Compositions comprising circular polyribonucleotides and uses thereof

Abstract

The present invention relates generally to pharmaceutical compositions and formulations of circular polyribonucleotides and uses thereof.

Description

[0001] Cross-reference to related applications

[0002] This application claims and benefits from the following priorities: U.S. Provisional Application No. 62 / 702,714, filed July 24, 2018; No. 62 / 823,569, filed March 25, 2019; and No. 62 / 863,670, filed June 19, 2019, the entire contents of each of which are incorporated herein by reference. background

[0003] Certain cyclic polyribonucleotides are ubiquitous in human tissues and cells, including those of healthy individuals. Overview

[0004] The present invention described herein includes compositions comprising cyclic polynucleotides and methods of using thereof.

[0005] In some aspects, a method of binding a target in a cell includes providing an untranslatable cyclic polynucleotide comprising an aptamer sequence having a secondary structure for binding the target; and delivering the untranslatable cyclic polynucleotide to a cell, wherein the untranslatable cyclic polynucleotide forms a detectable complex with the target at least 5 days after delivery. In some embodiments, the target is selected from the group consisting of nucleic acid molecules, small molecules, proteins, carbohydrates, and lipids. In some embodiments, the target is a gene regulatory protein. In some embodiments, the gene regulatory protein is a transcription factor. In some embodiments, the nucleic acid molecule is a DNA molecule or an RNA molecule. In some embodiments, the complex regulates gene expression. In some embodiments, the complex regulates directed transcription of DNA molecules, epigenetic remodeling of DNA molecules, or degradation of DNA molecules. In some embodiments, the complex regulates target degradation, target translocation, or target signal transduction. In some embodiments, gene expression is associated with the pathogenesis of a disease or condition. In some embodiments, the complex is detectable at least 7, 8, 9, or 10 days after delivery. In some embodiments, the untranslatable cyclic polynucleotide is present at least five days after delivery. In some embodiments, the untranslatable cyclic polynucleotide is present for at least 6, 7, 8, 9, or 10 days after delivery. In some embodiments, the untranslatable cyclic polynucleotide is an unmodified untranslatable cyclic polynucleotide. In some embodiments, the untranslatable cyclic polynucleotide has a quasi-double-stranded secondary structure. In some embodiments, the aptamer sequence further has a target-binding tertiary structure. In some embodiments, the cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a human cell.

[0006] In some aspects, methods for binding transcription factors in cells include providing an untranslatable cyclic polynucleotide containing an aptamer sequence that binds to the transcription factor; and delivering the untranslatable cyclic polynucleotide to the cell, wherein the untranslatable cyclic polynucleotide forms a complex with the transcription factor and regulates gene expression.

[0007] In some aspects, a method for chelating transcription factors in cells includes: providing an untranslatable cyclic polynucleotide comprising an aptamer sequence that binds to the transcription factor; and delivering the untranslatable cyclic polynucleotide to a cell, wherein the untranslatable cyclic polynucleotide chelates the transcription factor by binding to it to form a complex in the cell. In some embodiments, cell viability decreases after the complex is formed.

[0008] In some aspects, methods for sensitizing cells to cytotoxic agents include providing an untranslatable cyclic polynucleotide (cRP) comprising an aptamer sequence that binds to a transcription factor; and delivering the cytotoxic agent and the untranslatable cRP to cells, wherein the untranslatable cRP forms a complex with the transcription factor in the cells; thereby sensitizing the cells to the cytotoxic agent compared to cells lacking the untranslatable cRP. In some embodiments, sensitizing cells to the cytotoxic agent results in a decrease in cell viability following delivery of the cytotoxic agent and the untranslatable cRP. In some embodiments, the decreased cell viability is 40% or more, occurring at least two days after delivery of the cytotoxic agent and the untranslatable cRP.

[0009] In some aspects, methods for binding pathogenic proteins in cells include: providing an untranslatable cyclic polynucleotide containing an aptamer sequence for binding the pathogenic protein; and delivering the untranslatable cyclic polynucleotide to the cell, wherein the untranslatable cyclic polynucleotide forms a complex with the pathogenic protein to degrade the pathogenic protein.

[0010] In some aspects, methods of binding ribonucleic acid molecules in cells include: providing an untranslatable cyclic polynucleotide containing a sequence complementary to the sequence of the ribonucleic acid molecule; and delivering the untranslatable cyclic polynucleotide to the cell, wherein the untranslatable cyclic polynucleotide forms a complex with the ribonucleic acid molecule.

[0011] In some aspects, methods for binding genomic deoxyribonucleic acid (DNA) molecules in cells include providing an untranslatable cyclic polynucleotide (cRP) containing an aptamer sequence that binds to the DNA molecule; and delivering the untranslatable cRP to the cell, wherein the untranslatable cRP forms a complex with the DNA molecule and regulates gene expression.

[0012] In some aspects, methods of binding small molecules in cells include providing an untranslatable cyclic polynucleotide comprising an aptamer sequence that binds to the small molecule; and delivering the untranslatable cyclic polynucleotide to the cell, wherein the untranslatable cyclic polynucleotide forms a complex with the small molecule and modulates cellular processes. In some embodiments, the small molecule is an organic compound with a molecular weight not exceeding 900 Daltons that modulates cellular processes. In some embodiments, the small molecule is a drug. In some embodiments, the small molecule is a fluorophore. In some embodiments, the small molecule is a metabolite.

[0013] In some aspects, the composition comprises an untranslatable cyclic polynucleotide containing an aptamer sequence having a secondary structure for binding a target.

[0014] In some aspects, the pharmaceutical composition comprises an untranslatable cyclic polynucleotide containing an aptamer sequence having a secondary structure for binding the target; and a pharmaceutically acceptable carrier or excipient.

[0015] In some respects, cells contain untranslatable cyclic polynucleotides as described herein.

[0016] In some respects, methods of treating subjects in need include administering compositions as described herein or pharmaceutical compositions as described herein.

[0017] In some respects, polynucleotides are polynucleotides that encode untranslatable cyclic polynucleotides as described herein.

[0018] In some respects, the method is to produce the untranslatable cyclic polynucleotides described herein.

[0019] In some aspects, the pharmaceutical composition comprises a cyclic polynucleotide containing a binding site for a target, such as RNA, DNA, protein, cell membrane, etc.; and a pharmaceutically acceptable carrier or excipient; wherein the target and the cyclic polynucleotide form a complex, and wherein the target is not microRNA. In some aspects, the pharmaceutical composition comprises a cyclic polynucleotide containing: a first binding site for binding a first target, and a second binding site for binding a second target; and a pharmaceutically acceptable carrier or excipient; wherein the first binding site is different from the second binding site, and wherein both the first target and the second target are microRNAs. In some embodiments, the binding site contains an aptamer sequence. In some embodiments, the first binding site contains a first aptamer sequence, and the second binding site contains a second aptamer sequence. In some embodiments, the aptamer sequence has a secondary structure for binding a target. In some embodiments, the first aptamer sequence has a secondary structure for binding a first target, and the second aptamer sequence has a secondary structure for binding a second target. In some embodiments, the binding site is a first binding site, and the target is a first target. In some embodiments, the cyclic polynucleotide further contains a second binding site for binding a second target. In some embodiments, the first target comprises a first cyclic polynucleotide (circRNA) binding motif. In some embodiments, the second target comprises a second cyclic polynucleotide (circRNA) binding motif. In some embodiments, the first target, the second target, and the cyclic polynucleotide form a complex. In some embodiments, the first and second targets interact with each other. In some embodiments, the complex regulates cellular processes. In some embodiments, the first and second targets are identical, and the first binding site and the second binding site bind to different binding sites on the first and second targets. In some embodiments, the first and second targets are different. In some embodiments, the cyclic polynucleotide further comprises one or more additional binding sites binding to a third or more targets. In some embodiments, one or more targets are identical, and one or more additional binding sites bind to different binding sites on one or more targets. In some embodiments, the formation of the complex regulates cellular processes. In some embodiments, the cyclic polynucleotide regulates cellular processes associated with the first or second target upon contact with the first or second target. In some embodiments, the first and second targets interact with each other in the complex. In some embodiments, the cellular processes are related to the pathogenesis of a disease or condition. In some embodiments, the cellular processes are different from the translation of the cyclic polynucleotide. In some embodiments, the first target comprises a deoxyribonucleic acid (DNA) molecule, and the second target comprises a protein. In some embodiments, the complex regulates the directed transcription of DNA molecules, epigenetic remodeling of DNA molecules, or degradation of DNA molecules. In some embodiments, the first target comprises a first protein, and the second target comprises a second protein.In some embodiments, the complex regulates the degradation of a first protein, the translocation of a first protein, or signal transduction, or modulates the function of a native protein, inhibiting or regulating the formation of a complex formed through direct interaction between a first protein and a second protein. In some embodiments, the first target or the second target is a ubiquitin ligase. In some embodiments, the first target comprises a first ribonucleic acid (RNA) molecule, and the second target comprises a second RNA molecule. In some embodiments, the complex regulates the degradation of the first RNA molecule. In some embodiments, the first target comprises a protein, and the second target comprises an RNA molecule. In some embodiments, the complex regulates protein translocation or inhibits the formation of a complex formed through direct interaction between a protein and an RNA molecule. In some embodiments, the first target is a receptor, and the second target is a substrate of the receptor. In some embodiments, the complex inhibits receptor activation.

[0020] In some aspects, the pharmaceutical composition comprises a cyclic polynucleotide containing a binding site for a target; and a pharmaceutically acceptable carrier or excipient; wherein the cyclic polynucleotide is untranslatable or defectively translated, and wherein the target is not a microRNA. In some aspects, the pharmaceutical composition comprises a cyclic polynucleotide containing a binding site for a target, wherein the target contains a ribonucleic acid (RNA) binding motif; and a pharmaceutically acceptable carrier or excipient; wherein the cyclic polynucleotide is untranslatable or defectively translated, and wherein the target is a microRNA. In some embodiments, the binding site comprises an aptamer sequence having a secondary structure for binding the target. In some embodiments, the target comprises a DNA molecule. In some embodiments, the binding of the target to the cyclic polynucleotide regulates transcriptional interference of the DNA molecule. In some embodiments, the target comprises a protein. In some embodiments, the binding of the target to the cyclic polynucleotide regulates the interaction of the protein with other molecules. In some embodiments, the protein is a receptor, and the binding of the target to the cyclic polynucleotide activates the receptor. In some embodiments, the protein is a first enzyme, wherein the cyclic polynucleotide further includes a second binding site for binding to a second enzyme, and wherein the binding of the first and second enzymes to the cyclic polynucleotide regulates the enzymatic activity of the first and second enzymes. In some embodiments, the protein is a ubiquitin ligase. In some embodiments, the target comprises a messenger RNA (mRNA) molecule. In some embodiments, the binding of the target to the cyclic polynucleotide regulates interference in the translation of the mRNA molecule. In some embodiments, the target comprises a ribosome. In some embodiments, the binding of the target to the cyclic polynucleotide regulates interference in the translation process. In some embodiments, the target comprises a cyclic RNA molecule. In some embodiments, the binding of the target to the cyclic polynucleotide chelates the cyclic RNA molecule. In some embodiments, the binding of the target to the cyclic polynucleotide chelates microRNA molecules.

[0021] In some aspects, the pharmaceutical composition comprises a cyclic polynucleotide comprising: a binding site for binding to a cell membrane (e.g., cell wall membrane, organelle membrane, etc.), wherein the cell membrane contains a ribonucleic acid (RNA) binding motif; and a pharmaceutically acceptable carrier or excipient. In some embodiments, the binding site comprises an aptamer sequence having a secondary structure for binding to a cell membrane (e.g., cell wall membrane, organelle membrane, etc.). In some embodiments, the cyclic polynucleotide further comprises a second binding site for binding to a second target, wherein the second target contains a second RNA binding motif. In some embodiments, the cyclic polynucleotide binds to a cell membrane and a second target. In some embodiments, the cyclic polynucleotide further comprises a second binding site for binding to a second cellular target, and wherein the binding of the cyclic polynucleotide to the cellular target and the second cellular target induces a conformational change in the cellular target, thereby inducing downstream signal transduction of the cellular target. In some embodiments, the cyclic polynucleotide is untranslatable or defectively translated. In some embodiments, the cyclic polynucleotide further comprises at least one structural element selected from the group consisting of: a) an encryptogen; b) a splicing element; c) a regulatory sequence; d) a replication sequence; e) a quasi-double-stranded secondary structure; f) a quasi-helical structure; and g) an expression sequence. In some embodiments, the quasi-helical structure comprises at least one double-stranded RNA segment and at least one non-double-stranded segment. In some embodiments, the quasi-helical structure comprises a first sequence and a second sequence linked to a repetitive sequence. In some embodiments, the encryptogen comprises a splicing element. In some embodiments, the cyclic polynucleotide comprises at least one modified nucleic acid. In some embodiments, at least one modified nucleic acid is selected from the group consisting of: 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamido (2'-O-NMA), locked nucleic acid (LNA), ethylene nucleic acid (ENA), peptide nucleic acid (PNA), 1',5'-dehydrated hexadiol nucleic acid (HNA), morpholino, methylphosphonate nucleotide, thiol phosphonate nucleotide, and 2'-fluoroN3-P5'-phosphoramide. In some embodiments, the cryptogenerator comprises at least one modified nucleic acid. In some embodiments, the cryptogenerator comprises a protein binding site. In some embodiments, the cryptogen contains an immune protein binding site.In some embodiments, the immunogenicity of the circular polynucleotide is at least 2-fold lower than that of its codon-deficient counterpart, as assessed by expression, signaling, or activation of at least one of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-β. In some embodiments, the circular polynucleotide is about 20 bases to about 20 kb in size. In some embodiments, the circular polynucleotide is synthesized by cyclization of a linear polynucleotide. In some embodiments, the circular polynucleotide is substantially resistant to degradation.

[0022] In some aspects, the pharmaceutical composition comprises a cyclic polynucleotide containing a binding site for a target, wherein the target contains a ribonucleic acid (RNA) binding motif; and a pharmaceutically acceptable carrier or excipient, wherein the cyclic polynucleotide comprises at least one modified nucleotide and a first portion containing at least about 5, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 consecutive unmodified nucleotides. In some aspects, the pharmaceutical composition comprises a cyclic polynucleotide containing a binding site for a target, wherein the target comprises a ribonucleic acid (RNA) binding motif; and a pharmaceutically acceptable carrier or excipient, wherein the cyclic polynucleotide comprises at least one modified nucleotide and a first portion containing at least about 5, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 consecutive nucleotides, and wherein the first portion lacks pseudouridine or 5'-methylcytidine. In some embodiments, the binding site comprises an aptamer sequence having a secondary structure of the target. In some embodiments, the immunogenicity of the cyclic polynucleotide is lower than that of the corresponding unmodified cyclic polynucleotide. In some embodiments, the cyclic polynucleotide has at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 times lower immunogenicity than the corresponding unmodified cyclic polynucleotide, as assessed by expression, signaling, or activation of at least one of the group consisting of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-β. In some embodiments, the cyclic polynucleotide has a longer half-life than the corresponding unmodified cyclic polynucleotide. In some embodiments, the half-life of the cyclic polynucleotide is at least about 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 times longer than that of the corresponding unmodified cyclic polynucleotide. In some embodiments, the half-life is measured by introducing the cyclic polynucleotide or the corresponding unmodified cyclic polynucleotide into a cell and measuring the level of the introduced cyclic polynucleotide or the corresponding cyclic polynucleotide within the cell.In some embodiments, at least one modified nucleotide is selected from the group consisting of N(6)-methyladenosine (m6A), 5'-methylcytidine, and pseudouridine. In some embodiments, at least one modified nucleic acid is selected from the group consisting of: 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamido (2'-O-NMA), locked nucleic acid (LNA), ethylene nucleic acid (ENA), peptide nucleic acid (PNA), 1',5'-dehydrated hexadiol nucleic acid (HNA), morpholino, methylphosphonate nucleotide, thiol phosphonate nucleotide, and 2'-fluoroN3-P5'-phosphamide. In some embodiments, at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the nucleotides in the cyclic polynucleotide are modified nucleotides. In some embodiments, the cyclic polynucleotide includes a binding site composed of unmodified nucleotides, which binds to proteins, DNA, RNA, or cellular targets. In some embodiments, the cyclic polynucleotide includes an internal ribosome entry site (IRES) composed of unmodified nucleotides. In some embodiments, the binding site is composed of unmodified nucleotides. In some embodiments, the binding site includes an IRES composed of unmodified nucleotides. In some embodiments, a first portion includes a binding site for binding to proteins, DNA, RNA, or cellular targets. In some embodiments, the first portion includes an IRES. In some embodiments, the cyclic polynucleotide includes one or more expression sequences. In some embodiments, the cyclic polynucleotide includes one or more expression sequences and an IRES, wherein the cyclic polynucleotide includes 5'-methylcytidine, pseudouridine, or a combination thereof in addition to the IRES. In some embodiments, one or more expression sequences of the cyclic polynucleotide are configured to have a higher translation efficiency than the corresponding unmodified cyclic polynucleotide. In some embodiments, one or more expressed sequences of the cyclic polynucleotide have a translation efficiency at least about 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, or 3 times higher than that of the corresponding unmodified cyclic polynucleotide. In some embodiments, the translation efficiency of one or more expressed sequences of the cyclic polynucleotide is higher than that of the corresponding cyclic polynucleotide having a first portion comprising a modified nucleotide.In some embodiments, the translation efficiency of one or more expressed sequences of a cyclic polynucleotide is higher than that of a corresponding cyclic polynucleotide having a first portion comprising more than 10% modified nucleotides. In some embodiments, one or more expressed sequences of a cyclic polynucleotide have a translation efficiency at least about 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 times higher than that of a corresponding cyclic polynucleotide (having a first portion comprising modified nucleotides). In some embodiments, the translation efficiency is measured in cells containing the cyclic polynucleotide or the corresponding cyclic polynucleotide or in an in vitro translation system (e.g., in rabbit reticulocyte lysate). In some embodiments, the cyclic polynucleotide is any of the cyclic polynucleotides in the disclosed embodiments.

[0023] In some respects, treatment methods include administering a pharmaceutical composition of any of the aforementioned disclosed embodiments to a subject suffering from a disease or condition.

[0024] In some respects, methods for preparing pharmaceutical compositions include generating a cyclic polynucleotide of any of the disclosed embodiments.

[0025] In some aspects, the composition of any of the embodiments is formulated in a carrier such as a membrane or lipid bilayer.

[0026] In some aspects, the method for preparing the cyclic polynucleotide of any of the disclosed embodiments includes cyclizing a linear polynucleotide having a nucleic acid sequence into a cyclic polynucleotide.

[0027] In some respects, the engineered cells comprise compositions of any of the disclosed embodiments.

[0028] By incorporating via reference

[0029] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the extent that each publication, patent or patent application is expressly and individually indicated to be incorporated herein by reference. Attached Figure Description

[0030] This patent or application document contains at least one color drawing. A copy of this patent or patent application disclosure having one or more color drawings will be provided by the Patent Office upon request and upon payment of the necessary fees. Embodiments of the invention described in the following detailed description will be better understood when read in conjunction with the drawings. For the purpose of illustrating the invention, exemplary embodiments of the invention are shown in the drawings. However, it should be understood that the invention is not limited to the precise arrangement and means of the embodiments shown in the drawings.

[0031] Figure 1 An exemplary cyclic polynucleotide molecular scaffold is shown.

[0032] Figure 2 An exemplary transribozyme cyclic polynucleotide is shown.

[0033] Figure 3 A schematic diagram of protein expression via cyclic polynucleotides is shown.

[0034] Figure 4 An exemplary cyclic polynucleotide molecular scaffold for lipids, such as membranes, is shown.

[0035] Figure 5A An exemplary circular polynucleotide molecular scaffold for DNA is shown.

[0036] Figure 5B An exemplary circular polynucleotide molecular scaffold with sequence-specific DNA-binding motifs is shown. circRNA can bind to the major groove of the DNA duplex to form parallel or antiparallel triple-stranded structures based on the orientation of the third strand. Exemplary parallel triple-stranded structures include TA·U, CG·G, and CG·C (DNA / DNA / RNA). Exemplary antiparallel triple-stranded structures include TA·A, TA·U, and CG·G (DNA / DNA / RNA).

[0037] Figure 5C An exemplary cyclic polynucleotide molecular scaffold is shown, which has a DNA-binding motif specific to the enhancer region of the DHFR gene to interfere with transcription factor binding and / or mRNA transcription.

[0038] Figure 5D An exemplary cyclic polynucleotide molecular scaffold is shown, which has a DNA-binding motif specific to the enhancer region of the MEG3 gene to interfere with transcription factor binding and / or mRNA transcription.

[0039] Figure 5E An exemplary cyclic polynucleotide molecular scaffold is shown, which has a DNA-binding motif specific to the enhancer region of the EPS gene to interfere with transcription factor binding and / or mRNA transcription.

[0040] Figure 6 An exemplary cyclic polynucleotide molecular scaffold for RNA is shown.

[0041] Figure 7A An exemplary circular polynucleotide molecular scaffold is shown to chelate and / or degrade target RNA.

[0042] Figure 7B An exemplary cyclic polynucleotide molecular scaffold is shown for RNA and enzymes targeting RNA (e.g., uncapping enzymes that induce RNA degradation).

[0043] Figure 7C An exemplary cyclic polynucleotide molecular scaffold is shown for RNA, DNA, and proteins (e.g., driving the translation of target genes).

[0044] Figure 8 Exemplary cyclic polynucleotide molecular scaffolds for proteins such as FUS / TDP43 / ATXN2, PRPF8, GEMIN5, CUG BP1, and LIN28A are shown.

[0045] Figure 9A , 9B 9C showed that the modified circular RNA binds to the protein translation machinery in the cell.

[0046] Figure 10A , 10B 10C showed that, compared with unmodified circular RNA in cells, modified circular RNA exhibited reduced binding to immune proteins, as assessed by activation of immune-related genes (MDA5, OAS, and IFN-β expression).

[0047] Figure 11 The results showed that, compared with unmodified circular RNA, the hybridized circular RNA had reduced immunogenicity, as assessed by the expression of RIG-I, MDA5, IFN-β, and OAS in cells.

[0048] Figure 12 This indicates that, compared to linear aptamers, circular RNA aptamers exhibit increased intracellular delivery and enhanced binding to small molecule targets.

[0049] Figure 13 This illustrates the binding of a circular RNA containing a protein-binding motif to a target protein.

[0050] Figure 14 This indicates that the small molecule-circular RNA conjugate binds to the protein targeted by the small molecule.

[0051] Figure 15This demonstrates the interaction between circular RNA-small molecule conjugates and specific bioactive proteins.

[0052] Figure 16 The diagram shows a circRNA with two binding sites that can act as a scaffold, for example, to form a complex with an enzyme (Enz) and a target substrate (substrate), thereby facilitating the enzyme's modification of the target substrate (M).

[0053] Figure 17 Images from electrophoretic mobility shift assay (EMSA) are shown, demonstrating that RNA with out-of-order binding aptamer sequences did not show binding affinity to the NF-κB p50 subunit, while both linear and circular RNAs with NF-κB binding aptamer sequences bound to the p50 subunit with similar affinity.

[0054] Figure 18 The results showed that treatment with circular RNA containing the NF-κB binding aptamer sequence resulted in a decrease in cell viability of A549 cells compared to its linear counterpart.

[0055] Figure 19 The results showed that co-treatment with linear RNA and doxorubicin (dox) on day 2 reduced cell viability, and co-treatment with cyclic aptamers and dox on days 1 and 2 resulted in more cell death in the dox-resistant A549 lung cancer cell line.

[0056] Figure 20 This is a schematic diagram showing an exemplary circular RNA that is delivered into a cell and tags the target BRD4 protein in the cell for degradation via the ubiquitin system.

[0057] Figure 21 Western blot images and quantitative plots are shown, indicating that circular RNA containing phthalimide piperidone and the small molecule JQ1 can degrade BRD4 in cells.

[0058] Figure 22 The images show aptamer fluorescence at different time points following delivery of circular RNA (circular aptamer) or linear RNA (linear aptamer) to HeLa cell cultures when bound to TO-1 biotin. The fluorescence images (top panel) show aptamer fluorescence when bound to TO-1 biotin at 6 hours, day 1, and day 10 after delivery of circular RNA (circular aptamer) or linear RNA (linear aptamer). The graphs (bottom panel) show the percentage of fluorescent cells in HeLa cell cultures at 6 hours, day 1, day 3, day 5, day 7, day 10, and day 12 after delivery of circular RNA (circular aptamer), linear RNA (linear aptamer), or TO-1 biotin only (control).

[0059] Figure 23The results show that, compared to circular RNA without a binding aptamer motif, circular RNA with a HuR RNA-binding aptamer motif, and circular RNA with an RNA-binding aptamer motif, HuR-bound circular RNA with a HuR RNA-binding aptamer motif and RNA with an RNA-binding aptamer motif are different.

[0060] Figure 24 The results show that, compared to circular RNA without a binding aptamer motif, circular RNA with a HuR DNA-binding aptamer motif, and circular RNA with DNA, HuR-bound circular RNA with a HuR DNA-binding aptamer motif and RNA with a DNA-binding aptamer motif produced by streptavidin pull-down are different.

[0061] Figure 25 The study showed lower expression of secreted proteins from circular RNAs without HuR binding motifs compared to circular RNAs with 1X HuR binding motifs, 2X HuR binding motifs, and 3X HuR binding motifs. Detailed Implementation

[0062] This invention generally relates to pharmaceutical compositions and formulations of cyclic polynucleotides and their uses.

[0063] The following reference examples describe several aspects for illustrative purposes. It should be understood that numerous specific details, relationships, and methods are presented to provide a comprehensive understanding of the features described herein. However, those skilled in the art will readily recognize that the features described herein can be practiced without one or more of the specific details or by other methods. The features described herein are not limited by the order in which actions or events are shown, as some actions may occur in a different order and / or simultaneously with other actions or events. Furthermore, not all actions or events shown are required to implement the methods of the features described herein.

[0064] The terminology used herein is for descriptive purposes only and is not intended to be limiting. As used herein, the singular forms “a,” “an,” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent to which the terms “including,” “having,” “with,” or variations thereof are used in the detailed description and / or claims, these terms are intended to be inclusive in a manner similar to the term “comprising.”

[0065] definition

[0066] As used herein, the terms “circRNA” or “circular RNA” or “circular polynucleotide” refer to polynucleotides that form a circular structure through covalent or non-covalent bonds.

[0067] As used herein, the term "cryptogen" refers to a nucleic acid sequence of a cyclic polynucleotide that helps to reduce, evade, and / or avoid detection by immune cells and / or reduce the induction of an immune response against the cyclic polynucleotide.

[0068] As used herein, the term “expressed sequence” refers to the sequence of nucleic acids that encode products, such as peptides or polypeptides or regulatory nucleic acids.

[0069] As used herein, the term "immunoprotein binding site" refers to a sequence of nucleotides that binds to an immune protein and helps to mask cyclic polynucleotides as non-exogenous nucleotide sequences.

[0070] As used herein, the term "modified ribonucleotide" refers to a nucleotide having at least one modification for a sugar, nucleobase, or nucleoside bond.

[0071] As used in this article, the phrase “quasi-helical structure” refers to the higher-order structure of a cyclic polynucleotide in which at least a portion of the cyclic polynucleotide folds into a helical structure.

[0072] As used in this article, the phrase “quasi-double-stranded secondary structure” refers to the higher-order structure of a cyclic polynucleotide in which at least a portion of the cyclic polynucleotide forms a double strand.

[0073] As used in this article, the term "regulatory sequence" refers to the nucleic acid sequence that modifies the expression product.

[0074] As used herein, the term "repetitive nucleotide sequence" refers to a repetitive nucleic acid sequence within a segment of DNA or the entire genome. In some embodiments, repetitive nucleotide sequences include poly(CA) sequences or poly(TG) sequences. In some embodiments, repetitive nucleotide sequences include repetitive sequences within the Alu family of introns.

[0075] As used herein, the term “replication element” refers to a sequence and / or motif that can be used to replicate or initiate the transcription of cyclic polynucleotides.

[0076] As used herein, the term "selective translation sequence" refers to a nucleic acid sequence in which the translation of an expression sequence is selectively initiated or activated within a cyclic polynucleotide.

[0077] As used herein, the term “selective degradation sequence” refers to a nucleic acid sequence in which the translation of the initiating expression sequence is performed within a cyclic polynucleotide.

[0078] As used herein, the term "interlaced sequence" refers to a nucleotide sequence that induces ribosome arrest during translation. In some embodiments, the interlaced sequence is a non-conserved sequence of an amino acid with a strong α-helical tendency followed by a concordant sequence -D(V / I)ExNPG P, where x is any amino acid.

[0079] As used herein, the term “substantially resistant to” means a substance that has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% resistance to a reference.

[0080] As used herein, the term "complex" refers to the association between at least two parts (e.g., chemical or biochemical parts) that have an affinity for each other. For example, at least two parts are a target (e.g., a protein) and a circular RNA molecule.

[0081] The terms “peptide” and “protein” are used interchangeably and refer to polymers of two or more amino acids linked by covalent bonds (e.g., amide bonds). Peptides described herein can include full-length proteins (e.g., fully processed proteins) as well as shorter amino acid sequences (e.g., fragments of naturally occurring proteins or synthetic peptide fragments). Peptides can include naturally occurring amino acids (e.g., one of the twenty amino acids commonly found in naturally synthesized peptides and known to be abbreviated by a single letter (A, R, N, C, D, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, and V)) and non-naturally occurring amino acids (e.g., amino acids not among the twenty commonly found in naturally synthesized peptides), including synthetic amino acids, amino acid analogs, and amino acid mimics.

[0082] As used herein, the term "binding site" refers to the region of a cyclic polynucleotide that interacts with another entity, such as a compound, protein, or nucleic acid. Binding sites may contain aptamer sequences.

[0083] As used herein, the term “binding moiety” refers to a region of a target that can be bound by a binding site, such as a region, domain, fragment, epitope, or portion of a nucleic acid (e.g., RNA, DNA, RNA-DNA hybrid), a compound, a small molecule (e.g., a drug), an aptamer, a polypeptide, a protein, a lipid, a carbohydrate, an antibody, a virus, a viral particle, a membrane, a multicomponent complex, an organelle, a cell, other cellular parts, any fragment thereof, and any combination thereof.

[0084] As used herein, the term "aptamer sequence" refers to a non-naturally occurring or synthetic oligonucleotide that specifically binds to a target molecule. Typically, aptamers are 20 to 250 nucleotides long. Typically, aptamers bind to their targets through secondary structure rather than sequence homology.

[0085] As used in this article, the term "small molecule" refers to organic compounds with a molecular weight of no more than 900 Daltons. Small molecules can regulate cellular processes or act as fluorophores.

[0086] As used herein, the term "conjugated portion" refers to a modified nucleotide containing a functional group used in the conjugation method.

[0087] As used herein, the term "linear counterpart" refers to a polynucleotide having the same nucleotide sequence and nucleic acid modifications as a cyclic polynucleotide and having two free ends (i.e., the non-cyclic form of the cyclic polynucleotide). In some embodiments, the linear counterpart further comprises a 5' cap. In some embodiments, the linear counterpart further comprises a polyadenosine tail. In some embodiments, the linear counterpart further comprises a 3' UTR. In some embodiments, the linear counterpart further comprises a 5' UTR.

[0088] Cyclic polynucleotides

[0089] The cyclic polynucleotides (circRNAs) described herein are polynucleotides that form a continuous structure through covalent or non-covalent bonds.

[0090] The invention described herein includes compositions comprising synthetic circRNA and methods of using thereof. Due to their circular structure, circRNAs can have improved stability, increased half-life, reduced immunogenicity, and / or improved functionality (e.g., the functions described herein) compared to corresponding linear RNAs. In some embodiments, the circRNA is detectable for at least 5 days after delivery to cells. In some embodiments, the circRNA is detectable for 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 days after delivery to cells. Circular RNAs can be detected using any technique known in the art.

[0091] In some embodiments, circRNA binds to one or more targets. In some embodiments, circRNA is a circular aptamer. In one embodiment, circRNA contains one or more binding sites for binding to one or more targets. In one embodiment, circRNA contains an aptamer sequence. In one embodiment, circRNA binds to both DNA and protein targets and, for example, mediates transcription. In another embodiment, circRNA causes protein complexes to aggregate, for example, mediating post-translational modifications or signal transduction. In another embodiment, circRNA binds to two or more different targets, such as proteins, and, for example, shuttles these proteins into the cytoplasm or mediates the degradation of one or more targets.

[0092] In some embodiments, circRNA binds to at least one of DNA, RNA, and protein to regulate cellular processes (e.g., altering protein expression, regulating gene expression, regulating cell signaling, etc.). In some embodiments, the synthesized circRNA includes a binding site for interacting with at least one portion of a target or selected DNA, RNA, or protein, such as a binding moiety, thereby competing for binding with an endogenous counterpart.

[0093] In some embodiments, circular RNA forms a complex that regulates cellular processes (e.g., alters protein expression, regulates gene expression, modulates cell signaling, etc.). In some embodiments, circular RNA sensitizes cells to cytotoxic agents (e.g., chemotherapeutic agents) by binding to a target (e.g., transcription factors), resulting in reduced cell viability. For example, sensitization of cells to cytotoxic agents leads to reduced cell viability following delivery of the cytotoxic agent and the circular RNA. In some embodiments, the reduced cell viability is a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%, or any percentage thereof.

[0094] In some embodiments, the complex can be detected for at least 5 days after the circular RNA is delivered to the cells. In some embodiments, the complex can be detected for 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 days after the circular RNA is delivered to the cells.

[0095] In one embodiment, the synthesized circRNA binds to and / or chelates miRNA. In another embodiment, the synthesized circRNA binds to and / or chelates proteins. In another embodiment, the synthesized circRNA binds to and / or chelates mRNA. In another embodiment, the synthesized circRNA binds to and / or chelates ribosomes. In another embodiment, the synthesized circRNA binds to and / or chelates circRNA. In another embodiment, the synthesized circRNA binds to and / or chelates long non-coding RNA (lncRNA) or any other non-coding RNA, such as miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, long non-coding RNA, shRNA. In addition to binding and / or chelating sites, the circRNA may also include degradation elements that will cause degradation of the bound and / or chelated RNA and / or protein.

[0096] In one embodiment, the circRNA comprises a lncRNA or a sequence of lncRNA, for example, a sequence of a naturally occurring non-circular lncRNA or a fragment thereof. In one embodiment, the lncRNA or lncRNA sequence is circularized, with or without a spacer sequence, to form a synthetic circRNA.

[0097] In one embodiment, the circRNA has ribozyme activity. In one embodiment, the circRNA can act as a ribozyme and cleave pathogenic or endogenous RNA, DNA, small molecules, or proteins. In one embodiment, the circRNA has enzymatic activity. In one embodiment, the synthesized circRNA is capable of specifically recognizing and cleaving RNA (e.g., viral RNA). In another embodiment, the circRNA is capable of specifically recognizing and cleaving proteins. In another embodiment, the circRNA is capable of specifically recognizing and degrading small molecules.

[0098] In one embodiment, the circRNA is a sacrificial, self-cleaving, or cleavable circRNA. In one embodiment, the circRNA can be used to deliver RNA, such as miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, long non-coding RNA, or shRNA. In one embodiment, the synthesized circRNA consists of microRNAs separated by (1) a self-cleavable element (e.g., a hammerhead structure, a splicing element), (2) a cleavage recruitment site (e.g., ADAR), (3) a degradable adapter (e.g., glycerol), (4) a chemical adapter, and / or (5) a spacer sequence. In another embodiment, the synthesized circRNA consists of siRNAs separated by (1) a self-cleavable element (e.g., a hammerhead structure, a splicing element), (2) a cleavage recruitment site (e.g., ADAR), (3) a degradable adapter (e.g., glycerol), (4) a chemical adapter, and / or (5) a spacer sequence.

[0099] In one embodiment, the circRNA is a circRNA capable of transcription / replication. This circRNA can encode any type of RNA. In one embodiment, the synthesized circRNA has an antisense miRNA and a transcriptional element. In one embodiment, a linear functional miRNA is generated from the circRNA post-transcriptionally. In one embodiment, the circRNA is a non-translatable cyclic polynucleotide.

[0100] In one embodiment, the circRNA has one or more of the aforementioned properties as well as a translation element.

[0101] In some embodiments, the circRNA comprises at least one modified nucleotide. In some embodiments, the circRNA comprises at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the modified nucleotide. In some embodiments, the circRNA comprises substantially all (e.g., greater than 80%, 85%, 90%, 95%, 97%, 98%, or 99%, or about 100%) of the modified nucleotide. In some embodiments, the circRNA comprises a portion of modified nucleotides and an unmodified continuous nucleotide, which may be referred to as hybridized circRNA. The portion of the unmodified continuous nucleotide may be an unmodified binding site in the hybridized circRNA configured to bind a protein, DNA, RNA, or cellular target. The portion of the unmodified continuous nucleotide may be an unmodified IRES in the hybridized circRNA. In other embodiments, the circRNA lacks the modified nucleotide and may be referred to as unmodified circRNA.

[0102] target

[0103] circRNA may contain at least one target binding site, such as a target binding moiety. circRNA may contain at least one aptamer sequence that binds to a target. In some embodiments, circRNA contains one or more binding sites against one or more targets. Targets include, but are not limited to, nucleic acids (e.g., RNA, DNA, RNA-DNA hybrids), small molecules (e.g., drugs, fluorophores, metabolites), aptamers, peptides, proteins, lipids, carbohydrates, antibodies, viruses, viral particles, membranes, multicomponent complexes, organelles, cells, other cellular parts, any fragments thereof, and any combination thereof. (See, for example, Fredriksson et al., (2002) Nat Biotech 20: 473-77; Gullberg et al., (2004) PNAS 101: 8420-24). For example, a target is single-stranded RNA, double-stranded RNA, single-stranded DNA, double-stranded DNA, DNA or RNA containing one or more double-stranded regions and one or more single-stranded regions, RNA-DNA hybrids, small molecules, aptamers, polypeptides, proteins, lipids, carbohydrates, antibodies, antibody fragments, antibody mixtures, viral particles, membranes, multi-component complexes, cells, cellular parts, any fragments thereof, or any combination thereof.

[0104] In some embodiments, the target is a polypeptide, protein, or any fragment thereof. For example, the target may be a purified polypeptide, an isolated polypeptide, a fusion-labeled polypeptide, a polypeptide attached to or spanning the membrane of a cell, virus, or viral particle, a cytoplasmic protein, an intracellular protein, an extracellular protein, a kinase, a tyrosine kinase, a serine / threonine kinase, a phosphatase, an aromatase, a phosphodiesterase, a cyclase, a helicase, a protease, an oxidoreductase, a reductase, a transferase, a hydrolase, a cleavage enzyme, an isomerase, a glycosylation enzyme, an extracellular matrix protein, a ligase, a ubiquitin ligase, any ligase that affects post-translational modifications, an ion transport protein, an ion transport channel, an ion transport pore, an apoptosis protein, or a cell adhesion protein. Proteins, pathogenic proteins, aberrantly expressed proteins, transcription factors, transcription regulators, translational proteins, epigenetic factors, epigenetic regulators, chromatin regulators, molecular chaperones, secretory proteins, ligands, hormones, cytokines, chemokines, nucleoproteins, receptors, transmembrane receptors, receptor tyrosine kinases, G protein-coupled receptors, growth factor receptors, nuclear receptors, hormone receptors, signal transducers, antibodies, membrane proteins, integrated membrane proteins, peripheral membrane proteins, cell wall proteins, globular proteins, fibrin, glycoproteins, lipoproteins, chromosomal proteins, proto-oncogenes, oncogenes, tumor suppressor genes, any fragments thereof, or any combination thereof. In some embodiments, the target is a heterologous polypeptide. In some embodiments, the target is a protein overexpressed in cells using molecular techniques (e.g., transfection). In some embodiments, the target is a recombinant polypeptide. For example, the target is in a sample produced from bacteria (e.g., *Escherichia coli*), yeast, mammalian, or insect cells (e.g., biologically overexpressed proteins). In some embodiments, the target is a polypeptide with mutations, insertions, deletions, or polymorphisms. In some embodiments, the target is a polypeptide naturally expressed by a cell (e.g., a healthy cell or a cell associated with a disease or condition). In some embodiments, the target is an antigen, such as a polypeptide used to immunize an organism or to generate an immune response in an organism, for example, for antibody production.

[0105] In some embodiments, the target is an antibody. An antibody can specifically bind to a particular spatial and polar organization of another molecule. Antibodies can be monoclonal, polyclonal, or recombinant antibodies, and can be prepared using techniques well known in the art, such as immunizing a host and collecting serum (polyclonal), or by preparing sequential hybrid cell lines and collecting secreted proteins (monoclonal), or by cloning and expressing a nucleotide sequence or a mutagenic form thereof, said nucleotide sequence or mutagenic form thereof encoding at least the amino acid sequence required for the specific binding of a natural antibody. Naturally occurring antibodies can be proteins comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain may consist of a heavy chain variable region (V... H It consists of a heavy chain constant region and a heavy chain constant region. The heavy chain constant region can contain three structural domains, C H1 C H2 and CH3 Each light chain may contain a light chain variable region (V). L ( ) and the light chain constant region. The light chain constant region may contain a domain C L V H and V L The region can be further divided into highly variable regions, called complementary determinant regions (CDRs), interspersed with more conservative regions, called frame regions (FRs). Each V H and V L An antibody consists of three CDRs and four FRs arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The constant region of an antibody can mediate the binding of an immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system. Antibodies can be any isotype (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), subclass, or modified versions thereof. Antibodies can comprise complete immunoglobulins or fragments thereof. An antibody fragment can refer to one or more fragments of the antibody that retain the ability to specifically bind to a binding site (e.g., an antigen). Additionally, aggregates, polymers, and conjugates of immunoglobulins or fragments thereof are also included, as long as they maintain binding affinity to a specific molecule. Examples of antibody fragments include Fab fragments, which consist of V... L V H C L and C H1 A monovalent segment composed of structural domains; an F(ab)2 segment, which is a bivalent segment containing two Fab segments connected by disulfide bridges in the hinge region; composed of V H and C H1 Fd fragments composed of structural domains; V-shaped segments formed by a single arm of the antibody. L and V H Fv segments composed of structural domains; composed of V H Single-domain antibody (dAb) fragments composed of structural domains (Ward et al., (1989) Nature [Nature] 341: 544-46); and isolated CDR and single-chain fragments (scFv), in which V L and V H The domains pair to form a monovalent molecule (called a single-chain Fv (scFv); see, for example, Bird et al., (1988) Science 242: 423-26; and Huston et al., (1988) PNAS 85: 5879-83). Therefore, antibody fragments include Fab, F(ab)2, scFv, Fv, dAb, etc. Although the two domains V...L and V H Encoded by different genes, but linked by artificial peptide linkers using recombinant methods, these single-chain antibodies form a single protein chain. Such single-chain antibodies comprise one or more antigen-binding moieties. Antibodies can be multivalent, such as bivalent, trivalent, tetravalent, pentavalent, hexavalent, heptavalent, or octavalent antibodies. Antibodies can be multispecific. For example, bispecific, trispecific, tetraspecific, pentaspecific, hexaspecific, heptaspecific, or octaspecific antibodies can be generated, for instance, by recombinantly binding any two or more antigen-binding agents (e.g., Fab, F(ab)2, scFv, Fv, IgG). Multispecific antibodies can be used to bring two or more targets into close proximity, for example, a degradation machinery and a target substrate to be degraded, or a ubiquitin ligase and a substrate to be ubiquitinated. These antibody fragments can be obtained using conventional techniques known to those skilled in the art and can be screened for utility in the same manner as intact antibodies. Antibodies can be human, humanized, chimeric, isolated, canine, cat, donkey, sheep, any plant, animal, or mammalian.

[0106] In some embodiments, the target is a polymeric form of ribonucleotides and / or deoxyribonucleotides (adenine, guanine, thymine, or cytosine), such as DNA or RNA (e.g., mRNA). DNA includes double-stranded DNA found in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In some embodiments, the polynucleotide target is single-stranded, double-stranded, small interfering RNA (siRNA), messenger RNA (mRNA), transfer RNA (tRNA), chromosomes, genes, non-coding genomic sequences, genomic DNA (e.g., fragmented genomic DNA), purified polynucleotides, isolated polynucleotides, hybridized polynucleotides, transcription factor binding sites, mitochondrial DNA, ribosomal RNA, eukaryotic polynucleotides, prokaryotic polynucleotides, synthetic polynucleotides, linked polynucleotides, recombinant polynucleotides, polynucleotides containing nucleic acid analogs, methylated polynucleotides, demethylated polynucleotides, any fragment thereof, or any combination thereof. In some embodiments, the target is a recombinant polynucleotide. In some embodiments, the target is a heterologous polynucleotide. For example, the target is a polynucleotide produced by bacteria (e.g., *Escherichia coli*), yeast, mammalian, or insect cells (e.g., a polynucleotide heterologous to the organism). In some embodiments, the target is a polynucleotide having mutations, insertions, deletions, or polymorphisms.

[0107] In some embodiments, the target is an aptamer. An aptamer is a separate nucleic acid molecule that binds to a binding site or target molecule, such as a protein, with high specificity and affinity. An aptamer is a three-dimensional structure that maintains one or more specific conformations, providing chemical contact for specific binding to its given target. Although aptamers are nucleic acid-based molecules, they differ fundamentally from other nucleic acid molecules, such as genes and mRNA. In these other nucleic acid molecules, the nucleic acid structure encodes information through its linear base sequence, which is therefore important for its information storage function. In stark contrast, the function of an aptamer based on specific binding to a target molecule does not entirely depend on a conserved linear base sequence (non-coding sequence), but rather on specific secondary / tertiary / quaternary structures. Any coding potential that an aptamer may possess is incidental and not considered to play a role in the binding of the aptamer to its homologous target. Aptamers differ from naturally occurring nucleic acid sequences that bind to certain proteins. These latter sequences are naturally occurring sequences embedded in the genome of an organism that bind to specific subgroups of proteins involved in the transcription, translation, and transport of naturally occurring nucleic acids, such as nucleic acid-binding proteins. On the other hand, aptamers are non-naturally occurring nucleic acid molecules. Although aptamers that bind to nucleic acid-binding proteins can be identified, in most cases, these aptamers have very little or no sequence identity with sequences recognized by nucleic acid-binding proteins in nature. More importantly, aptamers can bind to almost any protein (not just nucleic acid-binding proteins) and almost any target chaperone, including small molecules, carbohydrates, peptides, etc. For most chaperones, and even proteins, the native nucleic acid sequence to which they bind does not exist. For those chaperones that do have such sequences, such as nucleic acid-binding proteins, these sequences will differ from the aptamers because the binding affinity used in nature is relatively low compared to tightly bound aptamers. Aptamers can specifically bind to selected chaperones and, for example, modulate the activity of the chaperone or binding interactions through binding; aptamers can block the function of their chaperones. The functional property of chaperone-specific binding is an inherent characteristic of aptamers. Aptamers can range from 6 to 35 kDa. Aptamers can range from 20 to 250 nucleotides. Aptamers can bind to their chaperones with micromolar to subnanomolar molecular affinity and can distinguish closely related targets (e.g., aptamers can selectively bind related proteins from the same gene family). In some cases, aptamers bind only one molecule. In some cases, aptamers bind to family members of the target molecule. In others, aptamers bind to multiple different molecules. Aptamers are able to bind to specific chaperones using commonly seen intermolecular interactions, such as hydrogen bonding, electrostatic complementarity, hydrophobic contact, and steric exclusion. Aptamers possess many desirable characteristics for therapeutic and diagnostic purposes, including high specificity and affinity, low immunogenicity, biological efficacy, and excellent pharmacokinetic properties. Aptamers may comprise molecular stem and loop structures (e.g., hairpin loop structures) formed by the hybridization of covalently linked complementary polynucleotides.The stem contains hybrid polynucleotides, and the loop is a region covalently linked to two complementary polynucleotides. The aptamer can be a linear ribonucleic acid containing an aptamer sequence (e.g., a linear aptamer) or a circular polynucleotide containing an aptamer sequence (e.g., a circular aptamer).

[0108] In some embodiments, the target is a small molecule. For example, the small molecule may be a macrocyclic molecule, an inhibitor, a drug, or a compound. In some embodiments, the small molecule contains no more than five hydrogen bond donors. In some embodiments, the small molecule contains no more than ten hydrogen bond acceptors. In some embodiments, the molecular weight of the small molecule is 500 Daltons or less. In some embodiments, the molecular weight of the small molecule is about 180 to 500 Daltons. In some embodiments, the small molecule contains an octanol-water partition coefficient of not more than five log P. In some embodiments, the small molecule has a partition coefficient of -0.4 to 5.6 log P. In some embodiments, the molar refractive index of the small molecule is 40 to 130. In some embodiments, the small molecule contains about 20 to about 70 atoms. In some embodiments, the polar surface area of ​​the small molecule is 140 angstroms. 2 Or smaller.

[0109] In some embodiments, the target is a cell. For example, the target is an intact cell, a cell treated with a compound (e.g., a drug), a fixed cell, a lysed cell, or any combination thereof. In some embodiments, the target is a single cell. In some embodiments, the target is multiple cells.

[0110] In some embodiments, the circRNA contains binding sites for a single target or multiple targets (e.g., two or more). In one embodiment, a single circRNA contains 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different binding sites for a single target. In one embodiment, a single circRNA contains 2, 3, 4, 5, 6, 7, 8, 9, 10 or more identical binding sites for a single target. In one embodiment, a single circRNA contains 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different binding sites for one or more different targets. In one embodiment, the sample contains two or more targets, such as a mixture or library of targets, and the sample contains circRNA containing two or more binding sites that bind to the two or more targets.

[0111] In some embodiments, a single target or multiple targets (e.g., two or more) have multiple binding portions. In one embodiment, a single target may have 2, 3, 4, 5, 6, 7, 8, 9, 10 or more binding portions. In one embodiment, a sample contains two or more targets, such as a mixture or library of targets, and the sample contains two or more binding portions. In some embodiments, a single target or multiple targets contain multiple distinct binding portions. For example, a plurality may include at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 16,000, 17,000, 18,000, 19,000, 20,000, 25,000, or 30,000 combined portions.

[0112] The target may include multiple bonding portions, each comprising at least two distinct bonding portions. For example, the bonding portions may comprise multiple bonding portions, including at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000, 3,000, 4 000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 16,000, 17,000, 18,000, 19,000, 20,000, 21,000, 22,000, 23,000, 24,000, or 25,000 different combinations.

[0113] Binding site and binding moiety

[0114] In some cases, circRNA contains one binding site. The binding site may contain an aptamer sequence. In some cases, circRNA contains at least two binding sites. For example, circRNA may contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more binding sites. In some embodiments, the circRNA described herein is a molecular scaffold that binds to one or more targets or one or more binding portions of one or more targets. Each target may be, but is not limited to, different or the same nucleic acid (e.g., RNA, DNA, RNA-DNA hybrid), small molecule (e.g., drug), aptamer, polypeptide, protein, lipid, carbohydrate, antibody, virus, viral particle, membrane, multicomponent complex, cell, cellular part, any fragment thereof, and any combination thereof. In some embodiments, one or more binding sites bind to the same target. In some embodiments, one or more binding sites bind to one or more binding portions of the same target. In some embodiments, one or more binding sites bind to one or more different targets. In some embodiments, one or more binding sites bind to one or more binding portions of different targets. In some embodiments, circRNA acts as a scaffold for binding one or more targets. In some embodiments, circRNA acts as a scaffold for one or more binding moieties of one or more targets. In some embodiments, circRNA modulates cellular processes by specifically binding to one or more targets. In some embodiments, circRNA modulates cellular processes by specifically binding to one or more binding moieties of one or more targets. In some embodiments, circRNA modulates cellular processes by specifically binding to one or more targets. In some embodiments, the circRNA described herein includes binding sites for one or more specific target sites. In some embodiments, circRNA includes multiple binding sites or combinations of binding sites for each target. In some embodiments, circRNA includes multiple binding sites or combinations of binding sites for each target binding moieties. For example, circRNA may include one or more binding sites for peptide targets. In some embodiments, circRNA includes one or more binding sites for polynucleotide targets such as DNA or RNA, mRNA targets, rRNA targets, tRNA targets, or genomic DNA targets.

[0115] In some cases, circRNA contains binding sites for single-stranded DNA. In some cases, circRNA contains binding sites for double-stranded DNA. In some cases, circRNA contains binding sites for antibodies. In some cases, circRNA contains binding sites for viral particles. In some cases, circRNA contains binding sites for small molecules. In some cases, circRNA contains binding sites that bind within or on cells. In some cases, circRNA contains binding sites for RNA-DNA hybrids. In some cases, circRNA contains binding sites for methylated polynucleotides. In some cases, circRNA contains binding sites for unmethylated polynucleotides. In some cases, circRNA contains binding sites for aptamers. In some cases, circRNA contains binding sites for peptides. In some cases, circRNA contains binding sites for peptides, proteins, protein fragments, labeled proteins, antibodies, antibody fragments, small molecules, viral particles (e.g., viral particles containing transmembrane proteins), or cells. In some cases, circRNA contains binding sites for binding moieties on single-stranded DNA. In some cases, circRNA contains binding sites for binding moieties on double-stranded DNA. In some cases, circRNA contains binding sites for binding moieties on antibodies. In some cases, circRNA contains binding sites for binding moieties on viral particles. In some cases, circRNA contains binding sites for binding moieties on small molecules. In some cases, circRNA contains binding sites for intracellular or cellular binding moieties. In some cases, circRNA contains binding sites for binding moieties on RNA-DNA hybrids. In some cases, circRNA contains binding sites for binding moieties on methylated polynucleotides. In some cases, circRNA contains binding sites for binding moieties on unmethylated polynucleotides. In some cases, circRNA contains binding sites for binding moieties on aptamers. In some cases, circRNA contains binding sites for binding moieties on peptides. In some cases, circRNA contains binding sites for binding moieties on peptides, proteins, protein fragments, labeled proteins, antibodies, antibody fragments, small molecules, viral particles (e.g., viral particles containing transmembrane proteins), or cellular binding moieties.

[0116] In some cases, the binding site binds to the portion of the target containing at least two amide bonds. In some cases, the binding site does not bind to the portion of the target containing phosphodiester bonds. In some cases, a portion of the target is not DNA or RNA. In some cases, the binding portion contains at least two amide bonds. In some cases, the binding portion does not contain phosphodiester bonds. In some cases, the binding portion is not DNA or RNA.

[0117] The circRNAs provided herein may include one or more binding sites targeting a binding portion on a binding complex. The circRNAs provided herein may include one or more binding sites targeting a target to form a complex. For example, the circRNAs provided herein may act as a scaffold to form a complex between the circRNA and a target. In some embodiments, the circRNA forms a complex with a single target. In some embodiments, the circRNA forms a complex with two targets. In some embodiments, the circRNA forms a complex with three targets. In some embodiments, the circRNA forms a complex with four targets. In some embodiments, the circRNA forms a complex with five or more targets. In some embodiments, the circRNA forms a complex with a complex of two or more targets. In some embodiments, the circRNA forms a complex with a complex of three or more targets. In some embodiments, two or more circRNAs form a complex with a single target. In some embodiments, two or more circRNAs form a complex with two or more targets. In some embodiments, a first circRNA forms a complex with a first binding portion of a first target and a second, different binding portion of a second target. In some embodiments, a first circRNA forms a complex with a first binding portion of a first target, and a second circRNA forms a complex with a second binding portion of a second target.

[0118] In some embodiments, circRNA may include binding sites targeting one or more antibody-peptide complexes, peptide-peptide complexes, peptide-DNA complexes, peptide-RNA complexes, peptide-aptamer complexes, virus particle-antibody complexes, virus particle-peptide complexes, virus particle-DNA complexes, virus particle-RNA complexes, virus particle-aptamer complexes, cell-antibody complexes, cell-peptide complexes, cell-DNA complexes, cell-RNA complexes, cell-aptamer complexes, small molecule-peptide complexes, small molecule-DNA complexes, small molecule-aptamer complexes, small molecule-cell complexes, small molecule-virus particle complexes, and combinations thereof.

[0119] In some embodiments, circRNA may include one or more binding sites on one or more antibody-peptide complexes, peptide-peptide complexes, peptide-DNA complexes, peptide-RNA complexes, peptide-aptamer complexes, virus particle-antibody complexes, virus particle-peptide complexes, virus particle-DNA complexes, virus particle-RNA complexes, virus particle-aptamer complexes, cell-antibody complexes, cell-peptide complexes, cell-DNA complexes, cell-RNA complexes, cell-aptamer complexes, small molecule-peptide complexes, small molecule-DNA complexes, small molecule-aptamer complexes, small molecule-cell complexes, small molecule-virus particle complexes, and combinations thereof.

[0120] In some cases, the binding site binds to a polypeptide, protein, or fragment thereof. In some embodiments, the binding site binds to a domain, fragment, epitope, region, or portion of a target polypeptide, protein, or fragment thereof. For example, the binding site binds to a domain, fragment, epitope, region, or portion of an isolated polypeptide, cellular polypeptide, purified polypeptide, or recombinant polypeptide. For example, the binding site binds to a domain, fragment, epitope, region, or portion of an antibody or fragment thereof. For example, the binding site binds to a domain, fragment, epitope, region, or portion of a transcription factor. For example, the binding site binds to a domain, fragment, epitope, region, or portion of a receptor. For example, the binding site binds to a domain, fragment, epitope, region, or portion of a transmembrane receptor. The binding site may bind to a domain, fragment, epitope, region, or portion of an isolated, purified, and / or recombinant polypeptide. The binding site may bind to a domain, fragment, epitope, region, or portion of an analyte mixture (e.g., lysate). For example, the binding site binds to a domain, fragment, epitope, region, or portion of a lysate from multiple cells or from a single cell. The binding site may bind to the binding portion of a target. In some cases, the binding moiety is on a polypeptide, protein, or fragment thereof. In some embodiments, the binding moiety comprises a domain, fragment, epitope, region, or portion of a polypeptide, protein, or fragment thereof. For example, the binding moiety comprises a domain, fragment, epitope, region, or portion of an isolated polypeptide, a cellular polypeptide, a purified polypeptide, or a recombinant polypeptide. For example, the binding moiety comprises a domain, fragment, epitope, region, or portion of an antibody or a fragment thereof. For example, the binding moiety comprises a domain, fragment, epitope, region, or portion of a transcription factor. For example, the binding moiety comprises a domain, fragment, epitope, region, or portion of a receptor. For example, the binding moiety comprises a domain, fragment, epitope, region, or portion of a transmembrane receptor. The binding moiety may be on or comprise a domain, fragment, epitope, region, or portion of an isolated, purified, and / or recombinant polypeptide. The binding moiety includes a binding moiety on a mixture of analytes (e.g., lysates) or a domain, fragment, epitope, region, or portion of a mixture of analytes (e.g., lysates). For example, the binding portion is on or contains a domain, fragment, epitope, region, or portion of a lysate from multiple cells or from a single cell.

[0121] In some cases, the binding site binds to a domain, fragment, epitope, region, or portion of a compound (e.g., a small molecule). For example, the binding site binds to a domain, fragment, epitope, region, or portion of a drug. For example, the binding site binds to a domain, fragment, epitope, region, or portion of a compound. For example, the binding moiety binds to a domain, fragment, epitope, region, or portion of an organic compound. In some cases, the binding site binds to a domain, fragment, epitope, region, or portion of a small molecule with a molecular weight of 900 Daltons or less. In some cases, the binding site binds to a domain, fragment, epitope, region, or portion of a small molecule with a molecular weight of 500 Daltons or greater. The small molecule moiety bound to the binding site can be obtained, for example, from a library of natural or synthetic molecules, including libraries of compounds generated by combinatorial means, i.e., combinatorial libraries of compound diversity. Methods for generating and screening combinatorial libraries are known in the art and are described below: US 5,741,713; 5,734,018; 5,731,423; 5,721,099; 5,708,153; 5,698,673; 5,688,997; 5,688,696; 5,684,711; 5,641,862; 5,639,603; 5,593,853; 5,574,656; 5,571,698; 5,565,324; 5,549,974; 5,545,568; 5,541,061; 5,525,735; 5,463,564; 5,440,016; 5,438,119; 5,223,409, the public information of which is incorporated herein by reference. Binding sites can bind to the binding portion of a small molecule. In some cases, the binding portion is on or contains a domain, fragment, epitope, region, or portion of the small molecule. For example, the binding portion is on or contains a domain, fragment, epitope, region, or portion of a drug. For example, the binding portion is on or contains a domain, fragment, epitope, region, or portion of a compound. For example, the binding portion is on or contains a domain, fragment, epitope, region, or portion of an organic compound. In some cases, the binding portion is on or contains a domain, fragment, epitope, region, or portion of a small molecule with a molecular weight of 900 Daltons or less. In some cases, the binding portion is on or contains a domain, fragment, epitope, region, or portion of a small molecule with a molecular weight of 500 Daltons or greater.The binding portion can be obtained, for example, from libraries of natural or synthetic molecules, including libraries of compounds generated through combinatorial processes, i.e., combinatorial libraries of compound diversity. Methods for generating and screening combinatorial libraries are known in the art and are described below: US 5,741,713; 5,734,018; 5,731,423; 5,721,099; 5,708,153; 5,698,673; 5,688,997; 5,688,696; 5,684,711; 5,641,862; 5,639,603; 5,593,853; 5,574,656; 5,571,698; 5,565,324; 5,549,974; 5,545,568; 5,541,061; 5,525,735; 5,463,564; 5,440,016; 5,438,119; 5,223,409, the public information of which is incorporated herein by reference.

[0122] Binding sites can bind to a domain, fragment, epitope, region, or portion of a member of a specific binding pair (e.g., a ligand). Binding sites can bind to a monovalent (single epitope) or polyvalent (multiple epitope) domain, fragment, epitope, region, or portion. Binding sites can bind to an antigenic or hapten portion of a target. Binding sites can bind to a domain, fragment, epitope, region, or portion of a single molecule or multiple molecules sharing at least one common epitope or determinant cluster site. Binding sites can bind to a domain, fragment, epitope, region, or portion of a cell (e.g., a bacterial cell, plant cell, or animal cell). Binding sites can bind to a target in its natural environment (e.g., tissue), cultured cells or microorganisms (e.g., bacteria, fungi, protozoa, or viruses), or lysed cells. Binding sites can bind to a portion of a target that is modified (e.g., chemically modified) to provide one or more additional binding sites, such as, but not limited to, dyes (e.g., fluorescent dyes), polypeptide-modified portions (e.g., phosphate groups, carbohydrate groups, etc.), or polynucleotide-modified portions (e.g., methyl groups). Binding sites can bind to the binding portion of a member of a specific binding pair. The binding moiety may be on or contain a domain, segment, epitope, region, or portion of a member of a specific binding pair (e.g., a ligand). The binding moiety may be on or contain a domain, segment, epitope, region, or portion of a monovalent (single epitope) or polyvalent (multiple epitope) binding moiety. The binding moiety may be antigenic or haptenic. The binding moiety may be on or contain a domain, segment, epitope, region, or portion of a single molecule or multiple molecules sharing at least one common epitope or cluster-determining site. The binding moiety may be on or contain a domain, segment, epitope, region, or portion of a portion of a cell (e.g., a bacterial cell, plant cell, or animal cell). The binding site can be in its natural environment (e.g., tissue), cultured cells or microorganisms (e.g., bacteria, fungi, protozoa, or viruses), or lysed cells. The binding site can be modified (e.g., chemically) to provide one or more additional binding sites, such as, but not limited to, dyes (e.g., fluorescent dyes), polypeptide-modified sites (e.g., phosphate groups, carbohydrate groups, etc.), or polynucleotide-modified sites (e.g., methyl groups).

[0123] In some cases, binding sites bind to domains, fragments, epitopes, regions, or portions of molecules found in a host sample. Binding sites can bind to the binding portion of a molecule found in a host sample. In some cases, the binding portion is on or contains the domains, fragments, epitopes, regions, or portions of a molecule found in a host sample. Samples from the host include bodily fluids (e.g., urine, blood, plasma, serum, saliva, semen, feces, sputum, cerebrospinal fluid, tears, mucus, etc.). Samples can be examined directly or pretreated to make the binding portion more detectable. Samples include a quantity of material from living organisms or previously living organisms. Samples can be natural, recombinant, synthetic, or non-natural. Binding sites can bind to any of the above, whether naturally or recombinantly expressed in cells, in cell lysates or cell culture media, in vitro translated samples, or immunoprecipitated from samples (e.g., cell lysates). The binding portion can be any of the above, whether it is naturally or recombinantly expressed from cells, in cell lysates or cell culture media, is an in vitro translated sample, or is immunoprecipitated from a sample (e.g., cell lysates).

[0124] In some cases, the binding site binds to a target expressed in a cell-free system or in vitro. For example, the binding site binds to a target in a cell extract. In some cases, the binding site binds to a target in a cell extract having a DNA template and reagents for transcription and translation. The binding site may bind to a binding portion of a target expressed in a cell-free system or in vitro. In some cases, the binding portion of the target is expressed in a cell-free system or in vitro. For example, the binding portion of the target is in a cell extract. In some cases, the binding portion of the target is in a cell extract having a DNA template and reagents for transcription and translation. Exemplary sources of cell extracts that can be used include wheat germ, *Escherichia coli*, rabbit reticulocytes, extreme thermophiles, hybridomas, Xenopus oocytes, insect cells, and mammalian cells (e.g., human cells). Exemplary cell-free methods that can be used to express target peptides (e.g., to generate target peptides on an array) include protein in situ arrays (PISA), multiple dot speckle technology (MIST), self-assembled mRNA translation, nucleic acid programmable protein arrays (NAPPA), nanopore NAPPA, DNA array to protein array (DAPA), membrane-free DAPA, nanopore replication and µIP-microgravure printing, and pMAC-protein microarray replication (see Kilb et al., Eng. Life Sci. [Life Science Engineering] 2014, 14, 352-364).

[0125] In some cases, the binding site binds to a target synthesized in situ from a DNA template (e.g., on a solid substrate of the array). The binding site may bind to a binding moiety of the target synthesized in situ. In some cases, the binding moiety of the target is synthesized in situ from a DNA template (e.g., on a solid substrate of the array). In some cases, multiple binding moieties are synthesized in situ from multiple corresponding DNA templates in parallel or in a single reaction. Exemplary methods for in situ target peptide expression include those described in: Stevens, Structure 8 (9): R177-R185 (2000); Katzen et al., Trends Biotechnol. 23 (3):150-6. (2005); He et al., Curr. Opin. Biotechnol. 19 (1): 4-9. (2008); Ramachandran et al., Science 305 (5680): 86-90. (2004); He et al., Nucleic Acids Res. 29 (15): E73-3 (2001); Angenendt et al., Mol. Cell Proteomics 5 (9): 1658-66 (2006); Tao et al., Nat Biotechnol. 24 (10): 1253-4 (2006); Angenendt et al., Anal. Chem. [Analytical Chemistry] 76 (7): 1844-9 (2004); Kinpara et al., J. Biochem. [Journal of Biochemistry] 136 (2): 149-54 (2004); Takulapalli et al., J. Proteome Res. [Journal of Proteomics Research] 11 (8): 4382-91 (2012); He et al., Nat. Methods [Natural Methods] 5 (2): 175-7 (2008); Chatterjee and J. LaBaer, ​​Curr Opin Biotech [Current Views on Biotechnology] 17 (4): 334-336 (2006); He and Wang, Biomol Eng [Biomolecular Engineering] 24(4): 375-80 (2007); and He and Taussig, J. Immunol. Methods 274(1-2): 265-70 (2003).

[0126] In some cases, the binding site binds to a nucleic acid target containing at least a 6-nucleotide span (e.g., at least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 100 nucleotides). In some cases, the binding site binds to a protein target containing a continuous nucleotide segment. In some cases, the binding site binds to a protein target containing a non-continuous nucleotide segment. In some cases, the binding site binds to a nucleic acid target containing a site of mutation or functional mutation, said mutation or functional mutation including deletion, addition, exchange, or truncation of nucleotides in the nucleic acid sequence. The binding site may bind to the binding portion of the nucleic acid target. In some cases, the binding portion of the nucleic acid target contains at least a 6-nucleotide span, e.g., at least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 100 nucleotides. In some cases, the binding portion of the protein target contains a continuous nucleotide segment. In some cases, the binding portion of the protein target contains a non-continuous nucleotide segment. In some cases, the binding portion of the nucleic acid target contains a site of mutation or functional mutation, which includes the deletion, addition, exchange, or truncation of nucleotides in the nucleic acid sequence.

[0127] In some cases, the binding site binds to a protein target containing at least a 6-amino acid span (e.g., at least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 100 amino acids). In some cases, the binding site binds to a protein target containing a continuous amino acid segment. In some cases, the binding site binds to a protein target containing a non-continuous amino acid segment. In some cases, the binding site binds to a protein target containing a mutated or functionally mutated site, including the deletion, addition, exchange, or truncation of amino acids in the polypeptide sequence. The binding site may bind to the binding portion of the protein target. In some cases, the binding portion of the protein target contains at least a 6-amino acid span, such as at least 8, 9, 10, 12, 15, 20, 25, 30, 40, 50, or 100 amino acids. In some cases, the binding portion of the protein target contains a continuous amino acid segment. In some cases, the binding portion of the protein target contains a non-continuous amino acid segment. In some cases, the binding portion of the protein target contains a mutated or functionally mutated site, including the deletion, addition, exchange, or truncation of amino acids in the polypeptide sequence.

[0128] In some embodiments, the binding site binds to a domain, fragment, epitope, region, or portion of a membrane-binding protein. The binding site may bind to the binding portion of a membrane-binding protein. In some embodiments, the binding portion is on or includes a domain, fragment, epitope, region, or portion of a membrane-binding protein. Exemplary membrane-binding proteins include, but are not limited to, GPCRs (e.g., adrenergic receptors, angiotensin receptors, cholecystokinin receptors, muscarinic acetylcholine receptors, neurotensin receptors, glycopyridine receptors, dopamine receptors, opioid receptors, serotonin receptors, somatostatin receptors, etc.), ion channels (e.g., nicotinic acetylcholine receptors, sodium channels, potassium channels, etc.), non-excitatory and excitatory channels, receptor tyrosine kinases, receptor serine / threonine kinases, receptor guanylate cyclases, growth factor and hormone receptors (e.g., epidermal growth factor (EGF) receptors), etc. The binding site may bind to a domain, fragment, epitope, region, or portion of a mutant or modified variant of the membrane-binding protein. Binding sites can bind to the binding portion of mutant or modified variants of membrane-binding proteins. The binding portion can also be on or contain a domain, fragment, epitope, region, or portion of a mutant or modified variant of a membrane-binding protein. For example, some single- or multi-point mutations in GPCRs retain function and are involved in disease (see, for example, Stadel et al., (1997) Trends in Pharmacological Review 18: 430-37).

[0129] The binding site binds to, for example, a domain, fragment, epitope, region, or portion of a ubiquitin ligase. The binding site binds to, for example, a domain, fragment, epitope, region, or portion of a ubiquitin adaptor, proteasome adaptor, or proteasome protein. The binding site binds to, for example, a domain, fragment, epitope, region, or portion of a protein involved in endocytosis, phagocytosis, lysosomal pathways, autophagy, macroautophagy, microautophagy, chaperone-mediated autophagy, multivesicular pathways, or combinations thereof. In some cases, the binding site binds to a binding moiety. The binding moiety may contain, for example, a domain, fragment, epitope, region, or portion of a ubiquitin ligase. The binding moiety may contain, for example, a domain, fragment, epitope, region, or portion of a ubiquitin adaptor, proteasome adaptor, or proteasome protein. The binding moiety may contain, for example, a domain, fragment, epitope, region, or portion of a protein involved in endocytosis, phagocytosis, lysosomal pathways, autophagy, macroautophagy, microautophagy, chaperone-mediated autophagy, multivesicular pathways, or combinations thereof.

[0130] The binding site binds to, for example, a domain, segment, epitope, region, or portion of a protein associated with a disease or condition. The binding site binds to, for example, a domain, segment, epitope, region, or portion of a proto-oncogene. The binding site binds to, for example, a domain, segment, epitope, region, or portion of an oncogene. The binding site binds to, for example, a domain, segment, epitope, region, or portion of a tumor suppressor gene. The binding site binds to, for example, a domain, segment, epitope, region, or portion of an inflammatory gene (e.g., a cytokine). The binding site may bind to a binding moiety. The binding moiety may contain, for example, a domain, segment, epitope, region, or portion of a protein associated with a disease or condition. The binding moiety may contain, for example, a domain, segment, epitope, region, or portion of a proto-oncogene. The binding moiety may contain, for example, a domain, segment, epitope, region, or portion of an oncogene. The binding moiety may contain, for example, a domain, segment, epitope, region, or portion of a tumor suppressor gene. The binding moiety may contain, for example, a domain, segment, epitope, region, or portion of an inflammatory gene (e.g., a cytokine).

[0131] Figure 1 Examples of circRNAs having sequence-specific RNA-binding motifs, sequence-specific DNA-binding motifs, and protein-specific binding motifs are shown. In some embodiments, circRNAs may include other binding motifs for binding other intracellular molecules. Non-limiting examples of circRNA applications are listed in Table 1.

[0132] Table 1 process MOA (Example) Targeted transcription DNA-circRNA protein (pol, TF) Epigenetic remodeling DNA-circRNA protein (SWI / SNF) Transcriptional interference circRNA-DNA Translation interference circRNA-mRNA or ribosome Protein-protein interaction inhibitors circRNA-protein protein degradation Protein-circRNA-protein (ubiq) RNA degradation RNA-circRNA-RNA (RNase to RNA) DNA degradation DNA-circRNA-protein (DNA to DNA enzyme) Artificial receptor Cell surface circRNA substrate Protein translocation protein-circRNA-protein / RNA Cell fusion Cell surface-circRNA-cell surface Complex disassembly protein-circRNA-protein / RNA Receptor inhibition protein-circRNA-substrate Signal transduction Protein-circRNA-protein (Caspase) Multi-enzyme acceleration Multienzyme-circRNA Receptor induction circRNA receptor RNA binding site

[0133] In some embodiments, the cyclic polynucleotide includes one or more RNA binding sites. In some embodiments, the cyclic polynucleotide includes an RNA binding site that modifies the expression of an endogenous gene and / or an exogenous gene. In some embodiments, the RNA binding site regulates the expression of a host gene. The RNA binding site may include a sequence that hybridizes to an endogenous gene (e.g., a sequence of miRNA, siRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, gRNA as described herein), a sequence that hybridizes to an exogenous nucleic acid (e.g., viral DNA or RNA), a sequence that hybridizes to RNA, a sequence that interferes with gene transcription, a sequence that interferes with RNA translation, a sequence that stabilizes or destabilizes RNA (e.g., through targeted degradation), or a sequence that regulates a DNA- or RNA-binding factor. In some embodiments, the cyclic polynucleotide includes an aptamer sequence that binds to RNA. Aptamer sequences can bind to endogenous genes (e.g., sequences of miRNA, siRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, and gRNA as described herein), exogenous nucleic acids (e.g., viral DNA or RNA), RNA, sequences that interfere with gene transcription, sequences that interfere with RNA translation, sequences that stabilize RNA or destabilize RNA (e.g., through targeted degradation), or sequences that regulate DNA- or RNA-binding factors. The secondary structure of aptamer sequences can bind to RNA. By binding aptamer sequences to RNA, circular RNA can form complexes with RNA.

[0134] In some embodiments, the RNA binding site may be one of the following: tRNA, lncRNA, lincRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA binding sites. RNA binding sites are well known to those skilled in the art.

[0135] Certain RNA binding sites can suppress gene expression through the biological process of RNA interference (RNAi). In some embodiments, the cyclic polynucleotide comprises an RNAi molecule having an RNA or RNA-like structure, typically having 15-50 base pairs (e.g., about 18-25 base pairs) and a nucleobase sequence that is identical (complementary) or nearly identical (substantially complementary) to the coding sequence in the target gene expressed in the cell. RNAi molecules include, but are not limited to: short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), meroduplex, and dicer substrates.

[0136] In some embodiments, the RNA binding site comprises siRNA or shRNA. siRNA and shRNA are analogous to intermediates in the endogenous miRNA gene processing pathway. In some embodiments, siRNA can act as miRNA, and vice versa. Like siRNA, microRNAs can use RISC to downregulate target genes, but unlike siRNA, most animal miRNAs do not cleave mRNA. Instead, miRNAs reduce protein output through translational repression or poly-A removal and mRNA degradation. Known miRNA binding sites are located within the 3'-UTR of mRNA; miRNAs appear to target sites that are almost perfectly complementary to nucleotides 2–8 from the 5' end of the miRNA. This region is called the seed region. Because siRNA and miRNA are interchangeable, exogenous siRNA can downregulate mRNAs with seed complementarity to the siRNA. Multiple target sites in the 3'-UTR can provide stronger downregulation.

[0137] MicroRNAs (or miRNAs) are short non-coding RNAs that bind to the 3'-UTR of nucleic acid molecules and downregulate gene expression by reducing the stability of the nucleic acid molecule or by inhibiting translation. Circular polynucleotides may contain one or more miRNA target sequences, miRNA sequences, or miRNA seeds. Such sequences can correspond to any miRNA.

[0138] The miRNA sequence includes a "seed" region, which is the sequence in positions 2-8 of the mature miRNA that is Watson-Crick complementary to the miRNA target sequence. The miRNA seed can contain positions 2-8 or 2-7 of the mature miRNA. In some embodiments, the miRNA seed can contain 7 nucleotides (e.g., positions 2-8 of the mature miRNA), wherein the seed complement site in the corresponding miRNA target is flanked by an adenine (A) opposite position 1 of the miRNA. In some embodiments, the miRNA seed can contain 6 nucleotides (e.g., positions 2-7 of the mature miRNA), wherein the seed complement site in the corresponding miRNA target is flanked by an adenine (A) opposite position 1 of the miRNA.

[0139] The bases of the miRNA seed sequence are largely complementary to the target sequence. By engineering the miRNA target sequence into cyclic polynucleotides (cRNAs), these cRNAs can evade or be detected by the host immune system, and their degradation or translation can be regulated. This process reduces the risk of off-target effects during cRNA delivery.

[0140] The cyclic polynucleotide may include a miRNA sequence that is identical to about 5 to about 25 consecutive nucleotides of the target gene. In some embodiments, the miRNA sequence targets the mRNA and begins with a dinucleotide AA, contains about 30%-70%, about 30%-60%, about 40%-60%, or about 45%-55% GC content, and does not have a high percentage identity with any nucleotide sequence other than the target in the mammalian genome to be introduced, for example, as determined by a standard BLAST search.

[0141] Conversely, cyclic polynucleotides can be engineered (i.e., removed) from microRNA binding sites to regulate protein expression in specific tissues. Regulation of expression in multiple tissues can be achieved by introducing or removing one or more miRNA binding sites.

[0142] Examples of tissues known to regulate mRNA and thus protein expression include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), bone marrow cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126). miRNAs can also regulate complex biological processes, such as angiogenesis (miR-132). In the cyclic polynucleotides described herein, binding sites for miRNAs associated with such processes can be removed or introduced to adapt the expression of the cyclic polynucleotides to the biologically relevant cell type or the associated biological process. In some embodiments, the miRNA binding site includes, for example, miR-7.

[0143] By understanding the expression patterns of miRNAs in different cell types, the cyclic polynucleotides described in this paper can be engineered for more targeted expression in specific cell types or only under specific biological conditions. By introducing tissue-specific miRNA binding sites, cyclic polynucleotides can be designed for optimal protein expression in tissues or under specific biological conditions.

[0144] Additionally, miRNA seed sites can be incorporated into cyclic polynucleotides to regulate expression in certain cells, leading to biological improvements. One example of this is the incorporation of the miR-142 site. Incorporation of the miR-142 site into the cyclic polynucleotides described herein regulates expression in hematopoietic cells and can also reduce or eliminate immune responses to proteins encoded by the cyclic polynucleotides.

[0145] In some embodiments, the cyclic polynucleotide comprises at least one miRNA, such as two, three, four, five, six, or more. In some embodiments, the cyclic polynucleotide comprises a miRNA having at least about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% nucleotide sequence identity with any of these nucleotide sequences or with a sequence complementary to the target sequence.

[0146] Lists of known miRNA sequences can be found in databases maintained by research organizations such as the Wellcome Trust Sanger Institute, the Penn Center for Bioinformatics, Memorial Sloan Kettering Cancer Center, and the European Molecule Biology Laboratory. RNAi molecules can be easily designed and produced using techniques known in the art. Furthermore, computational tools can be used to identify valid and specific sequence motifs.

[0147] In some embodiments, the cyclic polynucleotide comprises a long non-coding RNA. Long non-coding RNAs (lncRNAs) include non-protein-coding transcripts longer than 100 nucleotides. The longer length distinguishes lncRNAs from smaller regulatory RNAs such as miRNAs, siRNAs, and other short RNAs. Typically, most (approximately 78%) lncRNAs are tissue-specific. Divergent lncRNAs transcribed in the opposite direction to nearby protein-coding genes (comprising approximately 20% of all lncRNAs in the mammalian genome) can regulate the transcription of nearby genes.

[0148] The length of the RNA binding site can be between approximately 5 and 30 nucleotides, between approximately 10 and 30 nucleotides, or approximately 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides. The degree of identity between the RNA binding site and the target can be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0149] In some embodiments, the cyclic polynucleotide includes one or more large intergenic non-coding RNA (lincRNA) binding sites. LincRNAs constitute the majority of long non-coding RNAs. LincRNAs are non-coding transcripts and, in some embodiments, are longer than about 200 nucleotides. In some embodiments, lincRNAs have an exon-intron-exon structure, similar to protein-coding genes, but do not contain open reading frames and do not encode proteins. LincRNA expression can be strictly tissue-specific compared to coding genes. LincRNAs are typically co-expressed with their neighboring genes to a degree similar to that of paired neighboring protein-coding genes. In some embodiments, the cyclic polynucleotide comprises a cyclic lincRNA.

[0150] In some embodiments, the cyclic polynucleotides disclosed herein include one or more lincRNAs, such as FIRRE, LINC00969, PVT1, LINC01608, JPX, LINC01572, LINC00355, C1orf132, C3orf35, RP11-734, LINC01608, CC-499B15.5, CASC15, LINC00937, and RP11-191.

[0151] Lists of known lincRNA and lncRNA sequences can be found in databases maintained by research organizations such as the Institute of Genomics and Integrative Biology, the Diamantina Institute at the University of Queensland, Ghent University, and Sun Yat-sen University. LincRNA and lncRNA molecules can be easily designed and produced using techniques known in the art. Furthermore, computational tools can be used to determine valid and specific sequence motifs.

[0152] RNA binding sites may contain sequences that are wholly or substantially complementary to, or fully complementary to, all or a fragment thereof, of an endogenous gene or gene product (e.g., mRNA). Complementary sequences may be complementary to sequences at the boundaries between introns and exons, thereby preventing the maturation of newly generated nuclear RNA transcripts of a specific gene into mRNA for transcription. Complementary sequences can be specific to a gene by hybridizing with its mRNA and preventing its translation. RNA binding sites may also contain sequences that are wholly or substantially antisense to, or a fragment thereof, of an endogenous gene or gene product (e.g., DNA, RNA, or derivatives or hybrids thereof).

[0153] In some embodiments, the cyclic polynucleotide contains an RNA binding site having an RNA or RNA-like structure, typically between about 5-5000 base pairs (depending on the specific RNA structure, e.g., miRNA 5-30 bp, lncRNA 200-500 bp) and having a nucleobase sequence that is identical (complementary) or nearly identical (substantially complementary) to the coding sequence in the target gene expressed in the cell.

[0154] DNA binding site

[0155] In some embodiments, the cyclic polynucleotide contains a DNA-binding site, such as a sequence of guide RNA (gRNA). In some embodiments, the cyclic polynucleotide contains a complementary sequence to the guide RNA or gRNA sequence. The short synthetic gRNA consists of a "scaffold" sequence necessary for binding to an incomplete effector portion and a user-defined target sequence of approximately 20 nucleotides for the genome target. The guide RNA sequence can be 17-24 nucleotides long (e.g., 19, 20, or 21 nucleotides) and complementary to the target nucleic acid sequence. Custom gRNA generators and algorithms can be used to design effective guide RNAs. Gene editing has also been achieved using chimeric "single guide RNAs" ("sgRNAs"), engineered (synthetic) single RNA molecules that mimic the naturally occurring crRNA-tracrRNA complex and contain tracrRNA (for binding nucleases) and at least one crRNA (to guide the nuclease to the editable target sequence). Chemically modified sgRNAs can be effective in genome editing.

[0156] gRNAs can recognize specific DNA sequences (e.g., sequences adjacent to or within gene promoters, enhancers, silencers, or repressors).

[0157] In some embodiments, the gRNA is part of a CRISPR system for gene editing. For gene editing, the circular polynucleotide can be designed to include one or more guide RNA sequences corresponding to a desired target DNA sequence. The gRNA sequence may include at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides that interact with Cas9 or other exonucleases to cleave DNA; for example, Cpf1 interacts with at least about 16 nucleotides of the gRNA sequence to perform detectable DNA cleavage.

[0158] In some embodiments, the cyclic polynucleotide includes an aptamer sequence that can bind to DNA. The secondary structure of the aptamer sequence can bind to DNA. In some embodiments, the cyclic polynucleotide forms a complex with DNA by binding the aptamer sequence to DNA.

[0159] In some embodiments, the cyclic polynucleotide includes a sequence that binds to the major groove of duplex DNA. In one such case, the specificity and stability of the triplet structure generated by the cyclic polynucleotide and duplex DNA is provided by Hoogsteen hydrogen bonds, which differ from those formed in classical Watson-Crick base pairing in duplex DNA. In one case, the cyclic polynucleotide binds to the purine-rich strand of the target duplex via the major groove.

[0160] In some embodiments, triplet formation occurs in two motifs, distinguished by the orientation of the cyclic polynucleotide relative to the purine-rich strand of the target duplex. In some cases, the polypyrimidine sequence segment in the cyclic polynucleotide binds to the polypurine sequence segment of the duplex DNA in a parallel manner (i.e., in the same 5' to 3' orientation as the purine-rich strand of the duplex) via Hoogsteen hydrogen bonds, while the polypurine segment (R) binds to the purine strand of the duplex in an antiparallel manner via reverse Hoogsteen hydrogen bonds. In the antiparallel configuration, the purine motif contains a triplet of G:GC, A:AT, or T:AT; while in the parallel configuration, the pyrimidine motif contains a canonical triplet of C+:GC or a triplet of T:AT (where C+ represents protonated cytosine at the N3 position). The antiparallel GA and GT sequences in the cyclic polynucleotide form stable triplets at neutral pH, while the parallel CT sequences in the cyclic polynucleotide bind at acidic pH. The N3 on cytosine in cyclic polynucleotides can be protonated. Replacing C with 5-methyl-C may allow binding of the CT sequence in cyclic polynucleotides at physiological pH because 5-methyl-C has a higher pK than cytosine. For purine and pyrimidine motifs, consecutive homopurine-homopyrimidine sequence segments of at least 10 base pairs facilitate the binding of cyclic polynucleotides to duplex DNA because shorter triplexes may be unstable under physiological conditions, and sequence breaks destabilize the triplex structure. In some embodiments, the DNA duplex target for triplex formation comprises consecutive purine bases in one strand. In some embodiments, the target for triplex formation comprises a homopurine sequence in one strand of the DNA duplex and a homopyrimidine sequence in the complementary strand.

[0161] In some embodiments, the triplet containing the cyclic polynucleotide is a stable structure. In some embodiments, the triplet containing the cyclic polynucleotide exhibits an increased half-life, for example, an increase of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or greater, for example, lasting for at least about 1 hour to about 30 days, or for at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days or longer or any time in between.

[0162] protein binding site

[0163] In some embodiments, the cyclic polynucleotide includes one or more protein binding sites. In some embodiments, the protein binding site comprises an aptamer sequence. In one embodiment, the cyclic polynucleotide including a protein binding site reduces the immune response from the host compared to a response triggered by a reference compound, such as a cyclic polynucleotide lacking a protein binding site, such as linear RNA.

[0164] In some embodiments, the cyclic polynucleotides disclosed herein include one or more protein-binding sites for binding to proteins, such as ribosomes. By engineering protein-binding sites (e.g., ribosome-binding sites) into cyclic polynucleotides, cyclic polynucleotides can evade or be less detected by the host's immune system, exhibiting regulated degradation or regulated translation.

[0165] In some embodiments, the cyclic polynucleotide includes at least one immunoprotein binding site, for example, to mask the cyclic polynucleotide from the action of components of the host immune system, such as evading CTL responses. In some embodiments, the immunoprotein binding site is bound to an immune protein and helps mask non-endogenous cyclic polynucleotides.

[0166] The conventional mechanism of ribosome binding to linear RNA involves the binding of the ribosome to the capped 5' end of the RNA. From the 5' end, the ribosome migrates to the start codon, thus forming the first peptide bond. According to the present invention, internal initiation (i.e., cap-independent) or translation of the cyclic polynucleotide does not require a free or capped end. More precisely, the ribosome binds to an uncapped internal site, thereby initiating polypeptide elongation at the start codon. In some embodiments, the cyclic polynucleotide comprises one or more RNA sequences containing a ribosome binding site, such as a start codon.

[0167] In some embodiments, the cyclic polynucleotides disclosed herein include protein-binding sequences. In some embodiments, the protein-binding sequences target or localize the cyclic polynucleotides to a specific target. In some embodiments, the protein-binding sequences specifically bind to arginine-rich regions of a protein.

[0168] In some embodiments, the cyclic polynucleotides disclosed herein include one or more protein-binding sites, each binding to a target protein, for example, acting as a scaffold to bring two or more proteins into close proximity. In some embodiments, the cyclic polynucleotides disclosed herein include two protein-binding sites, each binding to a target protein, thereby bringing the target proteins into close proximity. In some embodiments, the cyclic polynucleotides disclosed herein include three protein-binding sites, each binding to a target protein, thereby bringing three target proteins into close proximity. In some embodiments, the cyclic polynucleotides disclosed herein include four protein-binding sites, each binding to a target protein, thereby bringing four target proteins into close proximity. In some embodiments, the cyclic polynucleotides disclosed herein include five or more protein-binding sites, each binding to a target protein, thereby bringing five or more target proteins into close proximity. In some embodiments, the target proteins are the same. In some embodiments, the target proteins are different. In some embodiments, bringing the target proteins into close proximity promotes the formation of a protein complex. For example, the cyclic polynucleotides disclosed herein can act as a scaffold to promote the formation of a complex containing 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more target proteins. In some embodiments, bringing two or more target proteins into close proximity promotes the interaction of two or more target proteins. In some embodiments, bringing two or more target proteins into close proximity regulates, promotes, or inhibits enzymatic reactions. In some embodiments, bringing two or more target proteins into close proximity regulates, promotes, or inhibits signal transduction pathways.

[0169] In some embodiments, the protein binding site includes, but is not limited to, binding sites targeting the following proteins: ACIN1, AGO, APOBEC3F, APOBEC3G, ATXN2, AUH, BCCIP, CAPRIN1, CELF2, CPSF1, CPSF2, CPSF6, CPSF7, CSTF2, CSTF2T, CTCF, DDX21, DDX3, DDX3X, DDX42, DGCR8, EIF3A, EIF4A3, and EIF4G2. , ELAVL1, ELAVL3, FAM120A, FBL, FIP1L1, FKBP4, FMR1, FUS, FXR1, FXR2, GNL3, GTF2F1, HNRNPA1, HNRNPA2B1, HNR NPC, HNRNPK, HNRNPL, HNRNPM, HNRNPU, HNRNPUL1, IGF2BP1, IGF2BP2, IGF2BP3, ILF3, KHDRBS1, LARP7, LIN28A, L IN28B, m6A, MBNL2, METTL3, MOV10, MSI1, MSI2, NONO, NONO-, NOP58, NPM1, NUDT21, p53, PCBP2, POLR2A, PRPF8, P TBP1, RBFOX1, RBFOX2, RBFOX3, RBM10, RBM22, RBM27, RBM47, RNPS1, SAFB2, SBDS, SF3A3, SF3B4, SIRT7, SLBP, SL TM, SMNDC1, SND1, SRRM4, SRSF1, SRSF3, SRSF7, SRSF9, TAF15, TARDBP, TIA1, TNRC6A, TOP3B, TRA2A, TRA2B, U2AF1, U2AF2, UNK, UPF1, WDR33, XRN2, YBX1, YTHDC1, YTHDF1, YTHDF2, YWHAG, ZC3H7B, PDK1, AKT1, and any other RNA-binding proteins.

[0170] In some embodiments, the protein binding site is a nucleic acid sequence that binds to a protein, such as a sequence that can bind to a transcription factor, enhancer, repressor, polymerase, nuclease, histone, or any other protein that binds to DNA. In some embodiments, the protein binding site is an aptamer sequence that binds to a protein. In some embodiments, the secondary structure of the aptamer sequence binds to the protein. In some embodiments, circular RNA forms a complex with the protein through the binding of the aptamer sequence.

[0171] In some embodiments, circular RNA is conjugated to a small molecule or a portion thereof, wherein the small molecule or a portion thereof binds to a target, such as a protein. The small molecule can be conjugated to the circular RNA by modified nucleotides, for example by click chemistry. Examples of small molecules that can bind to proteins include, but are not limited to, 4-hydroxytamoxifen (4-OHT), AC220, afatinib, aminopyrazole analogs, AR antagonists, BI-7273, bosutinib, ceritinib, chloroalkyl, dasatinib, fretinib, gefitinib, HIF-1α-derived (R)-hydroxyproline, HJB97, hydroxyproline-based ligands, IACS-7e, ibrutinib, ibrutinib derivatives, and JQ1. Lapatinib, LCL161 derivatives, lenalidomide, nutlin (small molecule), OTX015, PDE4 inhibitors, pomalidomide, ripk2 inhibitors, RN486, Sirt2 inhibitor 3b, SNS-032, gray factor, TBK1 inhibitors, phthalimide piperidone, phthalimide piperidone derivatives, thiazolidinedione-based ligands, VH032 derivatives, VHL ligand 2, VHL-1, VL-269 and their derivatives.

[0172] In some embodiments, the circular RNA is conjugated to more than one small molecule, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more small molecules. In some embodiments, the circular RNA is conjugated to more than one different small molecule, such as 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different small molecules. In some embodiments, more than one small molecule conjugated to the circular RNA is configured to recruit its respective target protein into proximity, which can lead to interactions between target proteins and / or other molecular and cellular changes. For example, the circular RNA can be conjugated to both JQ1 and phthalimide piperidone or derivatives thereof, thus recruiting targets of JQ1 (e.g., BET family proteins) and targets of phthalimide piperidone (e.g., E3 ligases). In some cases, the circular RNA conjugated to JQ1 and phthalimide piperidone recruits BET family proteins via JQ1 or derivatives thereof, labels BET family proteins with ubiquitin via an E3 ligase recruited by phthalimide piperidone or derivatives thereof, and thus leads to the degradation of the labeled BET family proteins.

[0173] Other binding sites

[0174] In some embodiments, the cyclic polynucleotide includes one or more binding sites for non-RNA or non-DNA targets. In some embodiments, the binding site may be one of the binding sites for small molecules, aptamers, lipids, carbohydrates, viral particles, membranes, multicomponent complexes, cells, cellular parts, or any fragment thereof. In some embodiments, the cyclic polynucleotide includes one or more binding sites for lipids. In some embodiments, the cyclic polynucleotide includes one or more binding sites for carbohydrates. In some embodiments, the cyclic polynucleotide includes one or more binding sites for membranes. In some embodiments, the cyclic polynucleotide includes one or more binding sites for multicomponent complexes such as ribosomes, nucleosomes, transcription machinery, etc.

[0175] In some embodiments, the cyclic polynucleotide includes an aptamer sequence. The aptamer sequence can bind to any target described herein (e.g., nucleic acid molecules, small molecules, proteins, carbohydrates, lipids, etc.). The aptamer sequence has a secondary structure capable of binding to the target. In some embodiments, the aptamer sequence has a tertiary structure capable of binding to the target. In some embodiments, the aptamer sequence has a quaternary structure capable of binding to the target. The cyclic polynucleotide can bind to the target via the aptamer sequence to form a complex. In some embodiments, the complex is detectable for at least 5 days. In some embodiments, the complex is detectable for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 days.

[0176] Chelation

[0177] In some embodiments, the circRNAs described herein chelate targets, such as DNA, RNA, proteins, and other cellular components, to regulate cellular processes. circRNAs having binding sites targeting a specific target can compete with the target for binding to an endogenous binding chaperone. In some embodiments, the circRNAs described herein chelate miRNAs. In some embodiments, the circRNAs described herein chelate mRNAs. In some embodiments, the circRNAs described herein chelate proteins. In some embodiments, the circRNAs described herein chelate ribosomes. In some embodiments, the circRNAs described herein chelate other circRNAs. In some embodiments, the circRNAs described herein chelate non-coding RNAs, lncRNAs, miRNAs, tRNAs, rRNAs, snoRNAs, ncRNAs, siRNAs, or shRNAs. In some embodiments, the circRNAs described herein include degradation elements that degrade the chelated target, such as DNA, RNA, proteins, or other cellular components bound to the circRNA. Non-limiting examples of circRNA chelation applications are listed in Table 2.

[0178] Table 2 process MOA (Example) Transcriptional interference circRNA-DNA Translation interference circRNA-mRNA or ribosome Protein-protein interaction inhibitors circRNA-protein microRNA chelation circRNA-RNA (antisense) circRNA chelators (endogenous circRNA) circRNA-circRNA (antisense)

[0179] In some embodiments, any method of using the circRNA described herein can be combined with a translation element. The circRNA containing a translation element described herein can translate RNA into a protein. Figure 3 A schematic diagram of protein expression promoted by circRNA is shown, wherein the circRNA comprises a sequence-specific RNA-binding motif, a sequence-specific DNA-binding motif, a protein-specific binding motif (protein 1), and a regulatory RNA motif (RNA 1). The regulatory RNA motif can initiate RNA transcription and protein expression.

[0180] Non-translated area

[0181] In some embodiments, the circRNA disclosed herein may contain a cryptogenic origin. In some embodiments, the cryptogenic origin contains a non-translated region (UTR). The UTR of a gene can be transcribed but not translated. In some embodiments, the UTR may be included upstream of the translation initiation sequence of the expressed sequence described herein. In some embodiments, the UTR may be included downstream of the expressed sequence described herein. In some cases, a UTR of the first expressed sequence is the same as, continuous with, or overlaps with another UTR of the second expressed sequence. In some embodiments, the intron is a human intron. In some embodiments, the intron is a full-length human intron, such as ZKSCAN1.

[0182] In some embodiments, the cryptogen enhances stability. In some embodiments, regulatory features of the UTR may be included in the cryptogen to enhance the stability of the cyclic polynucleotide.

[0183] In some embodiments, the cyclic polynucleotide comprises a UTR containing one or more segments of adenosine and uridine. AU enrichment signatures can increase the conversion rate of the expression product.

[0184] The introduction, removal, or modification of UTR AU enrichment elements (AREs) can be used to modulate the stability or immunogenicity of cyclic polynucleotides. When engineering specific cyclic polynucleotides, one or more copies of AREs can be introduced to destabilize the cyclic polynucleotide, and these copies of AREs can reduce translation and / or the yield of the expressed product. Similarly, AREs can be identified and removed or mutated to increase intracellular stability, thereby increasing the yield of translation and the resulting protein.

[0185] UTRs from any gene can be incorporated into the corresponding flanking regions of a cyclic polynucleotide. Furthermore, multiple wild-type UTRs of any known gene can be utilized. In some embodiments, artificial UTRs of variants of genes that are not wild-type can be used. These UTRs, or portions thereof, can be placed in the same orientation as in the transcript from which they were selected, or their orientation or position can be altered. Thus, 5'- or 3'-UTRs can be reversed, shortened, lengthened, or made into chimeras with one or more other 5'-UTRs or 3'-UTRs. As used herein, when relating to a UTR sequence, the term "altered" means that the UTR has been altered in some way relative to a reference sequence. For example, a 3'- or 5'-UTR can be altered relative to a wild-type or native UTR by changes in orientation or position as taught above, or by the inclusion of additional nucleotides, deletion of nucleotides, exchange of nucleotides, or transposition. Any alterations that produce "altered" UTRs (whether 3' or 5') constitute variant UTRs.

[0186] In some embodiments, dual, triple, or quadruple UTRs, such as 5'- or 3'-UTRs, may be used. As used herein, a "dual" UTR is a case in which two copies of the same UTR are encoded in tandem or substantially tandem. For example, dual β-globin 3'-UTRs may be used in some embodiments of the invention.

[0187] Encryption source

[0188] As described herein, cyclic polynucleotides may contain an encryption agent to reduce, evade, or avoid cellular innate immune responses. In some embodiments, the cyclic polynucleotides provided herein result in a reduced host immune response compared to a response induced by a reference compound, such as a linear polynucleotide corresponding to the cyclic polynucleotide or a cyclic polynucleotide lacking the encryption agent. In some embodiments, the immunogenicity of the cyclic polynucleotide is less than that of its encryption agent-free counterpart.

[0189] In some embodiments, cyclic polynucleotides are non-immunogenic in mammals such as humans. In some embodiments, cyclic polynucleotides are capable of replicating in mammalian cells such as human cells.

[0190] In some embodiments, the cyclic polynucleotide includes a sequence or expression product.

[0191] In some embodiments, the cyclic polynucleotide has a half-life that is at least the half-life of its linear counterpart (e.g., a linearly expressed sequence or a linear cyclic polynucleotide). In some embodiments, the cyclic polynucleotide has a half-life that is increased relative to the half-life of its linear counterpart. In some embodiments, the half-life is increased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or longer. In some embodiments, the half-life or persistence of the cyclic polynucleotide in the cell is at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days or longer or any time in between. In some embodiments, the half-life or persistence of the cyclic polynucleotide in the cell is from about 10 minutes to about 7 days, or from about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days, 7 days or any time in between.

[0192] In some embodiments, cyclic polynucleotides modulate cell function, for example, transiently or chronically. In some embodiments, cell function undergoes a stable alteration, for example, modulation lasting for at least about 1 hour to about 30 days, or for at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days, or longer, or any time in between. In some embodiments, cell function is transiently altered, for example, for a duration not exceeding about 30 minutes to about 7 days, or not exceeding about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days, 7 days, or any time in between.

[0193] In some embodiments, the cyclic polynucleotide is at least about 20 base pairs, at least about 30 base pairs, at least about 40 base pairs, at least about 50 base pairs, at least about 75 base pairs, at least about 100 base pairs, at least about 200 base pairs, at least about 300 base pairs, at least about 400 base pairs, at least about 500 base pairs, or at least about 1,000 base pairs. In some embodiments, the cyclic polynucleotide may be large enough to accommodate ribosome binding sites. Those skilled in the art will understand that the maximum size of the cyclic polynucleotide can be as large as is within the technical limitations of generating and / or using cyclic polynucleotides. Without being bound by theory, it is possible for multiple segments of RNA to be generated from DNA and their 5' and 3' free ends to anneal to produce a “string” of RNA, which may eventually be circularized when only one 5' free end and one 3' free end remain. In some embodiments, the maximum size of the cyclic polynucleotide may be limited by its ability to package RNA and deliver it to a target. In some embodiments, the size of the cyclic polynucleotide is sufficient to encode a useful polypeptide, and therefore, lengths of less than about 20,000 base pairs, less than about 15,000 base pairs, less than about 10,000 base pairs, less than about 7,500 base pairs, or less than about 5,000 base pairs, less than about 4,000 base pairs, less than about 3,000 base pairs, less than about 2,000 base pairs, less than about 1,000 base pairs, less than about 500 base pairs, less than about 400 base pairs, less than about 300 base pairs, less than about 200 base pairs, and less than about 100 base pairs may be useful.

[0194] Cut sequence

[0195] In some embodiments, the cyclic polynucleotide includes at least one cleavage sequence. In some embodiments, the cleavage sequence is adjacent to the expression sequence. In some embodiments, the cyclic polynucleotide includes a cleavage sequence, for example, in a sacrificial circRNA, a cleavable circRNA, or a self-cleaving circRNA. In some embodiments, the cyclic polynucleotide contains two or more cleavage sequences, resulting in the separation of the cyclic polynucleotide into multiple products, such as miRNA, linear RNA, smaller cyclic polynucleotides, etc.

[0196] In some embodiments, the cleavage sequence includes a ribozyme RNA sequence. Ribozymes (derived from ribonucleases, also known as RNases or catalytic RNAs) are RNA molecules that catalyze chemical reactions. Many natural ribozymes catalyze the hydrolysis of one of their own phosphodiester bonds, or catalyze the hydrolysis of bonds in other RNAs, but natural ribozymes have also been found to catalyze aminotransferase activity in ribosomes. Catalytic RNAs can be “evolved” through in vitro methods. Similar to the riboswitching activity discussed above, ribozymes and their reaction products can regulate gene expression. In some embodiments, the catalytic RNA or ribozyme is contained within a larger non-coding RNA, which allows the ribozyme to exist in many copies within the cell for the purpose of chemically transforming large molecules. In some embodiments, both the aptamer and the ribozyme can be encoded in the same non-coding RNA.

[0197] Sacrificial Order

[0198] In some embodiments, the circRNAs described herein include sacrificial circRNAs, cleavable circRNAs, or self-cleaving circRNAs. circRNAs can deliver cellular components, including, for example, RNA, lncRNA, lincRNA, miRNA, tRNA, rRNA, snoRNA, ncRNA, siRNA, or shRNA. In some embodiments, circRNAs include miRNAs separated by: (i) self-cleavable elements; (ii) cleavage recruitment sites; (iii) degradable adapters; (iv) chemical adapters; and / or (v) spacer sequences. In some embodiments, circRNAs include siRNAs separated by: (i) self-cleavable elements; (ii) cleavage recruitment sites (e.g., ADAR); (iii) degradable adapters (e.g., glycerol); (iv) chemical adapters; and / or (v) spacer sequences. Non-limiting examples of self-cleavable elements include hammerhead structures, splicing elements, hairpins, hepatitis D virus (HDV), Varkud satellites (VS), and glmS ribozymes. Table 4 lists non-restrictive examples of sacrificial applications of circRNA.

[0199] Table 3 process MOA (Example) miRNA delivery Circular microRNAs with self-cutting elements (e.g., hammerhead structures), cleavage recruitment (e.g., ADAR), or degradable linkers (e.g., glycerol). siRNA delivery Circular siRNAs with self-cutting elements (e.g., hammerhead structures), cleavage recruitment (e.g., ADAR), or degradable linkers (e.g., glycerol) Expression sequence peptides or polypeptides

[0200] In some embodiments, the cyclic polynucleotide contains a sequence encoding a peptide or polypeptide.

[0201] The polypeptide can be linear or branched. The length of the polypeptide is about 5 to about 4000 amino acids, about 15 to about 3500 amino acids, about 20 to about 3000 amino acids, about 25 to about 2500 amino acids, about 50 to about 2000 amino acids, or any range therebetween. In some embodiments, a polypeptide length less than about 4000 amino acids, less than about 3500 amino acids, less than about 3000 amino acids, less than about 2500 amino acids, or less than about 2000 amino acids, less than about 1500 amino acids, less than about 1000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, less than about 300 amino acids, or less may be useful.

[0202] In some embodiments, the cyclic polynucleotide comprises one or more RNA sequences, each of which can encode a polypeptide. The polypeptide can be produced in large quantities. Thus, the polypeptide can be any protein molecule that can be produced. The polypeptide can be secreted from a cell or located in the cytoplasm, nucleus, or membrane compartment of the cell.

[0203] In some embodiments, the cyclic polynucleotide includes a sequence encoding a protein, such as a therapeutic protein. Examples of therapeutic proteins may include, but are not limited to, protein replacements, protein supplements, vaccines, antigens (e.g., tumor antigens, viruses, and bacteria), hormones, cytokines, antibodies, immunotherapies (e.g., cancer), cell reprogramming / transdifferentiation factors, transcription factors, chimeric antigen receptors, transposases or nucleases, immune effectors (e.g., those influencing susceptibility to immune responses / signals), regulated death effector proteins (e.g., inducers of apoptosis or necrosis), tumor non-dissolving inhibitors (e.g., oncoprotein inhibitors), epigenetic modifiers, epigenetic enzymes, transcription factors, DNA or protein modifying enzymes, DNA intercalators, efflux pump inhibitors, nuclear receptor activators or inhibitors, proteasome inhibitors, enzyme competitive inhibitors, protein synthesis effectors or inhibitors, nucleases, protein fragments or domains, ligands or receptors, and CRISPR systems or components thereof.

[0204] Regulatory sequences

[0205] In some embodiments, the regulatory sequence is a promoter. In some embodiments, the cyclic polynucleotide includes at least one promoter adjacent to at least one expression sequence. In some embodiments, the cyclic polynucleotide includes a promoter adjacent to each expression sequence. In some embodiments, the promoter is present on one or both sides of each expression sequence, resulting in the separation of expression products, such as one or more peptides and / or one or more polypeptides.

[0206] Circular polynucleotides (CPNs) can regulate the expression of gene-encoded RNA. Because multiple genes may share a degree of sequence homology, CPNs can be engineered to target a class of genes with sufficient sequence homology. In some embodiments, CPNs may contain sequences complementary to sequences shared in different gene targets or sequences unique to a specific gene target. In some embodiments, CPNs can be engineered to target conserved regions of RNA sequences homologous among several genes, thereby targeting several genes within a gene family. In some embodiments, CPNs can be engineered to target sequences specific to a particular RNA sequence of a single gene.

[0207] In some embodiments, the length of the expressed sequence is less than 5000 bp (e.g., less than about 5000 bp, 4000 bp, 3000 bp, 2000 bp, 1000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, 200 bp, 100 bp, 50 bp, 40 bp, 30 bp, 20 bp, 10 bp or less). In some embodiments, the expressed sequence independently or additionally has a length greater than 10 bp (e.g., at least about 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb, 1.8 kb, 1.9 kb, 2 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3 ...1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3 kb, 2.9 kb, 2.1 kb, 2.2 kb, 2.3 kb, 2.4 kb, 2.5 kb, 2.6 kb, 2.7 kb, 2.8 kb, 2.9 kb, 3 5 kb or larger).

[0208] In some embodiments, the expressed sequence includes one or more features described herein, such as sequences encoding one or more peptides or proteins, one or more regulatory nucleic acids, one or more non-coding RNAs, and other expressed sequences.

[0209] Internal ribosome entry site (IRES)

[0210] In some embodiments, the cyclic polynucleotides described herein include an internal ribosome entry site (IRES) element. A suitable IRES element may comprise an RNA sequence capable of binding to a eukaryotic ribosome. In some embodiments, the IRES element is at least about 50 base pairs, at least about 100 base pairs, at least about 200 base pairs, at least about 250 base pairs, at least about 350 base pairs, or at least about 500 base pairs. In some embodiments, the IRES element is derived from the DNA of an organism, including but not limited to viruses, mammals, and fruit flies. Viral DNA may be derived from, for example, piconevirus cDNA, encephalomyocarditis virus (EMCV) cDNA, and poliovirus cDNA. In some embodiments, the fruit fly DNA from which the IRES element is derived may include, for example, an antennal leg gene from the fruit fly *Drosophila melanogaster*.

[0211] In some embodiments, the cyclic polynucleotides described herein comprise at least one IRES flanking at least one (e.g., 2, 3, 4, 5 or more) expression sequences. In some embodiments, the IRES may be flanked by at least one (e.g., 2, 3, 4, 5 or more) expression sequences. In some embodiments, the cyclic polynucleotide may include one or more IRES sequences on one or both sides of each expression sequence, resulting in the separation of one or more peptides and / or one or more polypeptides.

[0212] Translation start sequence

[0213] In some embodiments, the cyclic polynucleotide encodes a polypeptide and may include a translation initiation sequence, such as a start codon. In some embodiments, the translation initiation sequence includes a Kozak or Shine-Dalgarno sequence. In some embodiments, the cyclic polynucleotide includes a translation initiation sequence, such as a Kozak sequence, adjacent to the expression sequence. In some embodiments, the translation initiation sequence (e.g., a Kozak sequence) is present on one or both sides of each expression sequence, resulting in separation of the expression products. In some embodiments, the cyclic polynucleotide includes at least one translation initiation sequence adjacent to the expression sequence.

[0214] Natural 5'-UTRs can function in translation initiation. Natural 5'-UTRs can contain a Kozak-like signature, which is involved in the ribosomal initiation of translation for various genes. The Kozak sequence has a shared CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another G. 5'-UTRs can also form secondary structures involved in elongation factor binding.

[0215] Cyclic polynucleotides may include more than one start codon, such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60, or more than 60 start codons. Translation may begin at the first start codon or downstream of the first start codon.

[0216] In some embodiments, the cyclic polynucleotide (cP) may be initiated by a codon that is not the first start codon, such as AUG. Translation of the cP may be initiated by an alternative translation initiation sequence, such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, and TTG / UUG. In some embodiments, translation is initiated at the alternative translation initiation sequence under selective conditions, such as stress-induced conditions. As a non-limiting example, translation of the cP may be initiated at an alternative translation initiation sequence, such as ACG. As another non-limiting example, translation of the cP may be initiated at an alternative translation initiation sequence, CTG / CUG. As yet another non-limiting example, translation of the cP may be initiated at an alternative translation initiation sequence, GTG / GUG. As yet another non-limiting example, cyclic polynucleotides can be translated at alternative translation initiation sequences that are repetitive non-AUG (RAN) sequences, such as short repetitive RNA sequences like CGG, GGGGCC, CAG, and CTG.

[0217] Nucleotides flanking the codon that initiates translation can affect the translation efficiency, length, and / or structure of cyclic polynucleotides. Masking any nucleotide flanking the codon that initiates translation can be used to alter the translation initiation position, translation efficiency, length, and / or structure of cyclic polynucleotides.

[0218] In one embodiment, a masking agent may be used near the start codon or an alternative start codon to mask or hide the codon, thereby reducing the likelihood that translation will begin at the masked or alternative start codon. Non-limiting examples of masking agents include antisense locked nucleic acid (LNA) oligonucleotides and exon conjugation complexes (EJCs). In some embodiments, the masking agent may be used to mask the start codon of a cyclic polynucleotide to increase the likelihood that translation will begin at the alternative start codon.

[0219] In some embodiments, translation is initiated under selective conditions, such as, but not limited to, virus-induced selection in the presence of GRSF-1, and the cyclic polynucleotide includes a GRSF-1 binding site.

[0220] In some embodiments, translation is initiated by treating eukaryotic initiation factor 4A (eIF4A) with Rocaglates. Translation can be suppressed by blocking the 43S scan, resulting in premature upstream translation initiation and reduced protein expression of transcripts carrying the RocA-eIF4A target sequence.

[0221] Termination sequence

[0222] In some embodiments, the cyclic polynucleotide comprises one or more expression sequences, and each expression sequence may have a termination sequence. In some embodiments, the cyclic polynucleotide comprises one or more expression sequences, and the expression sequences lack termination sequences, such that the cyclic polynucleotide is translated sequentially. The exclusion of termination sequences due to the lack of ribosome stall or shedding may result in rolling circle translation or sequential production of expression products such as peptides or polypeptides. In such embodiments, rolling circle translation produces sequential expression products through each expression sequence.

[0223] In some embodiments, the cyclic polynucleotide comprises an interleaved sequence. To avoid the generation of sequentially expressed products, such as peptides or polypeptides, while maintaining rolling circle translation, an interleaved sequence may be included to induce ribosome pause during translation. The interleaved sequence may include a 2A-like or CHYSEL (cis-acting hydrolase element) sequence. In some embodiments, the interleaved element encodes a sequence having a C-terminal concordant sequence X1X2X3EX5NPGP, where X1 is absent or G or H, X2 is absent or D or G, X3 is D or V or I or S or M, and X5 is any amino acid. In some embodiments, this sequence comprises a non-conserved sequence of amino acids with abundant α-helix content, followed by the concordant sequence -D(V / I)ExNPGP, where x = any amino acid. Some non-limiting examples of interleaved elements include GDVESNPGP, GDIEENPGP, VEPNPGP, IETNPGP, GDIESNPGP, GDVELNPGP, GDIETNPGP, GDVENPGP, GDVEENPGP, GDVEQNPGP, IESNPGP, GDIELNPGP, HDIETNPGP, HDVETNPGP, HDVEMNPGP, GDMESNPGP, GDVETNPGP, GDIEQNPGP, and DSEFNPGP.

[0224] In some embodiments, the cyclic polynucleotide includes a termination sequence at the end of one or more expressed sequences. In some embodiments, one or more expressed sequences lack a termination sequence. Typically, the termination sequence includes an in-frame nucleotide triplet that signals translation termination, such as UAA, UGA, UAG. In some embodiments, one or more termination sequences in the cyclic polynucleotide are frame-shift termination sequences, such as, but not limited to, off-frame or -1 and +1 shifted frames that can terminate translation (e.g., hidden termination). Frame-shift termination sequences include nucleotide triplets appearing in the second and third reading frames of the expressed sequence, TAA, TAG, and TGA. Frame-shift termination sequences may be important for preventing mRNA misreading, which is generally harmful to cells.

[0225] In some embodiments, the interleaved sequence described herein may terminate translation and / or cleave the expression product between the G and P of the shared sequence described herein. As a non-limiting example, a cyclic polynucleotide includes at least one interleaved sequence to terminate translation and / or cleave the expression product. In some embodiments, the cyclic polynucleotide includes an interleaved sequence adjacent to at least one expression sequence. In some embodiments, the cyclic polynucleotide includes an interleaved sequence following each expression sequence. In some embodiments, the cyclic polynucleotide includes an interleaved sequence present on one or both sides of each expression sequence, resulting in the translation of one or more individual peptides and / or polypeptides by each expression sequence.

[0226] Poly-A sequence

[0227] In some embodiments, the cyclic polynucleotide includes a polyA sequence. In some embodiments, the polyA sequence is longer than 10 nucleotides. In some embodiments, the polyA sequence is longer than 15 nucleotides (e.g., at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the polyA sequence is about 10 to about 3,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 750, 30 to 1,000, 30 to 1,500, 30 to 2,000, 30 to 2,500, 50 to 100, 50 to 250, 50 to 500, 50 to 750, 50 to 1,000, 50 to 1,500, 50 to 2,000, 50 to 2,500, 50 to 3,000, 100 to 500, 100 to 750, 100 to 1,000, 100 to 1,500). 100 to 2,000, 100 to 2,500, 100 to 3,000, 500 to 750, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 2,500, 500 to 3,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 2,500, 1,000 to 3,000, 1,500 to 2,000, 1,500 to 2,500, 1,500 to 3,000, 2,000 to 3,000, 2,000 to 2,500 and 2,500 to 3,000).

[0228] In one embodiment, the polyA sequence is designed relative to the length of the entire cyclic polynucleotide. The design can be based on the length of the coding region, the length of a specific feature or region (such as a first or flanking region), or the length of the final product expressed by the cyclic polynucleotide. In this document, the length of the polyA sequence can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% longer than the cyclic polynucleotide or its features. The polyA sequence can also be designed as a part of the cyclic polynucleotide. In this document, the polyA sequence can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more of the total length of the construct or the total length of the construct minus the polyA sequence. Furthermore, engineered binding sites and conjugation of the cyclic polynucleotide to the polyA-binding protein can enhance expression.

[0229] In some embodiments, the cyclic polynucleotide is designed to include poly-AG quartets. A G-tetrad is a cyclic hydrogen-bonded array of four guanine nucleotides, which can be formed from G-rich sequences in DNA and RNA. In some embodiments, G-tetrads may be incorporated into the ends of poly-A sequences. The stability, protein yield, and / or other parameters of the resulting cyclic polynucleotide construct can be determined, including half-life at different time points. In some embodiments, the protein yield produced by the poly-AG quartets can be at least 75% of the protein yield obtained using only a 120-nucleotide poly-A sequence.

[0230] Ribose switch

[0231] In some embodiments, the cyclic polynucleotide contains one or more riboswitch components.

[0232] A riboswitch can be part of a cyclic polynucleotide that can directly bind to small target molecules, and its binding to the target affects RNA translation as well as the stability and activity of the expression product. Therefore, depending on the presence or absence of the target molecule, the cyclic polynucleotide including the riboswitch can modulate the activity of the cyclic polynucleotide. In some embodiments, the riboswitch has an aptamer-like affinity region for individual molecules. Any aptamer contained in a non-coding nucleic acid can be used to chelate molecules from a large volume. In some embodiments, the "(ribo)switch" activity can be used for downstream reporting of events.

[0233] In some embodiments, riboswitches regulate gene expression by: transcription termination, translation initiation repression, mRNA self-cleavage, and alterations to splicing pathways in eukaryotes. Riboswitches can control gene expression by binding to or removing trigger molecules. Therefore, conditions that subject a cyclic polynucleotide including a riboswitch to activation, inactivation, or blockage of the riboswitch can alter gene expression. For example, gene expression can be altered due to transcription termination or blockage of ribosome-RNA binding. Depending on the nature of the riboswitch, binding to trigger molecules or their analogues can reduce / prevent or promote / increase the expression of RNA molecules.

[0234] In some embodiments, the riboswitch is a cobalamin riboswitch (also known as a B12-element) that binds to adenosylcobalamin (a coenzyme form of vitamin B12) to regulate the biosynthesis and transport of cobalamin and similar metabolites.

[0235] In some embodiments, the riboswitches are cyclic 2-GMP riboswitches that bind to cyclic 2-GMP to regulate multiple genes. There are two non-structurally related classes of cyclic 2-GMP riboswitches: cyclic 2-GMP-I and cyclic 2-GMP-II.

[0236] In some embodiments, the riboswitch is an FMN riboswitch (also known as an RFN element) that binds to flavin mononucleotides (FMNs) to regulate the biosynthesis and transport of riboflavin.

[0237] In some embodiments, the riboswitch is a glmS riboswitch that self-cleaves when a sufficient concentration of glucosamine-6-phosphate is present.

[0238] In some embodiments, the riboswitches are glutamine riboswitches, which bind glutamine to regulate genes involved in glutamine and nitrogen metabolism. Glutamine riboswitches also bind short peptides of unknown function. Such riboswitches fall into two structurally related categories: glnA RNA motifs and downstream peptide motifs.

[0239] In some embodiments, the riboswitches are glycine riboswitches that bind to glycine to regulate glycine metabolism genes. The glycine riboswitches contain two adjacent aptamer domains in the same mRNA and are the only known native RNAs to exhibit cooperative binding.

[0240] In some embodiments, the riboswitch is a lysine riboswitch (also known as an L-box), which binds to lysine to regulate the biosynthesis, catabolism, and transport of lysine.

[0241] In some embodiments, the riboswitches are pre-Q1 riboswitches that bind to pre-Q nucleotides to regulate genes involved in the synthesis of the precursor or the transport to the Q nucleotide. Two distinct classes of pre-Q1 riboswitches are pre-Q1-I riboswitches and pre-Q1-II riboswitches. Among naturally occurring riboswitches, the binding domain of pre-Q1-I riboswitches is unusually small. Pre-Q1-II riboswitches, found only in certain species of *Streptococcus* and *Lactococcus*, have a completely different structure and are larger than pre-Q1-I riboswitches.

[0242] In some embodiments, the riboswitches are purine riboswitches that bind purines to regulate purine metabolism and transport. Different forms of purine riboswitches bind guanine or adenine. The specificity of guanine or adenine depends on the Watson-Crick interaction with a single pyrimidine at position Y74 in the riboswitch. In guanine riboswitches, the single pyrimidine is cytosine (i.e., C74). In adenine riboswitches, the single pyrimidine is uracil (i.e., U74). Homologous types of purine riboswitches can bind deoxyguanosine, but with more significant differences than single nucleotide mutations.

[0243] In some embodiments, the riboswitch is an S-adenosylhomocysteine ​​(SAH) riboswitch that binds to SAH to regulate genes involved in the recycling of SAH generated from S-adenosylmethionine (SAM) in methylation reactions.

[0244] In some embodiments, the riboswitches are S-adenosylmethionine (SAM) riboswitches, which bind SAM to regulate the biosynthesis and transport of methionine and SAM. There are three distinct SAM riboswitches: SAM-I (originally called the S-box), SAM-II, and the SMK box. SAM-I is widely distributed in bacteria. SAM-II is found only in α-Proteobacteria, β-Proteobacteria, and a few γ-Proteobacteria. The SMK box riboswitches have been found in the Lactobacilliales order. These three variants of the riboswitches do not exhibit significant sequence or structural similarity. A fourth variant, SAM-IV, appears to have a ligand-binding core similar to SAM-I, but in the case of a different scaffold.

[0245] In some embodiments, the riboswitch is a SAM-SAH riboswitch, which binds SAM and SAH with similar affinity.

[0246] In some embodiments, the riboswitch is a tetrahydrofolate riboswitch that binds to tetrahydrofolate to regulate the synthesis and transport of genes.

[0247] In some embodiments, the riboswitch is a theophylline-binding riboswitch or a riboswitch bound to thymine pyrophosphate.

[0248] In some embodiments, the riboswitch is a glmS-catalytic riboswitch derived from *Thermoanaerobacter ertengcongensis*, which senses glucosamine 6-phosphate.

[0249] In some embodiments, the riboswitch is a thiamine pyrophosphate (TPP) riboswitch (also known as a Thi-box), which binds to TPP to regulate the biosynthesis and transport of thiamine, as well as the transport of similar metabolites. The TPP riboswitch has been found in eukaryotes.

[0250] In some embodiments, the riboswitch is a Moco riboswitch that binds to a molybdenum cofactor to regulate genes involved in the biosynthesis and transport of the coenzyme, as well as enzymes that use molybdenum or a derivative thereof as a cofactor.

[0251] In some embodiments, the riboswitch is an adenine-sensing add-A riboswitch found in the 5'-UTR of the gene encoding adenine deaminase (add) in Vibrio vulnificus.

[0252] Aptamer enzymes

[0253] In some embodiments, the cyclic polynucleotide comprises an aptamer. The aptamer is a switch for conditional expression in which the aptamer region acts as an allosteric control element and is coupled to a catalytic RNA region (hereinafter referred to as a "ribozyme"). In some embodiments, the aptamer is active in cell type-specific translation. In some embodiments, the aptamer is active in cell state-specific translation (e.g., in virus-infected cells or in the presence of viral nucleic acids or viral proteins).

[0254] Ribozymes are RNA molecules that catalyze chemical reactions. Many natural ribozymes can catalyze the hydrolysis of phosphodiester bonds in the ribozyme itself or in other RNA. Natural ribozymes can also catalyze the aminotransferase activity of ribosomes. Catalytic RNA can be "evolved" through in vitro methods. Ribozymes and their reaction products can regulate gene expression. In some embodiments, catalytic RNA or ribozymes are contained within a larger non-coding RNA, which allows the ribozyme to exist in many copies within the cell for the chemical transformation of large molecules. In some embodiments, both the aptamer and the ribozyme can be encoded in the same non-coding RNA.

[0255] Some non-limiting examples of ribozymes include hammerhead ribozymes, VL ribozymes, lead ribozymes, and hairpin ribozymes.

[0256] In some embodiments, aptamers are ribozymes capable of cleaving RNA sequences and regulated by binding to ligands or regulators. Ribozymes can be autocleaving ribozymes. Thus, these ribozymes can combine the properties of ribozymes and aptamers.

[0257] In some embodiments, the aptamer is contained within the untranslated region of the cyclic polynucleotide described herein. The aptamer is inactive in the absence of a ligand / regulator, which allows transgene expression. Expression can be turned off or downregulated by adding a ligand. Aptamers downregulated in response to the presence of a specific regulator can be used in control systems requiring upregulation of gene expression by a responding regulator.

[0258] Aptamers can also be used to develop systems for the self-regulation of cyclic polynucleotide expression. For example, the protein products of the cyclic polynucleotides described herein, i.e., rate-determining enzymes in the synthesis of specific small molecules, can be modified to include aptamers selected to have increased catalytic activity in the presence of said small molecules to provide an autoregulatory feedback loop for molecular synthesis. Alternatively, aptamer activity can be selected to sense the accumulation of protein products of cyclic polynucleotides or any other cellular macromolecules.

[0259] In some embodiments, the cyclic polynucleotide may include an aptamer sequence. Non-limiting examples of aptamers include an RNA aptamer that binds lysozyme, Toggle-25t (an RNA aptamer containing a 2'-fluoropyrimidine nucleotide that binds thrombin with high specificity and affinity), RNATat that binds the human immunodeficiency virus trans-action response element (HIV TAR), an RNA aptamer that binds heme, an RNA aptamer that binds interferon-γ, an RNA aptamer that binds vascular endothelial growth factor (VEGF), an RNA aptamer that binds prostate-specific antigen (PSA), an RNA aptamer that binds dopamine, and an RNA aptamer that binds heat shock factor 1 (HSF1).

[0260] In some embodiments, the circRNAs described herein can be used for RNA transcription and replication. For example, circRNAs can be used to encode non-coding RNAs, lncRNAs, miRNAs, tRNAs, rRNAs, snoRNAs, ncRNAs, siRNAs, or shRNAs. In some embodiments, circRNAs may include antisense miRNAs and transcriptional elements. Post-transcriptionally, such circRNAs can produce functional linear miRNAs. Non-limiting examples of circRNA expression and regulatory applications are listed in Table 5.

[0261] Table 4 process MOA (Example) Combination therapy of inhibition and translation Inhibit one protein and supplement with another (or the same) protein. Replica elements

[0262] Circular polynucleotides (CPNs) can encode sequences and / or motifs that can be used for replication. Replication of CPNs can be carried out by generating complementary CPNs. In some embodiments, the CPN includes a motif for initiating transcription, wherein transcription is driven by an endogenous cellular mechanism (DNA-dependent RNA polymerase) or RNA-dependent RNA polymerase encoded by the CPN. The product of rolling circle transcription events can be cleaved by a ribozyme to generate a unit-length complementary or proliferating CPN. The ribozyme can be encoded by the CPN, its complementary sequence, or by a trans RNA sequence. In some embodiments, the encoded ribozyme can include a sequence or motif that regulates (inhibits or promotes) the ribozyme's activity to control circRNA proliferation. In some embodiments, the unit-length sequence can be ligated into a circular form by a cellular RNA ligase. In some embodiments, the CPN includes replication elements that facilitate self-amplification. Examples of such replication elements include HDV replication domains and replication-capable circular RNA sense and / or antisense ribozymes, such as antigenome 5'-CGGGUCGGCAUGGCAUCUCCACCUCCUCGCGGUCCGACCUGGGCAUCCGAAGGAGGACGCACGUCCACUCGGAUGGCUAAGGGAGAGCCA-3' (SEQ ID NO: 1) and genome 5'-UGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCCGAGGGGACCGUCCCCUCGGUAAUGGCGAAUGGGACCCA-3' (SEQ ID NO: 2).

[0263] In some embodiments, the cyclic polynucleotide includes at least one cleavage sequence as described herein to aid replication. The cleavage sequence in the cyclic polynucleotide can cut the long transcript obtained from cyclic polynucleotide replication to a specific length, after which it can be cyclized to form a complementary cyclic polynucleotide.

[0264] In another embodiment, the cyclic polynucleotide includes at least one ribozyme sequence to cleave long transcripts obtained from cyclic polynucleotide replication to a specific length, wherein another encoded ribozyme cleaves the transcript at the ribozyme sequence. Circulation forms a complement to the cyclic polynucleotide.

[0265] In some embodiments, cyclic polynucleotides are substantially resistant to degradation by, for example, exonucleases.

[0266] In some embodiments, cyclic polynucleotides are replicated within the cell. In some embodiments, the replication rate of cyclic polynucleotides within the cell is any percentage between or between about 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-75%, 75%-80%, 80%-85%, 85%-90%, 90%-95%, and 95%-99%. In some embodiments, the cyclic polynucleotides are replicated within the cell and delivered to daughter cells. In some embodiments, the cell delivers at least one cyclic polynucleotide to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, cells undergoing meiosis deliver cyclic polynucleotides to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, cells undergoing mitosis transfer cyclic polynucleotides to daughter cells with an efficiency of at least 25%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99%.

[0267] In some embodiments, cyclic polynucleotides replicate within host cells. In some embodiments, cyclic polynucleotides are capable of replicating in mammalian cells, such as human cells.

[0268] Although in some embodiments, the cyclic polynucleotide replicates in the host cell, it does not integrate into the host genome, for example, it does not integrate with the host chromosome. In some embodiments, the cyclic polynucleotide has a negligible recombination frequency with, for example, the host chromosome. In some embodiments, the recombination frequency of the cyclic polynucleotide with, for example, the host chromosome is, for example, less than about 1.0 cM / Mb, 0.9 cM / Mb, 0.8 cM / Mb, 0.7 cM / Mb, 0.6 cM / Mb, 0.5 cM / Mb, 0.4 cM / Mb, 0.3 cM / Mb, 0.2 cM / Mb, 0.1 cM / Mb or lower.

[0269] Other sequences

[0270] In some embodiments, the cyclic polynucleotide further includes another nucleic acid sequence. In some embodiments, the cyclic polynucleotide may include DNA, RNA, or an artificial nucleic acid sequence. Other sequences may include, but are not limited to, genomic DNA, cDNA, or sequences encoding tRNA, mRNA, rRNA, miRNA, gRNA, siRNA, or other RNAi molecules. In some embodiments, the cyclic polynucleotide includes a sequence encoding siRNA to target one or more different loci of the same gene expression product as the cyclic polynucleotide. In some embodiments, the cyclic polynucleotide includes a sequence encoding siRNA to target a different gene expression product than the cyclic polynucleotide.

[0271] In some embodiments, the cyclic polynucleotide lacks a 5'-UTR. In some embodiments, the cyclic polynucleotide lacks a 3'-UTR. In some embodiments, the cyclic polynucleotide lacks a poly-A sequence. In some embodiments, the cyclic polynucleotide lacks a termination sequence. In some embodiments, the cyclic polynucleotide lacks an internal ribosome entry site. In some embodiments, the cyclic polynucleotide lacks susceptibility to exonuclease degradation. In some embodiments, the cyclic polynucleotide lacks binding to cap-binding proteins. In some embodiments, the cyclic polynucleotide lacks a 5' cap.

[0272] In some embodiments, the cyclic polynucleotide comprises one or more of the following sequences: a sequence encoding one or more miRNAs, a sequence encoding one or more replication proteins, a sequence encoding a foreign gene, a sequence encoding a therapeutic agent, a regulatory sequence (e.g., a promoter, an enhancer), a sequence encoding a regulatory sequence that targets one or more endogenous genes (siRNA, lncRNA, shRNA), and a sequence encoding a therapeutic mRNA or protein.

[0273] Other sequences can be approximately 2 nt to approximately 5000 nt, approximately 10 nt to approximately 100 nt, approximately 50 nt to approximately 150 nt, approximately 100 nt to approximately 200 nt, approximately 150 nt to approximately 250 nt, approximately 200 nt to approximately 300 nt, approximately 250 nt to approximately 350 nt, approximately 300 nt to approximately 500 nt, approximately 10 nt to approximately 1000 nt, approximately 50 nt to approximately 1000 nt, approximately 100 nt to approximately 1000 nt, approximately 1000 nt to approximately 2000 nt, approximately 2000 nt to approximately 3000 nt, approximately 3000 nt to approximately 4000 nt, approximately 4000 nt to approximately 5000 nt, or any range in between.

[0274] As a result of their cyclization, cyclic polynucleotides may contain certain features that distinguish them from linear RNA. For example, cyclic polynucleotides are less susceptible to degradation by exonucleases compared to linear RNA. Thus, cyclic polynucleotides are more stable than linear RNA, especially when incubated in the presence of exonucleases. This increased stability of cyclic polynucleotides compared to linear RNA makes them more useful as cell transformation agents for peptide production and allows for easier and longer storage compared to linear RNA. The stability of cyclic polynucleotides treated with exonucleases can be tested using methods standard in the art to determine whether RNA degradation has occurred (e.g., by gel electrophoresis).

[0275] In addition, unlike linear RNA, cyclic polynucleotides are less likely to be dephosphorylated when incubated with phosphatases such as calf intestinal phosphatase.

[0276] Nucleotide spacer sequence

[0277] In some embodiments, the cyclic polynucleotide includes a spacer sequence.

[0278] The spacer can be a nucleic acid molecule with low GC content, such as spanning the entire length of the spacer, or spanning at least 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of continuous nucleic acid residues, less than 65%, 60%, 55%, 50%, 55%, 50%, 45%, 40%, 39%, 38%, 37%, 36%, 35%, 34%, 33%, 32%, 31%, 30%, 29%, 28%, 27%, 26%, 25%, 24%, 23%, 22%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%. In some embodiments, the spacer has essentially no secondary structure, such as less than 40 kcal / mol, or less than -39, -38, -37, -36, -35, -34, -33, -32, -31, -30, -29, -28, -27, -26, -25, -24, -23, -22, -20, -19, -18, -17, -16, -15, -14, -13, -12, -11, -10, -9, -8, -7, -6, -5, -4, -3, -2, or -1 kcal / mol. The spacer may comprise nucleic acids, such as DNA or RNA.

[0279] The spacer sequence may encode an RNA sequence, and is preferably a protein or peptide sequence, including a secretory signal peptide.

[0280] The spacer sequence can be non-coding. If the spacer is a non-coding sequence, a start codon can be provided in the coding sequence of the adjacent sequence. In some embodiments, it is envisioned that the first nucleic acid residue of the coding sequence can be a start codon, such as the A residue of AUG. If the spacer encodes an RNA, protein, or peptide sequence, a start codon can be provided in the spacer sequence.

[0281] In some embodiments, the spacer is operatively connected to another sequence described herein.

[0282] Non-nucleic acid connector

[0283] The cyclic polynucleotides described herein may also include non-nucleic acid linkers. In some embodiments, the cyclic polynucleotides described herein have non-nucleic acid linkers between one or more sequences or elements described herein. In some embodiments, one or more sequences or elements described herein are linked to a linker. The non-nucleic acid linker can be a chemical bond, such as one or more covalent or non-covalent bonds. In some embodiments, the non-nucleic acid linker is a peptide linker or a protein linker. Such linkers can be between 2 and 30 amino acids, or longer. Linkers include any flexible, rigid, or cleavable linkers described herein.

[0284] The most commonly used flexible linkers have sequences primarily composed of Gly and Ser residues (“GS” linkers). Flexible linkers can have domains that require a certain degree of mobility or interaction for connection and can include small, nonpolar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids. The incorporation of Ser or Thr can also maintain the stability of the linker in aqueous solution by forming hydrogen bonds with water molecules, and thus reduce unfavorable interactions between the linker and the protein moiety.

[0285] Rigid joints function to maintain a fixed distance between domains and preserve their independence. Rigid joints can also be useful when spatial separation of domains is crucial for maintaining the stability or bioactivity of one or more components in a fusion. Rigid joints can have α-helical structures or proline-rich sequences (XP). n X represents any amino acid, preferably Ala, Lys, or Glu.

[0286] Cleavable linkers can release free functional domains in vivo. In some embodiments, the linker can be cleaved under specific conditions, such as in the presence of a reducing agent or a protease. In vivo cleavable linkers can utilize the reversible nature of disulfide bonds. One example includes a thrombin-sensitive sequence (e.g., PRS) between two Cys residues. In vitro thrombin treatment of CPRSCs results in the cleavage of the thrombin-sensitive sequence while the reversible disulfide bond remains intact. In vivo cleavage of linkers in fusion proteins can also be carried out by proteases that are expressed in vivo under pathological conditions (e.g., cancer or inflammation), in specific cells or tissues, or in restricted compartments of certain cells. The specificity of many proteases provides for the slow cleavage of linkers within restricted compartments.

[0287] Examples of linking molecules include hydrophobic linkers, such as negatively charged sulfonate groups; lipids, such as poly(-CH2-lipids), such as poly(-CHe g polyethylene glycol (PEG) groups, their unsaturated variants, their hydroxylated variants, their amidated or other N-containing variants, non-carbon linkers; carbohydrate linkers; phosphodiester linkers, or other molecules capable of covalently linking two or more polypeptides. Non-covalent linkers (such as hydrophobic lipid spheres to which the polypeptide is linked) may also be included, for example, through a hydrophobic region of the polypeptide or a hydrophobic extension of the polypeptide, such as being rich in leucine, isoleucine, valine, or possibly alanine, phenylalanine, or even a series of residues of tyrosine, methionine, glycine, or other hydrophobic residues. Polypeptides can use charge-based chemical linkages, such that a positively charged portion of the polypeptide is linked to a negatively charged portion of another polypeptide or nucleic acid.

[0288] cyclization

[0289] In some embodiments, linear cyclic polynucleotides may be cyclized or chained. In some embodiments, linear cyclic polynucleotides may be cyclized in vitro prior to formulation and / or delivery. In some embodiments, linear cyclic polynucleotides may be cyclized intracellularly.

[0290] Extracellular circularization

[0291] In some embodiments, linear cyclic polynucleotides are cyclized or chained using chemical methods to form cyclic polynucleotides. In some chemical methods, the 5' and 3' ends of the nucleic acid (e.g., linear cyclic polynucleotides) include chemically reactive groups that, when brought close together, can form new covalent bonds between the 3' and 5' ends of the molecule. The 5' end may contain an NHS ester reactive group, and the 3' end may contain a 3'-amino-terminal nucleotide, such that in an organic solvent, the 3'-amino-terminal nucleotide on the 3' end of the linear RNA molecule will undergo nucleophilic attack on the 5'-NHS-ester moiety, forming a new 5'- or 3'-amide bond.

[0292] In some embodiments, DNA or RNA ligases can be used to enzymatically ligate a 5'-phosphorylated nucleic acid molecule (e.g., a linear cyclic polynucleotide) to the 3'-hydroxyl group of a nucleic acid (e.g., a linear nucleic acid), forming a new phosphodiester bond. In an exemplary reaction, the linear cyclic polynucleotide is incubated with 1-10 units of T4 RNA ligase at 37°C for 1 hour, according to the manufacturer's protocol. The ligation reaction can occur in the presence of a linear nucleic acid capable of pairing with the tandem 5'- and 3'-region bases to facilitate the enzymatic ligation reaction.

[0293] In some embodiments, DNA or RNA ligases can be used for the synthesis of cyclic polynucleotides. As a non-limiting example, the ligase can be a circ ligase or a circular ligase.

[0294] In some embodiments, the 5' or 3' end of the linear cyclic polynucleotide may encode a ligase ribozyme sequence, such that during in vitro transcription, the resulting linear cyclic polynucleotide includes an active ribozyme sequence capable of ligating the 5' end of the linear cyclic polynucleotide to the 3' end. The ligase ribozyme may be derived from group I introns, hepatitis D virus, hairpin ribozymes, or may be selected via SELEX (ligand system evolution by exponential enrichment). Ribozyme ligation reactions may require 1 to 24 hours at temperatures between 0°C and 37°C.

[0295] In some embodiments, a linear cyclic polynucleotide can be cyclized or cascaded by using at least one non-nucleic acid moiety. On one hand, at least one non-nucleic acid moiety may react with a region or feature near the 5' end and / or 3' end of the linear cyclic polynucleotide to cyclize or cascade the linear cyclic polynucleotide. On the other hand, at least one non-nucleic acid moiety may be located at or attached to or adjacent to the 5' end and / or 3' end of the linear cyclic polynucleotide. The contemplated non-nucleic acid moiety may be homologous or heterologous. As a non-limiting example, the non-nucleic acid moiety may be a bond, such as a hydrophobic bond, ionic bond, biodegradable bond, and / or cleavable bond. As another non-limiting example, the non-nucleic acid moiety is a linker portion. As yet another non-limiting example, the non-nucleic acid moiety may be an oligonucleotide or peptide portion, such as an aptamer or non-nucleic acid linker as described herein.

[0296] In one embodiment, a linear cyclic polynucleotide can be cyclized or cyclicated due to its non-nucleic acid portion, resulting in attraction between atoms or molecular surfaces located at, adjacent to, or attached to the 5'- and 3'-termini of the cyclic polynucleotide. As a non-limiting example, one or more linear cyclic polynucleotides can be cyclized or cyclicated by intermolecular or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, van der Waals forces, and dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonance bonds, agnostic bonds, dipole bonds, conjugations, hyperconjugations, and antibondings.

[0297] In some embodiments, the linear cyclic polynucleotide may contain a ribozyme RNA sequence near the 5' end and near the 3' end. The ribozyme RNA sequence may be covalently linked to a peptide when the sequence is exposed to the remainder of the ribozyme. On one hand, the peptide covalently linked to the ribozyme RNA sequence near the 5' and 3' ends can link together, causing cyclization or cascading of the linear cyclic polynucleotide. On the other hand, the peptide covalently linked to the 5' and 3' ends of the ribozyme RNA sequence can cause cyclization or cascading of the linear primary construct or linear mRNA after ligation using methods known in the art, such as, but not limited to, protein ligation.

[0298] In some embodiments, the linear cyclic polynucleotide may include the 5' triphosphate of a nucleic acid converted to a 5' monophosphate, for example by contacting the 5' triphosphate with RNA 5' pyrophosphate hydrolase (RppH) or ATP diphosphate hydrolase (dephosphorylase). Alternatively, the conversion of the 5' triphosphate of the linear cyclic polynucleotide to a 5' monophosphate can be accomplished by a two-step reaction comprising: (a) contacting the 5' nucleotide of the linear cyclic polynucleotide with a phosphatase (e.g., thermosensitive phosphatase, shrimp alkaline phosphatase, or calf intestinal phosphatase) to remove all three phosphates; and (b) after step (a), contacting the 5' nucleotide with a kinase to which a single phosphate ester has been added (e.g., a polynucleotide kinase).

[0299] splice element

[0300] In some embodiments, the cyclic polynucleotide includes at least one splicing element. In some embodiments, the splicing element is adjacent to at least one expression sequence. In some embodiments, the cyclic polynucleotide includes a splicing element adjacent to each expression sequence. In some embodiments, the splicing element is located on one or both sides of each expression sequence, resulting in the separation of expression products, such as one or more peptides and / or one or more polypeptides.

[0301] In some embodiments, the cyclic polynucleotide includes an internal splicing element whose splice ends are joined together during replication. Some examples may include miniature introns (< 100 nt) having a splice site sequence and a short inverted repeat sequence (30-40 nt), such as AluSq2, AluJr, and AluSz, inverted sequences in side-joined introns, Alu elements in side-joined introns, and motifs found in cis-sequence elements near the backsplice event (suptable4-enriched motifs), such as sequences 200 bp before (upstream) or after (downstream) the backsplice site with a side-joined exon. In some embodiments, the cyclic polynucleotide includes at least one repeating nucleotide sequence as described elsewhere herein as an internal splicing element. In such embodiments, the repeating nucleotide sequence may include repeating sequences from Alu family introns. In some embodiments, splice-associated ribosome-binding proteins (e.g., blind muscle protein and vibration protein (QKI) splicing factors) may regulate the biogenesis of the cyclic polynucleotide.

[0302] In some embodiments, the cyclic polynucleotide may include a canonical splicing site at the head-to-tail junction of the cyclic polynucleotide.

[0303] In some embodiments, the cyclic polynucleotide may include a ridge-helix-ridge motif comprising two 4-base pair stems flanked by two 3-nucleotide ridges. Cleavage occurs at a site within the ridge region, generating a characteristic fragment terminated with a 5'-hydroxyl group and a 2',3'-cyclic phosphate. Cyclization is achieved by nucleophilic attack of the 5'-OH group onto the 2',3'-cyclic phosphate of the same molecule forming the 3',5'-phosphodiester bridge.

[0304] In some embodiments, the cyclic polynucleotide may comprise a polyrepetitive RNA sequence having an HPR element. The HPR comprises a 2',3'-cyclic phosphate group and a 5'-OH terminus. The HPR element self-processes the 5'- and 3'-termini of the linear cyclic polynucleotide, thereby joining the ends together.

[0305] In some embodiments, the cyclic polynucleotide may include a sequence mediating self-ligation. In some embodiments, the cyclic polynucleotide may include an HDV sequence (e.g., a conserved HDV replication domain sequence, GGCUCAUCUCGACAAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCAAGUUCGAGCAUGAGCC (SEQ ID NO: 3) (Beeharry et al., 2004) or GGCUAGAGGCGGCAGUCCUCAGUACUCUUACUCUUUUCUGUAAAGAGGAGACUGCUGGACUCGCCGCCCGAGCC (SEQ ID NO: 4)) for self-ligation. In some embodiments, the cyclic polynucleotide may include a cyclic E sequence (e.g., in PSTVd) for self-ligation. In another embodiment, the cyclic polynucleotide may include self-cyclized introns, such as 5' and 3' splicing, or self-cyclized catalytic introns, such as type I, type II, or type III introns. Non-restricted examples of type I intron self-splicing sequences may include self-splicing substitution intron-exon sequences derived from the T4 phage gene td and Tetrahymena insertion sequence (IVS) rRNA.

[0306] Other cyclization methods

[0307] In some embodiments, the linear cyclic polynucleotide may include a complementary sequence, comprising a repetitive or non-repetitive nucleic acid sequence within an individual intron or a side intron. A repetitive nucleic acid sequence is a sequence appearing within a segment of the cyclic polynucleotide. In some embodiments, the cyclic polynucleotide includes a repetitive nucleic acid sequence. In some embodiments, the repetitive nucleotide sequence includes a poly(CA) sequence or a poly(UG) sequence. In some embodiments, the cyclic polynucleotide includes at least one repetitive nucleic acid sequence that hybridizes with a complementary repetitive nucleic acid sequence in another segment of the cyclic polynucleotide, the hybridized segment forming an internal double strand. In some embodiments, the repetitive nucleic acid sequences and complementary repetitive nucleic acid sequences of two separate cyclic polynucleotides hybridize to generate a single cyclic polynucleotide, the hybridized segment forming an internal double strand. In some embodiments, the complementary sequence is located at the 5' and 3' ends of the linear cyclic polynucleotide. In some embodiments, the complementary sequence comprises about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more paired nucleotides.

[0308] Modification

[0309] In some aspects, the present invention described herein includes compositions and methods for using and preparing modified cyclic polynucleotides and for delivering modified cyclic polynucleotides. The term "modified nucleotide" can refer to any nucleotide analog or derivative having one or more chemical modifications to the chemical composition of an unmodified natural ribonucleotide (as shown in the chemical formulas in Table 5, such as natural unmodified nucleotides adenosine (A), uridine (U), guanine (G), cytidine (C)) and a monophosphate ester. The chemical modification of the modified ribonucleotide can be a modification of any one or more functional groups of the ribonucleotide, such as sugars, nucleobases, or nucleoside bonds (e.g., linked phosphate ester / phosphodiester bonds / phosphodiester backbones).

[0310] Table 5. Unmodified natural ribonucleotides

[0311] Relative to a reference sequence (particularly the parental polynucleotide), a cyclic polynucleotide may include one or more substitutions, insertions and / or additions, deletions, and covalent modifications included within the scope of this invention. In some embodiments, the cyclic polynucleotide includes one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, poly-A sequence, methylation, acylation, phosphorylation, methylation and acetylation of lysine and arginine residues, and nitrosylation of thiol groups and tyrosine residues, etc.). The cyclic polynucleotide may include any useful modifications, such as against sugars, nucleobases, or nucleoside internucleotides (e.g., against linked phosphate esters / phosphodiester bonds / phosphodiester backbones). One or more atoms of the pyrimidine nucleobase may be replaced or substituted with an optionally substituted amino group, an optionally substituted thiol, an optionally substituted alkyl group (e.g., methyl or ethyl), or a halogen (e.g., chlorinated or fluorinated). In some embodiments, modifications (e.g., one or more modifications) are present in each sugar and nucleoside internucleotide. Modifications can be made to deoxyribonucleic acid (DNA), threonucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or their hybrids, as RNA. Other modifications are described in this article.

[0312] In some embodiments, the cyclic polynucleotide contains at least one N(6) methyl adenosine (m6A) modification to increase translation efficiency.

[0313] In some embodiments, the modification may include chemically or cell-induced modifications. For example, some non-limiting examples of intracellular RNA modification are described in Lewis and Pan, “RNA modifications and structures cooperate to guide RNA-protein interactions,” Nat Reviews Molecular Cell Biology, 2017, 18:202-210.

[0314] In another embodiment, "pseudouridine" refers to m 1 acp 3 Ψ(1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine. In another embodiment, the term refers to m 1 Ψ (1-methylpseudouridine). In another embodiment, the term refers to Ψm (2′-O-methylpseudouridine). In another embodiment, the term refers to m5D (5-methyldihydrouridine). In another embodiment, the term refers to m 3 Ψ (3-methylpseudouridine). In another embodiment, the term refers to the pseudouridine moiety without further modification. In another embodiment, the term refers to any of the above-described pseudouridine monophosphate, diphosphate, or triphosphate. In another embodiment, the term refers to any other pseudouridine known in the art. Each possibility represents a separate embodiment of the invention.

[0315] In some embodiments, chemical modifications of the ribonucleotides of cyclic polynucleotides can enhance immune evasion. Modifications include, for example, end modifications such as 5'-end modifications (phosphorylation (mono, di, and triphosphorylation), conjugation, reverse linkage, etc.), 3'-end modifications (conjugation, DNA nucleotides, reverse linkage, etc.), base modifications (e.g., substitution with stable bases, unstable bases, or bases paired with an extended parental library), base removal (debased nucleotides), or base conjugation. The modified ribonucleotide bases may also include 5-methylcytidine and pseudouridine. In some embodiments, base modifications can modulate the expression, immune response, stability, and subcellular localization of cyclic polynucleotides, among other functional effects. In some embodiments, modifications include diorthogonal nucleotides, such as non-natural bases.

[0316] In some embodiments, sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions of one or more ribonucleotides in a cyclic polynucleotide, as well as backbone modifications, may include modifications or substitutions of phosphodiester bonds. Non-limiting examples of cyclic polynucleotides include those having a modified backbone or non-natural internucleotide bonds (e.g., those with modified or substituted phosphodiester bonds). Cyclic polynucleotides having a modified backbone particularly include those without a phosphorus atom in the backbone. For the purposes of this application, and as sometimes mentioned in the art, modified RNAs without a phosphorus atom in their internucleotide backbone may also be considered oligonucleotides. In specific embodiments, cyclic polynucleotides will include ribonucleotides having a phosphorus atom in their internucleotide backbone.

[0317] The modified cyclic polynucleotide backbone may include, for example, thiophosphates, chiral thiophosphates, dithiophosphates, phosphate triesters, aminoalkyl phosphate triesters, methyl and other alkylphosphonates (such as 3'-alkylphosphonides and chiral phosphonates), phosphonites, aminophosphates (such as 3'-aminophosphatamides and aminoalkylphosphonates), thionophosphoramidates, thionoalkylphosphonates, thionoalkyl phosphate triesters, and borophosphates having normal 3'-5' bonds, analogs of these with 2'-5' linkages, and those with opposite polarities, wherein adjacent nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included. In some embodiments, the cyclic polynucleotide may be negatively or positively charged.

[0318] Modified nucleotides that can be incorporated into cyclic polynucleotides can be modified at the nucleoside internucleotides (e.g., the phosphate backbone). Here, in the context of the polynucleotide backbone, the phrases "phosphate ester" and "phosphate diester" are used interchangeably. The backbone phosphate group can be modified by substituting one or more oxygen atoms with different substituents. Furthermore, modified nucleosides and nucleotides can include the overall substitution of the unmodified phosphate portion by another nucleoside internucleotide bond described herein. Examples of modified phosphate groups include, but are not limited to, thiophosphates, selenophosphite, boronic phosphate, phosphate borate, hydrophosphonates, aminophosphates, diaminophosphates, alkyl or aryl phosphonates, and triphosphates. In dithiophosphates, both non-linked oxygen atoms are replaced by sulfur. The phosphate linker can also be modified by substituting the linking oxygen with nitrogen (bridged aminophosphate), sulfur (bridged thiophosphate), and carbon (bridged methylene phosphonate).

[0319] Providing α-thiosubstituted phosphate moieties to impart stability to RNA and DNA polymers via non-natural thiophosphate backbones. Thiophosphate DNA and RNA exhibit enhanced nuclease resistance and thus longer half-lives in the cellular environment. Thiophosphates linked to cyclic polynucleotides hold promise for reducing innate immune responses by attenuating the binding / activation of cellular innate immune molecules.

[0320] In some embodiments, the modified nucleosides include α-thio-nucleosides (e.g., 5'-O-(l-thiophosphate)-adenosine, 5'-O-(l-thiophosphate)-cytidine (α-thiocytidine), 5'-O-(l-thiophosphate)-guanosine, 5'-O-(l-thiophosphate)-uridine, or 5'-O-(l-thiophosphate)-pseuuridine). Other nucleoside bonds may include nucleoside bonds that do not contain a phosphorus atom.

[0321] In some embodiments, the cyclic polynucleotide may include one or more cytotoxic nucleosides. For example, cytotoxic nucleosides may be incorporated into the cyclic polynucleotide, such as through bifunctional modification. Cytotoxic nucleosides may include, but are not limited to, vidarabine, 5-azacytidine, 4'-thiocytarabine, cyclopentenylcytidine, cladribine, clofarabine, cytarabine, cytosine cytarabine, l-(2-C-cyano-2-deoxy-β-D-arabino-pentafuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, fluorouridine, gemcitabine, a combination of tegafur and uracil, tegafur ((R,S)-5-fluoro-l-(tetrahydrofuran-2-yl)pyrimidin-2,4(1H,3H)-dione), trisatabine, tezacitabine, 2'-deoxy-2'-methylenecytidine (DMDC), and 6-mercaptopurine. Other examples include fludarabine phosphate, N4-behenyl-1-β-D-arabinopentafuranosylcytosine, N4-octadecyl-1-β-D-arabinopentafuranosylcytosine, N4-palmitoyl-1-(2-C-cyano-2-deoxy-β-D-arabinopentafuranosyl)cytosine, and P-4055 (cytarabine 5'-arabinoside).

[0322] Cyclic polynucleotides can be uniformly modified along the entire length of the molecule. For example, one or more types of nucleotides (e.g., naturally occurring nucleotides, purines or pyrimidines, or any one or more of A, G, U, C, I, pU) can be uniformly modified within the cyclic polynucleotide, or within a given predetermined sequence region. In some embodiments, the cyclic polynucleotide includes pseudouridine. In some embodiments, the cyclic polynucleotide includes inosine, which, relative to viral RNA, helps the immune system characterize the cyclic polynucleotide as endogenous. Incorporation of inosine can also mediate improved RNA stability / reduced degradation.

[0323] In some embodiments, all nucleotides in the cyclic polynucleotide (or a given sequence region thereof) are modified. In some embodiments, the modification may include m6A to enhance expression; inosine to weaken the immune response; pseudouridine to increase RNA stability and translation readthrough (stop codon = coding potential); m5C to increase stability; and 2,2,7-trimethylguanosine to facilitate subcellular translocation (e.g., nuclear localization).

[0324] Different sugar modifications, nucleotide modifications, and / or internucleotide bonds (e.g., backbone structure) can be present at various positions on a cyclic polynucleotide. Those skilled in the art will understand that nucleotide analogs or one or more other modifications can be located at any one or more positions on the cyclic polynucleotide such that the function of the cyclic polynucleotide is substantially not diminished. Modifications can also be non-coding region modifications. A cyclic polynucleotide may contain from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C) or any intermediate percentage (e.g., 1% to 20%). > 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 8 ...% to 80%, 1% to 90%, 1% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 1% to 80%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 90%, 1% to 9 0%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%.

[0325] In some embodiments, the cyclic polynucleotides provided herein are modified cyclic polynucleotides. For example, a fully modified cyclic polynucleotide comprises all or substantially all of the modified adenosine residues, all or substantially all of the modified uridine residues, all or substantially all of the modified guanine residues, all or substantially all of the modified cytidine residues, or any combination thereof. In some embodiments, the cyclic polynucleotides provided herein are hybridized cyclic polynucleotides. Hybridized cyclic polynucleotides may have at least one modified nucleotide and may have a portion of consecutive unmodified nucleotides. The unmodified portion of the hybridized cyclic polynucleotide may have at least about 5, 10, 15, or 20 consecutive unmodified nucleotides, or any number therein. In some embodiments, the unmodified portion of the hybridized cyclic polynucleotide has at least about 30, 40, 40, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 180, 200, 220, 250, 280, 300, 320, 350, 380, 400, 420, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, or 1000 consecutive unmodified nucleotides, or any number thereof. In some embodiments, the hybridized cyclic polynucleotide has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more unmodified portions. In some embodiments, the hybridized cyclic polynucleotide has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 30, 40, 50, 70, 80, 100, 120, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000 or more modified nucleotides. In some embodiments, the hybridized cyclic polynucleotide has at least 1%, 2%, 5%, 7%, 8%, 10%, 12%, 15%, 18%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 99% but less than 100% of the nucleotides modified. In some embodiments, the unmodified portion includes a binding site. In some embodiments, the unmodified portion includes a binding site configured to bind a protein, DNA, RNA, or a cellular target. In some embodiments, the unmodified portion includes IRES.

[0326] In some embodiments, the immunogenicity of the hybridized cyclic polynucleotide is lower than that of the corresponding unmodified cyclic polynucleotide. In some embodiments, the immunogenicity of the hybridized cyclic polynucleotide is at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 times lower than that of the corresponding unmodified cyclic polynucleotide. In some embodiments, the immunogenicity described herein is assessed by the expression level or signaling or activation of at least one of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-β. In some embodiments, the half-life of the hybridized cyclic polynucleotide is longer than that of the corresponding unmodified cyclic polynucleotide. In some embodiments, the half-life of the hybridized cyclic polynucleotide is at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 times longer than that of the corresponding unmodified cyclic polynucleotide. In some embodiments, the half-life is measured by introducing the cyclic polynucleotide or the corresponding cyclic polynucleotide into a cell and measuring the level of the introduced cyclic polynucleotide or the corresponding cyclic polynucleotide within the cell.

[0327] In some embodiments, the hybridized cyclic polynucleotide comprises one or more expression sequences. In some embodiments, the one or more expression sequences of the hybridized cyclic polynucleotide have similar or higher translation efficiencies than the corresponding unmodified cyclic polynucleotide. In some embodiments, the one or more expression sequences of the hybridized cyclic polynucleotide have translation efficiencies at least about 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, or 3 times higher than the corresponding unmodified cyclic polynucleotide. In some embodiments, the one or more expression sequences of the hybridized cyclic polynucleotide have higher translation efficiencies than the corresponding cyclic polynucleotide (which has a portion comprising a modified nucleotide (e.g., a portion corresponding to the unmodified portion of the hybridized cyclic polynucleotide)). In some embodiments, one or more expression sequences of cyclic polynucleotides are configured to have a higher translation efficiency than the corresponding cyclic polynucleotide (which has a first portion comprising more than 10% or at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of modified nucleotides). In some embodiments, one or more expressed sequences of the hybridized cyclic polynucleotide have a translation efficiency at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 times higher than that of the corresponding cyclic polynucleotide (which has a portion containing the modified nucleotide (e.g., a portion corresponding to the unmodified portion of the hybridized cyclic polynucleotide)). As described herein, in some embodiments, the translation efficiency is measured in cells containing the cyclic polynucleotide or the corresponding cyclic polynucleotide or in an in vitro translation system (e.g., in rabbit reticulum lysate).

[0328] In some embodiments, the hybridized cyclic polynucleotide has an unmodified (e.g., without modified nucleotides) binding site. In some embodiments, the hybridized cyclic polynucleotide has a binding site configured to bind an unmodified (e.g., without modified nucleotides) protein, DNA, RNA, or cellular target. In some embodiments, the hybridized cyclic polynucleotide has an unmodified (e.g., without modified nucleotides) internal ribosome entry site (IRES). In some embodiments, the hybridized cyclic polynucleotide has no more than 10% of the nucleotides in the binding site being modified nucleotides. In some embodiments, the hybridized cyclic polynucleotide has no more than 10% of the nucleotides in the binding site being modified nucleotides, the binding site being configured to bind a protein, DNA, RNA, or cellular target. In some embodiments, the hybridized cyclic polynucleotide has no more than 10% of the nucleotides in the internal ribosome entry site (IRES) being modified nucleotides. In some embodiments, the hybridized cyclic polynucleotide has modified nucleotides distributed throughout, in addition to the binding site. In some embodiments, the hybridized cyclic polynucleotide is distributed throughout the nucleotides having the modification, in addition to being configured as a binding site for binding proteins, DNA, RNA, or cellular targets. In some embodiments, the hybridized cyclic polynucleotide is distributed throughout the nucleotides having the modification, in addition to the IRES element. In other embodiments, the hybridized cyclic polynucleotide is distributed throughout the nucleotides having the modification, in addition to the IRES element and one or more other portions. Without being bound by any particular theory, the unmodified IRES element enables the hybridized cyclic polynucleotide to be translationally capable, for example, having a similar or higher translation efficiency for one or more translational sequences compared to the corresponding cyclic polynucleotide without any modified nucleotides.

[0329] In some embodiments, the hybridized cyclic polynucleotides (CNPs) generally contain modified nucleotides, such as 5'-methylcytosine and pseudouridine, except for IRES elements or binding sites configured to bind proteins, DNA, RNA, or cellular targets. In these cases, the hybridized CNPs exhibit higher immunogenicity compared to corresponding CNPs that do not contain 5'-methylcytosine and pseudouridine. In some embodiments, the immunogenicity of the hybridized cyclic polynucleotide is at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 times lower than that of the corresponding unmodified cyclic polynucleotide. In some embodiments, the immunogenicity described herein is assessed by the expression or signaling or activation of at least one of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-β. In some embodiments, the hybridized cyclic polynucleotide has a half-life that is n times higher than that of the corresponding unmodified cyclic polynucleotide (e.g., the corresponding cyclic polynucleotide that does not contain 5'-methylcytidine and pseudouridine). In some embodiments, the hybridized cyclic polynucleotide has a half-life that is at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 times higher than that of the corresponding unmodified cyclic polynucleotide. In some embodiments, half-life is measured by introducing a cyclic polynucleotide or a corresponding cyclic polynucleotide into a cell and measuring the level of the introduced cyclic polynucleotide or corresponding cyclic polynucleotide within the cell.

[0330] In some cases, the hybridized cyclic polynucleotides described herein exhibit similar immunogenicity to corresponding cyclic polynucleotides that are otherwise identical but have been fully modified. For example, hybridized cyclic polynucleotides (which are otherwise identical but are pervasive with 5'-methylcytidine and pseudouridine and do not have unmodified cytidine and uridine) may have similar or lower immunogenicity than corresponding cyclic polynucleotides (which are otherwise identical but pervasive with 5'-methylcytidine and pseudouridine and do not have unmodified cytidine and uridine). In some embodiments, hybridized cyclic polynucleotides (which are pervasive with 5'-methylcytidine and pseudouridine but do not have unmodified cytidine and uridine) have translation efficiencies similar to or higher than those of corresponding cyclic polynucleotides (which are otherwise identical but pervasive with 5'-methylcytidine and pseudouridine and do not have unmodified cytidine and uridine).

[0331] Conjugation of cyclic polynucleotides

[0332] The circRNA disclosed herein can be conjugated to, for example, compounds (e.g., small molecules), antibodies or fragments thereof, peptides, proteins, aptamers, drugs, or combinations thereof. In some embodiments, a small molecule can be conjugated to the circRNA to produce a circRNA comprising the small molecule.

[0333] The circRNA disclosed herein may contain a conjugation moiety to facilitate conjugation. The conjugation moiety may be incorporated, for example, at an internal site of a cyclic polynucleotide or at the 5′, 3′, or internal site of a linear polynucleotide. The conjugation moiety may be incorporated chemically or enzymatically. For example, the conjugation moiety may be incorporated during solid-phase oligonucleotide synthesis, either co-transcribedly (e.g., with a tolerant RNA polymerase) or post-transcribedly (e.g., with an RNA methyltransferase). The conjugation moiety may be a modified nucleotide or nucleotide analogue, such as bromodeoxyuridine. The conjugation moiety may contain reactive groups or functional groups, such as azide groups or alkyne groups. The conjugation moiety may be capable of chemically selective reactions. The conjugated moiety can be a hapten group, such as digoxin, 2,4-dinitrophenyl, biotin, avidin, or selected from azoles, nitroaryl compounds, benzofurans, triterpenes, ureas, thioureas, rotenone, oxazoles, thiazoles, coumarins, cyclolignans, heteroaryl compounds, azoaryl compounds, or benzodiazepines. The conjugated moiety may contain a diarylethylene photoswitcher capable of undergoing reversible ring rearrangement. The conjugated moiety may contain a nucleophile, a carbanion, and / or an α,β-unsaturated carbonyl compound.

[0334] circRNAs can be conjugated via chemical reactions, such as click chemistry, Staudinger linkage, Pd-catalyzed C / C bond formation (e.g., the Suzuki-Miyaura reaction), Michael addition, olefin metathesis, or the anti-electron-demanding Diels-Alder reaction. Click chemistry utilizes paired functional groups that react rapidly and selectively with each other under appropriate reaction conditions (“clicks”). Non-limiting click chemistry reactions include azide-alkyne cycloaddition reactions, copper-catalyzed 1,3-dipolar azide-alkyne cycloaddition reactions (CuAAC), strain-promoted azide-alkyne click chemistry reactions (SPAAC), and tetrazine-olefin linkage reactions.

[0335] Non-limiting examples of functionalized nucleotides include azide-modified UTP analogs, 5-azidomethyl-UTP, 5-azido-C3-UTP, 5-azido-PEG4-UTP, 5-ethynyl-UTP, DBCO-PEG4-UTP, vinyl-UTP, 8-azido-ATP, 3'-azido-2',3'-ddATP, 5-azido-PEG4-CTP, 5-DBCO-PEG4-CTP, N6-azidohexyl-3'-dATP, 5-DBCO-PEG4-dCpG, and 5-azidopropyl-UTP. In some embodiments, the circRNA comprises at least one 5-azidomethyl-UTP, 5-azido-C3-UTP, 5-azido-PEG4-UTP, 5-ethynyl-UTP, DBCO-PEG4-UTP, vinyl-UTP, 8-azido-ATP, 5-azido-PEG4-CTP, 5-DBCO-PEG4-CTP, or 5-azidopropyl-UTP.

[0336] A single, selected modified nucleotide (e.g., a modified A, C, G, U, or T containing an azide at the 2′ position) can be site-specifically incorporated under optimized conditions (e.g., via solid-phase chemical synthesis). Multiple nucleotides containing an azide at the 2′ position can be incorporated, for example, by substituting the nucleotide during in vitro transcription (e.g., replacing 5-azido-C3-UTP with UTP).

[0337] circRNA conjugates can be generated using copper-catalyzed click reactions, such as the copper-catalyzed 1,3-dipolar azido-alkyne cycloaddition (CuAAC) of alkyne-functionalized small molecules and azide-functionalized polynucleotides. Linear RNA can be conjugated to small molecules. For example, linear RNA can be modified at its 3′ end with an azide-derived nucleotide via poly(A) polymerase. Azides can be conjugated to small molecules via copper-catalyzed or strain-promoted azide-alkyne click reactions, and linear RNA can be cyclized.

[0338] Staudinger reactions can be used to generate circRNA conjugates. For example, circular RNA containing azide-functionalized nucleotides can be conjugated to alkyne-functionalized small molecules in the presence of triphenylphosphine-3,3',3"-trisulfonic acid (TPPTS).

[0339] The Suzuki-Miyaura reaction can be used to generate circRNA conjugates. For example, circRNAs containing halonucleotide analogs can be subjected to the Suzuki-Miyaura reaction in the presence of a homologous reactive chaperone. circRNAs containing 5-iodouridine triphosphate (IUTP) can be used, for example, in a catalytic system with Pd(OAc)2 and 2-aminopyrimidine-4,6-diol (ADHP) or dimethylamino-substituted ADHP (DMADHP) to functionalize iodouridine-labeled circRNAs in the presence of various boric acids and ester substrates. In another example, circRNAs containing 8-bromoguanosine can be reacted with arylboronic acids in the presence of a catalytic system made of Pd(OAc)2 and a water-soluble triphenylphosphine-3,3′,3″-trisulfonate ligand.

[0340] circRNA conjugates can be generated using the Michael addition method, for example, by reacting an electron-rich Michael donor with an α,β-unsaturated compound (Michael acceptor).

[0341] structure

[0342] In some embodiments, the cyclic polynucleotide comprises a higher-order structure, such as a secondary or tertiary structure. In some embodiments, the complementary segment of the cyclic polynucleotide folds itself into a double-stranded segment, which pairs with hydrogen bonds (e.g., AU and CG). In some embodiments, a helix, also called a stem, is formed intramolecularly with a double-stranded segment connected to a terminal loop. In some embodiments, the cyclic polynucleotide has at least one segment with a quasi-double-stranded secondary structure. In some embodiments, the segment with the quasi-double-stranded secondary structure has at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more paired nucleotides. In some embodiments, the cyclic polynucleotide has one or more segments (e.g., 2, 3, 4, 5, 6 or more) having a quasi-double-stranded secondary structure. In some embodiments, the segments are separated by 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides.

[0343] There are 16 possible base pairs, but 6 of them (AU, GU, GC, UA, UG, CG) can form actual base pairs. The rest are called mismatches and occur in the helix with a very low frequency. In some embodiments, the structure of the cyclic polynucleotide is not easily disrupted without affecting its function or having fatal consequences, providing an option to preserve secondary structure. In some embodiments, the primary structure of the stem (i.e., its nucleotide sequence) can still be varied while retaining the helical region. The bases are second in the higher-order structure and can be substituted as long as they retain secondary structure. In some embodiments, the cyclic polynucleotide has a quasi-helical structure. In some embodiments, the cyclic polynucleotide has at least one segment with a quasi-helical structure. In some embodiments, the quasi-helical segment has at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides. In some embodiments, the cyclic polynucleotide has one or more segments with a quasi-helical structure (e.g., 2, 3, 4, 5, 6 or more). In some embodiments, the segments are separated by 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides. In some embodiments, the cyclic polynucleotide includes at least one U-rich or A-rich sequence or a combination thereof. In some embodiments, the U-rich and / or A-rich sequences are arranged in a manner that will produce a triplet quasi-helix structure. In some embodiments, the cyclic polynucleotide has a double quasi-helix structure. In some embodiments, the cyclic polynucleotide has one or more segments (e.g., 2, 3, 4, 5, 6 or more) having a double quasi-helix structure. In some embodiments, the cyclic polynucleotide includes at least one C-rich and / or G-rich sequence. In some embodiments, C-rich and / or G-rich sequences are arranged in a manner that will produce a triplet quasi-helix structure. In some embodiments, the cyclic polynucleotide has an intramolecular triplet quasi-helix structure that contributes to stability.

[0344] In some embodiments, the cyclic polynucleotide has two quasi-helical structures (e.g., separated by phosphodiester bonds) such that their terminal base pairs are stacked, and the quasi-helical structures become collinear, resulting in "coaxially stacked" substructures.

[0345] In some embodiments, the cyclic polynucleotide has at least one miRNA binding site, at least one lncRNA binding site, and / or at least one tRNA motif.

[0346] deliver

[0347] The cyclic polynucleotides described herein can be included in pharmaceutical compositions together with a delivery carrier.

[0348] The pharmaceutical compositions described herein may be formulated to include, for example, a pharmaceutical excipient or carrier. The pharmaceutical carrier may be a membrane, lipid bilayer, and / or polymer carrier, such as liposomes or particles, such as nanoparticles, and delivered to a subject in need of it (e.g., human or non-human agricultural animals or livestock, such as cattle, dogs, cats, horses, poultry) by known methods. Such methods include, but are not limited to, transfection (e.g., lipid-mediated cationic polymers, calcium phosphate); electroporation or other membrane-disrupting methods (e.g., nuclear transfection), fusion, and viral delivery (e.g., lentiviruses, retroviruses, adenoviruses, AAVs).

[0349] The present invention further relates to a host or host cell comprising the cyclic polynucleotides described herein. In some embodiments, the host or host cell is a plant, insect, bacterium, fungus, vertebrate, mammal (e.g., human) or other organism or cell.

[0350] In some embodiments, cyclic polynucleotides are non-immunogenic in the host. In some embodiments, cyclic polynucleotides reduce or fail to elicit a host immune system response compared to a response induced by a reference compound (e.g., a linear polynucleotide corresponding to the cyclic polynucleotide, an unmodified cyclic polynucleotide, or a cyclic polynucleotide lacking an encryption agent). Some immune responses include, but are not limited to, humoral immune responses (e.g., the production of antigen-specific antibodies) and cell-mediated immune responses (e.g., lymphocyte proliferation).

[0351] In some embodiments, the host or host cells are exposed (e.g., delivered to or administered to) the cyclic polynucleotide. In some embodiments, the host is a mammal, such as a human. The amount of the cyclic polynucleotide, the expression product, or both in the host can be measured at any time after administration. In some embodiments, the time course of host growth in the culture is determined. If growth increases or decreases in the presence of the cyclic polynucleotide, the cyclic polynucleotide or the expression product, or both, are considered effective in increasing or decreasing host growth.

[0352] Generation method

[0353] In some embodiments, the cyclic polynucleotide comprises a non-naturally occurring deoxyribonucleic acid sequence and can be produced using recombinant DNA technology or chemical synthesis.

[0354] Within the scope of this invention, DNA molecules used to generate RNA loops may include DNA sequences of naturally occurring, unprocessed nucleic acid sequences, modified forms thereof, or DNA sequences encoding synthetic polypeptides not typically found in nature (e.g., chimeric molecules or fusion proteins). DNA molecules may be modified using a variety of techniques, including but not limited to classical mutagenesis and recombinant DNA techniques such as site-directed mutagenesis, chemical treatment of nucleic acid molecules to induce mutations, restriction enzyme cleavage of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification and / or mutagenesis of selected regions of nucleic acid sequences, synthesis of oligonucleotide mixtures, and ligation of mixture groups to “build” mixtures of nucleic acid molecules, and combinations thereof.

[0355] Cyclic polynucleotides can be prepared, for example, by chemical synthesis and enzymatic synthesis. In some embodiments, a linear primary construct or linear mRNA may be cyclized or cascaded to produce the cyclic polynucleotides described herein. The cyclization or cascaded mechanism can occur by methods such as, but not limited to, chemical, enzymatic, or ribozyme-catalyzed approaches. The newly formed 5'- or 3'- bonds can be intramolecular or intermolecular bonds.

[0356] Pharmaceutical Composition

[0357] This invention includes compositions in combination with one or more pharmaceutically acceptable excipients. The pharmaceutical composition may optionally contain one or more additional active substances, such as therapeutic and / or preventative active substances. The pharmaceutical compositions of this invention may be sterile and / or pyrogen-free. General considerations in the formulation and / or production of pharmaceutical preparations can be found, for example, Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (which is incorporated herein by reference). In one aspect, the invention includes a method for producing the pharmaceutical compositions described herein, the method comprising producing cyclic polynucleotides.

[0358] Although the description of pharmaceutical compositions provided herein is primarily directed toward pharmaceutical compositions suitable for administration to humans, those skilled in the art will understand that such compositions are generally suitable for administration to any other animal, such as non-human animals and non-human mammals. Modifications to pharmaceutical compositions suitable for administration to humans are well known to make them suitable for administration to a variety of animals, and such modifications can be designed and / or performed by a general veterinary pharmacist simply through routine experiments (if any). Subjects intended to administer the pharmaceutical compositions include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys.

[0359] The formulations of the pharmaceutical compositions described herein can be prepared by any method known in or developed in the field of pharmacology. Typically, such preparation methods involve the following steps: combining the active ingredient with an excipient and / or one or more other auxiliary ingredients, and then, if necessary and / or desired, separating, shaping, and / or packaging the product.

[0360] The pharmaceutical compositions described herein can be in unit dosage forms suitable for precise single-dose administration. In a unit dosage form, the formulation is divided into unit doses containing appropriate amounts of one or more compounds. The unit dose can be a packaging form containing discrete amounts of the formulation. Non-limiting examples are packaged injections, vials, or ampoules. Aqueous suspension compositions can be packaged in single-dose, non-resealable containers. Multi-dose, resealable containers can be used, for example, with or without preservatives. Injectable formulations can be present in unit dosage forms, such as in ampoules or in multi-dose containers containing preservatives.

[0361] In one aspect, the present invention includes a pharmaceutical composition comprising (a) a cyclic polynucleotide having a binding site for a target, such as RNA, DNA, protein, cell membrane, etc.; and (b) a pharmaceutically acceptable carrier or excipient; wherein the target and the cyclic polynucleotide form a complex, and wherein the target is not microRNA.

[0362] In some embodiments, the binding site is a first binding site, and the target is a first target. In some embodiments, the cyclic polynucleotide further includes a second binding site that binds to a second target.

[0363] In one aspect, the present invention includes a pharmaceutical composition comprising: (a) a cyclic polynucleotide comprising: (i) a first binding site for binding a first target; and (ii) a second binding site for binding a second target; and (b) a pharmaceutically acceptable carrier or excipient; wherein the first binding site is different from the second binding site, and wherein the first target and the second target are microRNAs.

[0364] In some embodiments, the first target comprises a first cyclic polynucleotide (circ-RNA) binding motif. In some embodiments, the second target comprises a second cyclic polynucleotide (circ-RNA) binding motif. In some embodiments, the first target, the second target, and the cyclic polynucleotide form a complex. In some embodiments, the first and second targets interact with each other. In some embodiments, the complex regulates cellular processes upon contact with cells. In some embodiments, the formation of the complex regulates cellular processes upon contact with cells. In such embodiments, cellular processes are related to the pathogenesis of diseases or conditions.

[0365] In some embodiments, upon contact with cells, cyclic polynucleotides regulate cellular processes associated with a first or second target. In some embodiments, the first and second targets interact with each other in the complex. In some embodiments, the cellular processes are related to the pathogenesis of a disease or condition. In some embodiments, the cellular processes are different from the translation of cyclic polynucleotides. In some embodiments, the first target comprises a deoxyribonucleic acid (DNA) molecule, and the target comprises a protein. In some embodiments, the complex regulates directed transcription of DNA molecules, epigenetic remodeling of DNA molecules, or degradation of DNA molecules.

[0366] In some embodiments, the first target comprises a first protein, and the second target comprises a second protein. In such embodiments, the complex regulates the degradation of the first protein, the translocation of the first protein, or signal transduction, or regulates the formation of a complex formed by the direct interaction between the first and second proteins (e.g., inhibiting or promoting the formation of the complex).

[0367] In some embodiments, the first target comprises a first ribonucleic acid (RNA) molecule, and the second target comprises a second RNA molecule. In such embodiments, the complex can modulate the degradation of the first RNA molecule.

[0368] In some embodiments, the target comprises a protein, and the second target comprises an RNA molecule. In such embodiments, the complex regulates protein translocation or inhibits the formation of a complex resulting from direct interactions between the protein and the RNA molecule.

[0369] In some embodiments, the first target is a receptor and the second target is a substrate of the receptor. In such embodiments, the complex inhibits receptor activation. As used herein, “receptor” can refer to a protein molecule that receives a chemical signal from outside the cell. Chemical signals can include, but are not limited to, small molecule organic compounds (e.g., amino acids and their derivatives, such as glutamic acid, glycine, γ-butyric acid), lipids, proteins or peptides, DNA and RNA molecules, and ions. Receptors can be located on the cell membrane, in the cytoplasm, or in the cell nucleus. The chemical signal that binds to the receptor can generally be referred to as the “substrate” of the receptor. Upon binding to the chemical signal, the receptor can elicit some form of cellular response by initiating one or more cellular processes, such as signal transduction pathways. The receptors described herein can be of any type that would be recognized by those skilled in the art, including: (1) ion receptors that can serve as targets for fast neurotransmitters (e.g., acetylcholine (nicotinic acid) and GABA); and activation of these receptors results in alterations in the transmembrane movement of ions. They can have a heteromeric structure in which each subunit consists of an extracellular ligand-binding domain and a transmembrane domain, wherein the transmembrane domain comprises four transmembrane α-helices. (1) Ligand-binding cavities may be located at the interface between subunits; (2) G protein-coupled receptors, which may include receptors for several hormones and slow neurotransmitters (e.g., dopamine, metabolizable glutamate). They may consist of seven transmembrane α-helices. Loops connecting the α-helices may form extracellular and intracellular domains; (3) Kinase-linked and associated receptors (or receptor tyrosine kinases), which may consist of an extracellular domain containing a ligand-binding site and an intracellular domain that typically has enzymatic function, connected by a single transmembrane α-helix. The insulin receptor is an example of such receptors, in which insulin may serve as its corresponding substrate; (4) Nuclear receptors, which may be located in the nucleus or cytoplasm and migrate to the nucleus after binding to a ligand. They may consist of a C-terminal ligand-binding region, a core DNA-binding domain (DBD), and an N-terminal domain containing the AF1 (Activation Function 1) region. Steroid and thyroid hormone receptors are examples of such receptors, and their corresponding substrates can include a variety of steroids and hormones.

[0370] In one aspect, the present invention includes a pharmaceutical composition comprising (a) a cyclic polynucleotide containing a binding site for a target; and (b) a pharmaceutically acceptable carrier or excipient; wherein the cyclic polynucleotide is untranslatable or defectively translated, and wherein the target is not a microRNA.

[0371] In one aspect, the present invention includes a pharmaceutical composition comprising (a) a cyclic polynucleotide containing a binding site for a target, wherein the target contains a first ribonucleic acid (RNA) binding motif; and (b) a pharmaceutically acceptable carrier or excipient; wherein the cyclic polynucleotide is untranslatable or defectively translated, and wherein the target is microRNA.

[0372] In such embodiments, the target comprises a DNA molecule. In such embodiments, the binding of the target to a cyclic polynucleotide regulates transcriptional interference of the DNA molecule. In such embodiments, the target comprises a protein. In such embodiments, the binding of the target to a cyclic polynucleotide inhibits the interaction of the protein with other molecules. In such embodiments, the protein is a receptor, and the binding of the target to the cyclic polynucleotide activates the receptor. In such embodiments, the protein is a first enzyme, the cyclic polynucleotide further comprises a second binding site for binding to a second enzyme, and the binding of the first and second enzymes to the cyclic polynucleotide regulates the enzymatic activity of the first and second enzymes. In such embodiments, the target comprises a messenger RNA (mRNA) molecule. In such embodiments, the binding of the target to a cyclic polynucleotide regulates translational interference of the mRNA molecule. In such embodiments, the target comprises a ribosome. In such embodiments, the binding of the target to a cyclic polynucleotide regulates translational interference. In such embodiments, the target comprises a cyclic RNA molecule. In such embodiments, the binding of the target to a cyclic polynucleotide chelates the cyclic RNA molecule. In such embodiments, the binding of the target to a cyclic polynucleotide chelates the target.

[0373] In one aspect, the present invention includes a pharmaceutical composition comprising (a) a cyclic polynucleotide containing a binding site for binding to the cell membrane of a target cell; and wherein the cell membrane of the target cell contains a first ribonucleic acid (RNA) binding motif; and (b) a pharmaceutically acceptable carrier or excipient.

[0374] In some embodiments, the cyclic polynucleotide further includes a second binding site that binds to a second membrane of a second target cell, wherein the second cell membrane of the second target cell contains a second RNA-binding motif. In some embodiments, the cyclic polynucleotide binds to both the cell membrane on the target cell and the second cell membrane of the second target cell, and cell fusion of the first target cell and the second target cell is regulated.

[0375] In some embodiments, the cyclic polynucleotide further includes a second binding site for binding to the second target, and the binding of both the first and target to the cyclic polynucleotide induces a conformational change in the first target, thereby inducing signal transduction downstream of the first target in the first cell. In some embodiments, the cyclic polynucleotide is untranslatable or defectively translated.

[0376] In some embodiments, the circular polynucleotide further comprises at least one structural element selected from: a) a cryptogenic element; b) a splicing element; c) a regulatory sequence; d) a replication sequence; e) a quasi-double-stranded secondary structure; and f) an expression sequence. In such embodiments, the quasi-helical structure comprises at least one double-stranded RNA segment and at least one non-double-stranded segment. In such embodiments, the quasi-helical structure comprises a first sequence and a second sequence linked to a repetitive sequence, such as an A-rich sequence. In some embodiments, the cryptogenic element comprises a splicing element.

[0377] In some embodiments, the cyclic polynucleotide comprises at least one modified nucleic acid. In such embodiments, the at least one modified nucleic acid is selected from the group consisting of: 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamido (2'-O-NMA), locked nucleic acid (LNA), ethylene nucleic acid (ENA), peptide nucleic acid (PNA), 1',5'-dehydrated hexadiol nucleic acid (HNA), morpholino, methylphosphonate nucleotide, thiol phosphonate nucleotide, and 2'-fluoroN3-P5'-phosphamide. The cyclic polynucleotide can be a fully modified cyclic polynucleotide. In some embodiments, the applied cyclic polynucleotide is a hybridized cyclic polynucleotide. In some embodiments, the cyclic polynucleotide comprises a modified nucleotide and an unmodified IRES.

[0378] In some embodiments, the cryptogen contains at least one modified nucleic acid, such as pseudouridine and N(6)methyladenosine (m6A). In some embodiments, the cryptogen contains a protein binding site, such as a ribonucleic acid-binding protein. In some embodiments, the cryptogen contains an immune protein binding site, for example, to evade a CTL response.

[0379] In some embodiments, the immunogenicity of the circular polynucleotide is at least 2-fold lower than that of its codon-deficient counterpart, as assessed by expression or signaling or activation of at least one of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR, and IFN-β. In some embodiments, the size of the circular polynucleotide is in the range of about 20 bases to about 20 kb. In some embodiments, the circular polynucleotide is synthesized by cyclization of a linear polynucleotide. In some embodiments, the circular polynucleotide is substantially resistant to degradation.

[0380] application

[0381] The cyclic polynucleotides described herein can be applied to cells, tissues, or subjects in need of them, for example, to regulate cellular function or processes, such as gene expression in cells, tissues, or subjects. The invention also contemplates methods for regulating cellular function or processes, such as gene expression, comprising administering the cyclic polynucleotides described herein to cells, tissues, or subjects in need of them. The administered cyclic polynucleotide may be a modified cyclic polynucleotide. In some embodiments, the administered cyclic polynucleotide is a fully modified cyclic polynucleotide. In some embodiments, the administered cyclic polynucleotide is a hybridized modified cyclic polynucleotide. In other embodiments, the administered cyclic polynucleotide is an unmodified cyclic polynucleotide.

[0382] Example paragraph [1] A pharmaceutical composition comprising: (a) A cyclic polynucleotide comprising a binding site for a target, such as RNA, DNA, protein, or cell membrane; and (b) Pharmaceutically acceptable carriers or excipients; The target and the cyclic polynucleotide form a complex, and The target mentioned is not microRNA.

[0383] [2] A pharmaceutical composition comprising: (a) A cyclic polynucleotide, said cyclic polynucleotide comprising: (i) binding to the first binding site of the first target, and (ii) binding to the second binding site of the second target; and (b) Pharmaceutically acceptable carriers or excipients; Wherein the first binding site is different from the second binding site, and Both the first target and the second target are microRNAs.

[0384] [3] The pharmaceutical composition as described in paragraph [1], wherein the binding site comprises an aptamer sequence.

[0385] [4] The pharmaceutical composition as described in paragraph [2], wherein the first binding site comprises a first aptamer sequence and the second binding site comprises a second aptamer sequence.

[0386] [5] The pharmaceutical composition of claim [3], wherein the aptamer sequence has a secondary structure for binding the target.

[0387] [6] The pharmaceutical composition of claim [4], wherein the first aptamer sequence has a secondary structure for binding the first target, and the second aptamer sequence has a secondary structure for binding the second target.

[0388] [7] The pharmaceutical composition of claim [1], wherein the binding site is a first binding site and the target is a first target.

[0389] [8] A pharmaceutical composition as described in any one of paragraphs [3], [5] and [7], wherein the cyclic polynucleotide further comprises a second binding site that binds to the second target.

[0390] [9] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6], [7] and [8], wherein the first target comprises a first cyclic polynucleotide (circRNA) binding motif.

[0391]

[10] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-[9], wherein the second target comprises a second cyclic polynucleotide (circRNA) binding motif.

[0392]

[11] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[10] , wherein the first target, the second target and the cyclic polynucleotide form a complex.

[0393]

[12] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[11] , wherein the first and second targets interact with each other.

[0394]

[13] A pharmaceutical composition as described in any one of paragraphs [1], [3], [5] and [7]-

[12] , wherein the complex modulates cellular processes.

[0395]

[14] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[13] , wherein the first target and the second target are identical, and the first binding site and the second binding site bind to different binding sites on the first target and the second target.

[0396]

[15] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[13] , wherein the first target and the second target are different.

[0397]

[16] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[15] , wherein the cyclic polynucleotide further comprises one or more additional binding sites for binding a third or more targets.

[0398]

[17] A pharmaceutical composition as described in any of paragraphs [2], [4], [6] and [7]-

[16] , wherein the one or more targets are identical and one or more additional binding sites bind to different binding sites on the one or more targets.

[0399]

[18] A pharmaceutical composition as described in any one of paragraphs [1], [3], [5] and [7]-

[17] , wherein the formation of the complex regulates cellular processes.

[0400]

[19] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[18] , wherein the cyclic polynucleotide regulates cellular processes associated with the first or second target when in contact with the first or second target.

[0401]

[20] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[19] , wherein the first target and the second target interact with each other in the complex.

[0402]

[21] A pharmaceutical composition as described in any of paragraphs

[13] -

[20] , wherein the cellular process is related to the pathogenesis of the disease or condition.

[0403]

[22] A pharmaceutical composition as described in any of paragraphs

[13] -

[21] , wherein the cellular process is different from the translation of the cyclic polynucleotide.

[0404]

[23] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[22] , wherein the first target comprises a deoxyribonucleic acid (DNA) molecule and the second target comprises a protein.

[0405]

[24] A pharmaceutical composition as described in any one of paragraphs [1], [3], [5] and [7]-

[23] , wherein the complex regulates the directed transcription of the DNA molecule, the epigenetic remodeling of the DNA molecule or the degradation of the DNA molecule.

[0406]

[25] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[24] , wherein the first target comprises a first protein and the second target comprises a second protein.

[0407]

[26] A pharmaceutical composition as described in any one of paragraphs [1], [3], [5] and [7]-

[25] , wherein the complex modulates the degradation of the first protein, the translocation of the first protein, or signal transduction, or modulates the function of the native protein, inhibiting or modulating the formation of a complex formed by the direct interaction between the first protein and the second protein.

[0408]

[27] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[26] , wherein the first target or the second target is a ubiquitin ligase.

[0409]

[28] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[27] , wherein the first target comprises a first ribonucleic acid (RNA) molecule and the second target comprises a second RNA molecule.

[0410]

[29] The pharmaceutical composition as described in paragraph

[28] , wherein the complex modulates the degradation of the first RNA molecule.

[0411]

[30] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[29] , wherein the first target comprises a protein and the second target comprises an RNA molecule.

[0412]

[31] A pharmaceutical composition as described in any one of paragraphs [1], [3], [5] and [7]-

[30] , wherein the complex modulates the translocation of the protein or inhibits the formation of a complex formed by direct interaction between the protein and the RNA molecule.

[0413]

[32] A pharmaceutical composition as described in any one of paragraphs [2], [4], [6] and [7]-

[31] , wherein the first target is a receptor and the second target is a substrate of the receptor.

[0414]

[33] A pharmaceutical composition as described in any one of paragraphs [1], [3], [5] and [7]-

[32] , wherein the complex inhibits the activation of the receptor.

[0415]

[34] A pharmaceutical composition comprising: (a) A cyclic polynucleotide, wherein the cyclic polynucleotide contains a binding site for a binding target; and (b) Pharmaceutically acceptable carriers or excipients; The cyclic polynucleotides described therein are untranslatable or defectively translated, and the target described therein is not microRNA.

[0416]

[35] A pharmaceutical composition comprising: (a) A circular polynucleotide containing a binding site for a target, wherein the target contains a ribonucleic acid (RNA) binding motif; and (b) Pharmaceutically acceptable carriers or excipients; The cyclic polynucleotides described therein are untranslatable or defectively translated, and the target described therein is microRNA.

[0417]

[36] A pharmaceutical composition as described in any one of paragraphs

[34] and

[35] , wherein the binding site comprises an aptamer sequence having a secondary structure for binding the target.

[0418]

[37] A pharmaceutical composition as described in any one of paragraphs

[34] and

[36] , wherein the target comprises a DNA molecule.

[0419]

[38] A pharmaceutical composition as described in any of paragraphs

[34] -

[37] , wherein the binding of the target to the cyclic polynucleotide regulates transcriptional interference of DNA molecules.

[0420]

[39] A pharmaceutical composition as described in any one of paragraphs

[34] and

[36] -

[38] , wherein the target comprises a protein.

[0421]

[40] The pharmaceutical composition as described in paragraph

[39] , wherein the binding of the target to the cyclic polynucleotide regulates the interaction of the protein with other molecules.

[0422]

[41] A pharmaceutical composition as described in any of paragraphs

[39] -

[40] , wherein the protein is a receptor, and wherein the binding of the target to the cyclic polynucleotide activates the receptor.

[0423]

[42] A pharmaceutical composition as described in any of paragraphs

[39] -

[41] , wherein the protein is a first enzyme, wherein the cyclic polynucleotide further comprises a second binding site for binding to a second enzyme, and wherein the binding of the first and second enzymes to the cyclic polynucleotide regulates the enzymatic activity of the first and second enzymes.

[0424]

[43] A pharmaceutical composition as described in any one of paragraphs

[39] and

[40] , wherein the protein is a ubiquitin ligase.

[0425]

[44] A pharmaceutical composition as described in any one of paragraphs

[34] ,

[36] , and

[38] , wherein the target comprises a messenger RNA (mRNA) molecule.

[0426]

[45] The pharmaceutical composition as described in paragraph

[44] , wherein the binding of the target to the cyclic polynucleotide modulates interference with the translation of the mRNA molecule.

[0427]

[46] A pharmaceutical composition as described in any one of paragraphs

[34] ,

[36] ,

[39] and

[40] , wherein the target comprises a ribosome.

[0428]

[47] A pharmaceutical composition as described in any of paragraphs

[34] -

[46] , wherein the binding of the target to the cyclic polynucleotide modulates interference with the translation process.

[0429]

[48] ​​A pharmaceutical composition as described in any one of paragraphs

[34] ,

[36] and

[38] , wherein the target comprises a circular RNA molecule.

[0430]

[49] The pharmaceutical composition as described in paragraph

[48] , wherein the target chelates the circular RNA molecule with the binding of the cyclic polynucleotide.

[0431]

[50] A pharmaceutical composition as described in any one of paragraphs

[35] ,

[36] ,

[38] and

[47] , wherein the target chelates the microRNA molecule with the binding of the cyclic polynucleotide.

[0432]

[51] A pharmaceutical composition comprising: (a) A cyclic polynucleotide comprising a binding site for binding to a cell membrane (e.g., cell wall membrane, organelle membrane, etc.), wherein the cell membrane comprises a ribonucleic acid (RNA) binding motif; and (b) Pharmaceutically acceptable carriers or excipients.

[0433]

[52] The pharmaceutical composition as described in paragraph

[51] , wherein the binding site comprises an aptamer sequence having a secondary structure for binding the membrane (e.g., cell wall membrane, organelle membrane, etc.) of the cell.

[0434]

[53] The pharmaceutical composition as described in any one of paragraphs

[51] and

[52] , wherein the cyclic polynucleotide further comprises a second binding site for binding to a second target, wherein the second target comprises a second RNA binding motif.

[0435]

[54] The pharmaceutical composition as described in paragraph

[53] , wherein the cyclic polynucleotide binds to the membrane of the cell and the second target.

[0436]

[55] The pharmaceutical composition as described in any of paragraphs

[51] -

[54] , wherein the cyclic polynucleotide further comprises a second binding site for binding to a second cell target, and wherein the binding of the cell target and the second cell target to the cyclic polynucleotide induces a conformational change in the cell target, thereby inducing downstream signal transduction of the cell target.

[0437]

[56] The pharmaceutical composition as described in any one of paragraphs [1]-

[55] , wherein the cyclic polynucleotide is untranslatable or defectively translated.

[0438]

[57] The pharmaceutical composition as described in any one of paragraphs [1]-

[56] , wherein the cyclic polynucleotide further comprises at least one structural element selected from the group consisting of: a) Encryption source; b) Splice element; c) Regulatory sequences; d) Copy sequence; e) Quasi-double-chain secondary structure f) Quasi-helical structure; and g) Expression sequence.

[0439]

[58] The pharmaceutical composition as described in paragraph

[57] , wherein the quasi-helical structure comprises at least one double-stranded RNA segment and at least one non-double-stranded segment.

[0440]

[59] A pharmaceutical composition as described in any one of paragraphs

[57] and

[58] , wherein the quasi-helical structure comprises a first sequence and a second sequence connected to a repeating sequence.

[0441]

[60] A pharmaceutical composition as described in any one of paragraphs

[57] -

[59] , wherein the encryption source comprises a splicing element.

[0442]

[61] The pharmaceutical composition as described in any one of paragraphs [1]-

[60] , wherein the cyclic polynucleotide comprises at least one modified nucleic acid.

[0443]

[62] The pharmaceutical composition as described in paragraph

[61] , wherein at least one modified nucleic acid is selected from the group consisting of: 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamido (2'-O-NMA), locked nucleic acid (LNA), ethylene nucleic acid (ENA), peptide nucleic acid (PNA), 1',5'-dehydrated hexadiol nucleic acid (HNA), morpholino, methylphosphonate nucleotide, thiol phosphonate nucleotide and 2'-fluoroN3-P5'-phosphamide.

[0444]

[63] A pharmaceutical composition as described in any one of paragraphs

[57] -

[62] , wherein the cryptogen comprises at least one modified nucleic acid.

[0445]

[64] A pharmaceutical composition as described in any of paragraphs

[57] -

[63] , wherein the cryptogen comprises a protein binding site.

[0446]

[65] A pharmaceutical composition as described in any of paragraphs

[57] -

[64] , wherein the cryptogen comprises an immune protein binding site.

[0447]

[66] The pharmaceutical composition as described in any of paragraphs

[57] -

[65] , wherein the immunogenicity of the cyclic polynucleotide is at least 2-fold lower than that of the counterpart lacking the cryptogenic source, as assessed by expression, signal transduction or activation of at least one of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR and IFN-β.

[0448]

[67] The pharmaceutical composition as described in any one of paragraphs [1]-

[66] , wherein the cyclic polynucleotide is about 20 bases to about 20 kb in size.

[0449]

[68] The pharmaceutical composition as described in any one of paragraphs [1]-

[67] , wherein the cyclic polynucleotide is synthesized by cyclization of a linear polynucleotide.

[0450]

[69] The pharmaceutical composition as described in any one of paragraphs [1]-

[68] , wherein the cyclic polynucleotide is substantially resistant to degradation.

[0451]

[70] A pharmaceutical composition comprising: (a) A cyclic polynucleotide comprising a binding site for a target, wherein the target comprises a ribonucleic acid (RNA) binding motif; and (b) Pharmaceutically acceptable carriers or excipients. The cyclic polynucleotide comprises at least one modified nucleotide and a first portion containing at least about 5, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 consecutive unmodified nucleotides.

[0452]

[71] A pharmaceutical composition comprising: (a) A cyclic polynucleotide comprising a binding site for a target, wherein the target comprises a ribonucleic acid (RNA) binding motif; and (b) Pharmaceutically acceptable carriers or excipients. The cyclic polynucleotide comprises at least one modified nucleotide and a first portion containing at least about 5, 10, 20, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000 consecutive nucleotides, wherein the first portion lacks pseudouridine or 5'-methylcytidine.

[0453]

[72] A pharmaceutical composition as described in any one of paragraphs

[70] and

[71] , wherein the binding site comprises an aptamer sequence having a secondary structure for binding the target.

[0454]

[73] A pharmaceutical composition as described in any of paragraphs

[70] -

[72] , wherein the immunogenicity of the cyclic polynucleotide is lower than that of the corresponding unmodified cyclic polynucleotide.

[0455]

[74] A pharmaceutical composition as described in any one of paragraphs

[70] -

[72] , wherein the cyclic polynucleotide has at least about 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5 or 10.0 times lower immunogenicity than the corresponding unmodified cyclic polynucleotide, as assessed by expression or signaling or activation of at least one of the group consisting of RIG-I, TLR-3, TLR-7, TLR-8, MDA-5, LGP-2, OAS, OASL, PKR and IFN-β.

[0456]

[75] A pharmaceutical composition as described in any of paragraphs

[70] -

[74] , wherein the cyclic polynucleotide has a longer half-life than the corresponding unmodified cyclic polynucleotide.

[0457]

[76] A pharmaceutical composition as described in any of paragraphs

[70] -

[74] , wherein the half-life of the cyclic polynucleotide is at least about 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5 or 10.0 times longer than that of the corresponding unmodified cyclic polynucleotide.

[0458]

[77] A pharmaceutical composition as described in any one of paragraphs

[75] and

[76] , wherein the half-life is measured by introducing a cyclic polynucleotide or a corresponding unmodified cyclic polynucleotide into a cell and measuring the level of the introduced cyclic polynucleotide or the corresponding cyclic polynucleotide in the cell.

[0459]

[78] The pharmaceutical composition as described in any of paragraphs

[70] -

[77] , wherein the at least one modified nucleotide is selected from the group consisting of N(6) methyladenosine (m6A), 5'-methylcytidine and pseudouridine.

[0460]

[79] The pharmaceutical composition as described in any one of paragraphs 70-

[77] , wherein at least one modified nucleic acid is selected from the group consisting of: 2'-O-methyl, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), TO-dimethylaminoethyloxyethyl (2'-O-DMAEOE), 2'-ON-methylacetamido (2'-O-NMA), locked nucleic acid (LNA), ethylene nucleic acid (ENA), peptide nucleic acid (PNA), 1',5'-dehydrated hexadiol nucleic acid (HNA), morpholino, methylphosphonate nucleotide, thiol phosphonate nucleotide and 2'-fluoroN3-P5'-phosphamide.

[0461]

[80] The pharmaceutical composition as described in any of paragraphs

[70] -

[79] , wherein at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% of the nucleotides of the cyclic polynucleotide are modified nucleotides.

[0462]

[81] A pharmaceutical composition as described in any of paragraphs

[70] -

[80] , wherein the cyclic polynucleotide comprises a binding site consisting of unmodified nucleotides, the binding site binding to a protein, DNA, RNA or cellular target.

[0463]

[82] A pharmaceutical composition as described in any of paragraphs

[70] -

[81] , wherein the cyclic polynucleotide comprises an internal ribosome entry site (IRES) composed of unmodified nucleotides.

[0464]

[83] A pharmaceutical composition as described in any of paragraphs

[70] -

[80] , wherein the binding site is composed of unmodified nucleotides.

[0465]

[84] The pharmaceutical composition as described in paragraph

[83] , wherein the binding site comprises an IRES consisting of unmodified nucleotides.

[0466]

[85] A pharmaceutical composition as described in any of paragraphs

[70] -

[84] , wherein the first portion comprises a binding site for a binding protein, DNA, RNA or a cellular target.

[0467]

[86] A pharmaceutical composition as described in any of paragraphs

[70] -

[85] , wherein the first portion comprises IRES.

[0468]

[87] A pharmaceutical composition as described in any of paragraphs

[70] -

[86] , wherein the cyclic polynucleotide comprises one or more expression sequences.

[0469]

[88] A pharmaceutical composition as described in any of paragraphs

[82] -

[87] , wherein the cyclic polynucleotide comprises one or more of the expressed sequences and the IRES, and wherein the cyclic polynucleotide comprises 5'-methylcytidine, pseudouridine, or a combination thereof in addition to the IRES.

[0470]

[89] A pharmaceutical composition as described in any of paragraphs

[70] -

[88] , wherein one or more expression sequences of the cyclic polynucleotide are configured to have a higher translation efficiency than the corresponding unmodified cyclic polynucleotide.

[0471]

[90] The pharmaceutical composition as described in any of paragraphs

[70] -

[89] , wherein one or more expressed sequences of the cyclic polynucleotide have a translation efficiency at least about 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8 or 3 times higher than the corresponding unmodified cyclic polynucleotide.

[0472]

[91] A pharmaceutical composition as described in any of paragraphs

[70] -

[90] , wherein the translation efficiency of one or more expressed sequences of the cyclic polynucleotide is higher than that of a corresponding cyclic polynucleotide having a first portion comprising a modified nucleotide.

[0473]

[92] A pharmaceutical composition as described in any of paragraphs

[70] -

[90] , wherein the translation efficiency of one or more expressed sequences of the cyclic polynucleotide is higher than that of a corresponding cyclic polynucleotide having a first portion comprising more than 10% modified nucleotides.

[0474]

[93] A pharmaceutical composition as described in any one of paragraphs

[70] -

[92] , wherein one or more expressed sequences of the cyclic polynucleotide have a translation efficiency at least about 1.2, 1.3, 1.5, 1.6, 1.8, 2, 2.2, 2.5, 2.8, 3, 3.2, 3.3, 3.5, 3.8, 4.0, 4.2, 4.5, 4.8, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10.0 times higher than that of the corresponding cyclic polynucleotide (which has a first portion comprising a modified nucleotide).

[0475]

[94] A pharmaceutical composition as described in any of paragraphs

[89] -

[93] , wherein the translation efficiency is measured in cells containing the cyclic polynucleotide or the corresponding cyclic polynucleotide or in an in vitro translation system (e.g., in rabbit reticulocyte lysate).

[0476]

[95] The pharmaceutical composition as described in any of paragraphs

[70] -

[94] , wherein the cyclic polynucleotide is any of the cyclic polynucleotides described in any of claims 0-

[69] .

[0477]

[96] A treatment method comprising administering a pharmaceutical composition as described in any one of paragraphs [1]-

[95] to a subject having a disease or condition.

[0478]

[97] A method for preparing a pharmaceutical composition, the method comprising producing a cyclic polynucleotide as described in any one of paragraphs [1]-

[95] .

[0479]

[98] The cyclic polynucleotide as described in any one of paragraphs [1]-

[95] is formulated in a carrier such as a membrane or lipid bilayer.

[0480]

[99] A method for producing a cyclic polynucleotide as described in any one of paragraphs [1] to

[95] , the method comprising cyclizing a linear polynucleotide having a nucleic acid sequence into a cyclic polynucleotide.

[0481]

[100] An engineered cell comprising the composition of any one of claims [1]-

[95] .

[0482]

[101] A method for binding a target in a cell, the method comprising: Provides an untranslatable cyclic polynucleotide comprising an aptamer sequence having a secondary structure for binding to the target; and The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide forms a detectable complex with the target at least 5 days after delivery.

[0483]

[102] A method for binding a target in a cell, the method comprising: The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide contains an aptamer sequence that binds to the target, and wherein the untranslatable cyclic polynucleotide forms a detectable complex with the target at least 5 days after delivery.

[0484]

[103] The method as described in any one of paragraphs

[101] and

[102] , wherein the target is selected from the group consisting of nucleic acid molecules, small molecules, proteins, carbohydrates and lipids.

[0485]

[104] The method as described in any one of paragraphs

[101] -

[103] , wherein the target is a gene regulatory protein.

[0486]

[105] The method as described in paragraph 104, wherein the gene regulatory protein is a transcription factor.

[0487]

[106] The method as described in paragraph

[103] , wherein the nucleic acid molecule is a DNA molecule or an RNA molecule.

[0488]

[107] The method as described in any one of paragraphs

[101] -

[106] , wherein the complex regulates gene expression.

[0489]

[108] The method as described in any one of paragraphs

[101] -

[107] , wherein the complex regulates the directed transcription of DNA molecules, the epigenetic remodeling of DNA molecules, or the degradation of DNA molecules.

[0490]

[109] The method as described in any one of paragraphs

[101] -

[108] , wherein the complex modulates the degradation of the target, the translocation of the target, or the target signal transduction.

[0491]

[110] The method as described in any one of paragraphs

[107] -

[109] , wherein the gene expression is related to the pathogenesis of the disease or condition.

[0492]

[111] The method as described in any one of paragraphs

[101] -

[110] , wherein the complex is detectable at least 7, 8, 9 or 10 days after delivery.

[0493]

[112] The method as described in any one of paragraphs

[101] -

[111] , wherein the untranslatable cyclic polynucleotide is present for at least five days after delivery.

[0494]

[113] The method as described in any one of paragraphs

[101] -

[112] , wherein the untranslatable cyclic polynucleotide is present for at least 6, 7, 8, 9 or 10 days after delivery.

[114] The method as described in any one of paragraphs

[101] -

[113] , wherein the untranslatable cyclic polynucleotide is an unmodified untranslatable cyclic polynucleotide.

[0495]

[115] The method as described in any one of paragraphs

[101] -

[114] , wherein the untranslatable cyclic polynucleotide has a quasi-double-stranded secondary structure.

[0496]

[116] The method as described in any one of paragraphs

[101] -

[115] , wherein the aptamer sequence further has a tertiary structure for binding the target.

[0497]

[117] The method as described in any one of paragraphs

[101] -

[116] , wherein the cell is a eukaryotic cell.

[0498]

[118] The method as described in any paragraph

[117] , wherein the eukaryotic cell is a human cell.

[0499]

[119] A method for binding transcription factors in a cell, the method comprising: Provides an untranslatable cyclic polynucleotide, wherein the cyclic polynucleotide contains an aptamer sequence that binds to the transcription factor; and The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide forms a complex with the transcription factor and regulates gene expression.

[0500]

[120] A method for binding transcription factors in cells, the method comprising: Untranslatable cyclic polynucleotides are delivered to the cells, wherein the untranslatable cyclic polynucleotides contain aptamer sequences that bind to the transcription factor, and wherein the untranslatable cyclic polynucleotides form a complex with the transcription factor and regulate gene expression.

[0501]

[121] A method for chelating transcription factors in cells, the method comprising: Provides an untranslatable cyclic polynucleotide, wherein the cyclic polynucleotide contains an aptamer sequence that binds to the transcription factor; and The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide chelates the transcription factor by binding to form a complex in the cell.

[0502]

[122] A method for chelating transcription factors in cells, the method comprising: An untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide contains an aptamer sequence that binds to the transcription factor, and wherein the untranslatable cyclic polynucleotide chelates the transcription factor to form a complex by binding to the transcription factor.

[0503]

[123] The method as described in any one of paragraphs

[121] and

[122] , wherein cell viability is reduced after the formation of the complex.

[0504]

[124] A method for sensitizing cells to a cytotoxic agent, the method comprising: Provides untranslatable cyclic polynucleotides, said cyclic polynucleotides containing aptamer sequences that bind transcription factors; and The cytotoxic agent and the untranslatable cyclic polynucleotide are delivered to the cells, wherein the untranslatable cyclic polynucleotide forms a complex with the transcription factor in the cells; This makes the cells more sensitive to the cytotoxic agent compared to cells lacking the untranslatable cyclic polynucleotide.

[0505]

[125] A method for sensitizing cells to a cytotoxic agent, the method comprising: The cytotoxic agent and an untranslatable cyclic polynucleotide are delivered to the cells, wherein the untranslatable cyclic polynucleotide contains an aptamer sequence that binds to the transcription factor; and wherein the untranslatable cyclic polynucleotide forms a complex with the transcription factor in the cells; This makes the cells more sensitive to the cytotoxic agent compared to cells lacking the untranslatable cyclic polynucleotide.

[0506]

[126] The method as described in any one of paragraphs

[124] and

[125] , wherein sensitizing the cells to the cytotoxic agent results in reduced cell viability after delivery of the cytotoxic agent and the untranslatable cyclic polynucleotide.

[0507]

[127] The method as described in paragraph

[126] , wherein at least two days after delivery of the cytotoxic agent and the untranslatable cyclic polynucleotide, the reduced cell viability is 40% or more.

[0508]

[128] A method for binding a pathogenic protein in a cell, the method comprising: Provides an untranslatable cyclic polynucleotide, said cyclic polynucleotide comprising an aptamer sequence that binds to the pathogenic protein; and The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide forms a complex with the pathogenic protein to degrade the pathogenic protein.

[0509]

[129] A method for binding a pathogenic protein in a cell, the method comprising: The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide contains an aptamer sequence that binds to the pathogenic protein; and wherein the untranslatable cyclic polynucleotide forms a complex with the pathogenic protein to degrade the pathogenic protein.

[0510]

[130] A method for binding ribonucleic acid molecules in a cell, the method comprising: Provides an untranslatable cyclic polynucleotide, said cyclic polynucleotide comprising a sequence complementary to the sequence of said ribonucleic acid molecule; and The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide forms a complex with the ribonucleic acid molecule in the cell.

[0511]

[131] A method for binding ribonucleic acid molecules in a cell, the method comprising: A non-translatable cyclic polynucleotide is delivered to the cell, wherein the non-translatable cyclic polynucleotide contains an aptamer sequence that binds to the ribonucleic acid molecule; wherein the non-translatable cyclic polynucleotide forms a complex with the ribonucleic acid molecule in the cell.

[0512]

[132] A method for binding genomic deoxyribonucleic acid molecules in a cell, the method comprising: Provides an untranslatable cyclic polynucleotide, said cyclic polynucleotide comprising an aptamer sequence that binds to the genomic deoxyribonucleic acid molecule; and The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide forms a complex with the genomic deoxyribonucleic acid molecule and regulates gene expression.

[0513]

[133] A method for binding genomic deoxyribonucleic acid molecules in cells, the method comprising: Untranslatable cyclic polynucleotides are delivered to the cells, wherein the untranslatable cyclic polynucleotides contain aptamer sequences that bind to the genomic deoxyribonucleic acid molecule; wherein the untranslatable cyclic polynucleotides form a complex with the genomic deoxyribonucleic acid molecule and regulate gene expression.

[0514]

[134] A method for binding small molecules in cells, the method comprising: Provides an untranslatable cyclic polynucleotide comprising an aptamer sequence that binds to the small molecule; and The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide forms a complex with the small molecule and regulates cellular processes (e.g., protein degradation, cell signal transduction, gene expression, etc.).

[0515]

[135] A method for binding small molecules in cells, the method comprising: Delivering an untranslatable cyclic polynucleotide to the cell, wherein the untranslatable cyclic polynucleotide contains an aptamer sequence that binds to the small molecule; wherein the untranslatable cyclic polynucleotide forms a complex with the small molecule and regulates cellular processes (e.g., protein degradation, cell signal transduction, gene expression, etc.).

[0516]

[136] The method as described in any one of paragraphs

[134] and

[135] , wherein the small molecule is an organic compound with a molecular weight not exceeding 900 Daltons and which regulates cellular processes.

[0517]

[137] The method as described in any one of paragraphs

[134] -

[136] , wherein the small molecule is a drug.

[0518]

[138] The method as described in any one of paragraphs

[134] and

[135] , wherein the small molecule is a fluorophore.

[0519]

[139] The method as described in any one of paragraphs

[134] -

[136] , wherein the small molecule is a metabolite.

[0520]

[140] A composition comprising an untranslatable cyclic polynucleotide comprising an aptamer sequence having a secondary structure for binding a target.

[0521]

[141] A pharmaceutical composition comprising: an untranslatable cyclic polynucleotide comprising an aptamer sequence having a secondary structure for binding the target; and a pharmaceutically acceptable carrier or excipient.

[0522]

[142] A cell comprising an untranslatable cyclic polynucleotide as described in any of paragraphs

[101] -

[141] .

[0523]

[143] A method of treating a subject in need, the method comprising administering a composition as described in any one of paragraphs

[101] -

[140] or the pharmaceutical composition as described in paragraph

[141] .

[0524]

[144] A polynucleotide that encodes an untranslatable cyclic polynucleotide as described in any of paragraphs

[101] -

[141] .

[0525]

[145] A method for producing untranslatable cyclic polynucleotides as described in any of paragraphs

[101] -

[141] .

[0526] All references and publications cited in this article are incorporated herein by reference.

[0527] The following examples are provided to further illustrate some embodiments of the invention, such as the use of model elements, but are not intended to limit the scope of the invention; by their exemplary nature it will be understood that other procedures, methods or techniques known to those skilled in the art may be used alternatively.

[0528] Example Example 1: Circular RNA that binds to DNA to regulate gene expression

[0529] This example illustrates how circular RNA binds to DNA to regulate gene expression.

[0530] Non-naturally occurring circular RNAs are engineered to include their sequences in model target genes (in this case, dihydrofolate reductase (DHFR)). DHFR is present in all organisms and plays a crucial role in regulating the amount of tetrahydrofolate in cells. Tetrahydrofolate and its derivatives are essential for the synthesis of purines and thymidine nucleotides, which are important for cell proliferation and growth. DHFR plays a central role in the synthesis of nucleic acid precursors. As shown in the following example, circular RNA binds to the DHFR gene to repress its transcription.

[0531] The circular RNA was designed to include the DHFR binding sequence 5'-ACAAAUGGGGACGAGGGGGGCGGGGCGGCC-3' (SEQ ID NO: 5).

[0532] Unmodified linear RNA was synthesized from a DNA segment containing the DHFR binding sequence described above via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0533] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0534] like Figure 5C As shown, a circular RNA that binds to DHFR genomic DNA was evaluated using a variety of methods, including CHART-qPCR (which assesses direct RNA binding to genomic DNA), DHFR transcript-specific qPCR, and cell proliferation and growth assays. Active binding of the circular RNA to the DHFR gene is expected to lead to reduced DHFR transcription, decreased purine and thymidine synthesis, and reduced cell proliferation and growth.

[0535] Example 2: Circular RNA that binds to dsDNA to regulate gene expression

[0536] This example illustrates how circular RNA binds to dsDNA to regulate gene expression.

[0537] like Figure 5D As shown, non-naturally occurring circular RNAs are engineered to include sequences that bind to model target genes (in this case, the target sequence of transforming growth factor β (TGF-β)). TGF-β is secreted by many cell types. Upon binding to the TGF-β receptor, the receptor is phosphorylated and activates a signaling cascade, leading to the activation of various downstream substrates and regulatory proteins. The following examples describe circular RNAs that bind to TGF-β target genes to repress their transcription.

[0538] The circular RNA was designed to include the TGF-β target binding sequence 5'-CGGAGAGCAGAGAGGGAGCG-3' (SEQ ID NO: 6).

[0539] Unmodified linear RNA was synthesized from a DNA segment containing a TGF-β binding sequence via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0540] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Biotech, M0202M) or T4 RNA ligase 2 (New England Biotech, M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0541] The binding of circular RNA to dsDNA was assessed using a triplet immunocapture assay. Here, the formation of the RNA-DNA triplet structure was evaluated by pulling the target DNA sequence from within the cell or from the cell nucleus using biotinylated triplet-forming oligonucleotide (TFO) ssRNA molecules (control sequence or target sequence 5'-CGGAGAGCAGAGAGGGAGCG-3' (SEQ ID NO: 7)). The DNA pulled by the biotinylated target or control TFO was sequenced to determine the DNA sequence enriched after RNA-dsDNA pull-out.

[0542] Other methods for demonstrating RNA-DNA binding include CHART-qPCR and gel migration variation assays, in which the target ssRNA oligonucleotide (5'-CGGAGAGCAGAGAGGGAGCG-3' (SEQ ID NO: 7)) interacts with the target dsDNA oligonucleotides (5'-AGAGAGAGGGAGAGAG-3' (SEQ ID NO: 8) and 3'-TCTCTCTCCCTCTCTC-5' (SEQ ID NO: 9)) but interacts with the control DNA oligonucleotides.

[0543] Other assessments of functional changes induced by target RNA binding include changes in TGF-β target genes (including TGFB2, TGFBR1, and / or SMAD2) measured by qPCR.

[0544] Example 3: Circular RNAs that bind to DNA to regulate gene expression

[0545] This example describes how circular RNA binds to DNA to inhibit transcription factor binding.

[0546] Non-naturally occurring circular RNAs are engineered to include binding sequences targeting a specific sequence (in this case, a gamma globulin transcription factor binding sequence). Fetal hemoglobin is the primary oxygen transporter in the human fetus during the last seven months of fetal development in the womb and persists in newborns until approximately six months after birth. Compared to adult hemoglobin, fetal hemoglobin binds oxygen with a greater affinity, enabling the developing fetus to better obtain oxygen from the mother's bloodstream. In newborns, fetal hemoglobin is almost completely replaced by adult hemoglobin by approximately six months after birth.

[0547] GATA-1 is a component of the repressor complex GATA-1-FOG-1-Mi2b, which is at -567°C. G γ / -566 A Binding to the GATA motif of γ-globin. The following examples describe its binding with -567. G γ / -566 A The γ-globulin GATA motif (GenBank coordinates 33992 to 33945 from accession GI455025 and GenBank coordinates 38772 to 38937 from accession GI455025, respectively) binds to a circular RNA to prevent the binding of repressive transcription factors / repressive complexes.

[0548] The circular RNA was designed to include a non-deleted binding sequence that includes the repressive transcription factor complexes GATA1, Mi2b, or FOG1.

[0549] Unmodified linear RNA was synthesized from DNA segments containing transcription factor binding sequences via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0550] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0551] DNA-bound circular RNAs were assessed using direct DNA-binding methods (such as CHART-qPCR), and their function was evaluated through methods such as activation and expression of fetal hemoglobin. Active binding of circular RNAs to upstream regulatory elements of γ-globin genes is expected to lead to competitive inhibition of transcription factors BCL11A or other repressive transcription factors, thereby activating HbF transcription. Changes in HbF levels can be measured using HPLC, flow cytometry, and / or qPCR.

[0552] Example 4: Circular RNA that binds to the DNA double helix

[0553] This example illustrates the binding of circular RNA to the DNA double helix.

[0554] Non-naturally occurring circular RNAs can be engineered to include DNA-binding sequences targeting the major groove. Short (15-mer) RNA oligonucleotides (triplex-forming oligonucleotides (TFOs)) can form stable triple-helical RNA:DNA complexes. The third strand in the triplet structure (i.e., TFO) follows a path through the major groove of the double-stranded DNA. The specificity and stability of the triplet structure are provided by Hoogsteen hydrogen bonds, which differ from those formed in classic Watson-Crick base pairing in double-stranded DNA. TFOs bind to the purine-rich strand of the target doublet through the major groove.

[0555] Unmodified linear RNA was synthesized from a DNA segment with a polypurine sequence of 10–15 bases via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0556] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0557] The binding of circular RNA to DNA is assessed using direct DNA binding methods, such as CHART-qPCR (which assesses direct RNA binding to genomic DNA). Other methods for assessing the binding of circular RNA to dsDNA include triplet immunocapture assays and gel migration variation assays.

[0558] Example 5: Circular RNA that binds to and chelates RNA transcripts

[0559] This example describes how circular RNA binds to and chelates RNA transcripts.

[0560] Non-naturally occurring circular RNAs are engineered to include one or more novel binding sequences targeting RNA transcripts. RNA molecules with amplified CGG segments are targeted for circular RNA binding. As illustrated in the following examples, the circular RNA binds to the repeating region of the RNA for chelation.

[0561] The circular RNA was designed to include a complementary sequence targeting 5'-CGG-3' of 50-220 FMR1 extended repeats.

[0562] Unmodified linear RNA was synthesized from DNA segments with 50–220 FMR1 extended repeats via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer’s instructions, and purified again using the RNA purification system.

[0563] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0564] The binding of circular RNA to FMR1 mRNA was assessed by oligonucleotide pull-down qPCR assay, in which modified oligonucleotides complementary to the circular RNA were used to pull down FMR1 mRNA, which was then reverse transcribed and amplified by qPCR. Binding was also assessed by co-localization of two fluorescent oligonucleotides (one specific to FMR1 mRNA and the other complementary to the circular RNA) and RNA FISH evaluation.

[0565] Example 6: Circular RNA that binds to and chelates RNA transcripts

[0566] This example describes how circular RNA binds to and chelates RNA transcripts.

[0567] Non-naturally occurring circular RNAs are engineered to include one or more novel binding sequences targeting RNA transcripts. SCA8 utilizes extended repeats of CTG. CTG repeats appear in transcribed but untranslated genes. As illustrated in the following examples, the circular RNA binds to the repeat region of the mRNA for chelation.

[0568] The circular RNA was designed to include a complementary sequence to 5'-CUG-3' of 50-120 SCA8 extended repeats.

[0569] Unmodified linear RNA was synthesized from DNA segments with 50–120 SCA8 extended repeats via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer’s instructions, and purified again using the RNA purification system.

[0570] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0571] Binding of circular RNA to SCA1 RNA was assessed by oligonucleotide pull-down qPCR assay, in which modified oligonucleotides complementary to the circular RNA were used to pull down the SCA8 RNA extended repeat, which was then reverse transcribed and amplified by qPCR. RNA FISH was also used to assess binding by co-localization of two fluorescent oligonucleotides (one specific to SCA8 RNA and the other complementary to the circular RNA).

[0572] Example 7: Circular RNA that binds to and chelates RNA transcripts

[0573] This example describes how circular RNA binds to and chelates RNA transcripts.

[0574] The synthesized circular RNA is engineered to include one or more novel binding sequences targeting the RNA transcript. The huntingtin (HTT) gene comprises a segment of 6–35 glutamine residues in its wild-type form. As illustrated in the following examples, the circular RNA binds to the said repeating region of the mRNA for chelation.

[0575] The circular RNA was designed to include a complementary sequence to 5'-CAG-3' of 40-120 HTT extended repeats.

[0576] Unmodified linear RNA was synthesized from DNA segments with 40–120 HTT extended repeats via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer’s instructions, and purified again using the RNA purification system.

[0577] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0578] One method for assessing the binding of circular RNA to HTT RNA is an oligonucleotide pull-down qPCR assay, wherein a modified oligonucleotide complementary to the circular RNA is used to pull down the HTT RNA, which is then reverse transcribed and amplified by qPCR. RNA FISH is also used to assess binding by evaluating the co-localization of two fluorescent oligonucleotides (one specific for HTTA and the other complementary to the circular RNA).

[0579] Example 8: Circular RNases that bind and chelate RNA transcripts and enzymes

[0580] This example illustrates how circular RNA can simultaneously bind and chelate RNA transcripts and proteins to aid in RNA degradation.

[0581] Non-naturally occurring circular RNAs are engineered to include one or more novel binding sequences targeting transcripts and proteins to aid in transcript degradation. The atrophin-1 protein, encoded by ATN1, is used as a model system. The encoded protein comprises serine repeats, alternating regions of acidic and basic amino acids, and variable glutamine repeats. The ATN1 gene contains a DNA segment called the CAG trinucleotide repeat.

[0582] In eukaryotic cells, most mRNAs possess a 5' monomethylguanosine cap and a 3' poly(A) tail, which are important for mRNA translation and stability. Removal of the 5' cap (uncapping) is a prerequisite for mRNA decay from the 5' end. The Dcp2 protein has been identified as the major mRNA uncapping enzyme in cells. As illustrated in the following example, circular RNA binds to the repeat region of mRNA for chelation and binds to the Dcp2 protein for mRNA uncapping.

[0583] The circular RNA was designed to include a complementary sequence to 5'-CAG-3' of 40-120 ATN1 extended repeats and an RNA cap structure that is recognized by Dcp2.

[0584] Unmodified linear RNA was synthesized from DNA segments with 40–120 ATN1 extended repeats and an RNA cap structure recognized by Dcp2 via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (Thermo Fisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system. Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Biotech, M0202M) or T4 RNA ligase 2 (New England Biotech, M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0585] One method for assessing the binding of circular RNA to ATN1 RNA is an oligonucleotide pull-down qPCR assay, in which a modified oligonucleotide complementary to the circular RNA is used to pull down the ATN1 RNA, which is then reverse transcribed and amplified by qPCR. Uncapping function is assessed by qSL-RT-PCR, which combines splint ligation and quantitative RT-PCR (Blewett et al., RNA, 2011, Mar, 17(3): 535-543).

[0586] Example 9: Circular RNA used for mRNA substitution

[0587] This example illustrates how circular RNA binds to target mRNA, creating a ribozyme cleavage site.

[0588] Non-naturally occurring circular RNAs are engineered to include sequences that bind to the M2 isoform of pyruvate kinase mRNA. As illustrated in the following example, the circular RNA binds to the target pyruvate kinase (PK) M2 isoform, leading to its cleavage.

[0589] The circular RNA was designed to include a sequence complementary to the pyruvate kinase M2 isotype, which will generate a VS ribozyme cleavage site at the target. The circular RNA also includes sequences encoding the trans-acting VS ribozyme and the pyruvate kinase M1 isotype.

[0590] Unmodified linear RNA was synthesized from a DNA segment containing an M2 isotype complementary sequence, a VS ribozyme, and an M1 coding sequence via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0591] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Biotech, M0202M) or T4 RNA ligase 2 (New England Biotech, M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0592] The binding of circular RNA to PK M2 mRNA and the associated degradation of PK M2 mRNA were assessed by RT-PCR. The restoration of PK M1 mRNA expression was assessed in a similar manner. Additionally, the expression of PK M1 and PK M2 proteins was assessed by Western blotting. Evidence for functional alterations induced after target RNA binding and cleavage included cell proliferation assays.

[0593] Example 10: Circular RNA for targeting mRNA cleavage

[0594] This example illustrates how circular RNA binds to a model target mRNA, generating a ribozyme cleavage site.

[0595] Non-naturally occurring circular RNAs are engineered to include sequences that bind to SRSF1 mRNA. The following examples illustrate how circular RNAs bind to their target SRSF1 mRNA, leading to its cleavage.

[0596] The circular RNA is designed to include a sequence complementary to tSRSF1 mRNA, which will generate a VS ribozyme cleavage site at the target. The circular RNA also contains the sequence of the trans-acting VS ribozyme and the coding sequence for the pyruvate kinase M1 isotype. Other trans-acting ribozymes, such as HDV, hammerhead structures, group I, and / or group II, are also utilized.

[0597] Unmodified linear RNA was synthesized from a DNA segment containing an SRSF1 complementary sequence and a VS ribozyme via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0598] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Biotech, M0202M) or T4 RNA ligase 2 (New England Biotech, M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0599] The binding of circular RNA to SRSF1 mRNA and the associated degradation of SRSF1 mRNA were assessed by RT-PCR. SRSF1 protein expression was assessed by Western blotting. Further evidence of alterations induced by target RNA binding and cleavage included cell proliferation assays.

[0600] Example 11: Circular RNA that chelates circular RNA

[0601] This example illustrates the binding of circular RNA to circular RNA.

[0602] Circular RNAs can be found in certain cell lines. One such example is circ-Dnmt1. As shown in the following example, circular RNA binds to circ-Dnmt1.

[0603] The circular RNA was designed to include a complementary sequence to circ-Dnmt1 to inhibit its RNA-protein interaction.

[0604] Unmodified linear RNA was synthesized from DNA segments with appropriate sequences via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0605] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0606] One method for assessing the binding of circular RNA to circ-Dnmt1 involves pulling down the circular RNA (using biotinylated oligonucleotides complementary to a region of the circular RNA) followed by RT-PCR. Additionally, electrophoretic mobility shift assays are used to visualize the circular RNA-circ-Dnmt1 complex.

[0607] Example 12: Circular RNA chelating two miRNAs

[0608] This example illustrates the binding of a circular RNA to two separate miRNAs.

[0609] The circular RNA was designed to include complementary sequences to two model miRNAs (miR-9 and miR-1269 in this case).

[0610] Unmodified linear RNA was synthesized from DNA segments with appropriate sequences via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0611] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0612] One method for assessing the binding of circular RNA to miR-9 and miR-1269 involves pulling the circular RNA down (using biotinylated oligonucleotides complementary to the region of the circular RNA) followed by RT-PCR. Additionally, electrophoretic mobility shift assays are used to visualize the circular RNA-miRNA-miRNA complexes.

[0613] Example 13: Circular RNA that binds to and chelates at least two separate RNA transcripts

[0614] This example describes a circular RNA binding to and chelating at least two model RNA transcripts.

[0615] Synthesized circular RNAs are engineered to include two or more novel binding sequences targeting RNA transcripts. SCA8 utilizes expanded repeats of the CTG. The FMR1 gene includes CGG expansion. As illustrated in the following examples, circular RNAs bind to repeat regions of RNA transcripts for chelation.

[0616] As shown in the following examples, circular RNA binds to the repeat regions of RNA to chelate FMR1 or SCA8 extended repeats.

[0617] The circular RNA was designed to include complementary sequences for 5'-CGG-3' of 50-220 FMR1 extended repeats and complementary sequences for 5'-CUG-3' of 50-120 SCA8 extended repeats.

[0618] Unmodified linear RNA was synthesized from DNA segments with extended repeats via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0619] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0620] Binding of the circular RNA to FMR1 or SCA1 mRNA was assessed by oligonucleotide pull-down qPCR assay, in which modified oligonucleotides complementary to the circular RNA were used to pull down the FMR1 or SCA1 mRNA, which was then reverse transcribed and amplified by qPCR. Binding was also assessed by co-localization of fluorescent oligonucleotides (one specific to FMR1 or SCA1 mRNA, the other complementary to the circular RNA), and fluorescence was assessed by RNA FISH.

[0621] Example 14: Circular RNA that binds to proteins

[0622] This example describes how circular RNA binds to a protein for chelation.

[0623] TAR-DNA binding protein 43 (TDP-43) is a multifunctional heteroribonucleoprotein involved in the processing and stabilization of mRNA. TDP-43 comprises two RNA recognition motifs (RRMs), a nuclear localization signal and a nuclear export sequence mediating nuclear shuttle, and a C-terminal glycine-rich domain (GRD) involved in TDP-43 protein interactions and function. As illustrated in the following example, circular RNA binds to TDP-43 for chelation.

[0624] The circular RNA was designed to include the TDP-43 RNA-binding motif: 5'-(UG)nUA(UG)m-3', 5'-GAGAGAGCGCGUGUGUGUGUGUGGUGGACAUA-3' (SEQ ID NO: 10) or (UG)6 and a protein-binding sequence targeting the C-terminal glycine-rich domain to competitively bind TDP-43 and inhibit its binding / downstream function.

[0625] Unmodified linear RNA was synthesized from a DNA segment containing a TDP-43 RNA motif and a protein-binding sequence targeting a C-terminal glycine-rich domain via in vitro transcription using T7 RNA polymerase. The transcribed RNA was purified using an RNA purification system (QIAGEN), treated with alkaline phosphatase (ThermoFisher Scientific, EF0652) according to the manufacturer's instructions, and purified again using the RNA purification system.

[0626] Splice-linked circular RNA was generated by treating transcribed linear RNA and DNA splices with T4 DNA ligase (New England Bio, Inc., M0202M) or T4 RNA ligase 2 (New England Bio, Inc., M0239S), and the circular RNA was isolated after enrichment with RNase R. RNA quality was assessed by agarose gel electrophoresis or automated electrophoresis (Agilent Technologies).

[0627] The binding of circular RNA to TDP-43 was assessed in vitro using EMSA (RNA electrophoretic mobility shift assay). When TDP-43 was bound to circRNA, its migration rate during gel electrophoresis was slower than that of unbound circular RNA. Similarly, ...

Claims

1. A method for binding a target in cells, the method comprising: Provides an untranslatable cyclic polynucleotide comprising an aptamer sequence having a secondary structure for binding the target; and The untranslatable cyclic polynucleotide is delivered to the cell, wherein the untranslatable cyclic polynucleotide forms a detectable complex with the target at least 5 days after delivery.

2. The method of claim 1, wherein the target is selected from the group consisting of nucleic acid molecules, small molecules, proteins, carbohydrates, and lipids.

3. The method of claim 1, wherein the target is a gene regulatory protein.

4. The method of claim 3, wherein the gene regulatory protein is a transcription factor.

5. The method of claim 2, wherein the nucleic acid molecule is a DNA molecule or an RNA molecule.

6. The method of claim 1, wherein the complex regulates gene expression.

7. The method of claim 1, wherein the complex regulates directed transcription of DNA molecules, epigenetic remodeling of DNA molecules, or degradation of DNA molecules.

8. The method of claim 1, wherein the complex modulates the degradation of the target, the translocation of the target, or the target signal transduction.

9. The method of claim 6, wherein the gene expression is related to the pathogenesis of the disease or condition.

10. The method of claim 1, wherein the complex is detectable at least 7, 8, 9 or 10 days after delivery.

Images