARS-CoV-2 spike protein expression detected on the cell surface of HEK293T cells transfected with one of thirteen (13) different circular RNAs encoding SARS-CoV-2 spike protein.

[0134] Figure 21 is a bar graph showing VZV gE expression detected on the cell surface of HEK293T cells transfected with one of four different circular RNAs encoding VZV gE.

[0135] Figure 22 is a graph showing the relative amount of circular polyribonucleotide with a modified CVB3 IRES with 5’ spacer element and 3’ RNA stability element and encoding EGFPd2 polypeptide present over time.

[0136] Figures 23A-23C is a series of bar graphs showing the concentration of polypeptide Factor 9-HiBiT encoded by a circular polyribonucleotide with 5’ spacer element and 3’ translation enhancer and encoding Factor 9-HiBiT at 24 hours post-transfection.

[0137] Figure 24A and Figure 24B is a graph showing the time course of expression data for EGFPd2 encoded by a circular polyribonucleotide with a modified CVB3 IRES with spacer element and / or translation enhancer and encoding EGFPd2, wherein Figure 24A EGFPd2 expression is shown over time, and Figure 24B the area under the curve from 0 to 24 hours is shown.

[0138] Figure 25A and Figure 25B is a graph showing the time course of expression data for EGFPd2 encoded by a circular polyribonucleotide with a modified CVB3 IRES with 5’ translation enhancer and 3’ spacer element and encoding EGFPd2, wherein Figure 25AEGFPd2 expression over time is shown, and Figure 25B Area under the curve from 0 to 24 hours is shown.

[0139] Figure 26A and Figure 26B is a bar graph showing the concentration of polypeptide B-HiBiT encoded by a circular polyribonucleotide having an EV69 IRES Figure 26A ) or a modified CVB3 IRES Figure 26B ) encoding polypeptide B-HiBiT with a 5’ spacer element and a 3’ translation enhancer 24 hours post transfection.

[0140] Figure 27 is a bar graph showing the concentration of polypeptide B-HiBiT encoded by a circular polyribonucleotide having multiple translation enhancers or multiple spacer elements.

[0141] Figure 28 is shown the expression of polypeptide G encoded by a circular polyribonucleotide having a modified CVB3 IRES with a spacer element and / or a translation enhancer encoding polypeptide G 24 hours post transfection.

[0142] Figure 29A and Figure 29B is a bar graph showing the area under the curve of GFPd2 Figure 29A ) and the concentration of polypeptide B-HiBiT Figure 29B ) encoded by a circular polyribonucleotide having a single spacer design or a dual spacer design.

[0143] Figure 30A and Figure 30B is a bar graph showing the area under the curve of GFPd2 encoded by a circular polyribonucleotide having a single spacer design or a dual spacer design.

[0144] Figure 31A and Figure 31B is a bar graph showing the area under the curve of polypeptide B-HiBiT encoded by a circular polyribonucleotide having a single spacer design or a dual spacer design.

[0145] Figures 32A-32D is a bar graph showing the area under the curve of GFPd2 encoded by a circular polyribonucleotide having one or more spacer elements and / or one or more translation enhancers, where the translation enhancer is FcIgG Figure 32A ), TP53I3 Figure 32B ), LSP1 Figure 32C ), or histone 4E Figure 32D ).

[0146] Figures 33A-33D is a bar graph showing the concentration of polypeptide B-HiBiT encoded by a circular polyribonucleotide having one or more spacer elements and / or one or more translation enhancers, where the translation enhancer is FcIgG Figure 33A , TP53I3 Figure 33B , LSP1 Figure 33C , or histone 4E Figure 33D .

[0147] Figures 34A-34D is a bar graph showing the area under the curve of GFPd2 encoded by a circular polyribonucleotide having a translation enhancer, where the translation enhancer is TBR16 Figure 34A , 12S Figure 34B , TRAM1- Figure 34C , and GPX4 Figure 34D .

[0148] Figures 35A-35D is a bar graph showing the concentration of polypeptide B-HiBiT encoded by a circular polyribonucleotide having a translation enhancer, where the translation enhancer is TBR16 Figure 35A , 12S Figure 35B , TRAM1- Figure 35C , and GPX4 Figure 35D . DETAILED DESCRIPTION

[0149] The present disclosure features compositions comprising a polyribonucleotide having one or more expression enhancing elements or spacer elements. The polyribonucleotides described herein are particularly useful for increasing the stability of a polynucleotide cargo (e.g., encoding an immunogen) encoded by the polyribonucleotide and / or increasing expression thereof.

[0150] The disclosure provides a polyribonucleotide comprising a first post-circularization element; a first expression-enhancing element of at least 100 ribonucleotides in length; a polyribonucleotide cargo encoding an immunogen; a second expression-enhancing element; and a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction. The disclosure also provides a polyribonucleotide having a first post-circularization element; a first spacer element of at least 100 ribonucleotides in length; a polyribonucleotide cargo encoding an immunogen; a second spacer element; and a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction. The disclosure also provides a polyribonucleotide having a first post-circularization element; a first spacer element; a polyribonucleotide cargo encoding an immunogen; a second spacer element of at least 100 ribonucleotides in length; and a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0151] The polyribonucleotide constructs described herein can exhibit increased stability, thereby potentially increasing the length of time a polyribonucleotide can persist before being degraded. Additionally, the polyribonucleotide constructs described herein can exhibit increased expression of a polynucleotide cargo encoded by the polyribonucleotide. As will be appreciated by one of skill in the art, each of the DNA sequences described herein includes an RNA equivalent sequence. Likewise, as will be appreciated by one of skill in the art, all of the RNA sequences described herein include a DNA equivalent sequence. The molecules, methods of production, and uses thereof are described in more detail below.

[0152] Circular polyribonucleotide elements

[0153] A circular polyribonucleotide can comprise, from 5' to 3', a first post-circularization element; one or more expression-enhancing elements; a polyribonucleotide cargo encoding an immunogen; and a second post-circularization element. In some embodiments, a circular polyribonucleotide comprises, from 5' to 3', a first post-circularization element; a polyribonucleotide cargo; one or more expression-enhancing elements; and a second post-circularization element.

[0154] In some embodiments, a circular polyribonucleotide comprises, from 5' to 3', a first post-circularization element; a first expression-enhancing element; a polyribonucleotide cargo; a second expression-enhancing element; and a second post-circularization element.

[0155] In some embodiments, the circular polyribonucleotide comprises, from 5' to 3', a first post-circularization element; a spacer element; a polyribonucleotide cargo; an expression- enhancing element; and a second post-circularization element. In some embodiments, the circular polyribonucleotide comprises, from 5' to 3', a first post-circularization element; a polyribonucleotide cargo encoding an immunogen; one or more expression-enhancing elements; and a second post-circularization element. In some embodiments, the circular polyribonucleotide comprises, from 5' to 3', a first post-circularization element; a first expression-enhancing element; a polyribonucleotide cargo encoding an immunogen; a second expression-enhancing element; and a second post-circularization element. In some embodiments, the circular polyribonucleotide comprises, from 5' to 3', a first post-circularization element; a first spacer element of at least 100 ribonucleotides in length; a polyribonucleotide cargo encoding an immunogen; a second spacer element; and a second post-circularization element.

[0156] A circular polyribonucleotide as disclosed herein comprises a first post-circularization element; (b) a first spacer element having at least 100 ribonucleotides (e.g., at least 100, 120, 140, 160, 180, 200, 250, 300, 400, or 500 ribonucleotides). A circular polyribonucleotide disclosed herein further comprises a polyribonucleotide cargo encoding an immunogen and a second spacer element. In some embodiments, the second spacer element is at least 100 ribonucleotides (e.g., at least 100, 120, 140, 160, 180, 200, 250, 300, 400, or 500 ribonucleotides) in length. For example, the second spacer element can be between 120 and 500 ribonucleotides in length (e.g., between 120 and 400, between 120 and 300, between 120 and 200, between 120 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 400 and 500, or between 350 and 500 ribonucleotides). In some embodiments, the second spacer element is between 100 and 300 ribonucleotides in length (e.g., between 100 and 280, between 100 and 260, between 100 and 240, between 100 and 220, between 100 and 200, between 100 and 180, between 100 and 160, between 100 and 140, between 100 and 120, between 120 and 300, between 140 and 300, between 160 and 300, between 180 and 300, between 200 and 300, between 220 and 300, between 240 and 300, between 260 and 300, or between 280 and 300 ribonucleotides). In some embodiments, the second spacer element is between 200 and 500 ribonucleotides in length (e.g., between 200 and 450, between 200 and 400, between 200 and 350, between 200 and 300, between 200 and 250, between 250 and 500, between 300 and 500, between 350 and 500, between 400 and 500, between 450 and 500, between 300 and 500, or between 300 and 400 ribonucleotides).

[0157] Expression enhancing element

[0158] A polyribonucleotide described herein can comprise one or more expression enhancing elements. In some embodiments, a circular or linear polyribonucleotide comprises between 1 and 5 expression enhancing elements (e.g., 1, 2, 3, 4, or 5 expression enhancing elements). For example, a circular or linear polyribonucleotide can comprise a first expression enhancing element and a second expression enhancing element. The one or more expression enhancing elements can comprise a translation enhancer, a stability element, a translation enhancer fused (e.g., linked, attached) to a spacer element, or a stability element fused (e.g., linked, attached) to a spacer element. In some embodiments, a circular or linear polyribonucleotide comprises a translation enhancer and a stability element.

[0159] A polyribonucleotide described herein can comprise a combination of elements as described in Table 1, in a 5’ to 3’ order. One or more spacer elements can be comprised between any of the elements described in Table 1.

[0160] Table 1. Exemplary Constructs

[0161]

[0162]

[0163] A spacer element can be fused to the 5’ end or 3’ end of a translation enhancer or a stability element

[0164] A polyribonucleotide described herein can comprise a first expression enhancing element or a second expression enhancing element. The first expression enhancing element can comprise a translation enhancer. The second expression enhancing element can comprise a translation enhancer. In some embodiments, a circular or linear polyribonucleotide described herein comprises one or more translation enhancers. In some embodiments, a translation enhancer can be fused (e.g., linked, attached) to a spacer element. A translation enhancer can be present between any of the nucleic acid elements described herein. A translation enhancer can also be present within a nucleic acid element described herein. In some embodiments, a translation enhancer is a spacer element. In some embodiments, a translation enhancer is a stability element.

[0165] In some embodiments, the translation enhancer is from a gene encoding an RNA binding protein. In some embodiments, the translation enhancer comprises a nucleic acid sequence comprising a fragment from a gene encoding an RNA binding protein. In some embodiments, the translation enhancer has at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, <99%, or 100%) sequence identity to a nucleic acid sequence comprising a fragment from a gene encoding an RNA binding protein. In some embodiments, the translation enhancer is from a gene encoding a BYDV-like element (BTE), a translation enhancer element (TED), a PMV / PEMV-like translation enhancer (PTE), an I-shaped structure (ISS), a Y-shaped structure (YSS), a t-shaped structure (TSS), a dumbbell-shaped structure, a viral RNA UTR (including Dengue, West Nile, Zika, Rotavirus), EMCV, CVB3, Hepatitis B virus post-transcriptional regulatory element, a human genomic fragment, a histone mRNA sequence, a cyclin D mRNA sequence, or an eIF4g adaptor sequence. In some embodiments, the translation enhancer element is from a plant virus. In some embodiments, the translation enhancer comprises a nucleic acid sequence comprising a fragment from a plant virus. In some embodiments, the translation enhancer has at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, <99%, or 100%) sequence identity to a nucleic acid sequence comprising a fragment from a plant virus. In some embodiments, the plant virus is a Barley Yellow Dwarf Virus (BYDV)-like element (BTE) translation enhancer. Non-limiting examples of plant viruses with a BTE include BYDV, TNVD, OLV1, LWSV, SCNMV, CRSV, TBTV, GRV, OMMV, BBSV, RSDaV, and OPMV. The BTE binds to eIF4g with high affinity. In particular embodiments, the circular or linear polyribonucleotide comprises a BTE sequence described in Table 2. In some embodiments, the BTE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from SEQ ID NOs: 1-22 of Table 2.

[0166] In some embodiments, the translational enhancer element is from a plant virus containing a TED. Non-limiting examples of plant viruses with TEDs include STNV, PLPV, PCRPV, ELV, RrLDV, PelRSV, and CbMV. TEDs bind with high affinity to eIF4F. In particular embodiments, the circular or linear polyribonucleotide comprises a TED sequence described in Table 3. In some embodiments, the TED comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from SEQ ID NOs: 23-29 of Table 3.

[0167] In some embodiments, the translational enhancer element is from a plant virus containing a millet mosaic virus / pea enation mosaic virus (PMV / PEMV)-like translational enhancer (PTE) translational enhancer. Non-limiting examples of plant viruses with PTEs include SCV, PFBV, CarMV, HnRSV, PSNV, HCRSV, GaMV, CMMV, TPAV, JINRV, PEMV2, PMV, MCMV, BGLV, AdMV, and CLSV. PTEs bind with high affinity to eIF4E. In particular embodiments, the circular or linear polyribonucleotide comprises a PTE sequence described in Table 4. In some embodiments, the PTE comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from SEQ ID NOs: 30-46 of Table 4.

[0168] In some embodiments, the translational enhancer element is from a plant virus containing an ISS translational enhancer. Non-limiting examples of plant viruses with ISSs include MNeSV, MNSV264, CBV, MWLMV, JCSMV, and GoMVA. ISSs bind to eIF4E that binds to eIF4G. In particular embodiments, the circular or linear polyribonucleotide comprises a TSS sequence described in Table 5. In some embodiments, the TSS comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from SEQ ID NOs: 47-53 of Table 5.

[0169] In some embodiments, the translational enhancer element is from a plant virus containing a YSS translational enhancer. Non-limiting examples of plant viruses with YSS include TBSV, CIRV, CymRSV, CNV, AMCV, PNSV, GALV, PLCV, PeLV, and LNV. YSS binds to eIF4F. In particular embodiments, the circular or linear polyribonucleotide comprises a YSS sequence set forth in Table 6. In some embodiments, the YSS comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from SEQ ID NOs: 54-63 of Table 6.

[0170] In some embodiments, the translational enhancer element is from a plant virus containing a TSS translational enhancer. Non-limiting examples of plant viruses with TSS include TYMV, RCNM, TCV, and CCFV. TSS binds to the 60s ribosomal subunit. In particular embodiments, the circular or linear polyribonucleotide comprises a TSS sequence set forth in Table 7. In some embodiments, the TSS comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from SEQ ID NOs: 64-67 of Table 7.

[0171] In some embodiments, the translational enhancer element is from a plant virus containing a dumbbell-shaped translational enhancer. Non-limiting examples of plant viruses with a dumbbell-shaped translational enhancer include CABYV-X. In particular embodiments, the circular or linear polyribonucleotide comprises a dumbbell-shaped translational enhancer sequence set forth in Table 8 SEQ ID NO: 68. In some embodiments, the dumbbell-shaped enhancer comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from SEQ ID NO: 68 of Table 8.

[0172] In some embodiments, the translation enhancer element is from a gene from a mammal. In some embodiments, the translation enhancer comprises a nucleic acid sequence comprising a fragment from a mammalian gene. In some embodiments, the translation enhancer has at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, <99%, or 100%) sequence identity to a nucleic acid sequence comprising a fragment from a mammalian gene. The gene from a mammal can be, but is not limited to, a histone or cyclin D mRNA sequence that binds to eIF4E. In some embodiments, the translation enhancer element is from a synthetic sequence, including but not limited to, an eIF4G aptamer that binds to eIF4G. In some embodiments, the translation enhancer element is from a viral sequence. Non-limiting examples of translation enhancers from viral sequences are HCV and DENV. In particular embodiments, the circular or linear polyribonucleotide comprises a mammalian, synthetic, or viral translation enhancer described in Table 8. In some embodiments, the mammalian, synthetic, or viral translation enhancer comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from SEQ ID NOs: 68-159 and 321-335 of Table 8.

[0173] In particular embodiments, the circular or linear polyribonucleotide comprises a translation enhancer element described in Tables 2-8. In some embodiments, the translation enhancer comprises a sequence having at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% sequence identity to a sequence from Tables 2-8.

[0174] In certain embodiments, the translation enhancer comprises a nucleic acid sequence having at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 1-159, 264-267, or 278-335. In some embodiments, the translation enhancer comprises a nucleic acid sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) identity to the nucleic acid sequence of any one of SEQ ID NOs: 1-159, 264-267, or 278-335. In some embodiments, the translation enhancer comprises a nucleic acid sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity) identity to the nucleic acid sequence of any one of SEQ ID NOs: 1-159, 264-267, or 278-335. In some embodiments, the translation enhancer comprises a nucleic acid sequence having the nucleic acid sequence of any one of SEQ ID NOs: 1-159, 264-267, or 278-335.

[0175] In some embodiments, the translation enhancer element can be TBR16, 12S, TRAM1, or GPX4.

[0176] The translation enhancer element can be a 5’ UTR or a 3’ UTR. In some embodiments, the 5’ UTR or 3’ UTR is a human translation enhancer. In some embodiments, the 5’ UTR or 3’ UTR comprises any one of the 5’ UTRs or 3’ UTRs described in Table 9 or a portion thereof.

[0177] A translation enhancer element can have between 20 and 750 ribonucleotides (e.g., between 20 and 700, between 20 and 650, between 20 and 600, between 20 and 550, between 20 and 500, between 20 and 450, between 20 and 400, between 20 and 350, between 20 and 300, between 20 and 250, between 20 and 200, between 20 and 150, between 20 and 100, between 20 and 50, between 50 and 100, between 50 and 750, between 100 and 750, between 150 and 750, between 200 and 750, between 250 and 750, between 300 and 750, between 350 and 750, between 400 and 750, between 450 and 750, between 500 and 750, between 550 and 750, between 600 and 750, between 650 and 750, and between 700 and 750 ribonucleotides). For example, a translation enhancer can be between 100 and 500 ribonucleotides in length (e.g., between 100 and 450, between 100 and 400, between 100 and 350, between 100 and 300, between 100 and 250, between 100 and 200, between 100 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 350 and 500, between 400 and 500, or between 450 and 500 ribonucleotides).

[0178] Table 2. BTE sequences

[0179]

[0180]

[0181]

[0182]

[0183] Table 3. TED sequences

[0184]

[0185] Table 4. PTE sequences

[0186]

[0187]

[0188] Table 5. ISS sequences

[0189]

[0190] Table 6. YSS sequences

[0191]

[0192]

[0193] Table 7. TSS sequences

[0194]

[0195] Table 8. Additional translational enhancer elements

[0196]

[0197]

[0198]

[0199]

[0200]

[0201]

[0202]

[0203] An expression enhancing element can include a translational enhancer fused to a spacer element. The spacer element can be conjugated to the 5’ end of the translational enhancer. In some embodiments, the spacer element can be conjugated to the 3’ end of the translational enhancer.

[0204] Stability elements

[0205] A polyribonucleotide described herein can include a first expression enhancing element, wherein the first expression enhancing element can include a stability element. A second expression enhancing element can include a stability element. A second spacer element can include an expression enhancing element. One or more of the expression enhancing elements can be a stability element. In some embodiments, the stability element is a translational enhancer. In some embodiments, the stability element is a spacer element.

[0206] The stability element can be a 5' UTR or a 3' UTR. In some embodiments, the 5' UTR or 3' UTR is a human UTR. In some embodiments, the 5' UTR or 3' UTR comprises any of the 5' UTRs or 3' UTRs described in Table 9 below, or a portion thereof. The 5' UTR or 3' UTR can be from a gene encoding TRAM1, TMED2, VAMP3, CRIP, AP2A2, PSMD5, GPX4, or PRKAB1. The 5' UTR or 3' UTR can be a 5' UTR or 3' UTR from human beta actin, DDB2, TP53I3, Fc IgG, LSP1, AES, DRB4, or mitochondrially encoded 12S rRNA.

[0207] The stability element can comprise between 50 and 2000 ribonucleotides (e.g., between 50 and 1500, between 50 and 1000, between 50 and 500, between 50 and 100, between 100 and 2000, between 500 and 2000, between 1000 and 2000, or between 1500 and 2000). The stability element can comprise between 20 and 750 ribonucleotides (e.g., between 20 and 700, between 20 and 650, between 20 and 600, between 20 and 550, between 20 and 500, between 20 and 450, between 20 and 400, between 20 and 350, between 20 and 300, between 20 and 250, between 20 and 200, between 20 and 150, between 20 and 100, between 20 and 50, between 50 and 100, between 50 and 750, between 100 and 750, between 150 and 750, between 200 and 750, between 250 and 750, between 300 and 750, between 350 and 750, between 400 and 750, between 450 and 750, between 500 and 750, between 550 and 750, between 600 and 750, between 650 and 750, and between 700 and 750 ribonucleotides). For example, the stability element can be between 100 and 500 ribonucleotides in length (e.g., between 100 and 450, between 100 and 400, between 100 and 350, between 100 and 300, between 100 and 250, between 100 and 200, between 100 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 350 and 500, between 400 and 500, or between 450 and 500 ribonucleotides).

[0208] The expression-enhancing element can include a stability element fused to a spacer element. The spacer element can be conjugated to the 5' end of the stability element. In some embodiments, the spacer element that does not encode the expression-enhancing element can be conjugated to the 3' end of the stability element.

[0209] The stability element can be any known stability element. In some embodiments, the stability element has a nucleic acid sequence having at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in Table 9. In some embodiments, the stability element has a nucleic acid sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in Table 9. In some embodiments, the stability element has a nucleic acid sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in Table 9. In some embodiments, the stability element has a nucleic acid sequence of any one of the sequences described in Table 9.

[0210] Table 9. Stability element sequences

[0211]

[0212]

[0213]

[0214]

[0215]

[0216] Untranslated region

[0217] In some embodiments, the circular or linear polyribonucleotide comprises an untranslated region (UTR). In some embodiments, the stability element can comprise a UTR. In some embodiments, the translation enhancer can comprise a UTR. In some embodiments, the UTR is a 3’ UTR. In some embodiments, the UTR is a 5’ UTR. A UTR of a genomic region comprising a gene can be transcribed but not translated. In some embodiments, a UTR can be included upstream of the translation initiation sequence of an expression sequence described herein. In some embodiments, a UTR can be included downstream of an expression sequence described herein. In some cases, one UTR of a first expression sequence is the same or contiguous or overlapping with another UTR of a second expression sequence. In some embodiments, the intron is a human intron. In some embodiments, the intron is a full-length human intron, for example ZKSCAN1.

[0218] Exemplary untranslated regions are described in International Patent Publication No. WO 2019 / 118919, paragraphs

[0197] -

[201] , which is hereby incorporated by reference in its entirety.

[0219] In some embodiments, the circular polyribonucleotide comprises a polyA sequence. Exemplary polyA sequences are described in International Patent Publication No. WO 2019 / 118919, paragraphs

[0202] -

[0205] , which is hereby incorporated by reference in its entirety. In some embodiments, the circular polyribonucleotide lacks a polyA sequence.

[0220] In some embodiments, the circular or linear polyribonucleotide comprises a UTR in which one or more stretches of adenosine and uridine are embedded. These AU-rich signatures can increase the rate of translation of the expression product.

[0221] The introduction, removal, or modification of UTR AU-rich elements (AREs) can be used to modulate the stability or immunogenicity (e.g., the level of one or more markers of an immune or inflammatory response) of a circular or linear polyribonucleotide. In engineering a particular circular polyribonucleotide, one or more copies of an ARE can be introduced into the circular polyribonucleotide, and the copy of the ARE can modulate translation and / or production of the expression product. Likewise, an ARE can be identified and removed or engineered into a circular polyribonucleotide to modulate intracellular stability, thereby affecting translation and production of the resulting protein.

[0222] It will be appreciated that any UTR from any gene can be incorporated into the respective flanking region of a circular polyribonucleotide.

[0223] In some embodiments, the circular polyribonucleotide lacks a 5'-UTR and is capable of expressing a protein from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a 3'-UTR and is capable of expressing a protein from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a polyA sequence and is capable of expressing a protein from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a termination element and is capable of expressing a protein from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks an internal ribosome entry site and is capable of expressing a protein from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a cap and is capable of expressing a protein from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide lacks a 5'-UTR, a 3'-UTR, and an IRES and is capable of expressing a protein from its one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide comprises one or more of the following sequences: a sequence encoding one or more miRNAs, a sequence encoding one or more replication proteins, a sequence encoding an exogenous gene, a sequence encoding an immunogen, a regulatory element (e.g., a translational modulator, e.g., a translational enhancer or suppressor), a translational initiation sequence, one or more regulatory nucleic acids targeting an endogenous gene (e.g., an siRNA, an IncRNA, an shRNA), and a sequence encoding an immunogen.

[0224] In some embodiments, the circular or linear polyribonucleotide lacks a 5'-UTR. In some embodiments, the circular polyribonucleotide lacks a 3'-UTR. In some embodiments, the circular polyribonucleotide lacks a polyA sequence. In some embodiments, the circular or linear polyribonucleotide lacks a termination element. In some embodiments, the circular or linear polyribonucleotide lacks an internal ribosome entry site. In some embodiments, the circular or linear polyribonucleotide lacks susceptibility to degradation by an exonuclease. In some embodiments, the fact that the circular polyribonucleotide lacks susceptibility to degradation can mean that the circular polyribonucleotide is not degraded by an exonuclease, or is degraded to a limited extent in the presence of an exonuclease only, e.g., comparable or similar to that in the absence of an exonuclease. In some embodiments, the circular polyribonucleotide is not degraded by an exonuclease. In some embodiments, the circular polyribonucleotide is reduced in degradation when exposed to an exonuclease. In some embodiments, the circular polyribonucleotide lacks binding to a cap-binding protein. In some embodiments, the circular polyribonucleotide lacks a 5' cap.

[0225] Spacer element

[0226] In some embodiments, the polyribonucleotide comprises one or more spacer elements. For example, the first expression enhancing element or the second expression enhancing element can comprise a spacer element fused to a translational enhancer or a spacer element fused to a stability element. In some embodiments, the spacer can be fused to the 5' end of the translational enhancer or stability element. In some embodiments, the spacer can be fused to the 3' end of the translational enhancer or stability element. In some embodiments, the spacer element is a translational enhancer. Not all spacers are translational enhancers. In some embodiments, the spacer element is a stability element. Not all spacers are stability elements. A spacer element refers to any contiguous nucleotide sequence (e.g., a contiguous nucleotide sequence of one or more nucleotides) that provides distance or flexibility between two adjacent regions of polynucleotides. A spacer element can be present between any of the nucleic acid elements described herein. A spacer element can also be present within a nucleic acid element described herein. A circular polyribonucleotide can comprise a first post-circularization element; a first spacer element of at least 100 ribonucleotides in length; a polyribonucleotide cargo encoding an immunogen; a second spacer element; and a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction. A circular polyribonucleotide can comprise a first post-circularization element; a first spacer element; a polyribonucleotide cargo encoding an immunogen; a second spacer element of at least 100 ribonucleotides in length; and a second post-circularization element; and wherein the first post-circularization element and the second post-circularization element together form a circularization junction.

[0227] In some embodiments, the spacer element is at least 100 ribonucleotides in length. The spacer element can be between 100 and 500 ribonucleotides in length (e.g., between 100 and 400, between 100 and 300, between 100 and 200, between 200 and 500, between 300 and 500, between 400 and 500, between 200 and 400, or between 200 and 300). For example, the spacer element, which does not comprise an expression enhancing element, can be between 120 and 500 ribonucleotides in length (e.g., between 120 and 400, between 120 and 300, between 120 and 200, between 120 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 400 and 500, or between 350 and 500). In some embodiments, the spacer element comprises between 110 and 500 ribonucleotides (e.g., between 110 and 400, between 110 and 300, between 110 and 200, between 110 and 150, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 400 and 500, or between 350 and 500). In some embodiments, the spacer element comprises between 100 and 300 ribonucleotides (e.g., between 100 and 280, between 100 and 260, between 100 and 240, between 100 and 220, between 100 and 200, between 100 and 180, between 100 and 160, between 100 and 140, between 100 and 120, between 110 and 300, between 120 and 300, between 140 and 300, between 160 and 300, between 180 and 300, between 200 and 300, between 220 and 300, between 240 and 300, between 260 and 300, or between 280 and 300). In some embodiments, the spacer element is between 200 and 500 ribonucleotides in length (e.g., between 200 and 450, between 200 and 400, between 200 and 350, between 200 and 300, between 200 and 250, between 250 and 500, between 300 and 500, between 350 and 500, between 400 and 500, between 450 and 500, between 300 and 500, or between 300 and 400). In some embodiments, the spacer element has at least 50 ribonucleotides.For example, the spacer element can have between 50 and 500 ribonucleotides (e.g., between 50 and 100, between 50 and 150, between 50 and 200, between 50 and 250, between 50 and 300, between 50 and 350, between 50 and 400, between 50 and 450, between 100 and 500, between 150 and 500, between 200 and 500, between 250 and 500, between 300 and 500, between 350 and 500, between 400 and 500, and between 450 and 500).

[0228] In some embodiments, the spacer element is about 50 (e.g., 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55) ribonucleotides in length. In some embodiments, the spacer element is about 80 (e.g., 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, or 88) ribonucleotides in length. In some embodiments, the spacer element is about 100 (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110) ribonucleotides in length. In some embodiments, the spacer element is about 120 (e.g., 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, or 132) ribonucleotides in length. In some embodiments, the spacer element is about 150 (e.g., 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, or 165) ribonucleotides in length. In some embodiments, the spacer element is about 200 (e.g., 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, or 220) ribonucleotides in length.

[0229] In some embodiments, the polynucleotide comprises a first spacer element and a second spacer element, wherein the first and second spacers are the same length. In some embodiments, the first spacer element and the second spacer element are approximately the same length.

[0230] In some embodiments, the polynucleotide comprises a first spacer element and a second spacer element, wherein the first spacer element and the second spacer element differ in length. In some embodiments, the difference between the length of the first spacer element and the length of the second region is between 0 and 100 (e.g., between 0 and 95, between 0 and 90, between 0 and 85, between 0 and 80, between 0 and 75, between 0 and 70, between 0 and 65, between 0 and 60, between 0 and 55, between 0 and 50, between 0 and 45, between 0 and 40, between 0 and 35, between 0 and 30, between 0 and 25, between 0 and 20, between 0 and 15, between 0 and 10, between 0 and 5, between 5 and 100, between 10 and 100, between 15 and 100, between 20 and 100, between 25 and 100, between 30 and 100, between 35 and 100, between 40 and 100, between 45 and 100, between 50 and 100, between 55 and 100, between 60 and 100, between 65 and 100, between 70 and 100, between 75 and 100, between 80 and 100, between 85 and 100, between 90 and 100, or between 95 and 100) nucleotides. In some embodiments, the difference between the length of the first spacer element and the length of the second spacer element is between 0 and 50 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides. In some embodiments, the first spacer is about 50 (e.g., 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55) ribonucleotides in length and the second spacer is about 120 (e.g., 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, or 132) ribonucleotides in length. In some embodiments, the first spacer is about 120 (e.g., 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, or 132) ribonucleotides in length and the second spacer is about 50 (e.g., 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55) ribonucleotides in length.

[0231] In some embodiments, the spacer element can be a poly-A based spacer or a poly-A based spacer element. In some embodiments, the first spacer is a poly-A based spacer or a poly-A based spacer element. In some embodiments, the second spacer is a poly-A based spacer or a poly-A based spacer element. In some embodiments, the first spacer and the second spacer can be a poly-A based spacer or a poly-A based spacer element. A poly-A based spacer or a poly-A based spacer element is equivalent to a poly-A region (e.g., a poly-AC region, a poly-AU region, a poly-AG region, or a poly-AT region), as described herein.

[0232] The first spacer element can consist of a poly-A region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine residues. The first spacer element can consist of a poly-AC region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or cytosine residues. The adenosine and cytosine residues can be present in any ratio to one another. In some embodiments, the first spacer element can consist of a poly-AU region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or uridine residues. In some embodiments, the first spacer element can consist of a poly-AG region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or guanosine residues. The adenosine and guanosine residues can be present in any ratio to one another. In some embodiments, the first spacer element can consist of a poly-AT region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or thymidine residues. The adenosine and thymidine residues can be present in any ratio to one another. In some embodiments, the first spacer element comprises a poly-AT region, wherein the poly-AT region comprises between 100 and 150 ribonucleotides (e.g., 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 ribonucleotides).

[0233] The second spacer element can consist of a poly-A region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine residues. The second spacer element can consist of a poly-AC region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or cytosine residues. In some embodiments, the second spacer element can consist of a poly-AU region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or uridine residues. The adenosine and uridine residues can be present in any ratio to one another. In some embodiments, the second spacer element can consist of a poly-AG region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or guanosine residues. The adenosine and guanosine residues can be present in any ratio to one another. In some embodiments, the first spacer element can consist of a poly-AT region comprising between 80% and 100% (e.g., 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) adenosine or thymidine residues. In some embodiments, the second spacer element comprises a poly-AT region, wherein the poly-AT region comprises between 100 and 150 ribonucleotides (e.g., 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 ribonucleotides). The adenosine and thymidine residues can be present in any ratio to one another.

[0234] In some embodiments, the spacer element sequence can be a poly-A region (e.g., poly-A, poly-AT, poly-AU, poly-AC, or poly-AG) or a random sequence. In some embodiments, a spacer element can be referred to based on a combination of nucleotide content and length. For example, an AU120 spacer element can consist of a poly-AU region comprising between 80% and 100% adenosine or uridine residues and having a length of 120 nucleotides.

[0235] In some embodiments, the spacer element has a nucleic acid sequence having at least 85% (e.g., at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in Table 10. In some embodiments, the spacer element has a nucleic acid sequence having at least 90% (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in Table 10. In some embodiments, the spacer element has a nucleic acid sequence having at least 95% (e.g., at least 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to any one of the sequences described in Table 10. In some embodiments, the spacer element has a nucleic acid sequence of any one of the sequences described in Table 10.

[0236] Table 10. Spacer element sequences

[0237]

[0238] Exemplary spacer element sequences are described in paragraphs

[0293] -

[0302] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0239] Internal ribosome entry site

[0240] In some embodiments, the circular or linear polyribonucleotides described herein comprise one or more internal ribosome entry site (IRES) elements. In some embodiments, the IRES is operably linked to one or more expression sequences (e.g., each IRES is operably linked to one or more expression sequences, wherein each expression sequence optionally encodes an immunogen). In embodiments, the IRES is positioned between a heterologous promoter and the 5’ end of a coding sequence.

[0241] Suitable IRES elements for inclusion in the polyribonucleotides include RNA sequences capable of engaging a eukaryotic ribosome. In some embodiments, the IRES element is at least about 5 nt, at least about 8 nt, at least about 9 nt, at least about 10 nt, at least about 15 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 40 nt, at least about 50 nt, at least about 100 nt, at least about 200 nt, at least about 250 nt, at least about 350 nt, or at least about 500 nt.

[0242] In some embodiments, the IRES element is from DNA of an organism including, but not limited to, viruses, mammals, and fruit flies. Such viral DNA can be from, but is not limited to, small RNA virus complementary DNA (cDNA), encephalomyocarditis virus (EMCV) cDNA, and poliovirus cDNA. In one embodiment, the IRES element is from the Antennapedia gene from Drosophila melanogaster.

[0243] In some embodiments, the IRES sequence is an IRES sequence of a Taura syndrome virus, a Triatoma virus, a Theiler's encephalomyelitis virus, a Simian virus 40, a Solenopsis invicta virus 1, a Rhopalosiphum padi virus, a Reticuloendotheliosis virus, a Human poliovirus 1, a Plautia stall intestine virus, a Kashmir bee virus, a Human rhinovirus 2 (HRV-2), a Homalodisca coagulata virus-1, a Human immunodeficiency virus type 1, a Homalodisca coagulata virus-1, a Himetobi P virus, a Hepatitis C virus, a Hepatitis A virus, a Hepatitis GB virus, a Foot-and-mouth disease virus, a Human enterovirus 71, a Equine rhinitis virus, a Ectropis obliqua calicivirus, a Encephalomyocarditis virus (EMCV), a Drosophila C virus, a Crucifer tobamo virus, a Cricket paralysis virus, a Bovine viral diarrhea virus 1, a Black queen cell virus, a Aphid deadly paralysis virus, a Avian encephalomyelitis virus (AEV), a Acute bee paralysis virus, a Hibiscus chlorotic ringspot virus, a Classical swine fever virus, a Human FGF2, a Human SFTPA1, a Human AML1 / RUNX1, a Drosophila antennapedia, a Human AQP4, a Human AT1R, a Human BAG-l, a Human BCL2, a Human BiP, a Human c-IAPl, a Human c-myc, a Human eIF4G, a Mouse NDST4L, a Human LEF1, a Mouse HIF1 alpha, a Human n.myc, a Mouse Gtx, a Human p27kipl, a Human PDGF2 / c-sis, a Human p53, a Human Pim-l, a Mouse Rbm3, a Drosophila reaper, a Canine Scamper, a Drosophila Ubx, a Human UNR, a Mouse UtrA, a Human VEGF-A, a Human XIAP, a Salivirus, a Cosavirus, a Parechovirus, a Drosophila bare, a S. cerevisiae TFIID, a S. cerevisiae YAP1, a Human c-src, a Human FGF-l, a Simian small RNA virus, a Turnip crinkle virus, a Aichi virus, a Crohivirus, an Echo virus 11, an eIF4G aptamer, a Coxsackievirus B3 (CVB3), or a Coxsackievirus A (CVB1 / 2).In yet another embodiment, the IRES is an IRES sequence of Coxsackievirus B3 (CVB3). In a further embodiment, the IRES is an IRES sequence of Encephalomyocarditis virus. In a further embodiment, the IRES is an IRES sequence of Theiler encephalomyelitis virus.

[0244] In some embodiments, the IRES sequence has a modified sequence compared to a wild-type IRES sequence. In some embodiments, when the last nucleotide of the wild-type IRES is not a cytosine nucleic acid residue, the last nucleotide of the wild-type IRES sequence is modified so that it is a cytosine residue. For example, the IRES sequence can be a CVB3 IRES sequence in which the terminal adenosine residue is modified to a cytosine residue. In some embodiments, the modified CVB3 IRES can have the nucleic acid sequence of:

[0245] UUAAAACAGCCUGUGGGUUGAUCCCACCCACAGGCCCAUUGGGCGCUAGCACUCUGGUAUCACGGUACCUUUGUGCGCCUGUUUUAUACCCCCUCCCCCAACUGUAACUUAGAAGUAACACACACCGAUCAACAGUCAGCGUGGCACACCAGCCACGUUUUGAUCAAGCACUUCUGUUACCCCGGACUGAGUAUCAAUAGACUGCUCACGCGGUUGAAGGAGAAAGCGUUCGUUAUCCGGCCAACUACUUCGAAAAACCUAGUAACACCGUGGAAGUUGCAGAGUGUUUCGCUCAGCACUACCCCAGUGUAGAUCAGGUCGAUGAGUCACCGCAUUCCCCACGGGCGACCGUGGCGGUGGCUGCGUUGGCGGCCUGCCCAUGGGGAAACCCAUGGGACGCUCUAAUACAGACAUGGUGCGAAGAGUCUAUUGAGCUAGUUGGUAGUCCUCCGGCCCCUGAAUGCGGCUAAUCCUAACUGCGGAGCACACACCCUCAAGCCAGAGGGCAGUGUGUCGUAACGGGCAACUCUGCAGCGGAACCGACUACUUUGGGUGUCCGUGUUUCAUUUUAUUCCUAUACUGGCUGCUUAUGGUGACAAUUGAGAGAUCGUUACCAUAUAGCUAUUGGAUUGGCCAUCCGGUGACUAAUAGAGCUAUUAUAUAUCCCUUUGUUGGGUUUAUACCACUUAGCUUGAAAGAGGUUAAAACAUUACAAUUCAUUGUUAAGUUGAAUACAGCAAC (SEQ ID NO: 184)

[0246] In some embodiments, the IRES sequence is an enterovirus 71 (EV71) IRES. In some embodiments, the terminal guanosine residue of the EV71 IRES sequence is modified to a cytosine residue. In some embodiments, the modified EV71 IRES can have the following nucleic acid sequence:

[0247] UUAAAACAGCUGUGGGUUGUCACCCACCCACAGGGUCCACUGGGCGCUAGUACACUGGUAUCUCGGUACCUUUGUACGCCUGUUUUAUACCCCCUCCCUGAUUUGCAACUUAGAAGCAACGCAAACCAGAUCAAUAGUAGGUGUGACAUACCAGUCGCAUCUUGAUCAAGCACUUCUGUAUCCCCGGACCGAGUAUCAAUAGACUGUGCACACGGUUGAAGGAGAAAACGUCCGUUACCCGGCUAACUACUUCGAGAAGCCUAGUAACGCCAUUGAAGUUGCAGAGUGUUUCGCUCAGCACUCCCCCCGUGUAGAUCAGGUCGAUGAGUCACCGCAUUCCCCACGGGCGACCGUGGCGGUGGCUGCGUUGGCGGCCUGCCUAUGGGGUAACCCAUAGGACGCUCUAAUACGGACAUGGCGUGAAGAGUCUAUUGAGCUAGUUAGUAGUCCUCCGGCCCCUGAAUGCGGCUAAUCCUAACUGCGGAGCACAUACCCUUAAUCCAAAGGGCAGUGUGUCGUAACGGGCAACUCUGCAGCGGAACCGACUACUUUGGGUGUCCGUGUUUCUUUUUAUUCUUGUAUUGGCUGCUUAUGGUGACAAUUAAAGAAUUGUUACCAUAUAGCUAUUGGAUUGGCCAUCCAGUGUCAAACAGAGCUAUUGUAUAUCUCUUUGUUGGAUUCACACCUCUCACUCUUGAAACGUUACACACCCUCAAUUACAUUAUACUGCUGAACACGAAGCGGCCACC (SEQ ID NO: 185)

[0248] In some embodiments, the IRES sequence is a synthetic IRES. A “synthetic IRES” is an IRES that is modified relative to a wild-type IRES to modulate its structure and / or activity. For example, in some embodiments, an IRES modified to incorporate an aptamer sequence is a synthetic IRES. In some embodiments, the polyribonucleotide comprises at least one IRES flanking at least one (e.g., 2, 3, 4, 5, or more) expression sequence. In some embodiments, the IRES flanks both sides of at least one (e.g., 2, 3, 4, 5, or more) expression sequence. In some embodiments, the polyribonucleotide comprises one or more IRES sequences on one or both sides of each expression sequence, resulting in the spacing of the resulting one or more peptides and or one or more polypeptides. For example, the polyribonucleotides described herein can comprise a first IRES operably linked to a first expression sequence and a second IRES operably linked to a second expression sequence.

[0249] In some embodiments, the polyribonucleotides described herein comprise an IRES (e.g., an IRES operably linked to a coding region). For example, the polyribonucleotides can comprise any IRES as described in: Chen et al. Nature Biotechnology 41:262-272, 2023, Chen et al. Mol. Cell 81(20):4300-4318, 2021; Jopling et al. Oncogene 20:2664-2670, 2001; Baranick et al. PNAS 105(12):4733-4738, 2008; Lang et al. Molecular Biology of the Cell 13(5):1792-1801, 2002; Dorokhov et al. PNAS 99(8):5301-5306, 2002; Wang et al. Nucleic Acids Research 33(7):2248-2258, 2005; Petz et al. Nucleic Acids Research 35(8):2473-2482, 2007, Chen et al. Science 268:415-417, 1995; Fan et al. Nature Communication 13(1):3751-3765, 2022, International Publication No. WO 2021 / 263124, and International Publication No. WO 2022 / 271965, each of which is hereby incorporated by reference in its entirety.

[0250] signal sequence

[0251] In some embodiments, an immunogen expressed by a circular or linear polyribonucleotide disclosed herein comprises a secreted immunogen, e.g., an immunogen that naturally comprises a signal sequence, or an immunogen that does not normally encode a signal sequence but is modified to contain a signal sequence. In some embodiments, one or more immunogens comprise a secretion signal. For example, the secretion signal can be a naturally encoded secretion signal of the secreted immunogen. In another example, the secretion signal can be a modified secretion signal of the secreted immunogen. In other embodiments, one or more immunogens do not comprise a secretion signal.

[0252] In some embodiments, the polyribonucleotide encodes multiple copies (e.g., one, two, three, four, five, six, seven, eight, nine, ten, or more) of the same immunogen. In some embodiments, at least one copy of the polypeptide (e.g., immunogen) comprises a signal sequence, and at least one copy of the polypeptide does not comprise a signal sequence. In some embodiments, the circular polyribonucleotide encodes a plurality of polypeptides (e.g., immunogens), wherein at least one of the plurality of polypeptides comprises a signal sequence, and at least one copy of the plurality of polypeptides does not comprise a signal sequence.

[0253] In some embodiments, the signal sequence is a wild-type signal sequence that is present at the N-terminus of the corresponding wild-type polypeptide (e.g., immunogen), e.g., when endogenously expressed. In some embodiments, the signal sequence is heterologous to the polypeptide (e.g., immunogen), e.g., is not present when the wild-type polypeptide is endogenously expressed. The polynucleotide sequence encoding the polypeptide can be modified to remove the nucleotide sequence encoding the wild-type signal sequence and / or to add a sequence encoding a heterologous signal sequence.

[0254] The circular polyribonucleotide can further comprise one or more adjuvants, each with or without a signal sequence. In some embodiments, the circular polyribonucleotide comprises an adjuvant with or without a signal sequence. In some embodiments, the circular polyribonucleotide encodes at least one adjuvant and at least one polypeptide. In some embodiments, at least one encoded adjuvant comprises a signal sequence and the at least one encoded polypeptide does not comprise a signal sequence. In some embodiments, at least one encoded adjuvant comprises a signal sequence and the at least one encoded polypeptide comprises a signal sequence. In some embodiments, at least one encoded adjuvant does not comprise a signal sequence and the at least one encoded polypeptide comprises a signal sequence. In some embodiments, neither the encoded adjuvant nor the encoded polypeptide comprises a signal sequence.

[0255] In some embodiments, the signal sequence is a wild-type signal sequence that is present at the N-terminus of the corresponding wild-type adjuvant, e.g., when endogenously expressed. In some embodiments, the signal sequence is heterologous to the adjuvant, e.g., is not present when the wild-type adjuvant is endogenously expressed. The polynucleotide sequence encoding the adjuvant can be modified to remove the nucleotide sequence encoding the wild-type signal sequence and / or to add a sequence encoding a heterologous signal sequence.

[0256] A polypeptide encoded by an expression sequence (e.g., an immunogen or adjuvant encoded by a polynucleotide) can comprise a signal sequence that directs the polypeptide to the secretory pathway. In some embodiments, the signal sequence can direct the polypeptide or adjuvant to reside in certain organelles (e.g., the endoplasmic reticulum, Golgi, or endosome). In some embodiments, the signal sequence directs the polypeptide or adjuvant to be secreted from the cell. For secretory proteins, the signal sequence can be post- secretionally cleaved, resulting in a mature protein. In other embodiments, the signal sequence can be embedded in the cell membrane or certain organelles, resulting in a transmembrane segment that anchors the protein to the cell membrane, endoplasmic reticulum, or Golgi. In certain embodiments, the signal sequence of a transmembrane protein is a short sequence at the N-terminus of the polypeptide. In other embodiments, a first transmembrane domain acts as a first signal sequence, targeting the protein to the membrane.

[0257] In some embodiments, the secretion signal is a human interleukin-2 (IL-2) secretion signal. In some embodiments, the IL-2 secretion signal has an amino acid sequence with at least 90% sequence identity to MYRMQLLSCIALSLALVTNS (SEQ ID NO: 186). In some embodiments, the IL-2 secretion signal has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 186. In some embodiments, the IL-2 secretion signal has an amino acid sequence with at least 99% sequence identity to SEQ ID NO: 186. In some embodiments, the IL-2 secretion signal has an amino acid sequence with 100% sequence identity to SEQ ID NO: 186.

[0258] In some embodiments, the secretion signal is a Gaussia luciferase secretion signal. In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence with at least 90% sequence identity to MGVKVLFALICIAVAEAK (SEQ ID NO: 187). In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence with at least 95% sequence identity to SEQ ID NO: 187. In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence with at least 99% sequence identity to SEQ ID NO: 187. In some embodiments, the Gaussia luciferase secretion signal has an amino acid sequence with 100% sequence identity to SEQ ID NO: 187.

[0259] In some embodiments, the secretion signal is an EPO (e.g., human EPO) secretion signal. In some embodiments, the EPO secretion signal has an amino acid sequence having at least 90% sequence identity to MGVHECPAWLWLLLSLLSLPLGLPVLGA (SEQ ID NO: 188). In some embodiments, the EPO secretion signal has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 188. In some embodiments, the EPO secretion signal has an amino acid sequence having 88. In some embodiments, the EPO secretion signal has an amino acid sequence having 100% sequence identity to SEQ ID NO: 188.

[0260] In some embodiments, the secretion signal is a wild-type SARS-CoV-2 secretion signal. In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence having at least 90% sequence identity to MFVFLVLLPLVSS (SEQ ID NO: 189). In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 189. In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 189. In some embodiments, the wild-type SARS-CoV-2 secretion signal has an amino acid sequence having 100% sequence identity to SEQ ID NO: 189.

[0261] In some embodiments, the polypeptide encoded by the polyribonucleotide comprises a secretion signal sequence, a transmembrane insertion signal sequence, or does not comprise a signal sequence.

[0262] Regulatory elements

[0263] In some embodiments, the polyribonucleotides described herein (e.g., the polyribonucleotide cargo of the polyribonucleotide encoding an immunogen) comprise one or more regulatory elements. In some embodiments, the polyribonucleotide comprises a regulatory element, e.g., a sequence that modifies expression of an expression sequence within the polyribonucleotide.

[0264] A regulatory element can comprise a sequence that is positioned adjacent to an expression sequence that encodes an expression product. The regulatory element can be operably linked to the adjacent sequence. The regulatory element can increase the amount of an expressed product compared to the amount of a product expressed in the absence of the regulatory element. The regulatory element can be used to increase expression of one or more polypeptides and / or adjuvants encoded by a polyribonucleotide. Likewise, the regulatory element can be used to decrease expression of one or more polypeptides encoded by a polyribonucleotide. In some embodiments, one regulatory element is used to increase expression of a polypeptide and another regulatory element is used to decrease expression of another polypeptide on the same polyribonucleotide. Additionally, one regulatory element can increase the amount of a product expressed from multiple expression sequences attached in tandem. Thus, one regulatory element can enhance expression of one or more expression sequences. Multiple regulatory elements can also be used, e.g., to differentially regulate expression of different expression sequences.

[0265] In some embodiments, the regulatory element is a translational regulator. A translational regulator can regulate translation of an expression sequence in a polyribonucleotide. The translational regulator can be a translational enhancer or a translational suppressor. In some embodiments, the polyribonucleotide comprises at least one translational regulator adjacent to at least one expression sequence. In some embodiments, the polyribonucleotide comprises a translational regulator adjacent to each expression sequence. In some embodiments, the translational regulator is present on one or both sides of each expression sequence, resulting in, e.g., a separation of the expression products of one or more peptides and or one or more polypeptides.

[0266] In some embodiments, the regulatory element is a microRNA (miRNA) or a miRNA binding site.

[0267] In some embodiments, a regulatory element as provided herein comprises a selective translation sequence. As used herein, the term “selective translation sequence” refers to a nucleic acid sequence that selectively initiates or activates translation of an expression sequence in a polyribonucleotide, e.g., certain riboswitch aptamer enzymes. The regulatory element can also comprise a selective degradation sequence. As used herein, the term “selective degradation sequence” refers to a nucleic acid sequence that initiates degradation of a polyribonucleotide or a polyribonucleotide expression product. In some embodiments, the regulatory element is a translational regulator. A translational regulator can regulate translation of an expression sequence in a polyribonucleotide. The translational regulator can be a translational enhancer or a translational suppressor. In some embodiments, a translation initiation sequence can act as a regulatory element.

[0268] In some embodiments, the polyribonucleotide produces stoichiometric ratios of expression products. Rolling circle translation produces expression products continuously in substantially equal ratios. In some embodiments, the polyribonucleotide has a stoichiometric translation efficiency such that expression products are produced in substantially equal ratios. In some embodiments, the polyribonucleotide has a stoichiometric translation efficiency of multiple expression products (e.g., products from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or more expression sequences). In some embodiments, the polyribonucleotide produces expression products in substantially different ratios. For example, the translation efficiency of multiple expression products can have a ratio of 1:10,000, 1:7000, 1:5000, 1:1000, 1:700, 1:500, 1:100, 1:50, 1:10, 1:5, 1:4, 1:3, or 1:2. In some embodiments, the ratio of multiple expression products can be modified using a regulatory element.

[0269] Other examples of regulatory elements are described in paragraphs

[0154] -

[0161] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0270] cleavage domain

[0271] The circular or linear polyribonucleotides of the present disclosure can comprise a cleavage domain (e.g., a stutter element or cleavage sequence).

[0272] As used herein, the term “stutter element” is a portion, such as a nucleotide sequence, that induces ribosome pausing during translation. In some embodiments, the stutter element is a non-conserved sequence of amino acids with a strong alpha helix propensity followed by the consensus sequence -D(V / I)ExNPGP (SEQ ID NO: 190), where x = any amino acid. In some embodiments, the stutter element can comprise a chemical moiety, such as a glycerol, a non-nucleic acid linking moiety, a chemical modification, a modified nucleic acid, or any combination thereof.

[0273] In some embodiments, the circular or linear polyribonucleotide comprises at least one interleave element adjacent to an expression sequence. In some embodiments, the circular or linear polyribonucleotide comprises an interleave element adjacent to each expression sequence. In some embodiments, the interleave element is present on one or both sides of each expression sequence, resulting in the spacing of expression products. In some embodiments, the interleave element is part of one or more expression sequences. In some embodiments, the circular or linear polyribonucleotide comprises one or more expression sequences, and each of the one or more expression sequences is spaced from a succeeding expression sequence by an interleave element on the circular or linear polyribonucleotide. In some embodiments, the interleave element prevents (a) two rounds of translation of a single expression sequence or (b) one or more rounds of translation of two or more expression sequences from generating a single polypeptide. In some embodiments, the interleave element is a sequence that is spaced from the one or more expression sequences. In some embodiments, the interleave element comprises a portion of an expression sequence of the one or more expression sequences.

[0274] Examples of interleave elements are described in paragraphs

[0172] -

[0175] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0275] To avoid production of a continuous expression product while maintaining rolling circle translation, a stutter element can be included to induce ribosome stalling during translation. In some embodiments, the stutter element is at the 3’ end of at least one of the one or more expression sequences. The stutter element can be configured to stall the ribosome during rolling circle translation of the circular or linear polyribonucleotide. The stutter element can include, but is not limited to, a 2A-like or CHYSEL (SEQ ID NO: 191) (cis-acting hydrolyzing enzyme element) sequence. In some embodiments, the stutter element encodes a sequence having a C-terminal consensus sequence of X1X2X3EX5NPGP, where X1 is absent or G or H, X2 is absent or D or G, X3 is D or V or I or S or M, and X5 is any amino acid (SEQ ID NO: 192). Some non-limiting examples of stutter elements include GDVESNPGP (SEQ ID NO: 193), GDIEENPGP (SEQ ID NO: 194), VEPNPGP (SEQ ID NO: 195), IETNPGP (SEQ ID NO: 196), GDIESNPGP (SEQ ID NO: 197), GDVELNPGP (SEQ ID NO: 198), GDIETNPGP (SEQ ID NO: 199), GDVENPGP (SEQ ID NO: 200), GDVEENPGP (SEQ ID NO: 201), GDVEQNPGP (SEQ ID NO: 202), IESNPGP (SEQ ID NO: 203), GDIELNPGP (SEQ ID NO: 204), HDIETNPGP (SEQ ID NO: 205), HDVETNPGP (SEQ ID NO: 206), HDVEMNPGP (SEQ ID NO: 207), GDMESNPGP (SEQ ID NO: 208), GDVETNPGP (SEQ ID NO: 209), GDIEQNPGP (SEQ ID NO: 210), and DSEFNPGP (SEQ ID NO: 211).

[0276] In some embodiments, the stutter element described herein cleaves the expression product, such as between the G and P of the consensus sequence described herein. As one non-limiting example, the circular or linear polyribonucleotide comprises at least one stutter element to cleave the expression product. In some embodiments, the circular or linear polyribonucleotide comprises a stutter element adjacent to at least one expression sequence. In some embodiments, the circular or linear polyribonucleotide comprises a stutter element after each expression sequence. In some embodiments, the circular or linear polyribonucleotide comprises a stutter element present on one or both sides of each expression sequence, resulting in one or more individual peptides and / or polypeptides translated from each expression sequence.

[0277] In some embodiments, the interleave element comprises one or more modified or unnatural nucleotides that induce ribosome pausing during translation. Unnatural nucleotides can include peptide nucleic acids (PNAs), morpholinos, and locked nucleic acids (LNAs), as well as glycol nucleic acids (GNAs) and threose nucleic acids (TNAs). Examples of such include differ from naturally occurring DNA or RNA by altering the molecular backbone. Exemplary modifications can include modifications to the sugar, the nucleobase, the internucleoside linkage (e.g., to the linking phosphate / diester bond / phosphodiester backbone), and any combination thereof that can induce ribosome pausing during translation. Some exemplary modifications provided herein are described elsewhere herein.

[0278] In some embodiments, the interleaving element is present in other forms within the cyclic or linear polynucleotide. For example, in some exemplary cyclic or linear polynucleotides, the interleaving element includes a terminating element of a first expressed sequence in the cyclic or linear polynucleotide and a nucleotide spacer sequence separating the terminating element from a first translation initiation sequence subsequently expressed by the first expressed sequence. In some instances, the first interleaving element of the first expressed sequence is upstream (5') of the first translation initiation sequence subsequently expressed by the first expressed sequence in the cyclic or linear polynucleotide. In some cases, the first expressed sequence and the subsequent expressed sequence are two separate expressed sequences in the cyclic or linear polynucleotide. The distance between the first interleaving element and the first translation initiation sequence allows for sequential translation of the first expressed sequence and its subsequent expressed sequence. In some embodiments, the first interleaving element includes a terminating element and separates the expression product of the first expressed sequence from the expression product of its subsequent expressed sequence, thereby producing discrete expression products. In some cases, a circular or linear polynucleotide containing a first interleaving element upstream of the first translation initiation sequence of a subsequent expression sequence is translated sequentially, while a corresponding circular or linear polynucleotide containing an interleaving element of the second expression sequence upstream of the second translation initiation sequence of a subsequent expression sequence is not translated sequentially. In some cases, only one expression sequence exists in the circular or linear polynucleotide, and the first expression sequence and its subsequent expression sequence are the same expression sequence. In some exemplary circular or linear polynucleotides, the interleaving element contains a first termination element of the first expression sequence in the circular or linear polynucleotide, and a nucleotide spacer sequence separating the termination element from the downstream translation initiation sequence. In some such instances, the first interleaving element in the circular or linear polynucleotide is upstream (5') of the first translation initiation sequence of the first expression sequence. In some cases, the distance between the first interleaving element and the first translation initiation sequence allows for sequential translation of the first expression sequence and any subsequent expression sequence. In some embodiments, the first interleaving element separates one round of expression product of the first expression sequence from the next round of expression product of the first expression sequence, thereby producing discrete expression products. In some cases, cyclic or linear polynucleotides containing the first interleaving element upstream of the first translation initiation sequence of the first expression sequence in a cyclic or linear polynucleotide are translated sequentially, while corresponding cyclic or linear polynucleotides containing the interleaving element upstream of the second translation initiation sequence of the corresponding cyclic or linear polynucleotide are not translated sequentially. In some cases, the distance between the second interleaving element and the second translation initiation sequence in the corresponding cyclic or linear polynucleotide is at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times the distance between the first interleaving element and the first translation initiation sequence in the cyclic or linear polynucleotide.In some cases, the distance between the first stalling element and the first translation initiation is at least 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 70 nt, 75 nt, or more. In some embodiments, the distance between the second stalling element and the second translation initiation is at least 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 70 nt, 75 nt, or more than the distance between the first stalling element and the first translation initiation. In some embodiments, the circular or linear polyribonucleotide comprises more than one expression sequence.

[0279] In some embodiments, the plurality of expression sequences encoded by the circular ribonucleotide can be separated by an IRES between each expression sequence. For example, the circular polyribonucleotide can comprise a first IRES operably linked to a first expression sequence and a second IRES operably linked to a second expression sequence. The IRES between all expression sequences can be the same IRES. The IRES between expression sequences can be different.

[0280] In some embodiments, the plurality of expression sequences can be separated by a 2A self-cleaving peptide. For example, the circular polyribonucleotide can encode an IRES operably linked to an open reading frame encoding a first expression sequence, a 2A, and a second expression sequence. In some embodiments, the 2A can have the sequence of GSGATNFSLLKQAGDVEENPGP (SEQ ID NO: 212).

[0281] In some embodiments, the plurality of expression sequences can be separated by a protease cleavage site (e.g., a furin cleavage site). For example, the circular polyribonucleotide can encode an IRES operably linked to an open reading frame encoding a first expression sequence, a protease cleavage site (e.g., a furin cleavage site), and a second expression sequence. In some embodiments, the furin cleavage site can have the sequence of GRLRR (SEQ ID NO: 213).

[0282] In some embodiments, the plurality of expression sequences can be separated by a 2A self-cleaving peptide and a protease cleavage site (e.g., a furin cleavage site). For example, the circular polyribonucleotide can encode an IRES operably linked to an open reading frame encoding a first expression sequence, a 2A, a protease cleavage site (e.g., a furin cleavage site), and a second expression sequence. The circular polyribonucleotide can also encode an IRES operably linked to an open reading frame encoding a first expression sequence, a protease cleavage site (e.g., a furin cleavage site), a 2A, and a second expression sequence. The 2A and furin cleavage site in tandem can be referred to as a furin-2A (which includes furin-2A or 2A-furin arranged in either direction).

[0283] Further, the plurality of expression sequences and / or adjuvants encoded by the circular ribonucleotide can be separated by both an IRES and a 2A sequence. For example, an IRES can be between one expression sequence and a second expression sequence, while a 2A peptide can be between the second expression sequence and a third expression sequence. The selection of a particular IRES or 2A self-cleaving peptide can be used to control the expression level of an expression sequence under the control of the IRES or 2A sequence. For example, expression on a polypeptide can be higher or lower depending on the IRES and / or 2A peptide selected.

[0284] In some embodiments, the circular or linear polyribonucleotide comprises at least one cleavage sequence. In some embodiments, the cleavage sequence is adjacent to an expression sequence. In some embodiments, the cleavage sequence is between two expression sequences. In some embodiments, the cleavage sequence is comprised within an expression sequence. In some embodiments, the circular or linear polyribonucleotide comprises between 2 and 10 cleavage sequences. In some embodiments, the circular or linear polyribonucleotide comprises between 2 and 5 cleavage sequences. In some embodiments, the plurality of cleavage sequences are between a plurality of expression sequences; for example, the circular or linear polyribonucleotide can comprise three expression sequences and two cleavage sequences, such that there is one cleavage sequence between each expression sequence. In some embodiments, the circular or linear polyribonucleotide comprises a cleavage sequence, such as in a sacrificial circRNA or a cleavable circRNA or a self-cleaving circRNA. In some embodiments, the circular or linear polyribonucleotide comprises two or more cleavage sequences, resulting in the separation of the circular or linear polyribonucleotide into a plurality of products, such as miRNAs, linear RNAs, smaller circular or linear polyribonucleotides, and the like.

[0285] In some embodiments, the cleavage sequence comprises a ribozyme RNA sequence. Ribozymes (from ribonucleases, also known as RNases or catalytic RNAs) are RNA molecules that catalyze chemical reactions. Many natural ribozymes catalyze the hydrolysis of one of their own phosphodiester bonds, or catalyze the hydrolysis of bonds in other RNAs, but natural ribozymes that catalyze the amino transferase activity of ribosomes have also been found. Catalytic RNAs can be “evolved” by in vitro methods. Similar to the riboswitch activity discussed above, ribozymes and their reaction products can regulate gene expression. In some embodiments, catalytic RNAs or ribozymes can be placed in larger non-coding RNAs, which allows the ribozymes to exist in many copies within a cell for the purpose of chemical transformation of large volume molecules. In some embodiments, aptamers and ribozymes can both be encoded in the same non-coding RNA.

[0286] In some embodiments, the cleavage sequence encodes a cleavable polypeptide linker. For example, the polyribonucleotide can encode two or more expression sequences encoded by a single open reading frame (ORF). For example, the two or more expression sequences can be encoded by a single open reading frame whose expression is controlled by an IRES. In some embodiments, the ORF further encodes a polypeptide linker, e.g., such that the expression product of the ORF encodes two or more expression sequences, each separated by a sequence encoding a polypeptide linker (e.g., a linker of 5-200, 5 to 100, 5 to 50, 5 to 20, 50 to 100, or 50 to 200 amino acids). The polypeptide linker can comprise a cleavage site, e.g., a cleavage site recognized and cleaved by a protease (e.g., an endogenous protease in a subject after administration of the polyribonucleotide to the subject). In such embodiments, the single expression product comprising the amino acid sequences of the two or more expression sequences is cleaved upon expression, thereby separating the two or more expression sequences upon expression. Exemplary protease cleavage sites are known to those of skill in the art, e.g., amino acid sequences that function as protease cleavage sites recognized by metalloproteases (e.g., matrix metalloproteases (MMPs), such as any one or more of MMPs 1-28), disintegrins and metalloproteases (ADAMs, such as any one or more of ADAMs 2, 7-12, 15, 17-23, 28-30, and 33), serine proteases, urokinase-type plasminogen activators, matriptases, cysteine proteases, aspartate proteases, or cathepsins. In some embodiments, the protease is MMP9 and / or MMP2. In some embodiments, the protease is matriptase.

[0287] In some embodiments, the circular or linear polyribonucleotides described herein are sacrificial circular or linear polyribonucleotides, cleavable circular or linear polyribonucleotides, or self-cleaving circular or linear polyribonucleotides. The circular or linear polyribonucleotides can deliver cellular components including, for example, RNA, IncRNA, lincRNA, miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, or shRNA. In some embodiments, the circular or linear polyribonucleotides comprise a miRNA separated by (i) a self-cleavable element; (ii) a cleavage recruitment site; (iii) a degradable linker; (iv) a chemical linker; and / or (v) a spacer element sequence. In some embodiments, the circRNA comprises a siRNA separated by (i) a self-cleavable element; (ii) a cleavage recruitment site (e.g., ADAR); (iii) a degradable linker (e.g., glycerol); (iv) a chemical linker; and / or (v) a spacer element sequence. Non-limiting examples of self-cleavable elements include hammerhead structures, splicing elements, hairpins, hepatitis delta virus (HDV), Varkud satellite (VS), and glmS ribozymes.

[0288] In some embodiments, the circular polyribonucleotide comprises at least one staggering element adjacent to an expression sequence. In some embodiments, the circular polyribonucleotide comprises a staggering element adjacent to each expression sequence. In some embodiments, the staggering element is present on one or both sides of each expression sequence, resulting in, for example, the separation of the expression products of one or more peptides and / or one or more polypeptides. In some embodiments, the staggering element is part of one or more expression sequences. In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, and each of the one or more expression sequences is separated from a succeeding expression sequence by a staggering element on the circular polyribonucleotide. In some embodiments, the staggering element prevents (a) two rounds of translation of a single expression sequence or (b) one or more rounds of translation of two or more expression sequences to generate a single polypeptide. In some embodiments, the staggering element is a sequence that is separated from the one or more expression sequences. In some embodiments, the staggering element comprises a portion of an expression sequence in the one or more expression sequences.

[0289] translation initiation sequence

[0290] In some embodiments, the circular or linear polyribonucleotide encodes an expression sequence and comprises a translation initiation sequence, e.g., a start codon. In some embodiments, the polyribonucleotide comprises a translation initiation sequence operably linked to the expression sequence. In some embodiments, the translation initiation sequence comprises a Kozak or Shine-Dalgarno sequence. In some embodiments, the translation initiation sequence comprises a Kozak sequence. In some embodiments, the circular or linear polyribonucleotide comprises a translation initiation sequence, e.g., a Kozak sequence, adjacent to the expression sequence. In some embodiments, the translation initiation sequence is a non-coding start codon. In some embodiments, the translation initiation sequence, e.g., a Kozak sequence, is present on one or both sides of each expression sequence, resulting in the spacing of expression products. In some embodiments, the circular or linear polyribonucleotide comprises at least one translation initiation sequence adjacent to the expression sequence. In some embodiments, the translation initiation sequence provides conformational flexibility to the circular or linear polyribonucleotide. In some embodiments, the translation initiation sequence is within a single-stranded region of the circular or linear polyribonucleotide. Additional examples of translation initiation sequences are described in International Patent Publication No. WO 2019 / 118919, paragraphs

[0163] -

[0165] , which is hereby incorporated by reference in its entirety.

[0291] The circular or linear polyribonucleotide can comprise more than one start codon, such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, or more than 60 start codons. Translation can initiate on the first start codon or can initiate downstream of the first start codon.

[0292] In some embodiments, the circular or linear polyribonucleotide can initiate at a codon that is not the first start codon (e.g., AUG). Translation of the circular or linear polyribonucleotide can initiate at an alternative translation initiation sequence, such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG. In some embodiments, translation begins at the alternative translation initiation sequence under selective conditions (e.g., stress-inducing conditions). As a non-limiting example, translation of the polyribonucleotide can begin at an alternative translation initiation sequence, such as ACG. As another non-limiting example, polyribonucleotide translation can begin at an alternative translation initiation sequence CTG / CUG. As another non-limiting example, polyribonucleotide translation can begin at an alternative translation initiation sequence GTG / GUG. As another non-limiting example, the polyribonucleotide can begin translation at a Repeat Associated Non-AUG (RAN) sequence, such as an alternative translation initiation sequence of a repeat RNA containing a short stretch (e.g., CGG, GGGGCC, CAG, CTG).

[0293] In some embodiments, translation is initiated by treating eukaryotic initiation factor 4A (eIF4A) with Rocaglates (repress translation by blocking 43S scanning, resulting in premature upstream translation initiation and reduced protein expression of transcripts carrying the RocA-eIF4A target sequence, see, e.g., nature.com / articles / nature17978).

[0294] Termination element

[0295] In some embodiments, the polyribonucleotides described herein (e.g., polyribonucleotide cargo of the polyribonucleotide encoding an immunogen) comprise at least one termination element. In some embodiments, the polyribonucleotide comprises a termination element operably linked to an expression sequence. In some embodiments, the polynucleotide lacks a termination element.

[0296] In some embodiments, the polyribonucleotide comprises one or more expression sequences, and each expression sequence can or can not have a termination element. In some embodiments, the polyribonucleotide comprises one or more expression sequences, and the expression sequences lack a termination element, such that the polyribonucleotide is translated continuously. The exclusion of a termination element can result in rolling circle translation or continuous expression of the expression product.

[0297] In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, and each expression sequence can or can not have a termination element. In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, and the expression sequences lack a termination element, such that the circular polyribonucleotide is translated continuously. The exclusion of termination elements can result in rolling circle translation or continuous expression of an expression product (e.g., a peptide or polypeptide) due to the lack of ribosome stalling or dropping off. In such embodiments, the rolling circle translation expresses a continuous expression product through each expression sequence. In some other embodiments, the termination element of an expression sequence can be part of an interlaced element. In some embodiments, one or more expression sequences in the circular polyribonucleotide comprise a termination element. However, rolling circle translation or expression of a subsequent (e.g., second, third, fourth, fifth, etc.) expression sequence in the circular polyribonucleotide occurs. In such cases, the expression product can drop off the ribosome when the ribosome encounters the termination element (e.g., stop codon) and terminates translation. In some embodiments, translation terminates while the ribosome, e.g., at least one subunit of the ribosome, remains in contact with the circular polyribonucleotide.

[0298] In some embodiments, the circular polyribonucleotide comprises a termination element at the end of one or more expression sequences. In some embodiments, one or more expression sequences comprise two or more consecutive termination elements. In such embodiments, translation terminates and rolling circle translation terminates. In some embodiments, the ribosome completely disengages from the circular polyribonucleotide. In some such embodiments, production of a subsequent (e.g., second, third, fourth, fifth, etc.) expression sequence in the circular polyribonucleotide can require the ribosome to reengage with the circular polyribonucleotide prior to initiating translation. Typically, termination elements include in-frame nucleotide triplets that signal termination of translation, such as UAA, UGA, UAG. In some embodiments, one or more termination elements in the circular polyribonucleotide are out-of-frame termination elements, such as, but not limited to, off-frame or -1 and +1 shifted reading frames that can terminate translation (e.g., cryptic termination). Off-frame termination elements include nucleotide triplets that occur in the second and third reading frames of an expression sequence, TAA, TAG, and TGA. Out-of-frame termination elements can be important to prevent mRNA misreading that is typically deleterious to a cell. In some embodiments, the termination element is a stop codon.

[0299] Additional examples of termination elements are described in paragraphs

[0169] -

[0170] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0300] Polyribonucleotide cargo

[0301] In some embodiments, the circular polyribonucleotide encodes a polyribonucleotide cargo. The polyribonucleotide cargo described herein comprises any sequence comprising at least one polyribonucleotide. In some embodiments, the polyribonucleotide cargo comprises an expression sequence, a non-coding sequence, or an expression sequence and a non-coding sequence. In some embodiments, the polyribonucleotide cargo comprises an expression sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo comprises an IRES operably linked to an expression sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo comprises an expression sequence encoding a polypeptide having a biological effect on a subject.

[0302] For example, the polyribonucleotide cargo can comprise at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides. In some embodiments, the polyribonucleotide cargo comprises 1-20,000 nucleotides, 1-10,000 nucleotides, 1-5,000 nucleotides, 100-20,000 nucleotides, 100-10,000 nucleotides, 100-5,000 nucleotides, 500-20,000 nucleotides, 500-10,000 nucleotides, 500-5,000 nucleotides, 1,000-20,000 nucleotides, 1,000-10,000 nucleotides, or 1,000-5,000 nucleotides.

[0303] In embodiments, the polyribonucleotide cargo comprises one or more expression (or coding) sequences, wherein each expression (or coding) sequence encodes a polypeptide. In embodiments, the polyribonucleotide cargo comprises one or more non-coding sequences. In embodiments, the polyribonucleotide cargo consists entirely of one or more non-coding sequences. In embodiments, the polyribonucleotide cargo comprises a combination of expression (or coding) and non-coding sequences.

[0304] In some embodiments, the GC content of the nucleic acid sequence encoding the polypeptide is at least 51% (e.g., at least 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, or 60%). In some embodiments, the GC content of the nucleic acid sequence encoding the polypeptide is at most 52%, 53%, 54%, 55%, 56%, 57%, 58%, or 59%, or 60%. In some embodiments, the GC content of the nucleic acid sequence encoding the polypeptide is between 51% and 60%, 52% and 60%, 53% and 60%, 54% and 60%, 55% and 60%, 52% and 58%, 53% and 58%.

[0305] In some embodiments, the uridine content (for RNA) or thymidine content (for DNA) of the nucleic acid sequence encoding the polypeptide is greater than 10% (e.g., greater than 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25%). In some embodiments, the uridine content (for RNA) or thymidine content (for DNA) of the nucleic acid sequence encoding the polypeptide is at most 30% (e.g., at most 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, or 20%). In some embodiments, the uridine content (for RNA) or thymidine content (for DNA) of the nucleic acid sequence encoding the polypeptide is between 20% and 28%, 21% and 26%, 10% and 24%, 15% and 24%, 20% and 24%, 21% and 24%, 22% and 24%, 23% and 24%, 10% and 23%, 15% and 23%, 20% and 23%, 21% and 23%, or 22% and 23%.

[0306] The GC content of the expression sequence encoding the polypeptide refers to the GC content of the expression sequence that encodes only the polypeptide, without other coding regions that encode peptides other than the polypeptide. Likewise, the uridine content or thymidine of the expression sequence encoding the polypeptide refers to the uridine content of the expression sequence that encodes only the polypeptide, without other coding regions that encode peptides other than the polypeptide. In some embodiments, the calculation of the GC content or uridine (or thymidine) content of the expression sequence encoding the polypeptide only considers the contiguous nucleic acid sequence starting from the first nucleotide of the start codon of the open reading frame encoding the polypeptide to the last nucleotide of the stop codon of the same open reading frame in the 5' to 3' direction. In other embodiments, the calculation of the GC content or uridine (or thymidine) content of the expression sequence encoding the polypeptide only considers the contiguous nucleic acid sequence starting from the first nucleotide of the codon encoding the N-terminal amino acid residue of the polypeptide to the last nucleotide of the codon encoding the C-terminal amino acid residue of the polypeptide in the 5' to 3' direction.

[0307] In some embodiments, the nucleic acid sequence encoding the polypeptide has a uridine content of greater than 20%. In some embodiments, the nucleic acid sequence encoding the polypeptide has a uridine content of greater than 10% (e.g., greater than 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, or 25%). In some embodiments, the nucleic acid sequence encoding the polypeptide has a uridine content of at most 30% (e.g., at most 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 21%, or 20%). In some embodiments, the nucleic acid sequence encoding the polypeptide has a uridine content of 20% to 28%, 21% to 26%, 10% to 24%, 15% to 24%, 20% to 24%, 21% to 24%, 22% to 24%, 23% to 24%, 10% to 23%, 15% to 23%, 20% to 23%, 21% to 23%, or 22% to 23%. In some embodiments, the nucleic acid sequence encoding the polypeptide has a uridine content of 20% to 28%.

[0308] In some embodiments, the polyribonucleotides prepared as described herein are used as effectors in therapy or agriculture. For example, a circular polyribonucleotide prepared by a method described herein (e.g., a cell-free method described herein) can be administered to a subject (e.g., in a pharmaceutical or agricultural composition). In another example, a circular polyribonucleotide prepared by a method described herein (e.g., a cell-free method described herein) can be delivered to a cell.

[0309] In some embodiments, the polyribonucleotides include any feature or any combination of features disclosed in International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0310] Polypeptide expression sequences

[0311] In some embodiments, the polyribonucleotides (e.g., the polyribonucleotide cargo of a circular polyribonucleotide) described herein comprise one or more expression (or encoding) sequences, wherein each expression sequence encodes a polypeptide. In some embodiments, the circular polyribonucleotide comprises two, three, four, five, six, seven, eight, nine, ten, or more expression (or encoding) sequences.

[0312] Each encoded polypeptide can be linear or branched. In various embodiments, the polypeptide is from about 5 to about 40,000 amino acids, from about 15 to about 35,000 amino acids, from about 20 to about 30,000 amino acids, from about 25 to about 25,000 amino acids, from about 50 to about 20,000 amino acids, from about 100 to about 15,000 amino acids, from about 200 to about 10,000 amino acids, from about 500 to about 5,000 amino acids, from about 1,000 to about 2,500 amino acids, or any range therein. In some embodiments, a polypeptide of less than about 40,000 amino acids, less than about 35,000 amino acids, less than about 30,000 amino acids, less than about 25,000 amino acids, less than about 20,000 amino acids, less than about 15,000 amino acids, less than about 10,000 amino acids, less than about 9,000 amino acids, less than about 8,000 amino acids, less than about 7,000 amino acids, less than about 6,000 amino acids, less than about 5,000 amino acids, less than about 4,000 amino acids, less than about 3,000 amino acids, less than about 2,500 amino acids, less than about 2,000 amino acids, less than about 1,500 amino acids, less than about 1,000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, less than about 300 amino acids, or less can be useful.

[0313] The polypeptides included herein can include naturally occurring polypeptides or non-naturally occurring polypeptides. In some embodiments, the polypeptide is or includes a functional fragment or variant of a reference polypeptide (e.g., an enzymatically active fragment or variant of an enzyme). For example, the polypeptide can be a functionally active variant of any of the polypeptides described herein, e.g., having at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to a sequence of a polypeptide described herein or a naturally occurring polypeptide over a specified region or the entire sequence. In some cases, the polypeptide can have at least 50% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or greater) identity to a protein of interest.

[0314] Some examples of polypeptides include, but are not limited to, fluorescent tags or markers, antigens, therapeutic polypeptides, or polypeptides for agricultural applications.

[0315] A therapeutic polypeptide can be a hormone, a neurotransmitter, a growth factor, an enzyme (e.g., an oxidoreductase, a metabolic enzyme, a mitochondrial enzyme, an oxygenase, a dehydrogenase, an ATP-independent enzyme, a lysosomal enzyme, a desaturase), a cytokine, an antigen-binding polypeptide (e.g., an antigen-binding antibody or antibody-like fragment such as a single-chain antibody, nanobody, or other polypeptide containing an Ig heavy or light chain), an Fc fusion protein, an anticoagulant, a blood factor, a bone morphogenic protein, an interferon, an interleukin, and a thrombolytic agent.

[0316] A polypeptide for agricultural applications can be a bacteriocin, a lysin, an antimicrobial polypeptide, an antifungal polypeptide, a nodule C-rich peptide, a bacterial cell regulatory peptide, a peptide toxin, an insecticidal polypeptide (e.g., an insecticidal polypeptide or a nematocidal polypeptide), an antigen-binding polypeptide (e.g., an antigen-binding antibody or antibody-like fragment such as a single-chain antibody, nanobody, or other polypeptide containing an Ig heavy or light chain), an enzyme (e.g., a nuclease, an amylase, a cellulase, a peptidase, a lipase, a chitinase), a peptide pheromone, and a transcription factor.

[0317] In some embodiments, the circular polyribonucleotide expresses a non-human protein.

[0318] In some embodiments, the circular polyribonucleotide expresses an antibody, e.g., an antibody fragment or a portion thereof. In some embodiments, the antibody expressed by the circular polyribonucleotide can be of any isotype, such as IgA, IgD, IgE, IgG, IgM. In some embodiments, the circular polyribonucleotide expresses a portion of an antibody, such as a light chain, a heavy chain, an Fc fragment, a CDR (complementarity determining region), an Fv fragment, or a Fab fragment, additional portions thereof. In some embodiments, the circular polyribonucleotide expresses one or more portions of an antibody. For example, the circular polyribonucleotide can comprise more than one expression (or coding) sequence, where each sequence expresses a portion of an antibody, and the sum of which can constitute the antibody. In some cases, the circular polyribonucleotide comprises one expression sequence encoding a heavy chain of an antibody and another expression sequence encoding a light chain of an antibody. In some cases, when the circular polyribonucleotide is expressed in a cell or cell-free environment, the light chain and the heavy chain can undergo appropriate modifications, folding, or other post-translational modifications to form a functional antibody.

[0319] In embodiments, the polypeptide comprises multiple polypeptides, e.g., multiple copies of one polypeptide sequence, or multiple different polypeptide sequences. In embodiments, the multiple polypeptides are connected by linker amino acids or spacer amino acids.

[0320] In embodiments, the polynucleotide cargo comprises a sequence encoding a signal peptide. Numerous signal peptide sequences have been described, for example, the Tat (dual arginine translocation) signal sequence is generally an N-terminal peptide sequence containing the consensus SRRxFLK “dual arginine” motif, which serves to translocate folded proteins containing such Tat signal peptides across lipid bilayers. See also, for example, the signal peptide database publicly available at www[dot]signalpeptide[dot]de. Signal peptides can also be used to direct proteins to specific organelles; see, for example, experimentally determined and computationally predicted signal peptides disclosed in the Spdb signal peptide database, publicly available at proline,bic.nus.edu.sg / spdb.

[0321] In embodiments, the polynucleotide cargo comprises a sequence encoding a cell-penetrating peptide (CPP). Hundreds of CPP sequences have been described; see, for example, the cell-penetrating peptide database CPPsite publicly available at crdd[dot]osdd[dot]net / raghava / cppsite / . An example of a commonly used CPP sequence is a polyarginine sequence, such as octa-arginine or nona-arginine, which can be fused to the C-terminus of a CGI peptide.

[0322] In embodiments, the polynucleotide cargo comprises a sequence encoding a self- assembling peptide; see, for example, Miki et al. (2021) Nature Communications, 21:3412, DOI: 10.1038 / s41467-021-23794-6.

[0323] In some embodiments, the expression (or coding) sequence comprises a poly-A sequence (e.g., at the 3’ end of the expression sequence). In some embodiments, the poly-A sequence is greater than 10 nucleotides in length. In one embodiment, the poly-A sequence is greater than 15 nucleotides in length (e.g., at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the poly-A sequence is designed according to the description of a poly-A sequence in

[0202] -

[0204] of International Patent Publication No. WO 2019 / 118919 Al, which is incorporated by reference herein in its entirety. In some embodiments, the expression sequence lacks a poly-A sequence (e.g., at the 3’ end of the expression sequence).

[0324] In some embodiments, the circular polyribonucleotide comprises a poly-A, lacks a poly-A, or has a modified poly-A to modulate one or more characteristics of the circular polyribonucleotide. In some embodiments, the circular polyribonucleotide lacking a poly-A or having a modified poly-A improves one or more functional characteristics, such as immunogenicity (e.g., levels of one or more markers of immune or inflammatory response), half-life, and / or expression efficiency.

[0325] Therapeutic polypeptides

[0326] In some embodiments, the circular polyribonucleotide described herein (e.g., the polyribonucleotide cargo of the circular polyribonucleotide) comprises at least one expression sequence encoding a therapeutic polypeptide. A therapeutic polypeptide is a polypeptide that provides some therapeutic benefit when administered to or expressed in a subject. Administration of or expression of a therapeutic polypeptide in a subject can be used to treat or prevent a disease, disorder, or condition, or a symptom thereof. In some embodiments, the circular polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten, or more therapeutic polypeptides.

[0327] In some embodiments, the circular polyribonucleotide comprises an expression sequence encoding a therapeutic protein. The protein can treat a disease in a subject in need thereof. In some embodiments, the therapeutic protein can compensate for a mutated, under-expressed, or missing protein in a subject in need thereof. In some embodiments, the therapeutic protein can target, interact with, or bind to a cell, tissue, or virus in a subject in need thereof.

[0328] The therapeutic polypeptide can be a polypeptide that can be secreted from a cell or localized to the cytoplasm, nucleus, or membrane compartment of a cell.

[0329] The therapeutic polypeptide can be a hormone, a neurotransmitter, a growth factor, an enzyme (e.g., an oxidoreductase, a metabolic enzyme, a mitochondrial enzyme, an oxygenase, a dehydrogenase, an ATP-independent enzyme, a lysosomal enzyme, a desaturase), a cytokine, a transcription factor, an antigen-binding polypeptide (e.g., an antigen-binding antibody or antibody-like fragment, such as a single-chain antibody, a nanobody, or other polypeptide containing an Ig heavy or light chain), an Fc fusion protein, an anticoagulant, a blood factor, a bone morphogenic protein, an interferon, an interleukin, a thrombolytic agent, an antigen (e.g., a tumor, viral, or bacterial antigen), a nuclease (e.g., an endonuclease, such as a Cas protein, e.g., Cas9), a membrane protein (e.g., a chimeric antigen receptor (CAR), a transmembrane receptor, a G protein-coupled receptor (GPCR), a receptor tyrosine kinase (RTK), an antigen receptor, an ion channel, or a membrane transport protein), a secreted protein, a gene-editing protein (e.g., a CRISPR-Cas, a TALEN, or a zinc finger), or a gene-writing protein (see, e.g., International Patent Publication No. WO 2020 / 047124, incorporated by reference herein in its entirety).

[0330] In some embodiments, the therapeutic polypeptide is an antibody, e.g., a full-length antibody, an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the circular polyribonucleotide can be of any isotype, such as IgA, IgD, IgE, IgG, IgM. In some embodiments, the circular polyribonucleotide expresses a portion of an antibody, such as a light chain, a heavy chain, an Fc fragment, a CDR (complementarity determining region), an Fv fragment, or a Fab fragment, an additional portion thereof. In some embodiments, the circular polyribonucleotide expresses one or more portions of an antibody. For example, the circular polyribonucleotide can comprise more than one expression sequence, each of which expresses a portion of an antibody, and the sum of which can constitute the antibody. In some cases, the circular polyribonucleotide comprises one expression sequence encoding an antibody heavy chain and another expression sequence encoding an antibody light chain. When the circular polyribonucleotide is expressed in a cell, the light and heavy chains can undergo appropriate modifications, folding, or other post-translational modifications to form a functional antibody.

[0331] In some embodiments, a circular polyribonucleotide prepared as described herein is used as an effector in therapy or agriculture. For example, a circular polyribonucleotide prepared by a method described herein (e.g., a cell-free method described herein) can be administered to a subject (e.g., in a pharmaceutical or agricultural composition). In embodiments, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In embodiments, the subject is a human. In embodiments, the subject of the method is a non-human mammal. In embodiments, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cow, a water buffalo, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In embodiments, the subject is a bird, such as a member of the order Galliformes (e.g., a chicken, a turkey, a pheasant, a quail), the order Anseriformes (e.g., a duck, a goose), the subclass Archaeognatha (e.g., a termite, a silverfish), the order Columbiformes (e.g., a pigeon, a dove), or the order Psittaciformes (e.g., a parrot). In embodiments, the subject is an invertebrate, such as an arthropod (e.g., an insect, an arachnid, a crustacean), a nematode, an annelid, a helminth, or a mollusk. In embodiments, the subject is an invertebrate agricultural pest or an invertebrate that parasitizes an invertebrate or vertebrate host. In embodiments, the subject is a plant, such as an angiosperm (which can be a dicot or a monocot) or a gymnosperm (e.g., a conifer, a cycad, a ginkgo, a gnetophyte), a fern, a horsetail, a clubmoss, or a liverwort. In embodiments, the subject is a eukaryotic alga (single-celled or multicellular). In embodiments, the subject is a plant of agricultural or horticultural importance, such as an inter-row crop, a fruit-producing plant and tree, a vegetable, a tree, and an ornamental plant (including an ornamental flower, shrub, tree, ground cover, and turf grass).

[0332] Secreted polypeptide effectors

[0333] In some embodiments, a circular polyribonucleotide described herein (e.g., a polyribonucleotide cargo of a circular polyribonucleotide) comprises at least one coding sequence encoding a secreted polypeptide effector. Exemplary secreted polypeptide effectors or proteins that can be expressed include, for example, cytokines and cytokine receptors, polypeptide hormones and receptors, growth factors, coagulation factors, therapeutic replacement enzymes and therapeutic non-enzyme effectors, regeneration, repair, and fibrosis factors, transforming factors, and proteins that stimulate cell regeneration, non-limiting examples of which are described herein, e.g., in the table below.

[0334] Cytokines and cytokine receptors

[0335] In some embodiments, an effector described herein comprises a cytokine of Table 2, or a functional variant or fragment thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 11 (by reference to its UniProt ID). In some embodiments, a functional variant binds to a corresponding cytokine receptor with a Kd that is no more than 10%, 20%, 30%, 40%, or 50% higher or lower than the Kd of the corresponding wild-type cytokine for the same receptor under the same conditions. In some embodiments, an effector comprises a fusion protein comprising a first region (e.g., a cytokine polypeptide of Table 11 or a functional variant or fragment thereof) and a second heterologous region. In some embodiments, the first region is a first cytokine polypeptide of Table 11. In some embodiments, the second region is a second cytokine polypeptide of Table 11, wherein the first and second cytokine polypeptides form a cytokine heterodimer with one another in a wild-type cell. In some embodiments, a polypeptide of Table 11 or a functional variant thereof comprises a signal sequence, e.g., an endogenous signal sequence for the effector or a heterologous signal sequence.

[0336] In some embodiments, an effector described herein comprises an antibody or fragment thereof that binds to a cytokine of Table 11. In some embodiments, an antibody molecule comprises a signal sequence.

[0337] Table 11. Exemplary cytokines and cytokine receptors

[0338]

[0339]

[0340] 1 Sequences are available at the NCBI database on the World Wide Web at ncbi.nlm.nih.gov / gene; Maglott D, et al. Gene: a gene-centered information resource at NCBI. Nucleic Acids Res. 2014. pii: gku1055.

[0341] 2 Sequences are available at the Uniprot database on the World Wide Web at uniprot.org / uniprot; UniProt: the universal protein knowledgebase in 2021. Nucleic Acids Res. 49: D1 (2021).

[0342] Polypeptide hormones and receptors

[0343] In some embodiments, an effector described herein comprises a hormone of Table 12, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 12 (by reference to its UniProt ID). In some embodiments, a functional variant binds to a corresponding receptor with a Kd that is no more than 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type hormone for the same receptor under the same conditions. In some embodiments, a polypeptide of Table 12, or a functional variant thereof, comprises a signal sequence, e.g., an endogenous signal sequence for the effector or a heterologous signal sequence.

[0344] In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds to a hormone of Table 12. In some embodiments, an effector described herein comprises an antibody molecule (e.g., an scFv) that binds to a hormone receptor of Table 12. In some embodiments, an antibody molecule comprises a signal sequence.

[0345] Table 12. Exemplary polypeptide hormones and receptors

[0346]

[0347] 1 Sequences are available on the NCBI database on the World Wide Web site “ncbi.nlm.nih.gov / gene” (Maglott D et al. Gene: a gene-centered information resource at NCBI. Nucleic Acids Res. 2014. pii: gku1055).

[0348] 2 Sequences are available on the Uniprot database on the World Wide Web site “uniprot.org / uniprot / ”; UniProt: the universal protein knowledgebase in 2021. Nucleic Acids Res. 49: D1 (2021).

[0349] Growth factors

[0350] In some embodiments, an effector described herein comprises a growth factor of Table 13, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 13 by reference to its UniProt ID. In some embodiments, a functional variant binds to the corresponding receptor with a Kd that is no more than 10%, 20%, 30%, 40%, or 50% higher than the Kd of the corresponding wild-type growth factor for the same receptor under the same conditions. In some embodiments, a polypeptide of Table 13, or a functional variant thereof, comprises a signal sequence, e.g., an endogenous signal sequence or a heterologous signal sequence to the effector.

[0351] In some embodiments, an effector described herein comprises an antibody or fragment thereof that binds to a growth factor of Table 13. In some embodiments, an effector described herein comprises an antibody molecule (e.g., scFv) that binds to a growth factor receptor of Table 13. In some embodiments, an antibody molecule comprises a signal sequence.

[0352] Table 13. Exemplary growth factors

[0353]

[0354]

[0355] 1 Sequences are available in the NCBI database at the website www.ncbi.nlm.nih.gov / gene.

[0356] 2 Sequences are available in the Uniprot database at the website uniprot.org / uniport.

[0357] Coagulation factors

[0358] In some embodiments, an effector described herein comprises a polypeptide of Table 14, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 14 by reference to its UniProt ID. In some embodiments, a functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate that is no more than 10%, 20%, 30%, 40%, or 50% lower or higher than the wild-type protein. In some embodiments, a polypeptide of Table 14, or a functional variant thereof, comprises a signal sequence, e.g., an endogenous signal sequence or a heterologous signal sequence to the effector.

[0359] Table 14. Coagulation-related factors

[0360]

[0361] 1 Sequences are available in the NCBI database on the World Wide Web website ncbi.nlm.nih.gov / gene.

[0362] 2 Sequences are available in the Uniprot database on the World Wide Web website “uniprot.org / uniprot”.

[0363] Therapeutic replacement enzymes

[0364] In some embodiments, the effector described herein comprises an enzyme of Table 15, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 15 (by reference to its UniProt ID). In some embodiments, the functional variant catalyzes the same reaction as the corresponding wild-type protein, e.g., at a rate that is no more than or no less than 10%, 20%, 30%, 40%, or 50% lower than the wild-type protein.

[0365] Table 15. Exemplary enzyme effectors for enzyme deficiency disorders

[0366]

[0367]

[0368]

[0369]

[0370]

[0371] 1 Sequences are available in the NCBI database on the World Wide Web website ncbi.nlm.nih.gov / gene.

[0372] 2 Sequences are available in the Uniprot database on the World Wide Web website uniprot.org / uniprot.

[0373] Other non-enzyme effectors

[0374] In some embodiments, the therapeutic polypeptide described herein comprises a polypeptide of Table 16, or a functional variant thereof, e.g., a protein having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity to a protein sequence disclosed in Table 16 (by reference to its UniProt ID).

[0375] Table 16. Exemplary non-enzyme effectors and corresponding indications

[0376]

[0377]

[0378] 1 The sequences are available in the NCBI database on the web site ncbi.nlm.nih.gov / gene.

[0379] 2 The sequences are available in the Uniprot database on the web site uniprot.org / uniprot.

[0380] Regenerative, repair and fibrosis factors

[0381] The therapeutic polypeptides described herein also include growth factors or functional variants thereof, for example as disclosed in Table 17, for example proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity with the protein sequences disclosed in Table 17 (by reference to their NCBI Protein Accession Number). Also included are antibodies or fragments thereof against such growth factors, or miRNAs that promote regeneration and repair.

[0382] Table 17. Exemplary regenerative, repair and fibrosis factors

[0383]

[0384] 1 The sequences are available on the web site ncbi.nlm.nih.gov / gene.

[0385] 2 The sequences are available on the web site ncbi.nlm.nih.gov / protein.

[0386] Transforming factors

[0387] The therapeutic polypeptides described herein also include transforming factors, for example protein factors that transform fibroblasts into differentiated cells, for example the factors disclosed in Table 18 or functional variants thereof, for example proteins having at least 80%, 85%, 90%, 95%, 967%, 98%, 99% identity with the protein sequences disclosed in Table 18 (by reference to their UniProt ID).

[0388] Table 18: Polypeptides indicative for organ repair by transforming fibroblasts

[0389] Target NCBI Gene Accession Number 1 ]] NCBI protein accession number 2 ]] MESP1 Gene ID: 55897 EAX02066 ETS2 Gene ID: 2114 NP_005230 HAND2 Gene ID: 9464 NP_068808 Cardiac Gene ID: 993649 NP_001139784 ESRRA Gene ID: 2101 AAH92470 miR1 MI0000651 Not applicable miR133 MI000450 Not applicable TGFb Gene ID: 77040 NP_000651.3 WNT Gene ID: 7471 NP_005421 JAK Gene ID: 3716 NP_001308784 NOTCH Gene ID: 4851 XP_011517019

[0390] 1The sequence is available on the World Wide Web site ncbi.nlm.nih.gov / gene.

[0391] 2 The sequence is available on the World Wide Web site ncbi.nlm.nih.gov / protein.

[0392] Proteins stimulating cell regeneration

[0393] The therapeutic polypeptides described herein also include proteins stimulating cell regeneration, such as the proteins disclosed in Table 19 or functional variants thereof, such as proteins having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity to the protein sequences disclosed in Table 19 (by reference to their UniProt ID).

[0394] Table 19. Exemplary proteins stimulating cell regeneration

[0395] Target Gene Accession No. 1 ]] Protein Accession No. 2 ]] MST1 NG_016454 NP_066278 STK30 Gene ID: 26448 ]]> ​ NP_036103 MST2 Gene ID: 6788 NP_006272 SAV1 Gene ID: 660485 NP_068590 LATS1 Gene ID: 9113 NP_004681 LATS2 Gene ID: 26524 NP_055387 YAP1 NG_029530 NP_001123617 CDKN2b NG_023297 NP_004927 CDKN2a NG_007485 NP_478102

[0396] 1 The sequence is available on the World Wide Web site ncbi.nlm.nih.gov / gene.

[0397] 2 The sequence is available on the World Wide Web site ncbi.nlm.nih.gov / protein.

[0398] Cystic fibrosis transmembrane conductance regulator (CFTR)

[0399] In some embodiments, the effector described herein comprises a CFTR gene of Table 20 or a functional variant or fragment thereof, such as a protein having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the protein sequences disclosed in Table 20.

[0400] Table 20. Exemplary CFTR genes

[0401]

[0402]

[0403]

[0404]

[0405]

[0406] In some embodiments, the circular polyribonucleotide comprises one or more expression sequences (coding sequences) and is configured for sustained expression in a cell in a subject. In some embodiments, the circular polyribonucleotide is configured such that expression of the one or more expression sequences in the cell at a later time point is equal to or higher than expression at an earlier time point. In such embodiments, expression of the one or more expression sequences can be maintained at a relatively stable level or can increase over time. Expression of the expression sequences can be relatively stable over an extended period of time. For example, in some cases, expression of the one or more expression sequences in the cell does not decrease by 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% over a period of at least 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 23, or more days. In some cases, expression of the one or more expression sequences in the cell is maintained at a level that does not vary by more than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% over a period of at least 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 23, or more days.

[0407] Plant modifying polypeptides

[0408] In some embodiments, the polyribonucleotides described herein (e.g., the polyribonucleotide cargo of the polyribonucleotides) comprise at least one expression sequence encoding a plant modifying polypeptide. A plant modifying polypeptide refers to a polypeptide that can alter a genetic property (e.g., increase gene expression, decrease gene expression, or otherwise alter the nucleotide sequence of DNA or RNA), epigenetic property, or physiological or biochemical property of a plant in a manner that changes the physiology or phenotype of the plant (e.g., increases or decreases fitness of the plant). In some embodiments, the polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten, or more different plant modifying polypeptides, or multiple copies of one or more plant modifying polypeptides. The plant modifying polypeptide can alter the physiology or phenotype of, or increase or decrease the fitness of, a variety of plants, or can be a polypeptide that affects such alteration in one or more particular plants (e.g., plants of a particular species or genus).

[0409] Examples of polypeptides that can be used herein can include enzymes (e.g., metabolic recombination enzymes, helicases, integrases, RNases, DNases, or ubiquitinating proteins), pore-forming proteins, signaling ligands, cell-penetrating peptides, transcription factors, receptors, antibodies, nanobodies, gene editing proteins (e.g., CRISPR-Cas endonucleases, TALENs, or zinc fingers), riboproteins, protein aptamers, or chaperones.

[0410] Agricultural polypeptides

[0411] In some embodiments, a polyribonucleotide (e.g., a polyribonucleotide cargo of a polyribonucleotide) described herein comprises at least one expression sequence encoding an agricultural polypeptide. An agricultural polypeptide is a polypeptide suitable for agricultural use. In embodiments, an agricultural polypeptide is applied to a plant or seed (e.g., by foliar spray, dusting, injection, or seed coating) or to a plant environment (e.g., by soil drenching or granular soil application) such that the physiology, phenotype, or fitness of the plant is altered. Embodiments of agricultural polypeptides include polypeptides that alter the level, activity, or metabolism of one or more microorganisms residing in or on a plant or non-human vertebrate, invertebrate, microbial, or plant cell, the alteration resulting in an increase in fitness of the host. In some embodiments, an agricultural polypeptide is a plant polypeptide. In some embodiments, an agricultural polypeptide is an insect polypeptide. In some embodiments, an agricultural polypeptide has a biological effect when in contact with a non-human vertebrate, invertebrate, microbial, or plant cell.

[0412] In some embodiments, a polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten, or more agricultural polypeptides, or multiple copies of one or more agricultural polypeptides.

[0413] Examples of polypeptides that can be used in agricultural applications include, for example, bacteriocins, lysins, antimicrobial peptides, nodule C-rich peptides, and bacterial cell modulating peptides. Such polypeptides can be used to alter the level, activity, or metabolism of target microorganisms to increase fitness of insects, such as honeybees and silkworms. Examples of agriculturally useful polypeptides include peptide toxins, such as those naturally produced by insect pathogenic nematode bacteria (e.g., Bacillus thuringiensis, Photorhabdus luminescens, Serratia entomophila, or Xenorhabdus nematophila), as known in the art. Examples of agriculturally useful polypeptides include polypeptides (including small peptides, such as cyclic dipeptides or diketopiperazines) for controlling agriculturally important pests or pathogens, for example, antimicrobial polypeptides or antifungal polypeptides for controlling disease in plants, or insecticidal polypeptides (e.g., insecticidal or nematicidal polypeptides) for controlling invertebrate pests such as insects or nematodes. Examples of agriculturally useful polypeptides include antibodies, nanobodies, and fragments thereof, for example, antibody or nanobody fragments that retain at least some (e.g., at least 10%) of the specific binding activity of the intact antibody or nanobody. Examples of agriculturally useful polypeptides include transcription factors, for example, plant transcription factors; see, e.g., the “AtTFDB” database listing families of transcription factors identified in the model plant Arabidopsis thaliana, publicly available at agris-knowledgebase.org / AtTFDB / . Examples of agriculturally useful polypeptides include nucleases, for example, exonucleases or endonucleases (e.g., Cas nucleases, such as Cas9 or Cas12a). Examples of agriculturally useful polypeptides further include cell-penetrating peptides, enzymes (e.g., amylases, cellulases, peptidases, lipases, chitinases), pheromones (e.g., yeast mating pheromones, invertebrate reproductive and larval signaling pheromones; see, e.g., Altstein (2004) Peptides, 25: 1373-1376).

[0414] Termination element

[0415] In some embodiments, the polyribonucleotides described herein comprise at least one termination element. In some embodiments, the polyribonucleotides comprise a termination element operably linked to an expression sequence. In some embodiments, the polynucleotides lack a termination element.

[0416] In some embodiments, the polyribonucleotide comprises one or more expression sequences, and each expression sequence can or can not have a termination element. In some embodiments, the polyribonucleotide comprises one or more expression sequences, and the expression sequences lack a termination element, such that the polyribonucleotide is translated continuously. The exclusion of a termination element can result in rolling circle translation or continuous expression of an expression product.

[0417] In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, and each expression sequence can or can not have a termination element. In some embodiments, the circular polyribonucleotide comprises one or more expression sequences, and the expression sequences lack a termination element, such that the circular polyribonucleotide is translated continuously. The exclusion of a termination element can result in rolling circle translation or continuous expression of an expression product (e.g., a peptide or polypeptide) due to the lack of ribosome stalling or dropping off. In such embodiments, the rolling circle translation expresses a continuous expression product through each expression sequence. In some other embodiments, the termination element of an expression sequence can be part of an interlaced element. In some embodiments, one or more expression sequences in the circular polyribonucleotide comprise a termination element. However, rolling circle translation or expression of a subsequent (e.g., second, third, fourth, fifth, etc.) expression sequence occurs in the circular polyribonucleotide. In such cases, the expression product can drop off the ribosome when the ribosome encounters the termination element (e.g., stop codon) and terminates translation. In some embodiments, the translation terminates while the ribosome, e.g., at least one subunit of the ribosome, remains in contact with the circular polyribonucleotide.

[0418] In some embodiments, the circular polyribonucleotide comprises a termination element at the end of one or more expression sequences. In some embodiments, one or more expression sequences comprise two or more consecutive termination elements. In such embodiments, the translation terminates and the rolling circle translation terminates. In some embodiments, the ribosome completely disengages from the circular polyribonucleotide. In some such embodiments, production of a subsequent (e.g., second, third, fourth, fifth, etc.) expression sequence in the circular polyribonucleotide can require the ribosome to reengage with the circular polyribonucleotide prior to initiating translation. Typically, a termination element includes an in-frame nucleotide triplet (e.g., UAA, UGA, UAG) that signals termination of translation. In some embodiments, one or more termination elements in the circular polyribonucleotide are frameshift termination elements, such as but not limited to out-of-frame or -1 and +1 frameshift reading frames (e.g., cryptic terminators) that can terminate translation. Frameshifted termination elements include nucleotide triplets, TAA, TAG, and TGA, that occur in the second and third reading frames of an expression sequence. Frameshifted termination elements can be important to prevent mRNA misreading that is often deleterious to a cell. In some embodiments, the termination element is a stop codon.

[0419] are frameshift termination elements, such as but not limited to out-of-frame or -1 and +1 frameshift reading frames (e.g., cryptic terminators) that can terminate translation. Frameshifted termination elements include nucleotide triplets, TAA, TAG, and TGA, that occur in the second and third reading frames of an expression sequence. Frameshifted termination elements can be important to prevent mRNA misreading that is often deleterious to a cell. In some embodiments, the termination element is a stop codon.

[0420] In some embodiments, the expression sequence comprises a polyA sequence (e.g., at the 3’ end of the expression sequence, e.g., 3’ of the termination element). In some embodiments, the polyA sequence is greater than 10 nucleotides in length. In one embodiment, the polyA sequence is greater than 15 nucleotides in length (e.g., at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the polyA sequence is designed according to the description of a polyA sequence in

[0202] -

[0204] of International Patent Publication No. WO 2019 / 118919 Al, which is hereby incorporated by reference in its entirety. In some embodiments, the expression sequence lacks a polyA sequence (e.g., at the 3’ end of the expression sequence).

[0421] In some embodiments, the circular polyribonucleotide comprises a polyA, lacks a polyA, or has a modified polyA to modulate one or more characteristics of the circular polyribonucleotide. In some embodiments, the circular polyribonucleotide lacking a polyA or having a modified polyA improves one or more functional characteristics, such as immunogenicity (e.g., levels of one or more markers of immune or inflammatory response), half-life, and / or expression efficiency.

[0422] Additional examples of termination elements are described in paragraphs

[0169] -

[0170] of International Patent Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.

[0423] Modifications

[0424] A polyribonucleotide can comprise one or more substitutions, insertions and / or additions, deletions, and covalent modifications encompassed within the scope of the present disclosure relative to a reference sequence (in particular, a parental polyribonucleotide).

[0425] In some embodiments, the polyribonucleotide comprises one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly A sequence, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, such as any of the more than one hundred different nucleoside modifications that have been identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27: 196-197). In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, the polyribonucleotide comprises at least one nucleoside selected from the group as described in

[0311] of International Patent Publication No. WO 2019 / 118919 Al, which is incorporated by reference herein in its entirety.

[0426] The polyribonucleotide can comprise any useful modification, e.g., to the sugar, nucleobase, or internucleoside linkage (e.g., to the phosphate linkage / to the phosphodiester bond / to the phosphodiester backbone). One or more atoms of a pyrimidine nucleobase can be replaced or substituted with an optionally substituted amino group, an optionally substituted thiol, an optionally substituted alkyl group (e.g., methyl or ethyl), or a halo group (e.g., chloro or fluoro). In certain embodiments, there is a modification (e.g., one or more modifications) in each sugar and internucleoside linkage. The modification can be a ribonucleic acid (RNA) modification to deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or a hybrid thereof. Other modifications are described herein.

[0427] In some embodiments, the polyribonucleotide comprises at least one N(6) methyladenosine (m6A) modification to increase translation efficiency. In some embodiments, the m6A modification can decrease immunogenicity of the polyribonucleotide (e.g., decrease the level of one or more markers of immune or inflammatory response).

[0428] In some embodiments, the modifications can include chemical or cell-induced modifications. For example, some non-limiting examples of intracellular RNA modifications are described in Lewis and Pan, "RNA modifications and structures cooperate to guide RNA-protein interactions", Nat Reviews Mol Cell Biol, 2017, 18:202-210.

[0429] In some embodiments, chemical modifications to ribonucleotides of the polyribonucleotide can enhance immune evasion. The polyribonucleotide can be synthesized and / or modified by well-established methods in the art, such as those described in Current protocols in nucleic acid chemistry, Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated by reference. Modifications include, for example, end modifications, such as 5' end modifications (phosphorylation (mono-, di-, and tri-phosphorylated), conjugation, inverted linkage, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkage, etc.), base modifications (e.g., substitution with stable bases, unstable bases, or base-pairing with an expanded pool of pairing partners), base removal (abasic nucleotides), or base conjugation. Modified ribonucleotide bases can also include 5-methylcytosine and pseudouridine. In some embodiments, base modifications can modulate expression, immune response, stability, subcellular localization of the polyribonucleotide, to name a few functional effects. In some embodiments, the modifications include dual orthogonal nucleotides, such as non-natural bases. See, e.g., Kimoto et al., Chem Commun (Camb), 2017, 53: 12309, DOI: 10.1039 / c7cc06661a, which is hereby incorporated by reference in its entirety.

[0430] In some embodiments, sugar modifications (e.g., at the 2' position or 4' position) or sugar replacements and backbone modifications of one or more ribonucleotides of the polyribonucleotide include modifications or replacements of the phosphodiester linkage. Particular examples of polyribonucleotides include, but are not limited to, polyribonucleotides comprising modified backbones or non-natural internucleoside linkages (such as internucleoside modifications including modifications or replacements of the phosphodiester linkage). Polyribonucleotides with modified backbones include, inter alia, those that do not have a phosphorus atom in the backbone. For the purposes of this application, and as sometimes mentioned in the art, modified RNAs that do not have a phosphorus atom in their internucleosidic backbone can also be considered oligonucleosides. In particular embodiments, the polyribonucleotide will include ribonucleotides having a phosphorus atom in their internucleosidic backbone.

[0431] Modified polyribonucleotide backbones can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates (such as 3'-alkylene phosphonates and chiral phosphonates), phosphinates, amino-phosphoramidates (such as 3'-amino amino-phosphoramidates and aminoalkyl-amino phosphoramidates), thionophosphoramidates, thionoalkyl-phosphonates, thionoalkyl-phosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. In some embodiments, the polyribonucleotide can be negatively charged or positively charged.

[0432] Modified nucleotides that can be incorporated into polyribonucleotides can be modified on the internucleoside linkage (e.g., the phosphate backbone). Herein, the phrases “phosphate” and “phosphodiester” are used interchangeably in the context of a polyribonucleotide backbone. The backbone phosphate groups can be modified by replacing one or more of the oxygen atoms with different substituents. In addition, modified nucleosides and nucleotides can include wholesale replacement of the unmodified phosphate moiety with another internucleoside linkage as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenoates, boranophosphates, hydrogen phosphonates, phosphoramidates, diaminophosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. The two non-linking oxygens of a phosphorodithioate are replaced with sulfur. The phosphate linker can also be modified by replacing the linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene phosphonates).

[0433] a-thio-substituted phosphate moieties are provided to confer stability to RNA and DNA polymers through unnatural thio-phosphate backbone linkages. Thio-phosphate DNA and RNA have enhanced nuclease resistance and thus a longer half-life in cellular environments. Thio-phosphate linkage to polyribonucleotides is expected to reduce innate immune responses by attenuating binding / activation of cellular innate immune molecules.

[0434] In particular embodiments, the modified nucleosides include a-thio-nucleosides (e.g., 5'-0-(l-thio-phospho)-adenosine, 5'-0-(l-thio-phospho)-cytidine (a-thiocytidine), 5'-0-(l-thio-phospho)-guanosine, 5'-0-(l-thio-phospho)-uridine, or 5'-0-(l-thio-phospho)-pseudouridine).

[0435] Other internucleoside linkages that can be used in accordance with the present disclosure are described herein, including internucleoside linkages that do not include a phosphorus atom.

[0436] In some embodiments, the polyribonucleotides can comprise one or more cytotoxic nucleosides. For example, a cytotoxic nucleoside can be incorporated into the polyribonucleotide, such as a bifunctional modification. Cytotoxic nucleosides can include, but are not limited to, combinations of adenosine arabinoside, 5-azacytidine, 4'-thio- adenosine arabinoside, cyclopentenyl cytosine, cladrabine, clofarabine, cytosine arabinoside, l-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, fluorouridine, gemcitabine, tegafur, and uracil, tegafur ((RS)-5-fluoro-l-(tetrahydrofuran-2-yl)pyrimidine-2,4(lH,3H)-dione), troxacitabine, terazoxime, 2'-deoxy-2'-methylene cytidine (DMDC), and 6-mercaptopurine. Other examples include fludarabine phosphate, N4-behenoyl-l-beta-D-arabinopentofuranosyl cytosine, N4-octadecyl-l-beta-D-arabinopentofuranosyl cytosine, N4-palmitoyl-l-(2-C-cyano-2-deoxy-beta-D-arabinopentofuranosyl) cytosine, and P-4055 (cytarabine 5'-arachidonate).

[0437] The polyribonucleotide can or can not be uniformly modified along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purines or pyrimidines, or any one or more or all of A, G, U, C, I, pU) in the polyribonucleotide, or in a given predetermined sequence region thereof, can or can not be uniformly modified. In some embodiments, the polyribonucleotide comprises pseudouridine. In some embodiments, the polyribonucleotide comprises inosine, which can help the immune system characterize the polyribonucleotide as endogenous, relative to viral RNA. Incorporation of inosine can also mediate improved RNA stability / decreased degradation. See, e.g., Yu, Z, et al. (2015) RNA editing by ADAR1 marks dsRNA as“self.” Cell Res 25, 1283-1284, which is incorporated by reference in its entirety herein.

[0438] In some embodiments, all nucleotides in the polyribonucleotide (or a given sequence region thereof) are modified. In some embodiments, the modifications can include m6A, which can enhance expression; inosine, which can attenuate immune response; pseudouridine, which can increase RNA stability or translational readthrough (stutter element); m5C, which can increase stability; and 2,2,7-trimethylguanosine, which can facilitate subcellular translocation (e.g., nuclear localization).

[0439] Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) can be present at various positions of the polyribonucleotide. Those of ordinary skill in the art will appreciate that nucleotide analogs or other modification(s) can be located at any one or more positions of the polyribonucleotide such that the function of the polyribonucleotide is not substantially reduced. The modifications can also be non-coding region modifications. The polyribonucleotide can comprise from about 1% to about 100% (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C) or any intervening percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%) of modified nucleotides.

[0440] Production methods

[0441] The present disclosure provides methods for producing circular polyribonucleotides, including, for example, recombinant techniques or chemical synthesis. For example, DNA molecules for producing RNA circles can include DNA sequences of naturally occurring nucleic acid sequences, modified versions thereof, or DNA sequences encoding synthetic polypeptides that are not typically found in nature (e.g., chimeric molecules or fusion proteins). DNA and RNA molecules can be modified using a variety of techniques, including but not limited to classical mutagenesis techniques and recombination techniques, such as site-directed mutagenesis, chemical treatment of nucleic acid molecules to induce mutations, restriction enzyme cleavage of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification or mutagenesis of selected regions of nucleic acid sequences, synthesis of oligonucleotide mixtures, and ligation of mixture members to “build” mixtures of nucleic acid molecules, and combinations thereof.

[0442] Cyclic polyribonucleotides can be prepared according to any available technique, including but not limited to chemical synthesis and enzymatic synthesis. In some embodiments, a linear primary construct or linear polyribonucleotide for circularization can be circularized or concatenated to produce a circRNA described herein. In some embodiments, a linear polyribonucleotide for circularization can be circularized in vitro prior to formulation and / or delivery. In some embodiments, a cyclic polyribonucleotide can be in a mixture with linear polyribonucleotides. In some embodiments, a linear polyribonucleotide has the same nucleic acid sequence as a cyclic polyribonucleotide.

[0443] Mechanisms of circularization or concatenation can occur through methods such as, for example, chemical, enzymatic, splint ligation, or ribozyme catalysis. The newly formed 5’-3’ linkage can be an intramolecular bond or an intermolecular bond. For example, splint ligation enzymes (such as Ligases) can be used for splint ligation. According to this method, a single-stranded polynucleotide (splint) (such as single-stranded DNA or RNA) can be designed to hybridize to both ends of a linear polyribonucleotide, such that the two ends can be juxtaposed upon hybridization to the single-stranded splint. Thus, a splint ligation enzyme can catalyze the ligation of the juxtaposed ends of a linear polyribonucleotide, resulting in a circRNA. In some embodiments, DNA or RNA ligases can be used for the synthesis of cyclic polyribonucleotides. As one non-limiting example, a ligase can be a circ ligase or a circular ligase.

[0444] In some embodiments, the 5’ end or 3’ end of a linear polyribonucleotide can encode a ligase ribozyme sequence, such that during in vitro transcription, the resulting linear polyribonucleotide for circularization includes an active ribozyme sequence that is able to ligate the 5’ end of the linear polyribonucleotide for circularization to the 3’ end of the linear polyribonucleotide for circularization. The ligase ribozyme can be derived from a Group I intron, a hepatitis D virus, a hairpin ribozyme, or can be selected by SELEX (systematic evolution of ligands by exponential enrichment).

[0445] In another example, a linear polyribonucleotide can be circularized or linked by using at least one non-nucleic acid moiety. In an aspect, the at least one non-nucleic acid moiety can react with a region or feature near the 5' end or near the 3' end of the linear polyribonucleotide for circularization to circularize or link the linear polyribonucleotide for circularization. In another aspect, the at least one non-nucleic acid moiety can be located at or linked to or adjacent to the 5' end or 3' end of the linear polyribonucleotide for circularization. The non-nucleic acid moiety can be homologous or heterologous. As non-limiting examples, the non-nucleic acid moiety can be a bond, such as a hydrophobic bond, an ionic bond, a biodegradable bond, or a cleavable bond. As another non-limiting example, the non-nucleic acid moiety is a linking moiety. As yet another non-limiting example, the non-nucleic acid moiety can be an oligonucleotide or a peptide moiety, such as an aptamer or a non-nucleic acid linker, as described herein.

[0446] In some embodiments, the linear polyribonucleotides for circularization can include a 5' triphosphate of the nucleic acid, for example, by converting the 5' triphosphate to a 5' monophosphate by contacting the 5' triphosphate with an RNA 5' pyrophosphohydrolase (RppH) or an ATP diphosphohydrolase (dephosphoesterase). In some embodiments, the 5' end of at least a portion of the linear polyribonucleotides comprises a monophosphate moiety. In some embodiments, the population of polyribonucleotides comprising circular and linear polyribonucleotides is contacted with RppH prior to the enzymatic cleavage of at least a portion of the linear polyribonucleotides with a 5' exonuclease and / or a 3' exonuclease. Alternatively, converting the 5' triphosphate of the linear polyribonucleotides for circularization to a 5' monophosphate can be accomplished by a two-step reaction comprising: (a) contacting the 5' nucleotide of the linear polyribonucleotides for circularization with a phosphatase (e.g., a heat-stable phosphatase, shrimp alkaline phosphatase, or calf intestinal phosphatase) to remove all three phosphates; and (b) after step (a), contacting the 5' nucleotide with a kinase that adds a single phosphate (e.g., a polynucleotide kinase). In another aspect, the linear polyribonucleotides for circularization can be circularized by self-splicing or ligation. In some embodiments, the linear polyribonucleotides can comprise a sequence that mediates self-ligation. In some embodiments, the linear polyribonucleotides can comprise a loop E sequence (e.g., in PSTVd) to perform self-ligation. In some embodiments, the linear polyribonucleotides can comprise an HDV sequence, for example, an HDV replication domain conserved sequence, GGCUCAUCUCGACAAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCAAGUUCGAGCAUGAGCC (SEQ ID NO: 234) (Beeharry et al. 2004) or GGCUAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCGAGCC (SEQ ID NO: 235), to perform self-ligation. In another embodiment, the linear polyribonucleotides can comprise a self-circularizing intron, for example, 5' and 3' splice junctions, or a self-circularizing catalytic intron, such as a Type I, Type II, or Type III intron. Non-limiting examples of Type I intron self-splicing sequences can include the self-splicing permutation intron-exon sequence derived from the td gene of T4 bacteriophage, and the intervening sequence (IVS) rRNA of the pre-rRNA of Tetrahymena, the pre-tRNA-Leu gene of cyanobacterium Anabaena, or fishy.

[0447] In some embodiments, the polyribonucleotide comprises a catalytic intron fragment, such as a 3' half of a Group I catalytic intron fragment and a 5' half of a Group I catalytic intron fragment. The first and second annealing regions can be located within the catalytic intron fragment. Group I catalytic introns are self-splicing ribozymes that catalyze their own excision from mRNA, tRNA, and rRNA precursors by a double-metal-ion phosphoryl transfer mechanism. Importantly, the RNA itself removes itself from the catalytic intron without the need for an external enzyme, such as a ligase.

[0448] In some embodiments, the 3' half of a Group I catalytic intron fragment and the 5' half of a Group I catalytic intron fragment are from a Anabaena tRNA-Leu precursor gene or a Tetrahymena pre-rRNA.

[0449] In some embodiments, the 3' half of a Group I catalytic intron fragment and the 5' half of a Group I catalytic intron fragment are from a Anabaena tRNA-Leu precursor gene, and the 3' exon fragment comprises the first annealing region and the 5' exon fragment comprises the second annealing region. The first annealing region can comprise, for example, 5 to 50, such as 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides, and the second annealing region can comprise, for example, 5 to 50, such as 10 to 15 (e.g., 10, 11, 12, 13, 14, or 15) ribonucleotides.

[0450] In some embodiments, the 3' half of a Group I catalytic intron fragment and the 5' half of a Group I catalytic intron fragment are from a Tetrahymena pre-rRNA, and the 3' half of a Group I catalytic intron fragment comprises the first annealing region and the 5' exon fragment comprises the second annealing region. In some embodiments, the 3' exon comprises the first annealing region and the 5' half of a Group I catalytic intron fragment comprises the second annealing region. The first annealing region can comprise, for example, 6 to 50, such as 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides, and the second annealing region can comprise, for example, 6 to 50, such as 10 to 16 (e.g., 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.

[0451] In some embodiments, the 3' half of a Group I catalytic intron fragment and the 5' half of a Group I catalytic intron fragment are from a Anabaena tRNA-Leu precursor gene, a Tetrahymena pre-rRNA gene, or a T4 phage td gene.

[0452] In some embodiments, the 3’ half of the Type I catalytic intron fragment and the 5’ half of the Type I catalytic intron fragment are from a T4 bacteriophage td gene. The 3’ exon fragment can comprise a first annealing region, and the 5’ portion of the Type I catalytic intron fragment can comprise a second annealing region. The first annealing region can comprise, for example, 2 to 16, such as 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides, and the second annealing region can comprise, for example, 2 to 16, such as 10 to 16 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16) ribonucleotides.

[0453] In some embodiments, the 3’ half of the Type I catalytic intron fragment is the 5’ end of the linear polynucleotide.

[0454] In some embodiments, the 5’ half of the Type I catalytic intron fragment is the 3’ end of the linear polyribonucleotide.

[0455] In some embodiments, the 3’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AACAACAGATAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCGGGAGAATG-3’ (SEQ ID NO: 236).

[0456] In some embodiments, the 5’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AAATAATTGAGCCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTT-3’ (SEQ ID NO: 237).

[0457] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 236, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 237.

[0458] In some embodiments, the 3’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- CTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCTGGGAACTAATTTGTATGCGAAAGTATATTGATTAGTTTTGGAGTACTCG-3’ (SEQ ID NO: 238).

[0459] In some embodiments, the 5’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AAATAGCAATATTTACCTTTGGAGGGAAAAGTTATCAGGCATGCACCTGGTAGCTAGTCTTTAAACCAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGACATGGTCCTAACCACGCAGCCAAGTCCTAAGTCAACAGAT-3’ (SEQ ID NO: 239).

[0460] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 238, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 239.

[0461] In some embodiments, the 3’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- TAAACAACTAACAGCTTTAGAAGGTGCAGAGACTAGACGGGAGCTACCCTAACGGATTCAGCCGAGGGTAAAGGGATAGTCCAATTCTCAACATCGCGATTGTTGATGGCAGCGAAAGTTGCAGAGAGAATGAAAATCCGCTGACTGTAAAGGTCGTGAGGGTTCGAGTCCCTCCGCCCCCA-3’ (SEQ ID NO: 242).

[0462] In some embodiments, the 5’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’-TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACT-3’ (SEQ ID NO: 241).

[0463] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 240, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 241.

[0464] In some embodiments, the 3’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- TAAACAACTAACAGCTTTAGAAGGTGCAGAGACTAGACGGGAGCTACCCTAACGGATTCAGCCGAGGGTAAAGGGATAGTCCAATTCTCAACATCGCGATTGTTGATGGCAGCGAAAGTTGCAGAGAGAATGAAAATCCGCTGACTGTAAAGGTCGTGAGGGTTCGAGTCCCTCCGCCCCCA-3’ (SEQ ID NO: 242).

[0465] In some embodiments, the 5' half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5'- ACGGTAGACGCAGCGGACTTAGAAAACTGGGCCTCGATCGCGAAAGGGATCGAGTGGCAGCTCTCAAACTCAGGGAAACCTAAAACTTTAAACATTMAAGTCATGGCAATCCTGAGCCAAGCTAAAGC-3' (SEQ ID NO: 243).

[0466] In some embodiments, the 3' half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 242, and the 5' half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 243.

[0467] In some embodiments, the 3' half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5'- TTAAACTCAAAATTTAAAATCCCAAATTCAAAATTCCGGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTAAAGCCGAGGGTAAAGGGAGAGTCCAATTCTCAAAGCCTGAAGTTGCTGAAGCAACAAGGCAGTAGTGAAAGCTGCGAGAGAATGAAAATCCGTTGACTGTAAAAAGTCGTGGGGGTTCAAGTCCCCCCACCCCC-3' (SEQ ID NO: 244).

[0468] In some embodiments, the 5' half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5'- ATGGTAGACGCTACGGACTTAGAAAACTGAGCCTTGATAGAGAAATCTTTTAAGTGGAAGCTCTCAAATTCAGGGAAACCTAAATCTGAATACAGATATGGCAATCCTGAGCCAAGCCCAGAAAATTTAGACTTGAGATTTGATTTTGGAG-3' (SEQ ID NO: 245).

[0469] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 244, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 245.

[0470] In some embodiments, the 3’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- GGCTTTCAATTTGAAATCAGAAATTCAAAATTCAGGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTAAAGGCGAGGGTAAAGGGAGAGTCCAATTCTTAAAGCCTGAAGTTGTGCAAGCAACAAGGCAACAGTGAAAGCTGTGGAAGAATGAAAATCCGTTGACCTTAAACGGTCGTGGGGGTTCAAGTCCCCCCACCCCC-3’ (SEQ ID NO: 246).

[0471] In some embodiments, the 5’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ATGGTAGACGCTACGGACTTAGAAAACTGAGCCTTGATAGAGAAATCTTTCAAGTGGAAGCTCTCAAATTCAGGGAAACCTAAATCTGAATACAGATATGGCAATCCTGAGCCAAGCCCGGAAATTTTAGAATCAAGATTTTATTTT-3’ (SEQ ID NO: 247).

[0472] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 246, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 247.

[0473] In some embodiments, the 3’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AGAAATGGAGAAGGTGTAGAGACTGGAAGGCAGGCACCCTAACGTTAAAGGCGAGGGTGAAGGGACAGTCCAGACCACAAACCAGTAAATCTGGGCAGCGAAAGCTGTAGATGGTAAGCATAACCCGAAGGTCAGTGGTTCAAATCCACTTCCCGCCACCAAATTAAAAAAACAATAA-3’ (SEQ ID NO: 248).

[0474] In some embodiments, the 5’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- AGAAATGGAGAAGGTGTAGAGACTGGAAGGCAGGCACCCTAACGTTAAAGGCGAGGGTGAAGGGACAGTCCAGACCACAAACCAGTAAATCTGGGCAGCGAAAGCTGTAGATGGTAAGCATAACCCGAAGGTCAGTGGTTCAAATCCACTTCCCGCCACCAAATTAAAAAAACAATAA-3’ (SEQ ID NO: 249).

[0475] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 248, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 249.

[0476] In some embodiments, the 3’ half of the Type I catalytic intron fragment has at least 80% (e.g., at least 85%, 90%, 95%, 97%, 99%, or 100%) sequence identity to the sequence of 5’- ACAACAGATAACTTACTAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCGGGAGAATGAAAATCCGTAGCGTCTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA-3’ (SEQ ID NO: 250).

[0477] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 250, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 251.

[0478] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 250, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 251.

[0479] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 250, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 251.

[0480] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 250, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 251.

[0481] In some embodiments, the 3’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 250, and the 5’ half of the Type I catalytic intron fragment has the sequence of SEQ ID NO: 251.

[0482] In some embodiments, the Type I catalytic intron fragment is from the T4 bacteriophage nrdB gene or the nrdD gene. In some embodiments, the 3’ half of the Type I catalytic intron fragment comprises a sequence having at least 80% sequence identity to 5’- TTGCAAAACAAGGTTCAACGACTAGTCTTCGGACGTAGGGTCAAGCGACTCGAAATGGGGAGAATCCCTCCGGGATTGTGATATAGTCTGGACTGCATGGTAACATGCAGCAGTTCATAAGAGAACGGGTTGAGAATTAGCGAGCTCAATCGAACATACG-3’ (SEQ ID NO: 254).

[0483] In some embodiments, the 3’ half of the Type I catalytic intron fragment of (A) comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5’- TTGCAAAACAAGGTTCAACGACTAGTCTTCGGACGTAGGGTCAAGCGACTCGAAATGGGGAGAATCCCTCCGGGATTGTGATATAGTCTGGACTGCATGGTAACATGCAGCAGTTCATAAGAGAACGGGTTGAGAATTAGCGAGCTCAATCGAACATACG-3’ (SEQ ID NO: 254).

[0484] In some embodiments, the 5’ half of the Type I catalytic intron fragment is from the T4 bacteriophage nrdB gene. In some embodiments, the 3’ half of the Type I catalytic intron fragment is from the T4 bacteriophage nrdB gene, and the 5’ half of the Type I catalytic intron fragment is from the T4 bacteriophage nrdB gene.

[0485] In some embodiments, the 5’ half of the Type I catalytic intron comprises a sequence having at least 80% sequence identity to 5’- AAAATGCGCCTTTAAACGGTAACGTTTATCGAAAACTCCTTTAATTGCTGGAAAGTCCTTTATGGAAAACTAGCAGCCAAGGTTTTGCTT-3’ (SEQ ID NO: 255).

[0486] In some embodiments, the 5' half of the Type I catalytic intron comprises a sequence with at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5'- AAAATGCGCCTTTAAACGGTAACGTTTATCGAAAACTCCTTTAATTGCTGGAAAGTCCTTTATGGAAAACTAGCAGCCAAGGTTTTGCTT-3' (SEQ ID NO: 255).

[0487] In some embodiments, the 3' half of the Type I catalytic intron fragment is from the T4 bacteriophage nrdD gene.

[0488] In some embodiments, the 3' half of the Type I catalytic intron fragment comprises a sequence with at least 80% sequence identity to 5'-CAGTAGCTGTAAATGCCCAACGACTATCCCTGATGAATGTAAGGGAGTAGGGTCAAGCGACCCGAAACGGCAGACAACTCTAAGAGTTGAAGATATAGTCTGAACTGCATGGTGACATGCAGCTGTTTATCCTCGTATAAATATGAATACGAGGTGAAACGATGAAATGAATTACATTGTTTCATATAAACGGGTAGAGAAGTAGCGAACTCTACTGAACACATTG-3' (SEQ ID NO: 256).

[0489] In some embodiments, the 3' half of the Type I catalytic intron fragment comprises a sequence with at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5'- CAGTAGCTGTAAATGCCCAACGACTATCCCTGATGAATGTAAGGGAGTAGGGTCAAGCGACCCGAAACGGCAGACAACTCTAAGAGTTGAAGATATAGTCTGAACTGCATGGTGACATGCAGCTGTTTATCCTCGTATAAATATGAATACGAGGTGAAACGATGAAATGAATTACATTGTTTCATATAAACGGGTAGAGAAGTAGCGAACTCTACTGAACACATTG-3' (SEQ ID NO: 256).

[0490] In some embodiments, the 5' half of the Type I catalytic intron fragment is from the T4 bacteriophage nrdD gene. In some embodiments, the 3' half of the Type I catalytic intron fragment is from the T4 bacteriophage nrdD gene and the 5' half of the Type I catalytic intron fragment is from the T4 bacteriophage nrdD gene.

[0491] In some embodiments, the 5' half of the Type I catalytic intron comprises a sequence having at least 80% sequence identity to 5'-TAACGTAAGTCAAGCTCATGTAAAATCTGCCTAAAACGGGAAACTCTCACTGAGACAATCCGTTGCTAAATCAG-3' (SEQ ID NO: 257).

[0492] In some embodiments, the 5' half of the Type I catalytic intron comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5'-TAACGTAAGTCAAGCTCATGTAAAATCTGCCTAAAACGGGAAACTCTCACTGAGACAATCCGTTGCTAAATCAG-3' (SEQ ID NO: 257).

[0493] In some embodiments, the 3' exon fragment comprises a sequence having at least 80% sequence identity to 5'-GTACCTTTAACTTCCATAAGAACATGGAAATCATGGAAGGTAATGCCAAG-3' (SEQ ID NO: 258).

[0494] In some embodiments, the 3' exon fragment comprises a sequence having at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5'-GTACCTTTAACTTCCAAAAGATACATAAAAATCATGGAAGGTAATGCCAAG-3' (SEQ ID NO: 259).

[0495] In some embodiments, the 3' exon fragment comprises a sequence having at least 80% sequence identity to 5'-GTACCTTTAACTTCCAAAAGATACATAAAAATCATGGAAGGTAATGCCAAG-3' (SEQ ID NO: 259).

[0496] In some embodiments, the 3' exon fragment comprises a sequence with at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5'- ATGAAGTGAACACGTTATTCAGTTCAAACGGACAGACTCCTTTTGTAACA -3' (SEQ ID NO: 261).

[0497] In some embodiments, the 5' exon fragment comprises a sequence with at least 80% sequence identity to 5'-TTTTTATGTATCTTTTGCGT-3' (SEQ ID NO: 260).

[0498] In some embodiments, the 5' exon fragment comprises a sequence with at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5'-TTTTTATGTATCTTTTGCGT-3' (SEQ ID NO: 260).

[0499] In some embodiments, the 3' exon fragment comprises a sequence with at least 80% sequence identity to 5'- ATGAAGTGAACACGTTATTCAGTTCAAACGGACAGACTCCTTTTGTAACA -3' (SEQ ID NO: 261).

[0500] In some embodiments, the 3' exon fragment comprises a sequence with at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5'- ATGAAGTGAACACGTTATTCAGTTCAAACGGACAGACTCCTTTTGTAACA -3' (SEQ ID NO: 261).

[0501] In some embodiments, the 3' exon fragment comprises a sequence with at least 80% sequence identity to 5'- ATGAAGTGAACACGTTACATAAGCTTGGAATGCAGACTCCTTTTGTAACA -3' (SEQ ID NO: 262).

[0502] In some embodiments, the 3' exon fragment comprises a sequence with at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5'- ATGAAGTGAACACGTTACATAAGCTTGGAATGCAGACTCCTTTTGTAACA -3' (SEQ ID NO: 262).

[0503] In some embodiments, the 5' exon fragment comprises a sequence with at least 80% sequence identity to 5'-TGCATTCCAAGCTTATGAGT-3' (SEQ ID NO: 263).

[0504] In some embodiments, the 5' exon fragment comprises a sequence with at least 85%, 90%, 95%, 97%, 99%, or 100% sequence identity to 5'-TGCATTCCAAGCTTATGAGT-3' (SEQ ID NO: 263).

[0505] In another aspect, the linear polyribonucleotides for circularization can be circularized or linked by non-nucleic acid moieties that cause attractive forces between atoms, molecular surfaces at, near, or attached to the 5' and 3' ends of the linear polyribonucleotides for circularization. In one embodiment, one or more linear polyribonucleotides are circularized or linked by intermolecular or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, van der Waals forces, and dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metal bonds, ionic bonds, resonance bonds, agnostic bonds, dipole bonds, conjugation, hyperconjugation, and backbonding.

[0506] In some embodiments, the linear polyribonucleotides for circularization can comprise a ribozyme RNA sequence near the 5' end and near the 3' end. The ribozyme RNA sequence can be covalently linked to the peptide when the sequence is exposed to the rest of the ribozyme. In one aspect, the peptides covalently linked to the ribozyme RNA sequences near the 5' end and the 3' end can be in communication with each other, causing the linear polyribonucleotides to circularize or link. In another example, the peptides covalently linked to the ribozyme RNA near the 5' end and the 3' end can cause the linear primary construct or linear mRNA to circularize or link after linkage using various methods known in the art, such as but not limited to protein ligation. Non-limiting examples of ribozymes for use in the linear primary constructs or linear polyribonucleotides of the present application, or a non-exhaustive list of methods of incorporating or covalently linking peptides are described in U.S. Patent Application No. US20030082768, the contents of which are incorporated herein by reference in their entirety.

[0507] In another aspect, chemical methods of circularization can be used to generate circular polyribonucleotides. Such methods can include, but are not limited to, click chemistry (e.g., alkyne and azide based methods, or clickable bases), olefin metathesis, phosphoramidate ligation, aminal-imine crosslinking, base modifications, and any combination thereof. In some chemical methods, the 5’ end and 3’ end of the linear polyribonucleotide used for circularization comprise chemically reactive groups that, when the groups are in close proximity to each other, can form a new covalent bond between the 5’ end and 3’ end of the molecule. The 5’ end can contain an NHS ester reactive group and the 3’ end can contain a 3’ amino terminal nucleotide such that, in an organic solvent, the 3’ amino terminal nucleotide on the 3’ end of the linear RNA molecule will undergo nucleophilic attack on the 5’-NHS-ester moiety, forming a new 5’ / 3’-amide bond.

[0508] In another aspect, linear RNA can be generated using a deoxyribonucleotide template transcribed in a cell-free system (e.g., by in vitro transcription) to generate circular polyribonucleotides. The linear polyribonucleotide generates a splice-compatible polyribonucleotide that can self-splice to generate a circular polyribonucleotide.

[0509] In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide by: providing a linear polyribonucleotide; and self-splicing the linear polyribonucleotide under conditions suitable for splicing the 3’ and 5’ splice sites of the linear polyribonucleotide; thereby producing a circular polyribonucleotide.

[0510] In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide by: providing a deoxyribonucleotide encoding a linear polyribonucleotide; transcribing the deoxyribonucleotide in a cell-free system to produce a linear polyribonucleotide; optionally purifying the splice-compatible linear polyribonucleotide; and self-splicing the linear polyribonucleotide under conditions suitable for splicing the 3’ and 5’ splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide.

[0511] In some embodiments, the disclosure provides a method of producing a circular polyribonucleotide by: providing a deoxyribonucleotide encoding a linear polyribonucleotide; transcribing the deoxyribonucleotide in a cell-free system to produce a linear polyribonucleotide (wherein the transcribing occurs in solution under conditions suitable for splicing the 3’ and 5’ splice sites of the linear polyribonucleotide), thereby producing a circular polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises a 5’ split intron and a 3’ split intron (e.g., a self-splicing construct for producing a circular polyribonucleotide). In some embodiments, the linear polyribonucleotide comprises a 5’ annealing region and a 3’ annealing region.

[0512] Suitable conditions for in vitro transcription and / or self-splicing can include any conditions (e.g., a solution or buffer, such as an aqueous buffer or solution) that mimic physiological conditions in one or more aspects. In some embodiments, suitable conditions include between 0.1-100 mM Mg2+ions or salts thereof (e.g., 1-100 mM, 1-50 mM, 1-20 mM, 5-50 mM, 5-20 mM, or 5-15 mM). In some embodiments, suitable conditions include between 1-1000 mM K+ions or salts thereof such as KC1 (e.g., 1-1000 mM, 1-500 mM, 1-200 mM, 50-500 mM, 100-500 mM, or 100-300 mM). In some embodiments, suitable conditions include between 1-1000 mM CI ions or salts thereof such as KC1 (e.g., 1-1000 mM, 1-500 mM, 1-200 mM, 50-500 mM, 100-500 mM, or 100-300 mM). In some embodiments, suitable conditions include between 0.1-100 mM Mn2+ions or salts thereof such as MnCl2(e.g., 0.1-100 mM, 0.1-50 mM, 0.1-20 mM, 0.1-10 mM, 0.1-5 mM, 0.1-2 mM, 0.5-50 mM, 0.5-20 mM, 0.5-15 mM, 0.5-5 mM, 0.5-2 mM, or 0.1-10 mM). In some embodiments, suitable conditions include dithiothreitol (DTT) (e.g., 1-1000 mM, 1-500 mM, 1-200 mM, 50-500 mM, 100-500 mM, 100-300 mM, 0.1-100 mM, 0.1-50 mM, 0.1-20 mM, 0.1-10 mM, 0.1-5 mM, 0.1-2 mM, 0.5-50 mM, 0.5-20 mM, 0.5-15 mM, 0.5-5 mM, 0.5-2 mM, or 0.1-10 mM). In some embodiments, suitable conditions include between 0.1 mM and 100 mM ribonucleotide triphosphates (NTPs) (e.g., 0.1-100 mM, 0.1-50 mM, 0.1-10 mM, 1-100 mM, 1-50 mM, or 1-10 mM). In some embodiments, suitable conditions include a pH of 4 to 10 (e.g., a pH of 5 to 9, a pH of 6 to 9, or a pH of 6.5 to 8.5). In some embodiments, suitable conditions include a temperature of 4°C to 50°C (e.g., 10°C to 40°C, 15°C to 40°C, 20°C to 40°C, or 30°C to 40°C).

[0513] In some embodiments, the linear polyribonucleotide is generated from a deoxyribonucleic acid (e.g., a deoxyribonucleic acid described herein, such as a DNA vector, a linearized DNA vector, or a cDNA). In some embodiments, the linear polyribonucleotide is transcribed from the deoxyribonucleic acid by transcription in a cell-free system (e.g., in vitro transcription).

[0514] In another aspect, a circular polyribonucleotide can be generated in a cell (e.g., a prokaryotic cell or a eukaryotic cell). In some embodiments, an exogenous polyribonucleotide (e.g., a linear polyribonucleotide described herein or a DNA molecule encoding transcription of a linear polyribonucleotide described herein) is provided to a cell. The linear polyribonucleotide can be transcribed in the cell from the exogenous DNA molecule provided to the cell. The linear polyribonucleotide can be transcribed in the cell from an exogenous recombinant DNA molecule that is transiently provided to the cell. In some embodiments, the exogenous DNA molecule does not integrate into the genome of the cell. In some embodiments, the linear polyribonucleotide is transcribed in the cell from a recombinant DNA molecule that integrates into the genome of the cell.

[0515] In some embodiments, the cell is a prokaryotic cell. In some embodiments, the prokaryotic cell comprising a polynucleoribonucleotide described herein is a bacterial cell or an archaeal cell. For example, the prokaryotic cell comprising a polynucleoribonucleotide described herein can be an E. coli, a halophilic archaea (e.g., Haloferax volcaniii), a Sphingomonas, a cyanobacterium (e.g., Synechococcus elongatus, Spirulina (Arthrospira) genus, and Synechocystis spp.), a Streptomyces, an actinomycete (e.g., Nonomuraea, Kitasatospora, or Thermobifida), a Bacillus spp. (e.g., Bacillus subtilis, Bacillus anthracis, Bacillus cereus), a betaproteobacteria (e.g., Burkholderia), an alphaproteobacterial (e.g., Agrobacterium), a Pseudomonas (e.g., Pseudomonas putida), and an enterobacteria. The prokaryotic cell can be grown in a culture medium. The prokaryotic cell can be contained in a bioreactor.

[0516] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a unicellular eukaryotic cell. In some embodiments, the unicellular eukaryotic cell is a unicellular fungal cell, such as a yeast cell (e.g., Saccharomyces cerevisiae and other Saccharomyces spp., Brettanomyces spp., Schizosaccharomyces spp., Torulaspora spp., and Pichia spp.). In some embodiments, the unicellular eukaryotic cell is a unicellular animal cell. The unicellular animal cell can be a cell isolated from a multicellular animal and grown in culture, or a subcell thereof. In some embodiments, the unicellular animal cell is dedifferentiated. In some embodiments, the unicellular eukaryotic cell is a unicellular plant cell. The unicellular plant cell can be a cell isolated from a multicellular plant and grown in culture, or a subcell thereof. In some embodiments, the unicellular plant cell is dedifferentiated. In some embodiments, the unicellular plant cell is from a plant callus. In embodiments, the unicellular cell is a plant cell protoplast. In some embodiments, the unicellular eukaryotic cell is a unicellular eukaryotic algal cell, such as a unicellular green alga, diatom, euglenid, or dinoflagellate. Non-limiting examples of unicellular eukaryotic algae of interest include Dunaliella salina, Chlorella vulgaris, Chlorella zofingiensis, Haematococcus pluvialis, Neochloris oleoabundans and other Neochloris spp., Protosiphon botryoides, Botryococcus braunii, Cryptococcus spp., Chlamydomonas reinhardtii and other Chlamydomonas spp. In some embodiments, the unicellular eukaryotic cell is a protist cell. In some embodiments, the unicellular eukaryotic cell is a protozoan cell.

[0517] In some embodiments, the eukaryotic cell is a cell of a multicellular eukaryote. For example, the multicellular eukaryote can be selected from the group consisting of a vertebrate, an invertebrate, a multicellular fungus, a multicellular alga, and a multicellular plant. In some embodiments, the eukaryotic organism is a human. In some embodiments, the eukaryotic organism is a non-human vertebrate. In some embodiments, the eukaryotic organism is an invertebrate. In some embodiments, the eukaryotic organism is a multicellular fungus. In some embodiments, the eukaryotic organism is a multicellular plant. In embodiments, the eukaryotic cell is a human cell or a cell of a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a bovine, including a cow, a water buffalo, a bison, a sheep, a goat, and a musk ox; a pig; a camelid, including a camel, a llama, and an alpaca; a deer, an antelope; and an equid, including a horse and a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse, a guinea pig, a hamster, a squirrel), or a lagomorph (e.g., a rabbit, a hare). In embodiments, the eukaryotic cell is a cell of a bird, such as a member of the avian clade Galloanserae (e.g., a chicken, a turkey, a pheasant, a quail), the clade Anseriformes (e.g., a duck, a goose), the clade Palaeognathae (e.g., an ostrich, an emu), the clade Columbiformes (e.g., a dove, a pigeon), or the clade Psittaciformes (e.g., a parrot). In embodiments, the eukaryotic cell is a cell of an arthropod (e.g., an insect, an arachnid, a crustacean), a nematode, an annelid, a worm, or a mollusk. In embodiments, the eukaryotic cell is a cell of a multicellular plant, such as an angiosperm (which can be a dicot or a monocot) or a gymnosperm (e.g., a conifer, a cycad, a ginkgo, a gnetophyte), a fern, a horsetail, a clubmoss, or a liverwort. In embodiments, the eukaryotic cell is a cell of a eukaryotic multicellular alga.

[0518] The eukaryotic cell can be grown in a culture medium. The eukaryotic cell can be contained in a bioreactor.

[0519] In some embodiments, any of the methods described herein for producing a circular polyribonucleotide can be performed in a bioreactor. A bioreactor refers to any vessel in which a chemical or biological process is performed, the process involving a living organism or a biochemical active substance derived from such an organism. A bioreactor can be compatible with the cell-free methods described herein for producing circular RNA. Vessels for bioreactors can include culture flasks, culture dishes, or culture bags, which can be single-use (disposable), autoclavable, or sterilizable. Bioreactors can be made of glass, or they can be polymer-based, or they can be made of other materials.

[0520] Examples of bioreactors include, but are not limited to, stirred tank (e.g., well-mixed) bioreactors and tubular (e.g., plug flow) bioreactors, airlift bioreactors, membrane stirred tanks, rotary filter stirred tanks, vibration mixers, fluidized bed reactors, and membrane bioreactors. The mode of operation of a bioreactor can be a batch or continuous process. A bioreactor is continuous when reagents and product streams continuously enter and exit the system. Batch bioreactors can have continuous recirculation flow, but no continuous reagent feed or product harvest. Some methods of the disclosure involve large-scale production of circular polyribonucleotides. For large-scale production methods, the methods can be performed in a volume of 1 liter (L) to 50 L or more (e.g., 5 L, 10 L, 15 L, 20 L, 25 L, 30 L, 35 L, 40 L, 45 L, 50 L or more). In some embodiments, the methods can be performed in a volume of 5 L to 10 L, 5 L to 15 L, 5 L to 20 L, 5 L to 25 L, 5 L to 30 L, 5 L to 35 L, 5 L to 40 L, 5 L to 45 L, 10 L to 15 L, 10 L to 20 L, 10 L to 25 L, 20 L to 30 L, 10 L to 35 L, 10 L to 40 L, 10 L to 45 L, 10 L to 50 L, 15 L to 20 L, 15 L to 25 L, 15 L to 30 L, 15 L to 35 L, 15 L to 40 L, 15 L to 45 L, or 15 to 50 L. In some embodiments, a bioreactor can produce at least 1 g of circular RNA. In some embodiments, a bioreactor can produce 1-200 g of circular RNA (e.g., 1-10 g, 1-20 g, 1-50 g, 10-50 g, 10-100 g, 50-100 g, or 50-200 g of circular RNA). In some embodiments, the amount produced is measured per liter (e.g., 1-200 g per liter), per batch or reaction (e.g., 1-200 g per batch or reaction), or per unit time (e.g., 1-200 g per hour or per day). In some embodiments, more than one bioreactor can be used in series to increase production capacity (e.g., one, two, three, four, five, six, seven, eight, or nine bioreactors can be used in series).

[0521] In some embodiments, the cyclization efficiency is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or 100%. In some embodiments, the cyclization efficiency is at least about 40%. In some embodiments, the cyclization efficiency is between about 10% and about 100%; for example, the cyclization efficiency is about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, and about 99%. In some embodiments, the cyclization efficiency is between about 20% and about 80%. In some embodiments, the cyclization efficiency is between about 30% and about 60%. In some embodiments, the cyclization efficiency is about 40%.

[0522] Additional methods of making circular polyribonucleotides described herein are described in, for example, Khudyakov and Fields, Artificial DNA: Methods and Applications, CRC Press (2002); Zhao, Synthetic Biology: Tools and Applications (First Edition), Academic Press (2013); Muller and Appel, RNA Biol, 2017, 14(8): 1018-1027; and Egli and Herdewijn, Chemistry and Biology of Artificial Nucleic Acids, (First Edition), Wiley-VCH (2012). Other methods of making circular polyribonucleotides are described in, for example, International Publication No. WO 2022 / 247943, U.S. Patent No. US11000547, International Publication No. 2018 / 191722, International Publication No. WO 2019 / 236673, International Publication No. WO 2020 / 023595, International Publication No. WO 2022 / 204460, International Publication No. WO 2022 / 204464, International Publication No. WO 2022 / 204466, and International Publication No. 2022 / 261490.

[0523] Additional methods of synthesizing circular polyribonucleotides are described elsewhere (see, e.g., U.S. Patent No. US 6210931, U.S. Patent No. US 5773244, U.S. Patent No. US 5766903, U.S. Patent No. US 5712128, U.S. Patent No. US 5426180, U.S. Publication No. US20100137407, International Publication No. WO 1992001813, and International Publication No. WO 2010084371, and Petkovic et al., Nucleic Acids Res. 43:2454-65 (2015); the contents of each of which are incorporated herein by reference in their entirety).

[0524] Methods of purification

[0525] One or more purification steps can be included in the methods described herein. For example, in some embodiments, the linear polyribonucleotides are substantially enriched or pure (e.g., purified) prior to self-splicing the linear polyribonucleotides. In other embodiments, the linear polyribonucleotides are not purified prior to self-splicing the linear polyribonucleotides. In some embodiments, the resulting circular RNAs are purified.

[0526] Purification can include separating or enriching the desired reaction product from one or more undesired components, such as any unreacted starting materials, byproducts, enzymes, or other reaction components. For example, purification of the linear polyribonucleotides after transcription (e.g., in vitro transcription) in a cell-free system can include separating or enriching from the DNA template prior to self-splicing the linear polyribonucleotides. Purification of the circular RNA product after splicing can be used to separate or enrich the circular polyribonucleotides from their corresponding linear polyribonucleotides. Methods of purification of polyribonucleotides are known to those of skill in the art and include enzymatic purification or by chromatography.

[0527] In some embodiments, the purification method results in circular polyribonucleotides having less than 50% (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%) linear polyribonucleotides.

[0528] In some embodiments, the reference standard for the amount of linear polyribonucleotide molecules present in a formulation (e.g., a pharmaceutical formulation) is the presence of no more than 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 1 pg / ml, 10 pg / ml, 50 pg / ml, 100 pg / ml, 200 pg / ml, 300 pg / ml, 400 pg / ml, 500 pg / ml, 600 pg / ml, 700 pg / ml, 800 pg / ml, 900 pg / ml, 1 mg / ml, 1.5 mg / ml, or 2 mg / ml of linear polyribonucleotide molecules.

[0529] In some embodiments, the reference standard for the amount of circular polyribonucleotide molecules present in a formulation (e.g., a pharmaceutical formulation) is that the molecules comprise at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93% (w / w), 94% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), 99.1% (w / w), 99.2% (w / w), 99.3% (w / w), 99.4% (w / w), 99.5% (w / w), 99.6% (w / w), 99.7% (w / w), 99.8% (w / w), 99.9% (w / w), or 100% (w / w) of the total ribonucleotide molecules in the formulation.

[0530] In some embodiments, the reference standard for the amount of linear polyribonucleotide molecules present in a formulation (e.g., a pharmaceutical formulation) is that the linear polyribonucleotide molecules comprise no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) of the total ribonucleotide molecules in the formulation.

[0531] In some embodiments, the reference standard for the amount of nicked polyribonucleotide molecules present in a preparation (e.g., a pharmaceutical preparation) is that the nicked polyribonucleotide molecules comprise no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), or 15% (w / w) of the total ribonucleotide molecules in the preparation.

[0532] In some embodiments, the reference standard for the amount of the combination of nicked and linear polyribonucleotide molecules present in a preparation is that the combination of nicked and linear polyribonucleotide molecules comprise no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) of the total ribonucleotide molecules in the preparation. In some embodiments, the preparation (e.g., a pharmaceutical preparation) is an intermediate preparation of a final cyclic polyribonucleotide finished pharmaceutical. In some embodiments, the preparation (e.g., a pharmaceutical preparation) is a drug substance or active pharmaceutical ingredient (API). In some embodiments, the preparation (e.g., a pharmaceutical preparation) is a finished pharmaceutical for administration to a subject.

[0533] In some embodiments, a preparation (e.g., a pharmaceutical preparation) of a cyclic polyribonucleotide is further processed (before, during, or after reduction of linear polyribonucleotides) to substantially remove DNA, protein contaminants (e.g., cellular proteins (such as host cell proteins) or protein process impurities), endotoxins, mononucleotide molecules, and / or process-related impurities.

[0534] Linear polyribonucleotide elements

[0535] Linear polyribonucleotides comprise elements as described herein as described below.

[0536] Linear polyribonucleotides described herein are polyribonucleotide molecules having a 5' end and a 3' end. In some embodiments, a linear RNA has a free 5' end or 3' end. In some embodiments, a linear RNA has a 5' end or 3' end that is modified or protected from degradation. In some embodiments, a linear RNA has a 5' or 3' end that is non-covalently attached. In some embodiments, a linear RNA is an mRNA.

[0537] In some embodiments, the linear polyribonucleotide is at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,000 nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides.

[0538] A linear polyribonucleotide of the present disclosure can include any element or combination of elements described herein, e.g., any element or combination of elements described above with respect to a circular polyribonucleotide. A linear polyribonucleotide can include any one or more IRES, signal sequence, regulatory element, cleavage domain, translation initiation sequence, untranslated region, termination element, or modification as described herein (e.g., with respect to a circular polyribonucleotide described above). A linear polyribonucleotide can include any number or configuration of such elements described herein (e.g., with respect to a circular polyribonucleotide described above).

[0539] Methods of use

[0540] A polyribonucleotide described herein (e.g., in a pharmaceutical composition) can be administered to a subject. For example, a circular or lin...

Claims

1. A circular polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a first spacer element of at least 100 ribonucleotides in length; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element; and (e) a second post-circularization element; and wherein the first post-circularization element and the second post- circularization element together form a circularization junction.

2. A circular polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-circularization element; (b) a first spacer element; (c) a polyribonucleotide cargo encoding an immunogen; (d) a second spacer element of at least 100 ribonucleotides in length; and (e) a second post-circularization element; and wherein the first post-circularization element and the second post- circularization element together form a circularization junction.

3. The circular polyribonucleotide of claim 1 or 2, wherein the first spacer element is between 100 and 500 ribonucleotides in length.

4. The circular polyribonucleotide of claim 3, wherein the second spacer element is between 100 and 500 ribonucleotides in length.

5. The circular polyribonucleotide of claim 4, wherein the first spacer element and the second spacer element each comprise between 110 and 500 ribonucleotides.

6. The circular polyribonucleotide of claim 5, wherein the first spacer element and the second spacer element each comprise between 120 and 500 ribonucleotides.

7. The circular polyribonucleotide of claim 6, wherein the first spacer element and the second spacer element each are between 150 and 500 ribonucleotides in length.

8. The circular polyribonucleotide of claim 7, wherein the first spacer element and the second spacer element each are between 200 and 500 ribonucleotides in length.

9. The circular polyribonucleotide of claim 4, wherein the first spacer element and the second spacer element each are between 100 and 300 ribonucleotides in length.

10. The circular polyribonucleotide of claim 9, wherein the first spacer element and the second spacer element each are between 100 and 200 ribonucleotides in length.

11. The circular polyribonucleotide of claim 9, wherein the first spacer element and the second spacer element each are between 110 and 300 ribonucleotides in length.

12. The circular polyribonucleotide of claim 11, wherein the first spacer element and the second spacer element each are between 120 and 300 ribonucleotides in length.

13. The circular polyribonucleotide of claim 12, wherein the first spacer element and the second spacer element each are between 150 and 300 ribonucleotides in length. ​ 14. The circular polyribonucleotide of any one of claims 1-13, wherein the difference between the length of the first spacer element and the length of the second spacer element is between 0 and 500 nucleotides.

15. The circular polyribonucleotide of any one of claims 14, wherein the difference between the length of the first spacer element and the length of the second spacer element is between 0 and 100 nucleotides.

16. The circular polyribonucleotide of claim 15, wherein the difference between the length of the first spacer element and the length of the second spacer element is between 0 and 50 nucleotides.

17. The circular polyribonucleotide of any one of claims 1-16, wherein the first spacer or the second spacer element consists of: (i) a poly-A region comprising between 80% and 100% adenosine residues; (ii) a poly-AC region comprising between 80% and 100% adenosine or cytosine residues; (iii) a poly-AU region comprising between 80% and 100% adenosine or uridine residues; or (iii) a poly-AG region comprising between 80% and 100% adenosine or guanosine residues.

18. The circular polyribonucleotide of any one of claims 1-17, wherein the circular polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide without the first spacer element or the second spacer element.

19. The circular polyribonucleotide of any one of claims 1-18, wherein the circular polyribonucleotide is detectable for at least 2-fold longer after administration of the circular polyribonucleotide to a subject compared to a polyribonucleotide without the first spacer element or the second spacer element.

20. The circular polyribonucleotide of any one of claims 1-19, wherein the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression compared to a polyribonucleotide without the first spacer element or the second spacer element.

21. The circular polyribonucleotide of any one of claims 1-20, wherein the polyribonucleotide cargo encoding an immunogen comprises an expression sequence.

22. The circular polyribonucleotide of claim 21, wherein the polyribonucleotide cargo encoding an immunogen comprises an IRES operably linked to an expression sequence.

23. The circular polyribonucleotide of claim 21 or 22, wherein the expression sequence further comprises a 3’ untranslated region or a 5’ untranslated region.

24. The circular polyribonucleotide of any one of claims 21-23, wherein the expression sequence encodes an immunogen.

25. The circular polyribonucleotide of any one of claims 1-24, wherein the polyribonucleotide comprises between 500 and 20,000 ribonucleotides.

26. The circular polyribonucleotide of claim 25, wherein the polyribonucleotide comprises between 2,000 and 20,000 ribonucleotides. ​ ​ ​ ​ 27. The circular polyribonucleotide of any one of claims 1-26, wherein the cyclization junction comprises a splice junction.

28. The circular polyribonucleotide of claim 27, wherein the first post-cyclization element comprises a first exon segment and the second post-cyclization element comprises a second exon segment, and wherein the first exon segment and the second exon segment are joined by the splice junction.

29. The circular polyribonucleotide of any one of claims 1-28, wherein the cyclization junction comprises an oligonucleotide splint that hybridizes to the first post-cyclization element and hybridizes to the second post-cyclization element.

30. The circular polyribonucleotide of claim 29, wherein the oligonucleotide splint is a DNA splint or an RNA splint.

31. The circular polyribonucleotide of claim 29 or 30, wherein the first post-cyclization element comprises a region that is capable of hybridizing to a first region of the oligonucleotide splint, and the second post-cyclization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint.

32. A linear polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-cyclization element; (b) a first spacer element that is at least 100 ribonucleotides in length; (c) a polyribonucleotide cargo that encodes an immunogen; (d) a second spacer element; and (e) a second post-cyclization element; and wherein the first post-cyclization element and the second post-cyclization element together form a cyclization junction.

33. A linear polyribonucleotide comprising, in the following order from 5' to 3': (a) a first post-cyclization element; (b) a first spacer element; (c) a polyribonucleotide cargo that encodes an immunogen; (d) a second spacer element that is at least 100 ribonucleotides in length; and (e) a second post-cyclization element; and wherein the first post-cyclization element and the second post-cyclization element together form a cyclization junction.

34. The linear polyribonucleotide of claim 32 or 33, wherein the first spacer element is between 100 and 500 ribonucleotides in length.

35. The linear polyribonucleotide of claim 34, wherein the second spacer element is between 100 and 500 in length.

36. The linear polyribonucleotide of claim 35, wherein the first spacer element and the second spacer element each comprise between 110 and 500 ribonucleotides.

37. The linear polyribonucleotide of claim 36, wherein the first spacer element and the second spacer element each comprise between 120 and 500 ribonucleotides.

38. The linear polyribonucleotide of claim 37, wherein the first spacer element and the second spacer element each are between 150 and 500 ribonucleotides in length. ​ 39. The linear polyribonucleotide of claim 38, wherein each of the first and second spacer elements is 200 to 500 ribonucleotides in length.

40. The linear polyribonucleotide of claim 35, wherein each of the first and second spacer elements is 100 to 300 ribonucleotides in length.

41. The linear polyribonucleotide of claim 40, wherein each of the first and second spacer elements is 100 to 200 ribonucleotides in length.

42. The linear polyribonucleotide of claim 40, wherein each of the first and second spacer elements is 110 to 300 ribonucleotides in length.

43. The linear polyribonucleotide of claim 42, wherein each of the first and second spacer elements is 120 to 300 ribonucleotides in length.

44. The linear polyribonucleotide of claim 43, wherein each of the first and second spacer elements is 150 to 300 ribonucleotides in length.

45. The linear polyribonucleotide of any one of claims 32-44, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 500 nucleotides.

46. The linear polyribonucleotide of claim 45, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 100 nucleotides.

47. The linear polyribonucleotide of claim 46, wherein the difference between the length of the first spacer element and the length of the second spacer element is 0 to 50 nucleotides.

48. The linear polyribonucleotide of any one of claims 32-47, wherein the first or second spacer element consists of: (i) a poly-A region comprising 80% to 100% adenosine residues; (ii) a poly-AC region comprising between 80% to 100% adenosine or cytosine residues; (iii) a poly-AU region comprising between 80% to 100% adenosine or uridine residues; or (iv) a poly-AG region comprising between 80% to 100% adenosine or guanosine residues.

49. The linear polyribonucleotide of any one of claims 32-48, wherein the polyribonucleotide exhibits at least 2-fold greater stability compared to a polyribonucleotide that does not have the first or second spacer element.

50. The linear polyribonucleotide of any one of claims 32-49, wherein the polyribonucleotide is detectable for at least 2-fold longer after administration of the polyribonucleotide to a subject compared to a polyribonucleotide that does not have the first or second spacer element.

51. The linear polyribonucleotide of any one of claims 32-50, wherein the polynucleotide cargo encodes an immunogen, wherein the immunogen has at least 4-fold greater expression compared to a polyribonucleotide that does not have the first spacer element or the second spacer element.

52. The linear polyribonucleotide of any one of claims 32-51, wherein the polyribonucleotide cargo encoding an immunogen comprises an expression sequence.

53. The linear polyribonucleotide of claim 52, wherein the polyribonucleotide cargo encoding an immunogen comprises an IRES operably linked to an expression sequence.

54. The linear polyribonucleotide of claim 52 or 53, wherein the expression sequence further comprises a 3’ untranslated region or a 5’ untranslated region.

55. The linear polyribonucleotide of any one of claims 52-54, wherein the expression sequence encodes an immunogen.

56. The linear polyribonucleotide of any one of claims 32-55, wherein the polyribonucleotide comprises between 500 and 20,000 ribonucleotides.

57. The linear polyribonucleotide of claim 56, wherein the polyribonucleotide comprises between 2,000 and 20,000 ribonucleotides.

58. The linear polyribonucleotide of any one of claims 21-57, wherein the cyclization junction comprises a splice junction.

59. The linear polyribonucleotide of claim 58, wherein the first post-cyclization element comprises a first exon segment and the second post-cyclization element comprises a second exon segment, and wherein the first exon segment and the second exon segment are joined by the splice junction.

60. The linear polyribonucleotide of any one of claims 32-59, wherein the cyclization junction comprises an oligonucleotide splint that hybridizes to the first post-cyclization element and hybridizes to the second post-cyclization element.

61. The linear polyribonucleotide of claim 60, wherein the oligonucleotide splint is a DNA splint or an RNA splint.

62. The linear polyribonucleotide of claim 60 or 61, wherein the first post-cyclization element comprises a region that is capable of hybridizing to a first region of the oligonucleotide splint, and the second post-cyclization element comprises a region that is capable of hybridizing to a second region of the oligonucleotide splint.

63. The linear polyribonucleotide of any one of claims 32-62, wherein: the first cyclization element comprises a first catalytic intron segment, a first splice site dinucleotide, and a first exon segment; and the second cyclization element comprises a second catalytic intron segment, a second splice site dinucleotide, and a second exon segment.

64. The linear polyribonucleotide of claim 63, wherein the first catalytic intron segment and the second catalytic intron segment are together capable of self-splicing, thereby covalently joining the first exon region and the second exon region to produce a circular polyribonucleotide.

65. The linear polyribonucleotide of claim 63 or 64, wherein the first catalytic intron fragment and the second catalytic intron fragment are from an Anabaena pre-tRNA-Leu gene or a Tetrahymena pre-rRNA.

66. The linear polyribonucleotide of any one of claims 32-65, wherein the first circularization element comprises a region capable of hybridizing to a first region of an oligonucleotide splint, and the second circularization element comprises a region capable of hybridizing to a second region of the oligonucleotide splint.

67. A DNA vector comprising an RNA polymerase promoter operably linked to a sequence encoding the linear polyribonucleotide of any one of claims 32-66.

68. A circular polyribonucleotide produced from the linear polyribonucleotide of any one of claims 32-66 or from the DNA vector of claim 67.

69. A pharmaceutical composition comprising the linear polyribonucleotide, circular polyribonucleotide, or DNA vector of any one of claims 1-66, and a pharmaceutically acceptable excipient.

70. A method of expressing an immunogen in a cell or subject, the method comprising providing the cell or the subject with the linear polyribonucleotide, circular polyribonucleotide, DNA vector, or pharmaceutical composition of one of claims 1-69.

71. A method of producing a circular polyribonucleotide from the linear polyribonucleotide of any one of claims 1-66, the method comprising providing the linear polyribonucleotide under conditions suitable for self-splicing of the linear polyribonucleotide to produce a circular polyribonucleotide.

Images