Compositions and methods for purifying polyribonucleotides
A method using a dsRNA-binding reagent effectively separates linear polyribonucleotides from circular polyribonucleotides, improving the purity and expression efficiency of circular polyribonucleotides by utilizing a dsRNA-binding column or resin.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SAIL BIOMEDICINES INC
- Filing Date
- 2025-12-30
- Publication Date
- 2026-07-09
AI Technical Summary
Existing methods struggle to effectively separate linear polyribonucleotides from a mixture containing both linear and circular polyribonucleotides, particularly when unprocessed or partially processed linear polyribonucleotides are present, which can contaminate preparations intended for circular polyribonucleotides.
A method involving a reagent that binds to double-stranded RNA (dsRNA) is used to separate linear polyribonucleotides from a mixture, allowing for the selective recovery of circular polyribonucleotides by using a dsRNA-binding column or resin, followed by centrifugation and elution steps to collect the desired polyribonucleotides.
This method enables the efficient separation of linear polyribonucleotides with dsRNAs from circular polyribonucleotides, resulting in a purified population of circular polyribonucleotides with enhanced expression levels and reduced contamination.
Smart Images

Figure IMGF000087_0001_TABLE 
Figure IMGF000088_0001_TABLE 
Figure IMGF000089_0001_TABLE
Abstract
Description
Docket No.: 32324.0220-US-PCT SBM24-113WO COMPOSITIONS AND METHODS FOR PURIFYING POLYRIBONUCLEOTIDESFIELD OF THE INVENTIONThe present disclosure generally relates to novel compositions and methods of purifying polyribonucleotides such as circular RNAs.BACKGROUNDPolyribonucleotides are useful for a variety of therapeutic and engineering applications. Thus, new compositions and methods for separating and purifying polyribonucleotides are useful.SUMMARY OF THE INVENTIONOne aspect of the invention relates to a method of separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear polyribonucleotides and circular polyribonucleotides. The method comprises:(a) providing a sample comprising the plurality of polyribonucleotides, wherein the plurality of polyribonucleotides comprises one or more linear polyribonucleotides, each comprising one or more dsRNAs;(b) contacting the sample with a reagent that binds to the dsRNAs; and(c) separating the linear polyribonucleotides comprising the dsRNAs bound to the reagent from the plurality of polyribonucleotides.In certain embodiments, the method addresses the presence of unprocessed or partially processed linear polyribonucleotides that may be present in preparations intended to comprise circular polyribonucleotides, and enables selective separation of such linear polyribonucleotides while allowing circular polyribonucleotides to be recovered.In some embodiments, the linear polyribonucleotide comprising the one or more dsRNAs is transcribed from a deoxyribonucleotide encoding the linear polyribonucleotide comprising the dsRNAs.In some embodiments, in the linear polyribonucleotide comprising the one or more dsRNAs, each dsRNA is located at a 3’ terminus, a 5’ terminus, or an internal position of the linear polyribonucleotide. In the instances where the linear polyribonucleotide is a linear precursor polyribonucleotide described herein, which contains circularization elements, an internal position refers to any non-terminus position but external to the circularization elements, i.e., any positions between the 5’ terminus and the 5’ circularization element and any position between the 3’ terminus and the 3’ circularization element. In some embodiments, in the linear polyribonucleotide comprising the one or more dsRNAs, each dsRNA is located at a 3’ terminus or at a 5’ terminus of the linear polyribonucleotide.In some embodiments, the linear polyribonucleotide comprises two or more dsRNAs, wherein 1LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO at least one dsRNA is located at the 3’ terminus of the linear polyribonucleotide, and at least one dsRNA is located at the 5’ terminus of the linear polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises 1-10 dsRNAs (e.g., 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 dsRNAs) at the 3’ terminus of the linear polyribonucleotide, and 1-10 dsRNAs (e.g., 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 dsRNAs) at the 5’ terminus of the linear polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises 1-4 dsRNAs at the 3’ terminus of the linear polyribonucleotide, and 1-4 dsRNAs at the 5’ terminus of the linear polyribonucleotide. In some embodiments, the numbers of the dsRNAs at the 3’ terminus and at the 5’ terminus of the linear polyribonucleotide are the same. In some embodiments, the numbers of the dsRNAs at the 5’ terminus and at the 3’ terminus of the linear polyribonucleotide are different.In some embodiments, the linear polyribonucleotide further comprises at least one spacer region between (CE1) and the dsRNA adjacent and external to (CE1), and / or at least one spacer region between (CE2) and the dsRNAs adjacent and external to (CE2). In some embodiments, each spacer region is at least 5 ribonucleotides in length, e.g., from 5 to 500 ribonucleotides in length, or from 5 to 10 (e.g., 5, 6, 7, 8, 9, or 10) ribonucleotides in length.In some embodiments, at least one of the dsRNAs is a dsRNA hairpin. In some embodiments, all of the dsRNAs are dsRNA hairpins.In some embodiments, the dsRNAs of at least one terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at the 5’ terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at the 3’ terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at both the 5’ terminus and the 3’ terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure.In some embodiments, the connection(s) of the multiple dsRNA hairpins within the multi-dsRNA hairpin structure is continuous, i.e., one end of the continuous strand of one dsRNA hairpin is connected to one end of the continuous strand of the adjacent dsRNA hairpin.In some embodiments, the dsRNA hairpin each independently has a stem region of at least 5 base pairs, at least 10 base pairs, at least 15 base pairs, at least 20 base pairs, at least 25 base pairs, at least 30 base pairs, at least 35 base pairs, at least 40 base pairs, at least 50 base pairs, at least 60 base pairs, at least 70 base pairs, at least 80 base pairs, at least 90 base pairs, or at least 100 base pairs in length; and / or up to 100 base pairs, up to 200 base pairs, up to 300 base pairs, up to 400 base pairs, up to 500 base pairs, up to 600 base pairs, up to 700 base pairs, up to 800 base pairs, up to 900 base pairs, or up to 1000 base pairs.In some embodiments, the dsRNA hairpin each independently has a loop region of at least 1, at least 2, at least 3, or at least 4 nucleotides in length. In one embodiment, the dsRNA hairpin has a loop region of 4 nucleotides in length.In some embodiments, the dsRNA hairpin each independently has a stem region of at least 202LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO or at least 30 base pairs in length; and / or a loop region of at least 2 or at least 3 nucleotides in length. In some embodiments, the dsRNA hairpin each independently has a stem region of at least 30, at least 35, at least 40, at least 45, or at least 50 base pairs in length. For instance, the dsRNA hairpin may each independently have a stem region of 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 base pairs. In some embodiments, the dsRNA hairpin has a loop region of at least 4 nucleotides in length.In some embodiments, the dsRNAs of at least one terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNAs at the 5’ terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNAs at the 3’ terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNAs at both the 5’ terminus and the 3’ terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, in any of the multi-dsRNA hairpin structure discussed above, each dsRNA hairpin independently has a stem region of 30-60 (e.g., 30-50, such as 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) base pairs. In some embodiments, the linker or spacer sequence operably linking the two or more dsRNAs (e.g., the two or more dsRNA hairpins within a multi-dsRNA hairpin structure) is 6-10 (e.g., 6, 7, 8, 9, or 10) nucleotides long. In some embodiments, the linker or spacer sequence operably linking the two or more dsRNAs (e.g., the two or more dsRNA hairpins within a multi-dsRNA hairpin structure) is a polyA sequence, or a random sequence.In some embodiments, the stem region of the dsRNA hairpin can contain one or more bulges, with each bulge containing 1-10 unpaired nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 unpaired nucleotides). In one embodiment, the stem region of the dsRNA hairpin contains a bulge of 1-2 unpaired nucleotides.In some embodiments, the step of separating comprises collecting the polyribonucleotides in the sample that are not bound by the reagent. In some embodiments, the polyribonucleotides in the sample that are not bound by the reagent comprises the circular polyribonucleotides.In some embodiments, the reagent is a polypeptide, a small molecule, or a nucleic acid. In some embodiments, the reagent that binds to the dsRNAs is contained in a dsRNA-binding column or resin. In some embodiments, the dsRNA-binding column or resin operates in a flow-through mode.In some embodiments, the sample comprising the plurality of polyribonucleotides is contained in aqueous buffers before the step of contacting the sample with the reagent (e.g., the dsRNA-binding column or resin containing the reagent).In some embodiments, the aqueous buffers comprise a buffer solution containing a salt at a 3LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO concentration of about 0.5M-2M (e.g., 0.5M, 0.7M, 0.75M, 0.8M, 0.85M, 0.9M, 0.95M, 1.0M, 1.05M, 1.10M, 1.15M, 1.20M, 1.25M, 1.30M, 1.4M, 1.5M, 1.6M, 1.7M, 1.75M, 1.8M, 1.9M, or 2.0M).In some embodiments, the aqueous buffers comprise a buffer solution (e.g., Tris) containing a salt (e.g., NaCl) that regulates the pH of the aqueous buffers. In some embodiments, the buffer solution containing the salt regulates the pH of the aqueous buffers to reach from about 5.0 to about 9.5, for instance, from about 5.5 to about 9.5, from about 6.0 to about 9.5, from about 6.5 to about 9.5, from about 7.0 to about 9.5, from about 7.5 to about 9.5, from about 8.0 to about 9.5, from about 8.5 to about 9.5, from about 9.0 to about 9.5, from about 5.5 to about 9.0, from about 6.0 to about 9.0, from about 6.5 to about 9.0, from about 7.0 to about 9.0, from about 7.5 to about 9.0, from about 8.0 to about 9.0, from about 8.5 to about 9.0, from about 5.5 to about 8.5, from about 6.0 to about 8.5, from about 6.5 to about 8.5, from about 7.0 to about 8.5, from about 7.5 to about 8.5, from about 8.0 to about 8.5, from about 5.5 to about 8.0, from about 6.0 to about 8.0, from about 6.5 to about 8.0, from about 7.0 to about 8.0, from about 7.5 to about 8.0, from about 5.5 to about 7.5, from about 6.0 to about 7.5, from about 6.5 to about 7.5, or from about 7.0 to about 7.5, from about 5.5 to about 7.0, from about 6.0 to about 7.0, or from about 6.5 to about 7.0. In some embodiments, the buffer solution containing the salt regulates the pH of the aqueous buffers to reach about 7.0, about 7.5, or about 8.0.In some embodiments, the aqueous buffers comprise a buffer solution containing a salt (e.g., NaCl) at a concentration about 0.5-2 M, or about 0.5- 1.5 M (e.g., 0.5M, 0.7M, 0.75M, 0.8M, 0.85M, 0.9M, 0.95M, 1.0M, 1.05M, 1.10M, 1.15M, 1.20M, 1.25M, 1.30M, 1.4M, or 1.5M), and optionally a chelating solution. The buffer solution may be a Tris solution at about 1-20 mM (e.g., 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 12.5 mM, 15 mM, 17.5 mM, or 20 mM) that regulates the pH of the aqueous buffers, to reach about 7.0-9.5 (e.g., including any ranges listed in the above embodiment for pH ranges falling between 7.0 and 9.5), or to reach about 7.0, about 7.5, or about 8.0.In some embodiments, the aqueous buffers comprise a Tris and / or HEPE buffer solution containing about 0.5M-1.5M NaCl that regulates the pH to about 7.0-9.5, or about 8.0, and optionally a chelating solution (such as EDTA).In some embodiments, the contacting and separating steps comprise:contacting the sample with the reagent (i.e., the dsRNA-binding column or resin containing the reagent) to allow the column or resin to bind the dsRNAs;optionally centrifugating the dsRNA-binding column or resin; andcollecting the flow-through solution comprising the polyribonucleotides in the sample that are not bound to the reagent (i.e., the column or resin containing the reagent) from the plurality of polyribonucleotides in the sample. In these embodiments, the polyribonucleotides in the sample that are not bound by the reagent (i.e., the column or resin containing the reagent) comprises the circular polyribonucleotide to be separated and collected.4LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO In some embodiments, the method further comprises:washing the column or resin containing the reagent that binds the dsRNAs with the aqueous buffers one or more times;optionally centrifugating the dsRNA-binding column or resin; andcollecting the flow-through solution comprising the polyribonucleotides in the sample that are not bound to the reagent (i.e., the column or resin containing the reagent) from the plurality of polyribonucleotides in the sample. In these embodiments, the polyribonucleotides in the sample that are not bound by the reagent (i.e., the column or resin containing the reagent) comprises the circular polyribonucleotide to be separated and collected.In some embodiments, the step of separating further comprises eluting the reagent bound with the linear polyribonucleotides comprising the dsRNAs to collect an eluate comprising the linear polyribonucleotides comprising the dsRNAs, using an eluant different from the aqueous buffers. For instance, the eluant may be guanidine hydrochloride.In some embodiments, the method further comprises, prior to step (a), providing a linear precursor polyribonucleotide and circularizing the linear precursor polyribonucleotide to produce the circular polyribonucleotide. The linear precursor polyribonucleotide may comprise a 5’ circularization element (CE2) and a 3’ circularization element (CE1). For instance, the circular polyribonucleotide may be produced by a circularization reaction of (CE1) and (CE2). In some embodiments, (CE1) comprises a 5’ self-splicing intron fragment and (CE2) comprises a 3’ selfsplicing intron fragment. For instance, the circular polyribonucleotide may be produced by selfsplicing of the linear precursor polyribonucleotide. The 5’ self-splicing intron fragment and the 3’ self-splicing intron fragment may each be a Group I or Group II self-splicing intron fragment.In some embodiments, the linear precursor polyribonucleotide comprises one or more dsRNAs, at least one of which is adjacent and external to one of the circularization elements, (CE1) or (CE2). In some embodiments, the linear precursor polyribonucleotide comprises one or more dsRNAs, at least one of which is adjacent and external to one of the 5’ and 3’ self-splicing intron fragments. The term “external”, when used in the context relative to the position(s) of the circularization elements in the linear polyribonucleotide or linear precursor polyribonucleotide, refers to the position of the dsRNA that is located outside the circularization element(s) and toward the terminus, e.g., a position between the 5’ terminus and the 5’ circularization element and a position between the 3’ terminus and the 3’ circularization element.In some embodiments, the linear precursor polyribonucleotide comprises at least two dsRNAs: at least one dsRNA is at the 5’ end of the polyribonucleotide and is adjacent and external to (CE2); and at least one dsRNA is at the 3’ end of the polyribonucleotide and is adjacent and external to (CE1). In some embodiments, the linear precursor polyribonucleotide comprises at least two dsRNAs: at least one dsRNA is at the 5’ end of the polyribonucleotide and is adjacent and external to the 5’ self-splicing intron fragment; and at least one dsRNA is at the 3’ end of the polyribonucleotide 5LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO and is adjacent and external to the 3’ self-splicing intron fragment.In some embodiments, the linear precursor polyribonucleotide comprises 1-10 dsRNAs (e.g., 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 dsRNAs) at the 5’ end of the polyribonucleotide, adjacent and external to (CE2), optionally the 5’ self-splicing intron fragment. In some embodiments, the linear precursor polyribonucleotide comprises 1-10 dsRNAs (e.g., 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 dsRNAs) at the 3’ end of the polyribonucleotide, adjacent and external to (CE1), optionally the 3’ self-splicing intron fragment. In some embodiments, the linear precursor polyribonucleotide comprises 1-4 dsRNAs at the 5’ end of the polyribonucleotide, adjacent and external to (CE2), optionally the 5’ self-splicing intron fragment. In some embodiments, the linear precursor polyribonucleotide comprises 1-4 dsRNAs at the 3’ end of the polyribonucleotide, adjacent and external to (CE1), optionally the 3’ self-splicing intron fragment. In some embodiments, the numbers of the dsRNAs at the 5’ end of the polyribonucleotide, adjacent and external to (CE2), and at the 3’ end of the polyribonucleotide, adjacent and external to (CE1), are the same. In some embodiments, the numbers of the dsRNAs at the 5’ end of the polyribonucleotide, adjacent and external to (CE2), and at the 3’ end of the polyribonucleotide, adjacent and external to (CE1), are different.In some embodiments, the linear polyribonucleotide further comprises at least one spacer region between (CE1) and the dsRNA adjacent and external to (CE1), and / or at least one spacer region between (CE2) and the dsRNAs adjacent and external to (CE2). In some embodiments, each spacer region is at least 5 ribonucleotides in length, e.g., from 5 to 500 ribonucleotides in length, or from 5 to 10 (e.g., 5, 6, 7, 8, 9, or 10) ribonucleotides in length.In some embodiments, at least one of these dsRNAs is a dsRNA hairpin. In some embodiments, all of the dsRNAs are dsRNA hairpins. In some embodiments, the dsRNAs of at least one end have a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at the 5’ end have a multi -dsRNA hairpin structure. In some embodiments, the dsRNAs at the 3’ end have a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at both ends have a multi-dsRNA hairpin structure. In some embodiments, the linker or spacer sequence operably linking the two or more dsRNAs (e.g., the two or more dsRNA hairpins within a multi-dsRNA hairpin structure) is 6-10 (e.g., 6, 7, 8, 9, or 10) nucleotides long. In some embodiments, the linker or spacer sequence operably linking the two or more dsRNAs (e.g., the two or more dsRNA hairpins within a multi-dsRNA hairpin structure) is a polyA sequence, or a random sequence.In some embodiments, the dsRNAs at the 5’ end of the polyribonucleotide, adjacent and external to (CE2), optionally the 5’ self-splicing intron fragment, have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNAs at the 3’ end of the polyribonucleotide, adjacent and external to (CE1), optionally the 3’ self-splicing intron fragment, have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNAs at both the 5’ end of the polyribonucleotide,6LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO adjacent and external to (CE2), optionally the 5’ self-splicing intron fragment, and at the 3’ end of the polyribonucleotide, adjacent and external to (CE1), optionally the 3’ self-splicing intron fragment, have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, in any of the multi-dsRNA hairpin structure discussed above, each dsRNA hairpin independently has a stem region of 30-60 (e.g., 30-50, such as 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) base pairs.In some embodiments, the circular polyribonucleotide comprises an expression sequence, a non-coding sequence, or an expression sequence and a noncoding sequence. In some embodiments, the circular polyribonucleotide comprises an expression sequence encoding one or more polypeptides (e.g., a peptide that has a biological effect on a subject).In some embodiments, the circular polyribonucleotide comprises an open-reading frame (ORF). The ORF may encode a polypeptide. In some embodiments, the circular polyribonucleotide comprises more than one ORF. Each of the ORFs may encode a polypeptide. When the circular polyribonucleotide comprises more than one ORF, each ORF may encode a same polypeptide, or a polypeptide different than that encoded in the other ORF(s). In some embodiments, a level of expression from the ORF of the circular polyribonucleotide after purification is increased at least 10% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) relative to a level of expression from the ORF prior to separating.In some embodiments, the circular polyribonucleotide comprises one or more internal ribosome entry site (IRES) (e.g., an IRES). In some embodiments, the IRES is operably linked to an expression sequence encoding a polypeptide. The ORF(s) (e.g., those encoding a polypeptide) may be operably linked to the IRES.In some embodiments, the method separates at least 5 pg (e.g., at least 10 pg, 20 pg, 30 pg, 40 pg, 50 pg, 60 pg, 70 pg, 80 pg, 90 pg, 100 pg, 150 pg, 200 pg, 250 pg, 300 pg, 350 pg, 400 pg, 450 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1000 mg, or more) of the circular polyribonucleotide.Another aspect of the invention relates to a population of the polyribonucleotides produced by the method as described herein. The population may include the circular polyribonucleotides to be separated from other polyribonucleotides contained in the initial sample, which comprises the plurality of polyribonucleotides, including linear polyribonucleotides comprising dsRNAs and the circular polyribonucleotides. The population of the circular polyribonucleotides separated and collected may contain a dsRNA having a duplex region of no more than 40 base pairs in length, no more than 30 base pairs in length, no more than 20 base pairs in length, or no more than 10 base pairs in length. In some embodiments, the population of the circular polyribonucleotides separated and collected does not contain any introduced (or exogenous) dsRNAs from the linear polyribonucleotides 7LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO or linear precursor polyribonucleotides.The population of the circular polyribonucleotide separated and collected may be at least 40% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or more) (wt%) of the total polyribonucleotides. In some embodiments, the population includes less than 40% (e.g., less than 30%, 20%, 10%, 5%, or less) (mol / mol) linear polyribonucleotides of the total polyribonucleotides.All above descriptions and all embodiments discussed in the above aspect relating to the method of separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear polyribonucleotides and circular polyribonucleotides, including various other components of the linear polyribonucleotides, linear precursor polyribonucleotide, and circular polyribonucleotides; various dsRNAs contained in the linear polyribonucleotides; various reagents and components thereof that bind to the dsRNAs; and various steps employed in the method, and are applicable to this aspect of the invention relating to the a population of the polyribonucleotides (e.g., the circular polyribonucleotides) produced by the method.Another aspect of the invention relates to a pharmaceutical composition comprising the population of circular polyribonucleotides produced by the method as described herein, and a diluent, carrier, and / or excipient.All above descriptions and all embodiments discussed in the above aspect relating to the method of separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear polyribonucleotides and circular polyribonucleotides, including various other components of the linear polyribonucleotides, linear precursor polyribonucleotide, and circular polyribonucleotides; various dsRNAs contained in the linear polyribonucleotides; various reagents and components thereof that bind to the dsRNAs; and various steps employed in the method, are applicable to these aspects of the invention relating to the pharmaceutical composition.All above descriptions and all embodiments discussed in the above aspect relating to the population of the circular polyribonucleotide produced by the method, including the % of various components in the total polyribonucleotides, are applicable to these aspects of the invention relating to the pharmaceutical composition.Another aspect of the invention relates to a linear precursor polyribonucleotide designed and produced to contain one or more dsRNAs, for utilization in separating and purifying circular polyribonucleotides.In some embodiments, the intermediate compound of linear polyribonucleotide comprises a formula of 5’-(DS2)-(CE2)-(P)-(CEl)-(DSl)-3’. In this formula, component (CE2) comprises a 5’ circularization element; component (P) comprises a polyribonucleotide cargo; component (CE1) comprises a 3’ circularization element; each of components (DS2) and (DS1) is independently absent or comprises a dsRNA, provided at least one of (DS2) and (DS 1) comprises a dsRNA.All above descriptions and all embodiments discussed in the above aspect relating to the method of separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a 8LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO mixture of linear polyribonucleotides and circular polyribonucleotides, including various other components of the linear polyribonucleotides, linear precursor polyribonucleotide, and circular polyribonucleotides; various dsRNAs contained in the linear polyribonucleotides; various reagents and components thereof that bind to the dsRNAs; and various steps employed in the method, and are applicable to this aspect of the invention relating to the linear precursor polyribonucleotide.In some embodiments, component (CE2) comprises a first annealing region comprising from 8 to 50 (e.g., from 10 to 30, 10 to 20, or 10 to 15; e.g., 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides, and component (CE1) comprises a second annealing region comprising from 8 to 50 (e.g., from 10 to 30, 10 to 20, or 10 to 15; e.g., 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides. In some embodiments, the first annealing region comprises from 10 to 30 ribonucleotides, from 10 to 20 ribonucleotides, or from 10 to 15 ribonucleotides; and the second annealing region comprises from 10 to 30 ribonucleotides, from 10 to 20 ribonucleotides, or from 10 to 15 ribonucleotides. The first annealing region and the second annealing region have from 80% to 100% (e.g., from 85% to 100%, from 90% to 100%, such as 80%, 85%, 90%, 95%, 97%, 99%, or 100%) complementarity; or alternatively, the first annealing region and the second annealing region comprises from zero to 10 (e.g., 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10) mismatched base pair. In some embodiments, the first annealing region and the second annealing region have 90% to 100% complementarity. In one embodiment, the first annealing region and the second annealing region are 100% complementary. In some embodiments, the first annealing region and the second annealing region comprise zero or one mismatched base pair.In some embodiments, each of components (DS2) and (DS1) comprises a same or different dsRNA.In some embodiments, component (DS2) is at the utmost 5’ terminus of the linear polyribonucleotide; and / or component (DS1) is at the utmost 3’ terminus of the linear polyribonucleotide. That is, the components (DS2) and / or (DS1) containing the dsRNAs may be at the very terminal end of the linear polyribonucleotide, and the linear polyribonucleotide does not contain further component at a terminal end beyond the components (DS2) and / or (DS1).Alternatively, the linear polyribonucleotide may contain further component(s) at the 5’- or 3’-terminal end beyond the components (DS2) and / or (DS1). In some embodiments, the linear polyribonucleotide further comprises one or more ribonucleotides between (DS2) and the 5’ terminus of the linear polyribonucleotide; and / or one or more ribonucleotides between (DS1) and the 3’ terminus of the linear polyribonucleotide.In some embodiments, any types of dsRNA having a duplex region of various lengths can be used here. In some embodiments, the dsRNA is a long dsRNA as defined herein having a length of 51 -600 nucleotides.9LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO In some embodiments, the dsRNA of components (DS2) and / or (DS1) is a dsRNA hairpin. In some embodiments, the dsRNAs of components (DS2) and (DS1) are all dsRNA hairpins.In some embodiments, the dsRNA of at least one of components (DS2) and (DS1) have a multi-dsRNA hairpin structure. In some embodiments, the dsRNA of component (DS2) has a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNA of component (DS1) has a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNAs of both components (DS2) and (DS1) have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, in any of the multi-dsRNA hairpin structure discussed above, each dsRNA hairpin independently has a stem region of 30-60 (e.g., 30-50, such as 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) base pairs.In some embodiments, the dsRNA hairpin has a stem region of at least 5 base pairs, at least 10 base pairs, at least 15 base pairs, at least 20 base pairs, at least 25 base pairs, at least 30 base pairs, at least 35 base pairs, or at least 40 base pairs, at least 50 base pairs, at least 60 base pairs, at least 70 base pairs, at least 80 base pairs, at least 90 base pairs, or at least 100 base pairs in length; and / or up to 100 base pairs, up to 200 base pairs, up to 300 base pairs, up to 400 base pairs, up to 500 base pairs, up to 600 base pairs, up to 700 base pairs, up to 800 base pairs, up to 900 base pairs, or up to 1000 base pairs. The loop region of the dsRNA hairpin can be any length. In some embodiments, the dsRNA hairpin has a loop region of at least 1, at least 2, at least 3, or at least 4 nucleotides in length. In one embodiment, the dsRNA hairpin has a loop region of 4 nucleotides in length.In some embodiments, the dsRNA hairpin has at least 20 or at least 30 base pairs in length; and / or a loop region of at least 2 or at least 3 nucleotides in length. In some embodiments, the dsRNA hairpin has a stem region of at least 30, at least 35, at least 40, at least 45, or at least 50 base pairs in length; and / or a loop region of at least 4 nucleotides in length.In some embodiments, component (CE1) comprises a 5’ self-splicing intron fragment and component (CE2) comprises a 3’ self-splicing intron fragment. In some embodiments, the 5’ selfsplicing intron fragment and the 3’ self-splicing intron fragment may each be a Group I or Group II self-splicing intron fragment.In some embodiments, the polyribonucleotide cargo of (P) comprises an expression sequence, a non-coding sequence, or an expression sequence and a noncoding sequence. In some embodiments, the polyribonucleotide cargo of (P) comprises an expression sequence encoding one or more polypeptides (e.g., a peptide that has a biological effect on a subject).In some embodiments, the polyribonucleotide cargo of (P) comprises one or more openreading frames (ORF). The ORF may encode a polypeptide. In some embodiments, (P) comprises one or more ORFs. Each of the ORFs may encode a polypeptide. When (P) comprises more than one 10LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO ORF, each ORF may encode a same polypeptide, or a polypeptide different than that encoded in the other ORF(s).In some embodiments, the polyribonucleotide cargo of (P) comprises one or more internal ribosome entry site (IRES) (e.g., an IRES). In some embodiments, the IRES is operably linked to an expression sequence encoding a polypeptide. In some embodiments, the IRES is operably linked to an ORF. In some embodiments, the IRES is operably linked to an ORF that encodes a polypeptide. In some embodiments, a second IRES is operably linked to a second ORF that encodes a polypeptide.In some embodiments, the linear polyribonucleotide further comprises at least one spacer region (5 ’-spacer) between (CE2) and (P), and / or at least one spacer region (3 ’-spacer) between (P) and (CE1).In some embodiments, the linear polyribonucleotide further comprises at least one spacer region between (CE1) and DS1, and / or at least one spacer region between (CE2) and DS2.In some embodiments, each spacer region may be at least 5 (e.g., at least 10, at least 15, or at least 20) ribonucleotides in length. For instance, each spacer region may be from 5 to 500 (e.g., 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides in length. In some embodiments, each spacer region may be from 5 to 10 (e.g., 5, 6, 7, 8, 9, or 10) ribonucleotides in length.In some embodiments, each spacer region independently comprises a polyA sequence. In some embodiments, each spacer region independently comprises a polyA-C sequence. In some embodiments, each spacer region independently comprises a polyA-G sequence. In some embodiments, each spacer region independently comprises a polyA-T sequence. In some embodiments, each spacer region independently comprises a random sequence.In one embodiment, the linear polyribonucleotide may have a formula:5’-(DS2)-(CE2)-(5'-spacer)-(IRES)-(ORF)- (3'-spacer)-(CEl)-(DSl)-3’.In some embodiments, component (CE2) further comprises (A)-(B)-(C); and / or component (CE1) further comprises (E)-(F)-(G). In these formulas, component (A) comprises a 3' half of Group I or Group II catalytic intron fragment; component (B) comprises a 3’ splice site; component (C) comprises a 3’ exon fragment; component (E) comprises a 5’ exon fragment; component (F) comprises a 5’ splice site; and component (G) comprises a 5' half of Group I catalytic intron fragment.In some embodiments, component (A) or (C) comprises the first annealing region, and component (E) or (G) comprises the second annealing region. In some embodiments, component (C) comprises the first annealing region and component (E) comprises the second annealing region. In some embodiments, component (A) comprises the first annealing region and component (G) comprises the second annealing region.In some embodiments, the 3’ exon fragment includes a first annealing region comprising from 8 to 50 (e.g., from 10 to 30, 10 to 20, or 10 to 15; e.g., 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47,11LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO 48, 49, or 50) ribonucleotides. In some embodiments, the 3’ exon fragment of the circularization element comprises 8-50, 8-40, or 8-30 (e.g., 8-10, 11-12, 13-15, 16-17, 18-20, 21-24, 25-27, or 27-30) ribonucleotides.In some embodiments, the 5’ exon fragment includes a second annealing region comprising from 8 to 50 (e.g., from 10 to 30, 10 to 20, or 10 to 15; e.g., 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 50) ribonucleotides. In some embodiments, the 5’ exon fragment of the circularization element comprises 8-50, 8-40, or 8-30 (e.g., 8-10, 11-12, 13-15, 16-17, 18-20, 21-24, 25-27, or 27-30) ribonucleotides.In some embodiments, the linear polyribonucleotide is at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1 ,000, at least 2,000, at least 3,000, at least 4,000, or at least 5,000 ribonucleotides in length. In some embodiments, the linear polyribonucleotide has a length of from 50 to 20,000 ribonucleotides, e.g., from 100 to 20,000, from 200 to 20,000, or from 300 to 20,000 ribonucleotides.BRIEF DESCRIPTION OF DRAWINGS FIG. 1 is a schematic drawing showing an exemplary reaction of circularizing a linear precursor polyribonucleotide to form a circular polyribonucleotide.FIG. 2 is a schematic drawing showing an exemplary method of separating a circular polyribonucleotide from a linear polyribonucleotide comprising a dsRNA hairpin on both the 5’ end and the 3’ end of the linear polyribonucleotide. The separation method employs a dsRNA column that binds and removes any uncircularized or linear RNAs that contain one or both of the dsRNA hairpins, generated in an in vitro transcription reaction or the circularization reaction.FIG. 3 is a graph showing the RNA species collected for each sample from the flow-through (FT, the portion not bound to the dsRNA resin) and from after the strip (Strip, the portion bound to the dsRNA resin), based on the DNA constructs designed to generate various RNAs listed in Table 1. The sample labels from the left to the right are CEOOOl-dsRNAlO, CE0001-dsRNA20, CE0001-dsRNA30, CE0001-dsRNA40, CE0001-scrambled40, WT (CE0001), dsRNA, and ssRNA, respectively.FIG. 4 is an image of Urea-PAGE gel run on the samples indicated in FIG. 3 (listed in Table 1), with a chart on the right indicating the lane numbers corresponding to the respective samples.FIGS. 5A-5B are graphs showing the % molecules containing any intron-containing linear RNA (FIG. 5A) and un-spliced linear RNA (FIG. 5B) in the samples initially loaded after IVT reactions (IVT) onto the dsRNA resin, the samples collected from flow-through (Flow-Through), and the samples collected from after the strip (Strip), for each of the RNA constructs CE0001-dsRNA40, CE0001-dsRNA50, and CE0001-dsRNA60, listed in Table 1 A.FIGS. 6A-6B are chromatograms generated by anion-exchange HPLC (AEX-HPLC) analysis 12LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO of components of different samples. FIG. 6A depicts different RNA species (i.e., polyribonucleotides containing introns, linear polyribonucleotides, or circular polyribonucleotides) in the sample initially loaded (Load) onto the dsRNA resin and the sample collected from flow-through (FT), for the WT (CE0001) constructs (listed in Table 1). FIG. 6B depicts different RNA species in the sample initially loaded (Load) onto the dsRNA resin, the sample collected from flow-through (FT), and the sample collected from after the strip (Strip), for the CE0001-dsRNA40 constructs (listed in Table 1).FIGS. 7A-7D are graphs showing the RNA species collected from the FT and from after the Strip, based on the DNA constructs designed to generate various RNAs listed in Table 3, varying the salt concentration in the buffer composition as 0.75M, IM, or 1.25M NaCl, respectively. FIG. 7A shows the FT or Strip samples from CE0001-dsRNA40 or from WT (CE0001) constructs encoding a bicistronic circular polyribonucleotide (ORF1 / ORF2). FIG. 7B shows the FT or Strip samples from CE0001-dsRNA40, from CE0001-scrambled40, or from WT (CE0062) constructs encoding a monocistronic circular polyribonucleotide (ORF3). FIG. 7C shows the FT or Strip samples from CE0001-dsRNA40 or from WT (CE0001) constructs encoding a monocistronic circular polyribonucleotide (ORF4). FIG. 7D shows the FT or Strip samples from dsRNA and from ssRNA (the control constructs).FIG. 8 is a graph showing the RNA species collected from the FT and Strip, based on the DNA constructs designed to generate various RNAs listed in Table 4. From the left to the right, the bars show the FT and Strip from CE0062-dsRNA40 and WT (CE0062) constructs encoding the bicistronic ORF1 / ORF2 (ORF1 / 2); the FT and Strip from CE0062-dsRNA40 and WT (CE0062) constructs encoding the monocistronic ORF4 (ORF4); and the FT and Strip from CE0062-dsRNA40, WT (CE0062), CE0001-dsRNA40, and WT (CE0001) constructs encoding the monocistronic ORF5 (ORF5).FIG. 9 shows a chart listing the RNA constructs used for Example 6, and corresponding diagrams for each of the RNA construct listed in the chart, illustrating the dsRNA hairpin extension on the 5’CE and 3’CE at the 5’ and 3’ ends for each RNA construct.FIG. 10 shows different RNA species in the sample initially loaded (Input) onto the dsRNA resin, the sample collected from flow-through (Flow through), and the sample collected from after the strip (Strip), generated by AEX-HPLC analysis, for a representative RNA construct built using 5’CE and 3’CE each containing a multi-dsRNA hairpin structure.FIGS. 11A-11B are graphs showing the % molecules containing 5’CE junction (FIG. 11 A) and 3’CE junction (FIG. 1 IB) in the samples initially loaded after IVT reactions (IVT) onto the dsRNA resin, the samples collected from flow-through (Flow-through), and the samples collected from after the strip (Strip), for certain RNA constructs (listed in FIG. 9 and Tables 5A-5B).FIGS. 12A-12B are graphs showing the fraction of intron-containing linear RNA in the samples initially loaded (Input) onto the dsRNA resin, the samples collected from flow-through (FT), and the samples collected from after the strip (Strip), varying the salt concentration in the buffer 13LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO composition as 1 M or 1.2 M NaCl, for certain RNA constructs (listed in FIG. 9 and Tables 5A-5B). FIG. 12A shows the fraction of E2-intron-containing linear RNA in the samples and El-intron-containing linear RNA in the samples, respectively. FIG. 12B shows the fraction of 5’ introncontaining linear RNA in the samples and 3’ intron-containing linear RNA in the samples, respectively. For each RNA construct in the figure, the bar graph, from left to right, indicates Input, FT (1 M NaCl), Strip (1 M NaCl), FT (1.2 M NaCl), and Strip (1.2 M NaCl).FIGS. 13A-13B are graphs showing the results of MDM assay with 25 fmol RNA in the samples initially loaded after IVT reactions (IVT) onto the dsRNA resin and the samples collected from flow-through (FT), for the RNA constructs listed in Table 8. FIG. 13A shows the levels of IP- 10 (Interferon-gamma-induced protein 10) produced in the samples. FIG. 13B shows the cell viability in the samples, normalized against the untransfected sample.DETAILED DESCRIPTIONDefinitionsTo facilitate the understanding of this disclosure, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the disclosure. Terms such as “a,” “an,” and “the” are not intended to refer to only a singular entity but include the general class of which a specific example may be used for illustration. The term “or” is used to mean “and / or” unless explicitly indicated to refer to alternatives only or the alternative are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or.” The terminology herein is used to describe specific embodiments, but their usage is not to be taken as limiting, except as outlined in the claims.As used herein, any values provided in a range of values include both the upper and lower bounds, and any values contained within the upper and lower bounds.As used herein, the term “about” refers to a value that is within ± 10% of a recited value. As used herein, the term “carrier” is a compound, composition, reagent, or molecule that facilitates the transport or delivery of a composition (e.g., a circular polyribonucleotide) into a cell by a covalent modification of the circular polyribonucleotide, via a partially or completely encapsulating agent, or a combination thereof. Non-limiting examples of carriers include carbohydrate carriers (e.g., an anhydride-modified phytoglycogen or glycogen-type material), nanoparticles (e.g., a nanoparticle that encapsulates or is covalently linked binds to the circular polyribonucleotide), liposomes, fusosomes, ex vivo differentiated reticulocytes, exosomes, protein carriers (e.g., a protein covalently linked to the circular polyribonucleotide), or cationic carriers (e.g., a cationic lipopolymer or transfection reagent).As used herein, the terms “circular polyribonucleotide,” “circular RNA,” and “circRNA” are used interchangeably and mean a polyribonucleotide molecule that has a structure having no free ends (i.e., no free 3’ or 5’ ends), for example a polyribonucleotide molecule that forms a circular or end- 14LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO less structure through covalent or non-covalent bonds. The circular polyribonucleotide may be, e.g., a covalently closed polyribonucleotide.As used herein, the terms “circularization element” refers to an element designed to be contained in a linear polyribonucleotide or linear precursor polyribonucleotide that can enable the circularization reaction of the linear polyribonucleotide or linear precursor polyribonucleotide to form a circular polyribonucleotide via a 5’ -3’ linkage, depending on the type of the circularization reaction desired. For instance, for a splicing reaction (e.g., a self-splicing reaction), the linear polyribonucleotide or linear precursor polyribonucleotide may contain a circularization element at the 5’ end (5’ CE) and a circularization element at the 3’ end (3’ CE), each containing a splicing ribozyme (e.g., a self-splicing ribozyme).As used herein, the terms “disease,” “disorder,” and “condition” each refer to a state of sub-optimal health, for example, a state that is or would typically be diagnosed or treated by a medical professional.As used herein the term “double-stranded RNA” or “dsRNA” refers to two strands of antiparallel polyribonucleotide sequences held together by complementary base pairing (e.g., two sequences that are in reverse complementary of each other in the region of base pairing), to form a region of substantial duplex structure. The double- stranded structure may be formed by a single self-complementary RNA strand or two complementary RNA strands. RNA duplex formation may be initiated either inside or outside the cell. The two strands can be of identical length or of different lengths provided there is sufficient complementarity between the two strands (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or virtually 100% complementary over the entire length of the duplex region) that a double stranded structure is formed. As used herein, the term “overhang” refers to non-double stranded regions of a dsRNA molecule (i.e., a single stranded RNA). The term “double-stranded RNA” or “dsRNA” intends to cover broadly all types of dsRNA structures having various lengths, such as a long dsRNA, siRNA, miRNA, dsRNA hairpin, or shRNA (short hairpin RNA), etc.The term “dsRNA hairpin” as used herein, refers to an RNA molecule having a stem-loop structure, comprising one or more duplex region (“stem”) formed by the first and second regions of the RNA molecule having complementary sequences, and a loop region joined by the first and second regions, the loop resulting from a lack of base pairing between the nucleotides (or nucleotide analogs) within the loop region. The stem region of the dsRNA hairpin can contain one or more bulges. The term “bulge” refers to a region of unpaired nucleotides within a duplex region. The term “shRNA” refers to short hairpin RNA which is a dsRNA hairpin that typically has a length of 70 nucleotides or shorter.The term “multi-dsRNA hairpin” or “multiple dsRNA hairpin” as used herein, refers to a structure, wherein two or more dsRNA hairpins are operably linked by a linker (e.g., an unstructured polyribonucleotide based linker) or a spacer sequence, forming a structure of dsRNA hairpin having 15LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO multiple stems and multiple loops. The multi-dsRNA hairpin may be a series of dsRNA hairpins operably linked by linker(s) or spacer sequence(s) sequentially. The connection(s) of the multiple dsRNA hairpins may be continuous, i.e., one end of the continuous strand of one dsRNA hairpin is connected to one end of the continuous strand of the adjacent dsRNA hairpin, and so on.As used herein, the term “duplex” or “duplex region” of the dsRNA refers to a double helical structure formed by the interaction of two anti-parallel polyribonucleotide sequences mainly through complementary base pairing (e.g., two polyribonucleotide sequences that are in reverse complementary of each other in the region of base pairing). A duplex region may be formed between anti-parallel polyribonucleotide sequences of two separate strands, or from a single polyribonucleotide sequence strand that is folded (e.g., via a hairpin) to provide complementary antiparallel sequences that base pair together.As used herein, the term “expression sequence” is a nucleic acid sequence that encodes a product, e.g., a peptide or polypeptide. An exemplary expression sequence that codes for a peptide or polypeptide can include a plurality of nucleotide triads, each of which can code for an amino acid and is termed as a “codon.”As used herein, the term “flow through” refers to a fraction containing an analyte material (e.g., a population of circRNA) that passes through a reagent (e.g., a column or a resin containing the reagent) during a purification process, i.e., the analyte is not bound to the reagent (e.g., the column or the resin containing the reagent). More specifically, as described herein, a flow-through (FT) refers to a fraction of the RNA sample containing circRNA that passes through the dsRNA-binding column or resin used during the purification process by gravity.By “heterologous” is meant to occur in a context other than in the naturally occurring (native) context. A “heterologous” polynucleotide sequence indicates that the polynucleotide sequence is being used in a way other than what is found in that sequence’ s native genome. For example, a “heterologous promoter” is used to drive transcription of a sequence that is not one that is natively transcribed by that promoter; thus, a “heterologous promoter” sequence is often included in an expression construct by means of recombinant nucleic acid techniques. The term “heterologous” is also used to refer to a given sequence that is placed in a non-naturally occurring relationship to another sequence; for example, a heterologous coding or non-coding nucleotide sequence is commonly inserted into a genome by genomic transformation techniques, resulting in a genetically modified or recombinant genome.As used herein, the term “intron fragment” refers to a portion of an intron, where a first intron fragment and a second intron fragment together form an intron, such as a catalytic intron. An intron fragment may be a 5’ portion of an intron (e.g., a 5’ portion of a catalytic intron) or a 3’ portion of an intron (e.g., a 3’ portion of a catalytic intron), such that the 5’ intron fragment and the 3’ intron fragment, together, form a functional intron, such as a functional intron capable of catalytic selfsplicing. The term intron fragment is meant to refer to an intron split into two portions. The term 16LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO intron fragment is not meant to state, imply, or suggest that the two portion or halves are equal in length. The term intron fragment is used synonymously with the term “split-intron” or “half-intron.” As used herein, the terms “linear polyribonucleotide,” “linear precursor polyribonucleotide,” “linear RNA,” and “linear polyribonucleotide molecule” are used interchangeably and refer to a polyribonucleotide having a 5’ end and a 3’ end. One or both of the 5’ and 3’ ends may be free ends or joined to another moiety. A linear polyribonucleotide may be a polyribonucleotide that has not undergone circularization (e.g., is precircularized) and can be used as a starting material for circularization through, for example, chemical, enzymatic, or ribozyme- or splicing -catalyzed circularization methods.As used herein, the phrase “mixed population of polyribonucleotides” refers to a heterogenous population of polyribonucleotides. Such a heterogenous population of polyribonucleotides contains circRNA, linear RNA, and, optionally, one or more impurities or byproducts (e.g., one or more impurities or by-products described herein).As used herein, the term “modified oligonucleotide” means an oligonucleotide containing a nucleotide with at least one modification to the sugar, nucleobase, or intemucleotide linkage.As used herein, the term “modified ribonucleotide” means a ribonucleotide containing a nucleoside with at least one modification to the sugar, nucleobase, or intemucleoside linkage.As used herein, the term “naked delivery” is a formulation for delivery to a cell without the aid of a carrier and without covalent modification to a moiety that aids in delivery to a cell. A naked delivery formulation is free from any transfection reagents, cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. For example, naked delivery formulation of a circular polyribonucleotide is a formulation that includes a circular polyribonucleotide without covalent modification and is free from a carrier.As used herein, the terms “nicked RNA” or “nicked linear polyribonucleotide” or “nicked linear polyribonucleotide molecule” are used interchangeably and mean a polyribonucleotide molecule having a 5’ and 3’ end that results from nicking or degradation of a circular RNA. A “nicked circular RNA” means a circular RNA that has been nicked.As used herein, the elements of a nucleic acid are “operably connected” or “operably linked” if they are positioned in the vector such that they can be transcribed to form a linear polyribonucleotide that can then be circularized into a circular polyribonucleotide using the methods provided herein.The term “pharmaceutical composition” is intended to also disclose that the circular polyribonucleotide (or linear polyribonucleotide) included within a pharmaceutical composition can be used for the treatment of the human or animal body by therapy.The term “polynucleotide” as used herein means a molecule including one or more nucleic acid subunits, or nucleotides, and can be used interchangeably with “nucleic acid” or “oligonucleotide.” A polynucleotide can include one or more nucleotides selected from adenosine 17LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO (A), cytosine (C), guanine (G), thymine (T) and uracil (U), or variants thereof. A nucleotide can include a nucleoside and at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphate (POs) groups. A nucleotide can include a nucleobase, a five-carbon sugar (either ribose or deoxyribose), and one or more phosphate groups. Ribonucleotides are nucleotides in which the sugar is ribose.“Polyribonucleotides,” “ribonucleic acids,” or “RNA” can refer to macromolecules that include multiple ribonucleotides that are polymerized by way of phosphodiester bonds. Deoxyribonucleotides are nucleotides in which the sugar is deoxyribose.As used herein, the term “polyribonucleotide cargo” herein includes any sequence including at least one polyribonucleotide. In some embodiments, the polyribonucleotide cargo includes one or multiple expression (or coding) sequences, wherein each expression (or coding) sequence encodes a polypeptide. In some embodiments, the polyribonucleotide cargo includes one or multiple noncoding sequences, such as a polyribonucleotide having regulatory or catalytic functions. In some embodiments, the polyribonucleotide cargo includes a combination of expression and noncoding sequences. In some embodiments, the polyribonucleotide cargo includes one or more polyribonucleotide sequences described herein, such as one or multiple regulatory elements, internal ribosomal entry site (IRES) elements, or spacer sequences.As used interchangeably herein, the terms “poly A” and “polyA sequence” refer to an untranslated, contiguous region of a nucleic acid molecule of at least 5 nucleotides in length and consisting of adenosine residues. In some embodiments, a polyA sequence is at least 10, at least 15, at least 20, at least 30, at least 40, or at least 50 nucleotides in length. In some embodiments, a polyA sequence is located 3’ to (e.g., downstream of) an open reading frame (e.g., an open reading frame encoding a polypeptide), and the polyA sequence is 3’ to a termination element (e.g., a Stop codon) such that the polyA is not translated. In some embodiments, a polyA sequence is located 3’ to a termination element and a 3’ untranslated region.As used herein, the term “polypeptide” refers to a polymer of amino acid residues (natural or unnatural) linked together most often by peptide bonds, and can include proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides can include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. A polypeptide can be a single molecule or a multi- molecular complex such as a dimer, trimer, or tetramer. They can also include single chain or multichain polypeptides such as antibodies or insulin and can be associated or linked. Most commonly disulfide linkages are found in multichain polypeptides. The term can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.As used herein, the terms “purify,” “purifying,” and “purification” refer to one or more steps or processes of removing impurities or by-products (e.g., linear RNA) from a sample containing a mixture of circular RNA and linear RNA, among other substances, to produce a composition18LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO containing an enriched population of circular RNA with a reduced level of an impurity or by-product (e.g., linear RNA) as compared to the original mixture or in which the linear RNA or substances have been reduced by 40% or more by mass (e.g., 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, or 99% or more) relative to a starting mixture.As used herein, the terms “pure” and “purity” refer to the extent to which an analyte (e.g., circular RNA) has been isolated and is free of other components. In the context of nucleic acids (e.g., polyribonucleotides), purity of an isolated nucleic acid (e.g., circular RNA) can be expressed with regard to the population of nucleic acids that is free of any contaminants, impurities, or by-products (e.g., linear RNA and other substances). For example, purity of a population of circular RNA indicates how much of the population is circular RNA by total mass of the isolated material, which may be determined using, e.g., pure circular RNA as a reference. A “pure” population of circRNA can be greater than 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or up to 70% (w / w) circRNA in the total population of polyribonucleotides. A “substantially pure” population of circRNA can be substantially free of impurities or by-products (e.g., linear RNA), e.g., greater than 70%, 75%, 80%, 85%, 90%, 95%, or >99% (w / w) circRNA in the total population of polyribonucleotides. In some embodiments, the level of impurities or by-products (e.g., linear RNA) in the total population of polyribonucleotide is no more than about 20%, 15%, 12%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% (w / w). Purity can be determined by detecting a level of a specific analyte (e.g., circRNA) using e.g., spectrophotometry (e.g., NanoDrop™ spectrophotometer), or other technique suitable for measuring purity of a population of nucleic acids and calculating a percentage of the analyte (w / w) relative to the total nucleic acid content (e.g., as determined by an assay known in the art).As used herein, a “regulatory element” is a moiety, such as a nucleic acid sequence, that modifies expression of an expression sequence within the circular or linear polyribonucleotide.As used herein, the term “sequence identity” is determined by alignment of two peptide or two nucleotide sequences using a global or local alignment algorithm. Sequences are referred to as “substantially identical” or “essentially similar” when they share at least a certain minimal percentage of sequence identity when optimally aligned (e.g., when aligned by programs such as GAP or BESTFIT using default parameters). Sequence alignments and scores for percentage sequence identity are determined, e.g., using computer programs. Alternatively, or additionally, percent identity is determined by searching against databases, e.g., using algorithms such as FASTA, BLAST, etc. Sequence identity refers to the sequence identity over the entire length of the sequence.As used herein, a “spacer” refers to any contiguous nucleotide sequence (e.g., of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions.As used herein, the term “subject” refers to an organism, such as a human, an animal, plant, or microbe.As used herein, the phrase “substantially free of one or more impurities or by-products” refers 19LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO to a property of a sample, such as a sample containing an enriched population of circular RNA, that is free of one or more impurities or by-products (e.g., one or more impurities or by-products disclosed herein) or contains a minimal amount of the one or more impurities or by-products. A minimal amount of the one or more impurities or by-products may be no more than 20% (w / w) (e.g., no more than 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% (w / w), or less). In some embodiments, the sample or the enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or byproducts are present in an amount that is less than 15% (w / w), less than 10% (w / w), or less than 5% (w / w). In some embodiments, the sample or the enriched population of circular RNA is substantially free of one or more impurities or by-products if the one or more impurities or by-products are present in an amount that is less than 1% (e.g., no more than 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1% (w / w), or less).As used herein, a “termination element” is a moiety, such as a nucleic acid sequence, that terminates translation of the expression sequence in the circular or linear polyribonucleotide.As used herein, the term “total ribonucleotide molecules” means the total amount of any ribonucleotide molecules, including linear polyribonucleotide molecules, circular polyribonucleotide molecules, monomeric ribonucleotides, other polyribonucleotide molecules, fragments thereof, and modified variations thereof, as measured by total mass of the ribonucleotide molecules.As used herein, the term “translation initiation sequence” is a nucleic acid sequence that initiates translation of an expression sequence in the circular or linear polyribonucleotide.As used herein, the terms “treat” and “treating” refer to a prophylactic or therapeutic treatment of a disease or disorder (e.g., an infectious disease, a cancer, a toxicity, or an allergic reaction) in a subject. The effect of treatment can include reversing, alleviating, reducing severity of, curing, inhibiting the progression of, reducing the likelihood of recurrence of the disease or one or more symptoms or manifestations of the disease or disorder, stabilizing (i.e., not worsening) the state of the disease or disorder, or preventing the spread of the disease or disorder as compared to the state or the condition of the disease or disorder in the absence of the therapeutic treatment.As used herein, a “vector” means a piece of DNA, that is synthesized (e.g., using PCR), or that is taken from a virus, plasmid, or cell of a higher organism into which a foreign DNA fragment can be or has been inserted for cloning or expression purposes. In some embodiments, a vector can be stably maintained in an organism. A vector can include, for example, an origin of replication, a selectable marker or reporter gene, such as antibiotic resistance or GFP, or a multiple cloning site (MCS).As used herein, the term “yield” refers to the relative amount of an analyte (e.g., a population of circular polyribonucleotides) obtained after a purification step or process as compared to the amount of analyte in the starting material (e.g., a mixed population of polyribonucleotides, such as, e.g., circular, and linear polyribonucleotides) (w / w). The yield may be expressed as a percentage. In 20LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO some embodiments, the amount of analyte (e.g., circular polyribonucleotides) in the starting material and analyte obtained after the purification step can be measured using an assay (e.g., a spectrophotometry). The methods of the disclosure can be used to produce a yield of an enriched population of circular polyribonucleotides of about 20% (w / w) or greater relative to the amount present in the starting material, e.g., mixed population of polyribonucleotides. For example, the methods can be used to produce a yield of purified circular polyribonucleotides of about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 65%, 70%, 75%, 80%, 85%, or 90% (w / w) or greater.This disclosure describes novel methods for separating, e.g., purifying, polyribonucleotides. Polyribonucleotides, such as linear or circular polyribonucleotides, may be used for a variety of engineering or therapeutic purposes. However, when polyribonucleotides are generated via certain biological reactions, various impurities, byproducts, or incomplete products may be present. This disclosure features methods useful to reduce or remove these impurities, byproducts, or incomplete products from a sample to produce compositions with a desired polyribonucleotide composition, amount, and / or purity, or a population containing a plurality of polyribonucleotides with a desired polyribonucleotide composition, amount, and / or purity.In certain embodiments, the methods are useful for purifying a polyribonucleotide that has undergone a splicing reaction, to separate spliced polyribonucleotides from unspliced polyribonucleotides or to separate unspliced polyribonucleotides from spliced polyribonucleotides. In some embodiments, the methods may be used to separate circular polyribonucleotides (e.g., that have been spliced) from linear polyribonucleotides or to separate linear polyribonucleotides from circular polyribonucleotides. Such purified compositions containing a desired polyribonucleotide may be useful for various downstream applications, such as delivering a polynucleotide cargo (e.g., encoding a gene or protein) to a target cell.Details on related polyribonucleotides such as linear polyribonucleotides and circular polyribonucleotides; the constructs of circular polyribonucleotides and their preparation methods; circularization reactions and methods from linear polyribonucleotides to form circular polyribonucleotides; polyribonucleotide cargos that include any expression (coding) sequence and non-coding sequences, and various elements constituting the sequences; and formulations and pharmaceutical compositions containing a population of polyribonucleotides produced by the methods as described herein may be found in WO 2024 / 097664, WO 2023 / 122745, WO 2023 / 069397, WO 2023 / 044006, and WO 2019 / 118919; all of which are incorporated herein by reference in their entirety.MethodsIn one aspect, provided is a method of separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear polyribonucleotides and circular21LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO polyribonucleotides. The methods described herein include separating a linear polyribonucleotide having one or more dsRNA that are bound by a reagent that specifically bind to the dsRNAs from a plurality of polyribonucleotides that do not contain the same dsRNAs under the same conditions. The method comprises:contacting a sample, comprising the plurality of polyribonucleotides that comprises one or more linear polyribonucleotides, each comprising one or more dsRNAs, with a reagent that binds to the dsRNAs; andseparating the linear polyribonucleotides comprising the dsRNAs bound to the reagent from the plurality of polyribonucleotides. Alternatively, the method comprises:(a) providing a sample comprising the plurality of polyribonucleotides, wherein the plurality of polyribonucleotides comprises one or more linear polyribonucleotides, each comprising one or more dsRNAs;(b) contacting the sample with a reagent that binds to the dsRNAs; and(c) separating the linear polyribonucleotides comprising the dsRNAs bound to the reagent from the plurality of polyribonucleotides. In some embodiments, the step of separating comprises collecting the polyribonucleotides in the sample that are not bound by the reagent. In some embodiments, the polyribonucleotides in the sample that are not bound by the reagent comprises the circular polyribonucleotides. The method thus further includes collecting the circular polyribonucleotides that are not bound to the reagent, thereby separating the circular polyribonucleotides from the plurality of polyribonucleotides in the sample.In some embodiments, linear polyribonucleotides that lack dsRNA regions bound by the reagent are not retained during the separating step and may be recovered together with the circular polyribonucleotides.In some embodiments, a linear polyribonucleotide is designed to contain one or more circularization elements (e.g., intron fragment) at one or both ends; one or more double-stranded RNAs (dsRNAs, such as dsRNA hairpins) are introduced to the linear polyribonucleotides adjacent but external to the circularization elements. The linear polyribonucleotide is circularized via the circularization reaction by the circularization elements, cleaving off any elements external to the circularization elements (including the dsRNAs), producing the circular polyribonucleotides that do not contain the introduced dsRNAs (such as dsRNA hairpins introduced to the linear polyribonucleotide or linear precursor polyribonucleotides, herein referred to as the dsRNA exogenous to the circular polyribonucleotides). The methods thus can employ a dsRNA-binding column (such as a dsRNA-binding resin, operating in a flow-through mode with aqueous buffers) to bind and remove any linear polyribonucleotides or linear precursor polyribonucleotides that contain dsRNAs (such as dsRNA hairpins), thereby separating (e.g., purifying) the circular polyribonucleotides that do not contain the introduced (or exogenous) dsRNAs from the linear polyribonucleotides or linear precursor polyribonucleotides.22LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO The dsRNA-binding reagent (e.g., the dsRNA-binding column or resin) described herein is not limited to a particular dsRNA-binding ligand or molecular class. In some embodiments, the dsRNA-binding reagent comprises a protein that specifically binds double-stranded RNA. In other embodiments, the dsRNA-binding reagent comprises a non-protein reagent, including a small molecule, dye, nucleic acid-based ligand or binder, peptide nucleic acid (PNA) or modified PNA, RNA aptamer, polysaccharide, or solid-phase matrix exhibiting affinity for dsRNA.In some embodiments, the dsRNA-binding reagent comprises a cellulose-based material, such as cellulose fibers or beads, which bind dsRNA under aqueous conditions. In other embodiments, the dsRNA-binding reagent comprises a chromatographic medium, including resins or monolithic supports functionalized to bind dsRNA, which may be operated in a flow-through mode to retain linear polyribonucleotides or linear precursor polyribonucleotides comprising dsRNA while allowing circular polyribonucleotides to pass through.The selection of a dsRNA-binding reagent and associated operating conditions may be guided by factors such as binding affinity for dsRNA, compatibility with the buffer conditions described herein, and suitability for the desired purification scale. Optimization of such parameters is within the skill of the art and does not require undue experimentation.In some embodiments, the methods include producing the linear polyribonucleotide comprising the one or more dsRNAs, by transcription (e.g., in vitro transcription) from a deoxyribonucleotide encoding the linear polyribonucleotide comprising the dsRNAs. The method further comprises circularizing a linear polyribonucleotide precursor to form the circular polyribonucleotide.The linear precursor polyribonucleotide may comprise a 5’ circularization element (CE2) and a 3’ circularization element (CE1). For instance, the circular polyribonucleotide may be produced by a circularization reaction of (CE1) and (CE2). In some embodiments, (CE1) comprises a 5’ selfsplicing intron fragment and (CE2) comprises a 3’ self-splicing intron fragment. For instance, the circular polyribonucleotide may be produced by self-splicing of the linear precursor polyribonucleotide. The 5’ self-splicing intron fragment and the 3’ self-splicing intron fragment may each be a Group I or Group II self-splicing intron fragment. In some embodiments, the linear precursor polyribonucleotide comprises one or more dsRNAs, at least one of which is adjacent and external to one of the circularization elements, (CE1) or (CE2). In some embodiments, the linear precursor polyribonucleotide comprises one or more dsRNAs, at least one of which is adjacent and external to one of the 5’ and 3’ self-splicing intron fragments.In some embodiments, the linear precursor polyribonucleotide comprises at least one dsRNAs, wherein at least one dsRNA is at the 5’ end of the polyribonucleotide and is adjacent and external to (CE2) or at least one dsRNA is at the 3’ end of the polyribonucleotide and is adjacent and external to (CE1). In some embodiments, the linear precursor polyribonucleotide comprises at least two dsRNAs: at least one dsRNA is at the 5’ end of the polyribonucleotide and is adjacent and 23LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO external to (CE2); and at least one dsRNA is at the 3’ end of the polyribonucleotide and is adjacent and external to (CE1). In some embodiments, the linear precursor polyribonucleotide comprises at least two dsRNAs: at least one dsRNA is at the 5’ end of the polyribonucleotide and is adjacent and external to the 5’ self-splicing intron fragment; and at least one dsRNA is at the 3’ end of the polyribonucleotide and is adjacent and external to the 3’ self-splicing intron fragment. In some embodiments, at least one of these dsRNAs is a dsRNA hairpin. In some embodiments, all of the dsRNAs are dsRNA hairpins. In some embodiments, the dsRNAs of at least one end have a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at the 5’ end have a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at the 3’ end have a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at both ends have a multi-dsRNA hairpin structure.In some embodiments, the method comprises introducing one or more deoxyribonucleotides encoding one or more dsRNAs into the 5’ and 3’ ends of the linear RNA (e.g., adjacent and external to the 5’ and 3’ circularization elements of the linear RNA, respectively); transcribing (e.g., via in vitro transcription) from the deoxyribonucleotides encoding the linear RNA comprising the dsRNAs to form the linear RNA; and circularizing the linear RNA to form the circular polyribonucleotide. The remnant intron parts are cleaved off from the circular polyribonucleotide during the circularization reaction. Either of the dsRNA regions are also cleaved off from the circular polyribonucleotide during the circularization reaction. See FIG. 2. When the polyribonucleotide sample is contacted with a reagent that binds to the dsRNAs (e.g., a dsRNA-binding column or resin containing the reagent), the reagent binds and removes any uncircularized RNA that contains one or both of the dsRNA regions (e.g., the linear impurities and the remnant intron parts containing one or both of the dsRNA regions), as well as any dsRNA impurities generated by the transcription.In some embodiments, the method comprises providing a deoxyribonucleotide encoding the linear polyribonucleotide comprising the dsRNAs; transcribing the deoxyribonucleotide in a cell-free system to produce the linear polyribonucleotide precursor; optionally purifying the splicingcompatible linear polyribonucleotide; and self-splicing the linear polyribonucleotide under conditions suitable for splicing of the 3’ and 5’ splice sites of the linear polyribonucleotide, thereby producing a circular polyribonucleotide.In some embodiments, the transcription of the linear polyribonucleotide occurs under conditions suitable for circularizing a linear polyribonucleotide precursor to form the circular polyribonucleotide. Thus, the method comprises providing a deoxyribonucleotide encoding a linear polyribonucleotide comprising the dsRNAs; transcribing the deoxyribonucleotide in a cell-free system to produce the linear polyribonucleotide precursor, wherein the transcribing occurs in a solution under conditions suitable for splicing of the 3’ and 5’ splice sites of the linear polyribonucleotide precursor, thereby producing a circular polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises a 5’ split-intron and a 3’ split-intron (e.g., a self-splicing construct for producing a circular polyribonucleotide). In some embodiments, the linear polyribonucleotide comprises a 5’ annealing 24LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO region and a 3’ annealing region.Suitable conditions for in vitro transcriptions and / or self-splicing may include any conditions (e.g., a solution or a buffer, such as an aqueous buffer or solution) that mimic physiological conditions in one or more respects. In some embodiments, suitable conditions include Mg2+ions or a salt thereof (e.g., MgCh) at 0.1-100 mM (e.g., 1-100, 1-50, 1-20, 5-50, 5-20, or 5-15 mM). In some embodiments, suitable conditions include K+ions or a salt thereof, or Cl" ions or a salt thereof (e.g., KC1) at 1-1000 mM (e.g., 1-500, 1-200, 50-500, 100-500, or 100-300 m ). In some embodiments, suitable conditions include Mn2+ions or a salt thereof (e.g., MnCh) at 0.1-100 mM (e.g., 0.1-50, 0.1-20, 0.1-10, 0.1-5, 0.1-2, 0.5- 50, 0.5-20, 0.5-15, 0.5-5, 0.5-2, or 0.1-10 mM). In some embodiments, suitable conditions include dithiothreitol (DTT) at 1-1000 pM (e.g., 1-500 pM, 1-200 pM, 50-500 pM, 100-500 pM, 100-300 pM, 0.1-100 mM, 0.1-50 mM, 0.1-20 mM, 0.1-10 mM, 0.1-5 mM, 0.1-2 mM, 0.5-50 mM, 0.5-20 mM, 0.5-15 mM, 0.5-5 mM, 0.5-2 mM, or 0.1-10 mM). In some embodiments, suitable conditions include ribonucleoside triphosphate (NTP) at 0.1-100 mM (e.g., 0.1-50, 0.1-10, 1-100, 1-50, or 1-10 mM). In some embodiments, suitable conditions include a pH of 4 to 10 (e.g., pH of 5 to 9, 6 to 9, or 6.5 to 8.5). In some embodiments, suitable conditions include a temperature of 4 °C to 50°C (e.g., 10 °C to 40°C, 15 °C to 40 °C, 20 °C to 40 °C, or 30 °C to 40 °C).In some embodiments, the circular polyribonucleotide produced by the circularization comprises an expression sequence, a non-coding sequence, or an expression sequence and a noncoding sequence. In some embodiments, the circular polyribonucleotide produced by the circularization comprises an expression sequence encoding one or more polypeptides (e.g., a peptide that has a biological effect on a subject).In some embodiments, the circular polyribonucleotide produced by the circularization comprises an open-reading frame (ORF). The ORF may encode a polypeptide. In some embodiments, the circular polyribonucleotide comprises more than one ORF. Each of the ORFs may encode a polypeptide. When the circular polyribonucleotide comprises more than one ORF, each ORF may encode a same polypeptide, or a polypeptide different than that encoded in the other ORF(s). In some embodiments, a level of expression from the ORF of the circular polyribonucleotide after purification is increased at least 10% (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) relative to a level of expression from the ORF prior to separating.In some embodiments, the circular polyribonucleotide produced by the circularization comprises at least one internal ribosome entry site (IRES) (e.g., an IRES). In some embodiments, the IRES is operably linked to an expression sequence encoding a polypeptide. The ORF(s) (e.g., those encoding a polypeptide) may be operably linked to the IRES.In some embodiments, the circular polyribonucleotides purified and collected by the methods described herein may contain a short dsRNA region having a duplex region of no more than 40 base pairs in length, no more than 30 base pairs in length, no more than 20 base pairs in length, no more than 10 base pairs in length, or no more than 9, 8, 7, 6, 5, 4, or 3 base pairs in length. In some 25LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO embodiments, the circular polyribonucleotides purified and collected by the methods described herein may contain a short dsRNA region having a duplex region of no more than 2 base pairs in length. In some embodiments, the circular polyribonucleotides purified and collected by the methods described herein may contain a dsRNA region having a duplex region of no more than 1 base pair in length.In some embodiments, the circular polyribonucleotides purified and collected by the methods described herein do not contain the introduced (or exogenous) dsRNAs from the linear polyribonucleotides or linear precursor polyribonucleotides.In some embodiments, the linear polyribonucleotide comprising the one or more dsRNAs may be prepared from attaching one or more dsRNAs to a linear polyribonucleotide.In some embodiments, in the linear polyribonucleotide comprising the one or more dsRNAs, each dsRNA is located at a 3’ terminus, a 5’ terminus, or an internal position of the linear polyribonucleotide. In the instances where the linear polyribonucleotide is a linear precursor polyribonucleotide described herein, which contains circularization elements, an internal position refers to any non-terminus position but external to the circularization elements, i.e., any positions between the 5’ terminus and the 5’ circularization element and any position between the 3’ terminus and the 3’ circularization element. In some embodiments, in the linear polyribonucleotide comprising the one or more dsRNAs, each dsRNA is located at a 3’ terminus or at a 5’ terminus of the linear polyribonucleotide.In some embodiments, the linear polyribonucleotide comprises two or more dsRNAs, wherein at least one dsRNA is located at a 3’ terminus of the linear polyribonucleotide, and at least one dsRNA is located at the 5’ terminus of the linear polyribonucleotide. In some embodiments, the linear polyribonucleotide comprises 1-100 dsRNAs (e.g., 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 dsRNAs) at the 3’ terminus of the linear polyribonucleotide, and 1-100 dsRNAs (e.g., 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, or 1-2 dsRNAs) at the 5’ terminus of the linear polyribonucleotide. In some embodiments, the numbers of the dsRNAs at the 3’ terminus and at the 5’ terminus of the linear polyribonucleotide are the same. In some embodiments, the numbers of the dsRNAs at the 5’ terminus and at the 3’ terminus of the linear polyribonucleotide are different.Any types of dsRNA having a duplex region of various lengths can be used here to be encoded onto the linear polyribonucleotide for purifying circular polyribonucleotides. In some embodiments, the dsRNA is a long dsRNA as defined herein having a length of 51-600 nucleotides. In some embodiments, the dsRNA is an siRNA. In some embodiments, the dsRNA is an miRNA.In some embodiments, at least one of the dsRNA is a dsRNA hairpin. In some embodiments, all of the dsRNAs are dsRNA hairpins.In some embodiments, two or more dsRNAs are introduced into the linear polyribonucleotide in series. The two or more dsRNAs may be operably linked by a linker (e.g., an unstructured polyribonucleotide based linker) or spacer sequence. When the dsRNAs in these multiple series 26LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO dsRNAs are dsRNA hairpins, these dsRNA hairpins may also be considered as a unity of a multi-dsRNA hairpin.In some embodiments, the dsRNAs of at least one terminus of the linear polyribonucleotide has a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at the 5’ terminus of the linear polyribonucleotide has a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at the 3’ terminus of the linear polyribonucleotide has a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs at both the 5’ terminus and the 3’ terminus of the linear polyribonucleotide has a multi-dsRNA hairpin structure. In some embodiments, the dsRNAs of at least one terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNAs at the 5’ terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNAs at the 3’ terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, the dsRNAs at both the 5’ terminus and the 3’ terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure, wherein 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence.In some embodiments, the length of the linker or spacer sequence operably linking the two or more dsRNAs (e.g., the two or more dsRNA hairpins within a multi-dsRNA hairpin structure) may be any size. For instance, each of the linker or spacer sequence may independently range from 1-100 nucleotides long, such as 1-50 nucleotides long, 1-40 nucleotides long, 1-30 nucleotides long, 1-20 nucleotides long, 1-10 nucleotides long, or 6-8 nucleotides long. In some embodiments, each of the linker or spacer sequence connecting the two or more dsRNAs (e.g., the two or more dsRNA hairpins within a multi-dsRNA hairpin structure) may independently range from 1-50 nucleotides long (e.g., 5-10 nucleotides long, 10-15 nucleotides long, 15-20 nucleotides long, 20-25 nucleotides long, 25-30 nucleotides long, 30-35 nucleotides long, 35-40 nucleotides long, 40-45 nucleotides long, or 45-50 nucleotides long). In some embodiments, the linker or spacer sequence operably linking the two or more dsRNAs (e.g., the two or more dsRNA hairpins within a multi-dsRNA hairpin structure) is 6-10 (e.g., 6, 7, 8, 9, or 10) nucleotides long. In some embodiments, the linker or spacer sequence operably linking the two or more dsRNAs (e.g., the two or more dsRNA hairpins within a multi-dsRNA hairpin structure) is a polyA sequence, or a random sequence.In some embodiments, the connection(s) of the multiple dsRNA hairpins within the multi-dsRNA hairpin structure is continuous, i.e., one end of the continuous strand of one dsRNA hairpin is connected to one end of the continuous strand of the adjacent dsRNA hairpin.The dsRNA hairpin may each independently have a stem region of at least 5 base pairs (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90,27LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO 95, 100, or more base pairs) in length. In some embodiments, the dsRNA hairpin each independently has a stem region of at least 10 base pairs, at least 15 base pairs, at least 20 base pairs, at least 25 base pairs, at least 30 base pairs, at least 35 base pairs, at least 40 base pairs, at least 50 base pairs, at least 60 base pairs, at least 70 base pairs, at least 80 base pairs, at least 90 base pairs, or at least 100 base pairs in length; and / or up to 100 base pairs, up to 200 base pairs, up to 300 base pairs, up to 400 base pairs, up to 500 base pairs, up to 600 base pairs, up to 700 base pairs, up to 800 base pairs, up to 900 base pairs, or up to 1000 base pairs. In some embodiments, the dsRNA hairpin each independently has a stem region of no more than 100 base pairs, no more than 90 base pairs, no more than 80 base pairs, no more than 70 base pairs, no more than 60 base pairs, no more than 50 base pairs, or no more than 40 base pairs in length.The loop region of the dsRNA hairpin can be any length. For instance, the dsRNA hairpin may each independently have a loop region of at least 1 nucleotide (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides) in length. In some embodiments, the dsRNA hairpin each independently has a loop region of at least 1, at least 2, at least 3, or at least 4 nucleotides in length. In one embodiment, the dsRNA hairpin has a loop region of 4 nucleotides in length.In some embodiments, the dsRNA hairpin each independently has a stem region of at least 20 or at least 30 base pairs in length; and / or a loop region of at least 2 or at least 3 nucleotides in length. In some embodiments, the dsRNA hairpin each independently has a stem region of at least 30, at least 35, at least 40, at least 45, or at least 50 base pairs in length; and / or a loop region of at least 4 nucleotides in length.In some embodiments, the stem region of the dsRNA hairpin can contain one or more bulges, with each bulge containing 1-10 unpaired nucleotides (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 unpaired nucleotides). In one embodiment, the stem region of the dsRNA hairpin contains a bulge of 1-2 unpaired nucleotides.In some embodiments, the dsRNA-binding reagent is a polypeptide, a small molecule, or a nucleic acid. In some embodiments, the reagent that binds to the dsRNAs is contained in a dsRNA-binding column or resin. In some embodiments, the dsRNA-binding column or resin operates in a flow-through mode. In some embodiments, the reagent that binds to the dsRNAs is an affinity chromatography column / resin containing the reagent that selectively binds dsRNA, while allowing other RNA components, such as a single-stranded RNA, a nicked RNA, or a circular RNA to flow through. In some embodiments, the affinity chromatography column / resin for dsRNA-binding may contain one or more of a small molecule based ligand, a polypeptide or protein-based ligand, and a nucleic acid based ligand, as described herein, that demonstrates high affinity for the dsRNA duplex region, and low affinity for an RNA that does not contain a duplex region.In some embodiments, the step of separating comprises collecting the polyribonucleotides in the sample that are not bound by the reagent. In some embodiments, the polyribonucleotides in the 28LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO sample that are not bound by the reagent comprises the circular polyribonucleotides. In some embodiments, the method comprises collecting the flow-through (the polyribonucleotides in the sample that are not bound by the reagent) to produce the purified circular polyribonucleotides.In some embodiments, the reagent that binds to the dsRNAs (e.g., an affinity chromatography column / resin containing the reagent that selectively binds dsRNA, e.g., dsRNA-binding column or resin) has improved selectivity to bind dsRNA under specific salt concentrations and / or specific pH conditions. In some embodiments, the specific salt concentrations and / or specific pH conditions are enabled by using an aqueous buffer. Accordingly the sample comprising the plurality of polyribonucleotides to be purified may be contained (e.g., dissolved / suspended) in aqueous buffers before the step of contacting the sample with the reagent (e.g., an affinity chromatography column / resin containing the reagent that selectively binds dsRNA, e.g., dsRNA-binding column or resin).In some embodiments, the aqueous buffers can comprise a buffer solution of any type known to one skilled in the art suitable for handling polyribonucleotides. Suitable buffer solutions include a Tris buffer, a HEPES (4-(2-Hydroxyethyl)piperazine-l -ethanesulfonic acid) buffer, a borate buffer, an acetate buffer, a succinate buffer, a histidine buffer (e.g., with an aluminum hydroxide adjuvant), a citrate buffer, a phosphate buffered saline (PBS), or a combination thereof. Exemplary buffers are a TE buffer that includes Tris (e.g., Tris-HCl), and EDTA; a TAE buffer that includes Tris, acetate, and EDTA; and a TBE buffer that includes Tris, borate, and EDTA.The buffer solution can be used in any concentration range known to one skilled in the art suitable for handling polyribonucleotides. For instance, the buffer solution may be used in 1-20 mM range.In some embodiments, the aqueous buffers can further comprise a chelating solution of any type known to one skilled in the art suitable for chelating metal ions (e.g., divalent metal ions such as Mg2+and Ca2+). Without being bound by theory, it may be desirable to include a chelating solution in the aqueous buffers to eliminate any free metal ions (e.g., divalent metal ions such as Mg2+and Ca2+) that can cause RNA hydrolysis. Suitable chelating solutions include ethylenediaminetetraacetic acid (EDTA), Ethylene Glycol Tetraacetic Acid (EGTA), Diethylenetriamine Pentaacetic Acid (DTP A), Nitrilotriacetic Acid (NTA) ,or a combination thereof.The salt contained in the aqueous buffers can be any salt known to one skilled in the art suitable to be used in a buffer solution for handling polyribonucleotides. Salts are typically used to maintain the stability of various polyribonucleotides and to control conditions for separation of linear polyribonucleotides from the circular polyribonucleotides. For instance, common physiological salts and / or pharmaceutically acceptable salts are suitable for use in the aqueous buffers. Non-limiting exemplary physiological salts include a sodium, potassium, or magnesium salt of chloride, phosphate, dihydrogen phosphate, etc., such as sodium chloride, potassium chloride, potassium dihydrogen29LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO phosphate, disodium phosphate, magnesium chloride, or combinations thereof. Non-limiting exemplary pharmaceutically acceptable salts include those of the inorganic ions, for example, sodium, potassium, calcium, magnesium ions, etc., with inorganic or organic acids, such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, methanesulfonic acid, p-toluene sulfonic acid, acetic acid, fumaric acid, succinic acid, lactic acid, mandelic acid, malic acid, citric acid, tartaric acid, or maleic acid. In some embodiments, the salts used in the aqueous buffers include, sodium chloride, potassium chloride, magnesium chloride, or magnesium sulfate. Additional salts particularly suitable for used in the aqueous buffer for handling polyribonucleotides also include chaotropic salts (such as guanidine HC1, guanidine thiocyanate, urea, and lithium perchlorate), ammonium acetate, and lithium chloride.The conditions of the aqueous buffers, such as the concentration of the salt and the concentration and pH value in the aqueous buffers, can be controlled to stabilize the polyribonucleotides. The conditions of the aqueous buffers, such as the concentration of the salt and the pH value in the aqueous buffer, can also be adjusted to minimize or eliminate binding of any dsRNA structure or any presence of a dsRNA region naturally occurring within the structure of the circular polyribonucleotides (e.g., referred to herein as the dsRNA endogenous to the circular polyribonucleotides) to the dsRNA-binding column or resin. One skilled in the art knows to adjust a buffer condition (e.g., increase the concentration of a salt in the buffer solution) to minimize or eliminate the binding to a dsRNA-binding column or resin of dsRNA endogenous to the circular polyribonucleotides.Without being bound by theory, the selective binding behavior described herein arises from structural and contextual differences between the engineered dsRNA regions present on linear polyribonucleotides or linear precursor polyribonucleotides and any secondary structure or dsRNA regions that may naturally occur within circular polyribonucleotides. The engineered dsRNA regions are intentionally designed to form extended, accessible double-stranded RNA structures that provide high-affinity binding sites for dsRNA-binding reagents. In contrast, endogenous dsRNA structures within circular polyribonucleotides are typically shorter, less accessible, and embedded within higher-order RNA structure, resulting in reduced binding affinity under the aqueous buffer conditions described herein.Accordingly, by selecting appropriate buffer conditions, such as salt concentration and pH, the methods described herein preferentially promote binding of dsRNA-binding reagents to engineered dsRNA regions on linear polyribonucleotides or linear precursor polyribonucleotides while minimizing or eliminating binding to endogenous dsRNA structures present in circular polyribonucleotides. This selective discrimination enables efficient removal of linear polyribonucleotides or linear precursor polyribonucleotides during purification while allowing circular polyribonucleotides to remain predominantly unbound and to be recovered with high purity.30LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO In some embodiments, linear polyribonucleotide species that remain unbound during separation comprise nicked circular RNA that lacks the dsRNA regions targeted by the dsRNA-binding reagent.The methods described herein employ the reagents that selectively bind to dsRNAs encoded onto the linear polyribonucleotide or linear precursor polyribonucleotide. Adjusting a buffer condition (e.g., by increasing the concentration of the salt in the buffer solution) can minimize or eliminate the binding to a dsRNA-binding column or resin of dsRNAs endogenous to the circular polyribonucleotides, and maximize the binding of the impurities (i.e., linear polyribonucleotides containing the dsRNAs) during the separation / purification of the circular polyribonucleotides.In some embodiments, the aqueous buffers comprise a buffer solution containing a salt at about 0.5M-2M (e.g., 0.5M, 0.7M, 0.75M, 0.8M, 0.85M, 0.9M, 0.95M, 1.0M, 1.05M, 1.10M, 1.15M, 1.20M, 1.25M, 1.30M, 1.4M, 1.5M, 1.6M, 1.7M, 1.75M, 1.8M, 1.9M, or 2.0M), and optionally a chelating solution (e.g., EDTA).In some embodiments, the aqueous buffers comprise a buffer solution (e.g., Tris such as Tris-HC1) containing a salt (e.g., NaCl) that regulates the pH of the aqueous buffers, and optionally a chelating solution (e.g., EDTA). In some embodiments, the buffer solution containing the salt regulates the pH of the aqueous buffers to reach from about 5.0 to about 9.5, for instance, from about 5.5 to about 9.5, from about 6.0 to about 9.5, from about 6.5 to about 9.5, from about 7.0 to about 9.5, from about 7.5 to about 9.5, from about 8.0 to about 9.5, from about 8.5 to about 9.5, from about 9.0 to about 9.5, from about 5.5 to about 9.0, from about 6.0 to about 9.0, from about 6.5 to about 9.0, from about 7.0 to about 9.0, from about 7.5 to about 9.0, from about 8.0 to about 9.0, from about 8.5 to about 9.0, from about 5.5 to about 8.5, from about 6.0 to about 8.5, from about 6.5 to about 8.5, from about 7.0 to about 8.5, from about 7.5 to about 8.5, from about 8.0 to about 8.5, from about 5.5 to about 8.0, from about 6.0 to about 8.0, from about 6.5 to about 8.0, from about 7.0 to about 8.0, from about 7.5 to about 8.0, from about 5.5 to about 7.5, from about 6.0 to about 7.5, from about 6.5 to about 7.5, or from about 7.0 to about 7.5, from about 5.5 to about 7.0, from about 6.0 to about 7.0, or from about 6.5 to about 7.0. In some embodiments, the buffer solution containing the salt regulates the pH of the aqueous buffers to reach about 7.0, about 7.5, or about 8.0.In some embodiments, the aqueous buffers comprise a salt (e.g., NaCl) at a concentration about 0.5-2 M, or about 0.5-1.5 M (e.g., 0.5M, 0.7M, 0.75M, 0.8M, 0.85M, 0.9M, 0.95M, 1.0M, 1.05M, 1.10M, 1.15M, 1.20M, 1.25M, 1.30M, 1.4M, or 1.5M); and / or of a buffer solution (e.g., Tris such as Tris-HCl) at a concentration about 1-20 mN (e.g., 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 12.5 mM, 15 mM, 17.5 mM, or 20 mM) that regulates the pH of the aqueous buffers, to reach about 7.0-9.5 (e.g., including any ranges listed in the above embodiment for pH ranges falling between 7.0 and 9.5), or to reach about 7.0, about 7.5, or about 8.0.In some embodiments, the solution that regulates pH is Tris or HEPES. These solutions may be included in the range of 5 mM to about 20 mM.31LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO In some embodiments, the aqueous buffers comprise a salt (e.g., NaCl), a buffer solution (e.g., Tris and / or HEPES) to adjust the pH at about 7.0, about 7.5, or about 8.0. In some embodiments, the aqueous buffers comprise a salt (e.g., NaCl), a buffer solution (e.g., Tris, and / or HEPES) to adjust the pH at about 7.0, about 7.5, or about 8.0, and a chelating solution (e.g., EDTA).In some embodiments, the aqueous buffers may be a buffer solution containing 20 mM Tris or HEPES pH 8.0; a salt (e.g., NaCl) at one of the following concentrations: 0.5 M, 0.7 M, 0.75 M, 0.8 M, 0.85 M, 1 M, 1.2 M, 1.25M, or 1.5 M; and optionally 10 mM EDTA. In one embodiment, the aqueous buffers comprise 20 mM Tris or HEPES pH 8.0, 0.75 M NaCl, and optionally 10 mM EDTA. In one embodiment, the aqueous buffers comprise 20 mM Tris or HEPES pH 8.0, 1 M or 1.2 M NaCl, and optionally 10 mM EDTA. In one embodiment, the aqueous buffers comprise 20 mM Tris or HEPES pH 8.0, 1.25 M NaCl, and optionally 10 mM EDTA.In some embodiments, the sample comprising the plurality of polyribonucleotides is contained in aqueous buffers before the step of contacting the sample with the reagent (e.g., the dsRNA-binding column or resin containing the reagent).In some embodiments, the loading volume for the sample comprising the plurality of polyribonucleotides (e.g., the sample may be contained in aqueous buffers) into the dsRNA-binding column or resin may be determined by a ratio to the column volume (CV) of the dsRNA-binding column or resin. Column volume generally refers to the packed bed volume of the resin in the dsRNA-biding column. In some embodiments, the loading volume may range from about 0.5 to about 20 CVs, or from about 0.5 to about 10 CVs (e.g. 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 CVs).In some embodiments, the loading amount of the total polyribonucleotides into the dsRNA-binding column or resin may range from about 10 ug / ml resin to about 100 mg / ml resin, from about 50 ug / ml resin to about 50 mg / ml resin, from about 50 ug / ml resin to about 10 mg / ml resin, or from about 100 ug / ml resin to about 1000 ug / ml resin (e.g. 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 ug / ml resin).In some embodiments, the linear flow rate of the aqueous buffers through the dsRNA-binding column or resin is adjusted to provide an increased yield of an enriched population of circular polyribonucleotides or an increased yield of the purified circular polyribonucleotides, without reducing the purity of the circular polyribonucleotides. In some embodiments, the linear flow rate is at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, or at least 600 cm / hour. In some embodiments, the linear flow rate ranges from about 50 cm / hour to about 2000 cm / hour, or from about 100 cm / hour to about 1800 cm / hour (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, or 1800 cm / hour).In some embodiments, the contacting and separating steps of the method comprise: contacting the sample with the reagent (i.e., the dsRNA-binding column or resin containing the reagent) to allow the column or resin to bind the dsRNAs; optionally centrifugating the dsRNA-binding column or 32LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO resin; and collecting the flow-through solution comprising the polyribonucleotides in the sample that are not bound to the reagent (i.e., the column or resin containing the reagent) from the plurality of polyribonucleotides in the sample. In these embodiments, the polyribonucleotides in the sample that are not bound by the reagent (i.e., the column or resin containing the reagent) comprises the circular polyribonucleotide to be separated and collected.In some embodiments, the method further comprises: washing the column or resin containing the reagent that binds the dsRNAs with the aqueous buffers one or more (e.g., two, three, four five, or more) times; optionally centrifugating the dsRNA-binding column or resin; and collecting the flow-through solution comprising the polyribonucleotides in the sample that are not bound to the reagent (i.e., the column or resin containing the reagent) from the plurality of polyribonucleotides in the sample. In these embodiments, the polyribonucleotides in the sample that are not bound by the reagent (i.e., the column or resin containing the reagent) comprises the circular polyribonucleotide to be separated and collected.After the sample is contacted with (e.g., loaded to) the reagent (i.e., the dsRNA-binding column or resin containing the reagent), the binding may be allowed at an ambient temperature, for a period of at least 1 minute (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, or 60 minutes or more).In some embodiments, the step of separating further comprises eluting the reagent bound with the linear polyribonucleotides comprising the dsRNAs to collect an eluate comprising the linear polyribonucleotides comprising the dsRNAs, using an eluant different from the aqueous buffers. For instance, the eluant may be guanidine hydrochloride.In some embodiments, the methods described herein enrich an amount of the desired polyribonucleotide in the sample. For example, the method may enrich the amount of the desired (e.g., spliced, e.g., circular) polyribonucleotide by at least 10%, (e.g., at least 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or more) relative to the sample prior to purification.In some embodiments, the methods of purification result in a circular polyribonucleotide that has less than 50% (mol / mol) (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1% (mol / mol)) linear polyribonucleotides.In some embodiments, the method separates at least 5 pg (e.g., at least 10 pg, 20 pg, 30 pg, 40 pg, 50 pg, 60 pg, 70 pg, 80 pg, 90 pg, 100 pg, 150 pg, 200 pg, 250 pg, 300 pg, 350 pg, 400 pg, 450 pg, 500 pg, 600 pg, 700 pg, 800 pg, 900 pg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1000 mg, or more) of the circular polyribonucleotide.Methods of transcription.The methods described herein employ a linear polynucleotide comprising the one or more 33LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO dsRNAs. In certain embodiments, provided herein is a method of generating a linear polyribonucleotide comprising the one or more dsRNAs by performing transcription (e.g., in a cell-free system, such as in vitro transcription (IVT)) using one or more deoxyribonucleotides (e.g., a vector, linearized vector, or cDNA) comprising the deoxyribonucleotide sequences encoding the one or more dsRNAs provided herein as templates (e.g., a vector, linearized vector, or cDNA provided herein with an RNA polymerase promoter positioned upstream of the region that codes for the linear polyribonucleotide) .In some embodiments, the deoxyribonucleotide templates comprising the deoxyribonucleotide sequences encoding the one or more dsRNAs may be transcribed (e.g., using in vitro transcription, IVT) to a produce a linear polyribonucleotide containing the one or more dsRNAs described herein. Upon expression, the linear polyribonucleotide may produce a splicing -compatible polyribonucleotide, which may be spliced in order to produce a circular polyribonucleotide.Methods of CircularizationThe disclosure provides methods of circularization of a polyribonucleotide, e.g., from a linear precursor polyribonucleotide. Circularization may be performed using methods including, e.g., recombinant technology or chemical synthesis. For example, a DNA molecule used to produce a circular RNA can include a DNA sequence of a naturally occurring original nucleic acid sequence, a modified version thereof, or a DNA sequence encoding a synthetic polypeptide not normally found in nature (e.g., chimeric molecules or fusion proteins). DNA and RNA molecules can be modified using a variety of techniques including, but not limited to, classic mutagenesis techniques and recombinant techniques, such as site- directed mutagenesis, chemical treatment of a nucleic acid molecule to induce mutations, restriction enzyme cleavage of a nucleic acid fragment, ligation of nucleic acid fragments, polymerase chain reaction (PCR) amplification or mutagenesis of selected regions of a nucleic acid sequence, synthesis of oligonucleotide mixtures and ligation of mixture groups to “build” a mixture of nucleic acid molecules and combinations thereof.The circular polyribonucleotides may be prepared according to any available technique, including, but not limited to chemical synthesis and enzymatic synthesis. In some embodiments, a linear polyribonucleotide may be cyclized or concatenated to create a circRNA described herein. The mechanism of cyclization or concatenation may occur through methods such as, e.g., chemical, enzymatic, or ribozyme-catalyzed methods. The newly formed 5’ -3’ linkage may be an intramolecular linkage or an intermolecular linkage.In some embodiments, either the 5' or 3' end of the linear polyribonucleotide can encode a ligase ribozyme sequence such that during in vitro transcription, the resultant linear circRNA includes an active ribozyme sequence capable of ligating the 5' end of the linear polyribonucleotide to the 3' end of the linear polyribonucleotide. The ligase ribozyme may be derived from the Group I Intron, Hepatitis Delta Virus, Hairpin ribozyme or may be selected by SELEX (systematic evolution of 34LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO ligands by exponential enrichment).In some embodiments, the linear polyribonucleotide may include a ribozyme RNA sequence near the 5' terminus and near the 3' terminus. The ribozyme RNA sequence may covalently link to a peptide when the sequence is exposed to the remainder of the ribozyme. The peptides covalently linked to the ribozyme RNA sequence near the 5’ terminus and the 3 ‘terminus may associate with each other, thereby causing a linear polyribonucleotide to cyclize or concatenate. In some embodiments, the peptides covalently linked to the ribozyme RNA near the 5' terminus and the 3' terminus may cause the linear primary construct or linear mRNA to cyclize or concatenate after being subjected to ligated using various methods known in the art such as, but not limited to, protein ligation. Non-limiting examples of ribozymes for use in the linear primary constructs or linear polyribonucleotides of the present invention or a non-exhaustive listing of methods to incorporate or covalently link peptides are described in US 2003 / 0082768, which is here in incorporated by reference in its entirety.In some embodiments, linear polyribonucleotides may be cyclized or concatenated by selfsplicing. The circular polyribonucleotides are thus prepared by self-circularization of the linear polyribonucleotide. In some embodiments, the self-splicing is based on self-splicing ribozyme. In some embodiments, the self-circularization of the linear polyribonucleotide employing self- splicing ribozyme is the permuted intron-exon (PIE) method, e.g., using group I introns. Details of this method may be found in Puttaraju et al., Nucleic Acid Res. 20:5357-64 (1992), which is incorporated herein by reference in its entirety. In some embodiments, the self -circularization of the linear polyribonucleotide employing self-splicing ribozyme is self-targeting and splicing (STS) method, using, e.g., the Tetrahymena group I intron ribozyme. Details of this method may be found in Lee et al., Mol. Ther. Nucleic Acids 33:587-98 (2023); Cui et al. Nucleic Acids Res. 51:e78 (2023), which are incorporated herein by reference in its entirety.In some embodiments, the linear polyribonucleotides may include loop E sequence to selfligate. In another embodiment, the linear polyribonucleotides may include a self-circularizing intron, e.g., a 5' and 3’ slice junction, or a self-circularizing catalytic intron such as a Group I intron, Group II intron, or Group III intron. Nonlimiting examples of Group I intron self-splicing sequences may include self-splicing permuted intron-exon sequences derived from T4 bacteriophage gene td, the intervening sequence (IVS) rRNA of Tetrahymena, or a cyanobacterium Anabaena pre-tRNA-Leu gene. All the various methods of in vitro self-circularization based on self-splicing ribozyme disclosed Lee et al. Int. J. Mol. Sci. 25(17):9437 (2024) (which is incorporated herein by reference in its entirety) are applicable herein for preparing circular polyribonucleotides.In some embodiments, chemical methods of circularization may be used to generate the circular polyribonucleotide. Such methods may include, but are not limited to click chemistry (e.g., alkyne and azide-based methods, or clickable bases), olefin metathesis, phosphoramidate ligation, hemiaminal-imine crosslinking, base modification, and any combination thereof.35LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Methods of making the circular polyribonucleotides described herein are described in, for example, Khudyakov & Fields, Artificial DNA: Methods And Applications, CRC Press (2002); in Zhao, Synthetic Biology: Tools And Applications (First Edition), Academic Press (2013); and Egli & Herdewijn, Chemistry And Biology Of Artificial Nucleic Acids (First Edition), Wiley-VCH (2012). Various methods of synthesizing circular polyribonucleotides are also described elsewhere (see, e.g., US 6210931, US 5773244, US 5766903, US 5712128, US 5426180, US 2010 / 0137407, WO 1992 / 001813, WO 2010 / 084371, and Petkovic et al., Nucleic Acids Res. 43:2454-65 (2015); which are herein incorporated by reference in their entirety).dsRNA-binding ReagentsThe methods described herein employ a reagent that binds to a dsRNA contained on a linear polyribonucleotide to separate and purify the circular polyribonucleotide from the plurality of the polyribonucleotides.Any reagents that can bind to a dsRNA can be used herein as the dsRNA-binding reagents. There are wide variety of reagents that can selectively bind to a dsRNA and are particularly suitable to be used herein as the dsRNA-binding reagents. The dsRNA-binding reagent may be, for example, a polypeptide, a small molecule, or a nucleic acid.In some embodiments, the reagent is a polypeptide or protein-based ligand. Non-limiting examples of the polypeptide or protein-based ligands that can bind to dsRNA include, for example, LL37 peptide (i.e., a cathelicidin peptide with antimicrobial and immunomodulatory properties); peptides derived from TAV2b (i.e., a protein from the Tobacco etch virus) domain such as wt33 (i.e., Wilms tumor protein encoded by the WT1 gene). In some embodiments, the reagent is a cellpenetrating peptide (CPP), or a polypeptide derived from CPP. In addition, proteinscontaining double-stranded RNA binding domains (dsRBDs) can interact specifically with dsRNA, and are suitable to be used herein as the dsRNA-binding reagents. These dsRBDs are typically found in proteins involved in RNA interference (e.g., TRBP (TAR RNA binding protein), RNA editing (e.g., ADAR (Adenosine Deaminase acting on RNA)), RNA processing (i.e., RNase III), and host defense against viral infections (e.g., naturally occurring viral proteins, such as viruses-encoding proteins like B2 (from Flock House virus) and VP3 (from Drosophila X virus), PKR (Protein Kinase R) that bind dsRNA).Typically, using the peptide, polypeptide, or protein-based ligands as the reagent to bind dsRNA, the binding is primarily shape-dependent (recognizing the A-form helix of dsRNA) rather than sequence-specific.In some embodiments, the reagent is a small molecule based ligand. In some embodiments, the reagent is a peptide-acridine conjugate (PAC). In some embodiments, the reagent is a G-clamp derivative. In some embodiments, the reagent is a fluorescent dye, such as a thiazole orange, a coumarin derivative, a Hoechst scaffold modification, a SYBR Green, PicoGreen, Quantifluor, or 36LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Cy3. In some embodiment, the reagent is an aminoglycoside such as Neomycin. In some embodiments, the reagent is a cationic triptycene scaffold. In some embodiments, the small molecule ligand is an anthrafurandione or anthrathiophenedione with aminoethyl side chains.In some embodiments, the reagent is a nucleic acid based ligand. In some embodiment, the reagent is a peptide nucleic acid (PNA) or modified PNA. In some embodiment, the reagent is a triple-helix-forming PNA. In some embodiments, the reagent is a nucleobase-modified dsRNA-binding PNA (dbPNA). In some embodiments, the reagent is an antisense PNA (dsPNA). In some embodiments, the reagent is a combined dbPNA and asPNA (daPNA). Details on the dbPNA, dsPNA, and daPNA may be found in Kesy et al. Bioconjugate chemistry 30(3):931-43 (2019), which is incorporated herein by reference in its entirety. In some embodiment, the reagent is an RNA aptamer that can be selected by methods like SELEX to selectively binds to a dsRNA.The reagents described herein may be conjugated (e.g., directly or indirectly) to a particle, e.g., a magnetic particle or a bead. In some embodiments, the reagent is conjugated to a plurality of particles. In some embodiments, a particle is conjugated to a plurality of reagents. Any particles that may be used to conjugate the reagent described herein and that are known to one skilled in the art for use in a resin or column can be used herein. A particle, e.g., a magnetic particle or a bead, may be porous, non-porous, hollow, solid, semisolid, semi-fluidic, fluidic, and / or a combination thereof. In some instances, a particle, e.g., a bead, may be dissolvable or degradable. In some cases, a particle, e.g., a bead, may not be degradable. In some embodiments, the bead is composed of crosslinked agarose, e.g., SEPHAROSE®.The reagent may be, for example, contained in a dsRNA-binding column or resin. In some embodiments, the dsRNA-biding reagent may be conjugated to a plurality of particles contained in a resin or column, resulting in a dsRNA-binding column or resin. In some embodiments, the resin includes cross-linked poly[styrene-divinylbenzene], agarose, or SEPHAROSE®.The shape, form, materials, and modifications of the surface of the resin can be selected from a range of options depending on the application. The surface of the resin can be substantially flat or planar. Alternatively, the surface of the resin can be rounded or contoured. Exemplary contours that can be included on a surface of the resin are wells, depressions, pillars, ridges, channels or the like.Exemplary materials that can be used as a surface of the resin include, but are not limited to acrylics, carbon (e.g., graphite, carbon-fiber), cellulose (e.g., cellulose acetate), ceramics, controlled-pore glass, cross-linked polysaccharides (e.g., agarose or SEPHAROSE®), gels, glass (e.g., modified or functionalized glass), gold, graphite, inorganic glasses, inorganic polymers, latex, metal oxides (e.g., SiOi, TiOi, stainless steel), metalloids, metals, mica, molybdenum sulfides, nanomaterials (e.g., highly oriented pyrolitic graphite (HOPG) nanosheets), nitrocellulose, NYLON™, optical fiber bundles, organic polymers, paper, plastics, polacryloylmorpholide, poly(4-methylbutene), polyethylene terephthalate), poly(vinyl butyrate), polybutylene, polydimethylsiloxane (PDMS), polyethylene, polyformaldehyde, polymethacrylate, polypropylene, polysaccharides, polystyrene,37LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO polyurethanes, polyvinylidene difluoride (PVDF), quartz, rayon, resins, rubbers, semiconductor material, silica, silicon (e.g., surface-oxidized silicon), sulfide, and TEFLON™. A single material or mixture of several varied materials can form a resin useful in the invention.In some embodiments, a surface of the resin includes a polymer. In some embodiments, a surface of the resin includes an acrylic based polymer, such as a poly (methylmethacrylate). In some embodiments, a surface of the resin includes a polystyrene-based polymer, such as a polystyrene divinyl benzene copolymer. In some embodiments, a surface of the resin includes a dextran-based polymer. In some embodiments, a surface of the resin includes a polyacrylamide.In some embodiments, a surface of the resin includes agarose. In some embodiments, a surface of the resin includes SEPHAROSE®.In some embodiments, a surface of the resin includes tentacle-based phases, e.g., methacrylate based. In some embodiments, a surface can include a membrane-based resin matrix. In some embodiments, the surface of the resin includes a porous resin or a non-porous resin.Suitable dsRNA-binding columns or resins include those chromatography columns or resins designed to isolate and purify dsRNA from a complex mixture, like cell lysates or IVT (in vitro transcription) feeds. These columns contain resin or matrix having the reagent that selectively binds dsRNA under specific conditions (in the presence of certain salt concentrations and specific pH conditions).In some embodiments, the dsRNA-binding columns / resins are affinity chromatography column / resin containing the reagent that selectively binds to the dsRNAs encoded onto the linear polyribonucleotide or linear precursor polyribonucleotide, while allowing other RNA components, such as a single-stranded RNA, a nicked RNA, or a circular RNA to flow through, thereby separating the linear polyribonucleotide or linear precursor polyribonucleotide containing the encoded dsRNAs from others in the mixture of polyribonucleotides that do not contain the encoded dsRNA (e.g., the circular RNAs).Any affinity chromatography column / resin suitable for dsRNA purification, known to one skilled in the art would be applicable herein. In some embodiments, the affinity chromatography column / resin for dsRNA-binding may contain one or more of the small molecule based ligand, a polypeptide or protein-based ligand, or a nucleic acid based ligand, as described herein, that demonstrates high affinity for the dsRNA duplex region, and low affinity for an RNA that does not contain a duplex region. An example for the affinity chromatography column / resin for dsRNA-binding is commercially available AVIpure columns (Repligen).In some embodiments, the dsRNA-binding column or resin operates in a flow-through mode. The polyribonucleotide sample comprising a plurality of polyribonucleotides comprising a mixture of linear polyribonucleotides and circular polyribonucleotides is loaded to the dsRNA-binding column or resin. The linear polyribonucleotides containing the dsRNAs bind to the dsRNA-binding column or resin containing the dsRNA-binding reagent, and the unbound polyribonucleotide (e.g., the circular 38LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO polyribonucleotides lacking the dsRNA) flows through by gravity. Thus, the step of separating comprises collecting the polyribonucleotides in the sample that are not bound by the reagent, by collecting the flow-through. In some embodiments, the polyribonucleotides in the sample that are not bound by the reagent comprises mainly the circular polyribonucleotides. Thus, collecting the flow-through result in the purified circular polyribonucleotides.In some embodiments, the reagent may be, or further comprises, a cellulose chromatography. In some embodiments, the cellulose chromatography employs cellulose-based columns / resins to specifically bind dsRNA under certain conditions. In some embodiments, the cellulose chromatography employs cellulose-based columns / resins to specifically bind dsRNA under high salt concentrations. In some embodiments, the cellulose chromatography employs cellulose-based columns / resins to specifically bind dsRNA under high ethanol concentrations.In some embodiments, the reagent may be, or further comprises, a micro-spin cellulose column to specifically bind dsRNA, allowing for rapid and high-throughput binding of dsRNAs.In some embodiments, the reagent may be, or further comprises, monolithic anion exchange columns to specifically bind dsRNA, allowing for high-throughput binding of dsRNAs. In some embodiments, the reagent may be, or further comprises, convective interaction media (CIM) monolithic anion exchange columns to specifically bind dsRNA.Double-stranded RNA (dsRNA)The dsRNA contained in the polyribonucleotide as described herein is configured to bind to a reagent. In some embodiments, the dsRNA may contain modified nucleotides (e.g., having modified phosphate, sugar, or base). In some embodiments, the dsRNA contains a portion configured to bind to the reagent and a portion that does not bind to the reagent (e.g., an overhang region).Typically, a dsRNA (or each strand of a dsRNA when there are two strands forming the dsRNA) can have a length of from 5 to 2000 nucleotides (e.g., from 5 to 1000, from 5 to 600, from 5 to 500, from 5 to 150, from 5 to 100, from 5 to 60, from 5 to 50, from 5 to 40, from 5 to 30, from 5 to 20, from 10 to 200, from 10 to 150, from 10 to 100, from 10 to 60, from 10 to 50, from 10 to 40, from 10 to 30, from 10 to 20, from 20 to 200, from 20 to 150, from 20 to 100, from 20 to 60 nucleotides, from 20 to 50, from 20 to 40, from 20 to 30, from 30 to 500, from 30 to 150, from 30 to 100, from 30 to 60, from 30 to 50, or from 30 to 40). Typically, a shorter version, e.g., when the duplex region is shorter or equal to 50 base pair (e.g., 5-50), the dsRNA may be referred to as siRNA or miRNA; and a longer dsRNA may have about 51-600 nucleotides.Any types of dsRNA having a duplex region of various lengths can be configured onto the polyribonucleotide for binding to a reagent. In some embodiments, the dsRNA is a long dsRNA as defined herein having a length of 51-600 nucleotides. In some embodiments, the dsRNA is an siRNA. In some embodiments, the dsRNA is an miRNA.In some embodiments, the dsRNA is a dsRNA hairpin. The dsRNA hairpin has at least one 39LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO stem region of at least 5 base pairs (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or more base pairs) in length. The dsRNA hairpin has a loop region of at least 1 nucleotide (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides) in length.In some embodiments, the dsRNA hairpin has at least one stem region of at least 10 base pairs, at least 20 base pairs, or at least 30 base pairs in length. In some embodiments, the dsRNA hairpin has at least one stem region of at least 30, at least 35, at least 40, at least 45, or at least 50 base pairs in length. In some embodiments, the dsRNA hairpin has a stem region of no more than 100 base pairs, no more than 90 base pairs, no more than 80 base pairs, no more than 70 base pairs, no more than 60 base pairs, no more than 50 base pairs, or no more than 40 base pairs in length. In some embodiments, the dsRNA hairpin has a loop region of at least 1, at least 2, at least 3, or at least 4 nucleotides in length. In some embodiments, the dsRNA hairpin has a loop region of at least 2 or at least 3 nucleotides in length. In some embodiments, the dsRNA hairpin has a loop region of at least 4 nucleotides in length. In one embodiment, the dsRNA hairpin has a loop region of 4 nucleotides in length.In some embodiments, the dsRNA has a multi-dsRNA hairpin structure. In some embodiments, in the multi-dsRNA hairpin structure, 2-10 (e.g., 2-8; or 2-6; or 2, 3, or 4) dsRNA hairpins are connected by a linker or spacer sequence. In some embodiments, in any of the multi-dsRNA hairpin structure discussed above, each dsRNA hairpin independently has a stem region of 30-60 (e.g., 30-50, such as 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50) base pairs.One of skill in the art would recognize that many dsRNA sequences (e.g., dsRNA hairpin sequences) and the design of dsRNA sequences (e.g., dsRNA hairpin sequences) are well known in the art and could be accessed via any suitable database. For example, dsRID (Double-Stranded RNA Identifier) is a machine learning-based method designed to predict dsRNA regions in silico (github.com / gxiaolab / dsRID). Additionally, DRSC / TRiP Functional Genomics Resources & DRSC-BTRR by Harvard Medical School (fgr.hms.harvard.edu / fly-cell-rnai-libraries) provides an extensive collection of DNA templates for production of double stranded RNA (dsRNA) via invitro transcription. Other databases and open sources online tools are well known to the skilled artisan to provide dsRNA sequences (e.g., dsRNA hairpin sequences) and their designs. The dsRNA sequences listed in each of the foregoing and other known databases are herein incorporated by reference in their entirety.The methods described herein also may include making polyribonucleotides containing the dsRNA (e.g., dsRNA hairpin), which has been described herein (see “Methods of transcription”) and is well known to one skilled in the art.40LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO BioreactorsIn some embodiments, any method of purifying a polyribonucleotide (e.g., circular polyribonucleotide) described herein may be performed in a bioreactor. A bioreactor refers to any vessel in which a chemical or biological process is carried out which involves organisms or biochemically active substances derived from such organisms. Bioreactors may be compatible with the cell-free methods for purifying or producing circular RNA described herein. A vessel for a bioreactor may include a culture flask, a dish, or a bag that may be individual use (disposable), autoclavable, or sterilizable. A bioreactor may be made of glass, or it may be polymer-based, or it may be made of other materials.Examples of bioreactors include, without limitation, stirred tank (e.g., well mixed) bioreactors and tubular (e.g., plug flow) bioreactors, airlift bioreactors, membrane stirred tanks, spin filter stirred tanks, vibromixers, fluidized bed reactors, and membrane bioreactors. The mode of operating the bioreactor may be a batch or continuous processes. A bioreactor is continuous when the reagent and product streams are continuously being fed and withdrawn from the system. A batch bioreactor may have a continuous recirculating flow, but no continuous feeding of reagents or product harvest.Some methods of the present disclosure are directed to large-scale production of polyribonucleotides. For large-scale production methods, the method may be performed in a volume of 1 L to 500 L or more, for instance, a volume of 1 L to 200 L or more, or a volume of 1 L to 150 L, or more. In some embodiments, the method may be performed in a volume of 5 L to 10 L, 5 L to 15 L, 5 L to 20 L, 5 L to 25 L, 5 L to 30 L, 5 L to 35 L, 5 L to 40 L, 5 L to 45 L, 5 L to 50 L, 10 L to 15 L, 10 L to 20 L, 10 L to 25 L, 20 L to 30 L, 10 L to 35 L, 10 L to 40 L, 10 L to 45 L, 10 L to 50 L, 15 L to 20 L, 15 L to 25 L, 15 L to 30 L, 15 L to 35 L, 15 L to 40 L, 15 L to 45 L, 15 to 50 L, 15 L to 100 L, 15 L to 150 L, 15 L to 200 L, 15 L to 300 L, 15 L to 400 L, or 15 L to 500 L. In some embodiments, a bioreactor may produce at least 1 g of RNA, such as l-200g of RNA (e.g., l-10g, 1-20g, l-50g, 10-50g, 10-100g, 50-100g, or 50-200g of RNA). In some embodiments, the amount produced is measured per liter (e.g., l-200g per liter), per batch or reaction (e.g., l-200g per batch or reaction), or per unit time (e.g., l-200g per hour or per day).In some embodiments, more than one bioreactor may be utilized in series to increase the production capacity (e.g., one, two, three, four, five, six, seven, eight, or nine bioreactors may be used in series).CompositionsCertain aspects of the invention also provide a population of polyribonucleotides produced by the methods as described herein, and a pharmaceutical composition comprising the population of polyribonucleotides as described herein, and a diluent, carrier, or excipient.The disclosure features a composition or pharmaceutical composition that includes a population of polyribonucleotides (e.g., circular polyribonucleotides) purified by the methods 41LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO described herein.In some embodiments, the population of the circular polyribonucleotides separated and collected do not contain an introduced (or exogenous) dsRNA from the linear polyribonucleotides or linear precursor polyribonucleotides, and the circular polyribonucleotide includes at least 1% (e.g., at least 5%, e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or more) (mol / mol) of the total polyribonucleotides. In some embodiments, the population has less than 50% (e.g., less than 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, or 1%) (mol / mol) linear polyribonucleotides in the total polyribonucleotides.In some embodiments, the linear polyribonucleotide includes an intron or portion thereof. The dsRNA may be located at 5’ or 3’ to the intron or portion thereof.In some embodiments, the polyribonucleotide may include a modified polyribonucleotide. In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) is at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93% (w / w), 94% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), or 100% (w / w) pure on a mass basis. Purity may be measured by any one of a number of analytical techniques known to one skilled in the art, such as, but not limited to, the use of separation technologies such as chromatography (using a column, using a paper, using a gel, using HPLC, using UHPLC, etc., or by IC, by SEC, by reverse phase, by anion exchange, by mixed mode, etc.) or electrophoresis (UREA PAGE, chip-based, polyacrylamide gel, RNA, capillary, c-IEF, etc.) with or without pre- or postseparation derivatization methodologies using detection techniques based on mass spectrometry, UV-visible, fluorescence, light scattering, refractive index, or that use silver or dye stains or radioactive decay for detection. Alternatively, purity may be determined without the use of a separation technology by mass spectrometry, by microscopy, by circular dichroism (CD) spectroscopy, by UV or UV- vis spectrophotometry, by fluorometry (e.g., Qubit), by RNAse H analysis, by surface plasmon resonance (SPR), or by methods that utilize silver or dye stains or radioactive decay for detection. In some embodiments, purity can be determined by detecting a level of a specific analyte (e.g., circRNA) using e.g., spectrophotometry (e.g., NanoDrop™ spectrophotometer), or other technique suitable for measuring purity of a population of nucleic acids and calculating a percentage of the analyte (w / w) relative to the total nucleic acid content (e.g., as determined by an assay known in the art).In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has a circular polyribonucleotide concentration of at least 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 50 ng / mL, 0.1 pg / mL, 0.5 pg / mL, 1 pg / mL, 2 pg / mL, 5 pg / mL, 10 pg / mL, 20 pg / mL, 30 pg / mL, 40 pg / mL, 50 pg / mL, 60 pg / mL, 70 pg / mL, 80 pg / mL, 100 pg / mL, 200 pg / mL, 300 pg / mL, 500 pg / mL, 1000 pg / mL, 500042LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO pg / mL, 10,000 pg / mL, 100,000 pg / mL, 200 mg / mL, 300 mg / mL, 400 mg / mL, 500 mg / mL, 600 mg / mL, 650 mg / mL, 700 mg / mL, or 750 mg / mL.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has a linear RNA content, e.g., linear RNA counterpart or RNA fragments, of no more than 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 1 pg / ml, 10 pg / ml, 50 pg / ml, 100 pg / ml, 200 pg / ml, 300 pg / ml, 400 pg / ml, 500 pg / ml, 600 pg / ml, 700 pg / ml, 800 pg / ml, 900 pg / ml, 1 mg / ml, 1 .5 mg / ml, 2 mg / ml, 5 mg / mL, 10 mg / mL, 50 mg / mL, 100 mg / mL, 200 mg / mL, 300 mg / mL, 400 mg / mL, 500 mg / mL, 600 mg / mL, 650 mg / mL, 700 mg / mL, 750 mg / mL, 800 mg / mL, 850 mg / mL, 900 mg / mL, 950 mg / mL, or 1000 mg / mL.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has a nicked RNA content of no more than 10% (w / w), 9.9% (w / w), 9.8% (w / w), 9.7% (w / w), 9.6% (w / w), 9.5% (w / w), 9.4% (w / w), 9.3% (w / w), 9.2% (w / w), 9.1 % (w / w), 9% (w / w), 8% (w / w), 7% (w / w), 6% (w / w), 5% (w / w), 4% (w / w), 3% (w / w), 2% (w / w), 1% (w / w), 0.5% (w / w), or 0.1% (w / w), or percentage therebetween. In one embodiment, a circular polyribonucleotide preparation e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has a nicked RNA content that as low as zero or is substantially free of nicked RNA.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has a combined linear RNA and nicked RNA content of no more than 30% (w / w), 25% (w / w), 20% (w / w), 15% (w / w), 10% (w / w), 9% (w / w), 8% (w / w), 7% (w / w), 6% (w / w), 5% (w / w), 4% (w / w), 3% (w / w), 2% (w / w), 1 % (w / w), 0.5% (w / w), or 0.1 % (w / w), or percentage therebetween. In one embodiment, a circular polyribonucleotide preparation e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has a combined nicked RNA and linear RNA content that is as low as zero or is substantially free of nicked and linear RNA.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has no more than 0.1% (w / w), 1% (w / w), 2% (w / w), 3% (w / w), 4% (w / w), 5% (w / w), 6% (w / w), 7% (w / w), 8% (w / w), 9% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 35% (w / w), 40% (w / w), 45% (w / w), or 50% (w / w)43LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO of linear RNA. In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has a linear RNA content, e.g., linear RNA counterpart or RNA fragments, of no more than the detection limit of corresponding analytical methodologies.In some embodiments, the linear polyribonucleotide molecules of the circular polyribonucleotide preparation include the linear counterpart or a fragment thereof of the circular polyribonucleotide molecule. In some embodiments, the linear polyribonucleotide molecules of the circular polyribonucleotide preparation include the linear counterpart (e.g., a pre-circularized version). In some embodiments, the linear polyribonucleotide molecules of the circular polyribonucleotide preparation include a non-counterpart or fragment thereof to the circular polyribonucleotide. In some embodiments, the linear polyribonucleotide molecules of the circular polyribonucleotide preparation include a noncounterpart to the circular polyribonucleotide. In some embodiments, the linear polyribonucleotide molecules include a combination of the counterpart of the circular polyribonucleotide and a noncounterpart or fragment thereof of the circular polyribonucleotide. In some embodiments, the linear polyribonucleotide molecules include a combination of the counterpart of the circular polyribonucleotide and a non-counterpart of the circular polyribonucleotide. In some embodiments, a linear polyribonucleotide molecule fragment is a fragment that is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, or more nucleotides in length, or any nucleotide number therebetween.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has an A260 / A280 absorbance ratio from about 1 .6 to about 2.3, e.g., as measured by spectrophotometer. In some embodiments, the A260 / A280 absorbance ratio is about 1.4, 1 .5, 1 .6, 1 .7, 1 .8, 1 .9, 2.0, 2.1 , 2.2, 2.3, 2.4, 2.5, or any number therebetween. In some embodiments, a circular polyribonucleotide (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has an A260 / A280 absorbance ratio greater than about 1.8, e.g., as measured by spectrophotometer. In some embodiments, the A260 / A280 absorbance ratio is about 1.6, 1.7, 1 .8, 1 .9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or greater.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) is substantially free of an impurity or byproduct. In various embodiments, the level of at least one impurity or byproduct in a composition including the circular polyribonucleotide is reduced by at least 30% (w / w), at least 40% (w / w), at least 50% (w / w), at least 60% (w / w), at least 70% (w / w), at least 80% (w / w), at least 90% (w / w), or at 44LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO least 95% (w / w) as compared to that of the composition prior to purification or treatment to remove the impurity or byproduct. In some embodiments, the level of at least one process-related impurity or byproduct is reduced by at least 30% (w / w), at least 40% (w / w), at least 50% (w / w), at least 60% (w / w), at least 70% (w / w), at least 80% (w / w), at least 90% (w / w), or at least 95% (w / w) as compared to that of the composition prior to purification or treatment to remove the impurity or byproduct. In some embodiments, the level of at least one product-related substance is reduced by at least 30% (w / w), at least 40% (w / w), at least 50% (w / w), at least 60% (w / w), at least 70% (w / w), at least 80% (w / w), at least 90% (w / w), or at least 95% (w / w) as compared to that of the composition prior to purification or treatment to remove the impurity or byproduct. In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) is further substantially free of a process-related impurity or byproduct.In some embodiments, the process-related impurity or byproduct includes a protein (e.g., a cell protein, such as a host cell protein), a deoxyribonucleic acid (e.g., a cell deoxyribonucleic acid, such as a host cell deoxyribonucleic acid), monodeoxyribonucleotide or dideoxyribonucleotide molecules, an enzyme (e.g., a nuclease, such as an endonuclease or exonuclease, or ligase), a reagent component, a gel component, or a chromatographic material. In some embodiments, the impurity or byproduct is selected from: a buffer reagent, a ligase, a nuclease, RNase inhibitor, RNase R, deoxyribonucleotide molecules, acrylamide gel debris, and monodeoxyribonucleotide molecules.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) is substantially free of DNA content e.g., template DNA or cell DNA (e.g., host cell DNA); and has a DNA content, as low as zero, or has a DNA content of no more than 1 pg / ml, 10 pg / ml, 0.1 ng / ml, 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 400 ng / ml, 500 ng / ml, 1000 pg / mL, 5000 pg / mL, 10,000 pg / mL, or 100,000 pg / mL; or has a DNA content no more than 0.001% (w / w), 0.01% (w / w), 0.1 % (w / w), 1% (w / w), 2% (w / w), 3% (w / w), 4% (w / w), 5% (w / w), 6% (w / w), 7% (w / w), 8% (w / w), 9% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 35% (w / w), 40% (w / w), 45% (w / w), 50% (w / w) of total nucleotides on a mass basis, wherein total nucleotide molecules is the total mass of deoxyribonucleotide content and ribonucleotide molecules, and / or after a total DNA digestion by enzymes that digest nucleosides by quantitative liquid chromatography-mass spectrometry (LC-MS), in which the content of DNA is back calculated from a standard curve of each base (i.e., A, C, G, T) as measured by LC-MS.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has a protein (e.g., cell protein (CP), e.g.,45LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO enzyme, a production-related protein, e.g., carrier protein) contamination, impurities, or by-products of no more than 0.1 ng / ml, 1 ng / ml, 5 ng / ml, 10 ng / ml, 15 ng / ml, 20 ng / ml, 25 ng / ml, 30 ng / ml, 35 ng / ml, 40 ng / ml, 50 ng / ml, 60 ng / ml, 70 ng / ml, 80 ng / ml, 90 ng / ml, 100 ng / ml, 200 ng / ml, 300 ng / ml, 400 ng / ml, or 500 ng / ml; or has a protein contamination, impurities, or by-products of less than 0.1 ng, 1 ng, 5 ng, 10 ng, 15 ng, 20 ng, 25 ng, 30 ng, 35 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 200 ng, 300 ng, 400 ng, or 500 ng per milligram (mg) of the circular polyribonucleotide.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) has low levels or is absent of endotoxins, e.g., as measured by the Limulus amebocyte lysate (LAL) test. In some embodiments, the pharmaceutical preparation or composition includes less than 20 EU / kg, 10 EU / kg, 5 EU / kg, or 1 EU / kg endotoxin, or lacks endotoxin as measured by the Limulus amebocyte lysate test. In some embodiments, the pharmaceutical preparation or composition has low levels or in absence of a nuclease or a ligase.In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) includes no greater than about 50% (w / w), 45% (w / w), 40% (w / w), 35% (w / w), 30% (w / w), 25% (w / w), 20% (w / w), 19% (w / w), 18% (w / w), 17% (w / w), 16% (w / w), 15% (w / w), 14% (w / w), 13% (w / w), 12% (w / w), 11% (w / w), 10% (w / w), 9% (w / w), 8% (w / w), 7% (w / w), 6% (w / w), 5% (w / w), 4% (w / w), 3% (w / w), 2% (w / w), 1% (w / w) of at least one enzyme (e.g., polymerase, e.g., RNA polymerase). In some embodiments, a circular polyribonucleotide preparation (e.g., a pharmaceutical preparation or composition containing a circular polyribonucleotide or an intermediate in the production / purification of the circular polyribonucleotide) is sterile or substantially free of microorganisms, e.g., the composition or preparation supports the growth of fewer than 100 viable microorganisms as tested under aseptic conditions, the composition or preparation meets the standard of USP <71 >, and / or the composition or preparation meets the standard of USP <85>. In some embodiments, the pharmaceutical preparation or composition includes a bioburden of less than 100 CFU / 100 ml, 50 CFU / 100 ml, 40 CFU / 100 ml, 30 CFU / 100 ml, 20 CFU / 100 ml, 10 CFU / 100 ml, or 1 CFU / 100 ml before sterilization.In some embodiments, the circular polyribonucleotide preparation can be further purified using known techniques in the art for removing impurities or byproduct, such as column chromatography or pH / vial inactivation.PolynucleotidesThe disclosure features polyribonucleotides that are used in the methods of separation and / or purification, and are present in the compositions described herein. The polyribonucleotides described herein may be linear polyribonucleotides (or linear polyribonucleotide precursors or intermediates),46LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO circular polyribonucleotides, or a combination thereof. In some embodiments, a circular polyribonucleotide is produced from a linear polyribonucleotide precursor or intermediate (e.g., by splicing compatible ends of the linear polyribonucleotide). In some embodiments, a linear polyribonucleotide is transcribed from a deoxyribonucleotide template (e.g., a vector, a linearized vector, or a cDNA).Linear polyribonucleotidesThe disclosure features a linear polyribonucleotide (e.g., linear polyribonucleotide precursor or intermediate) designed and produced to contain one or more dsRNAs, for utilization in separating and purifying circular polyribonucleotides.The linear polyribonucleotide may comprise a formula of 5’-(DS2)-(CE2)-(P)-(CEl)-(DSl)-3’. In this formula, component (CE2) comprises a 5’ circularization element; component (P) comprises a polyribonucleotide cargo; component (CE1) comprises a 3’ circularization element; each of components (DS2) and (DS1) is independently absent or comprises a dsRNA, provided at least one of (DS2) and (DS1) comprises a dsRNA.In some embodiments, component (CE2) may comprise a first annealing region comprising from 8 to 50 ribonucleotides, and component (CE1) may comprise a second annealing region comprising from 8 to 50 ribonucleotides. The first annealing region and the second annealing region have from 80% to 100% complementarity; or alternatively, the first annealing region and the second annealing region comprises from zero to 10 mismatched base pair. Each of components (DS2) and (DS1) may comprise a same or different dsRNA.In some embodiments, component (DS2) is at the utmost 5’ terminus of the linear polyribonucleotide; and / or component (DS1) is at the utmost 3’ terminus of the linear polyribonucleotide. That is, the components (DS2) and / or (DS1) containing the dsRNAs may be at the very terminal ends of the linear polyribonucleotide, and the linear polyribonucleotide does not contain further component at a terminal end beyond the components (DS2) and / or (DS1).Alternatively, the linear polyribonucleotide may contain further component(s) at the 5’- or 3’-terminal end beyond the components (DS2) and / or (DS1). In some embodiments, the linear polyribonucleotide further comprises one or more ribonucleotides between (DS2) and the 5’ terminus of the linear polyribonucleotide; and / or one or more ribonucleotides between (DS1) and the 3’ terminus of the linear polyribonucleotide.In some embodiments, component (CE1) comprises a 5’ self-splicing intron fragment and component (CE2) comprises a 3’ self-splicing intron fragment. The 5’ self-splicing intron fragment and the 3’ self-splicing intron fragment may each be a Group I or Group II self-splicing intron fragment.In some embodiments, the polyribonucleotide cargo of (P) comprises an expression sequence, a non-coding sequence, or an expression sequence and a noncoding sequence. In some embodiments,47LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO the polyribonucleotide cargo of (P) comprises an expression sequence encoding one or more polypeptides (e.g., a peptide that has a biological effect on a subject).In some embodiments, the polyribonucleotide cargo of (P) comprises an open-reading frame (ORF). The ORF may encode a polypeptide. In some embodiments, (P) comprises one or more ORFs. Each of the ORFs may encode a polypeptide. When (P) comprises more than one ORF, each ORF may encode the same polypeptide, or a polypeptide different than that encoded in the other ORF(s).In some embodiments, the polyribonucleotide cargo of (P) comprises an internal ribosome entry site (IRES) (e.g., an IRES). In some embodiments, (P) comprises one or more IRES. In some embodiments, the IRES is operably linked to an expression sequence encoding a polypeptide. In some embodiments, the IRES is operably linked to an ORF. In some embodiments, the IRES is operably linked to an ORF that encodes a polypeptide.In some embodiments, the polyribonucleotide cargo of (P) comprises an expression sequence that is a multicistronic expression construct. Multicistronic expression construct includes a stretch of ribonucleotide sequences that encodes for multiple polypeptides.In some embodiments, the polyribonucleotide cargo of (P) comprises an expression sequence that is a bicistronic expression construct. Bicistronic expression construct contains two open reading frames (ORFs) under the control of a single promoter. In some embodiments, the bicistronic polyribonucleotide cargo of (P) comprises (0RF-2A-0RF). In some embodiments, the bicistronic polyribonucleotide cargo of (P) comprises (ORF-IRES-ORF). In some embodiments, the bicistronic polyribonucleotide cargo of (P) comprises (IRES-ORF-2A-ORF). In some embodiments, the bicistronic polyribonucleotide cargo of (P) comprises (IRES-ORF- IRES-ORF). In some embodiments, the bicistronic polyribonucleotide cargo of (P) comprises (IRES-ORF-spacer-IRES-ORF). Any spacers described herein are applicable for this formula.In some embodiments, the linear polyribonucleotide further comprises at least one spacer region (5 ’-spacer) between (CE2) and (P), and / or at least one spacer region (3 ’-spacer) between (P) and (CE1). In some embodiments, the linear polyribonucleotide may comprise a formula:5’ -(CE2)-(5'-spacer)-(P)-(3'-spacer)-(CEl)-3’ . In one embodiment, the linear polyribonucleotide may have a formula: 5’-(DS2)-(CE2)-(5'-spacer)-(P)-(3'-spacer)-(CEl)-(DSl)-3’.In some embodiments, the linear polyribonucleotide may comprise a formula:5’-(CE2)-(5'-spacer)-(IRES)-(ORF)-(3'-spacer)-(CEl)-3’. In one embodiment, the linear polyribonucleotide may have a formula: 5’-(DS2)-(CE2)-(5'-spacer)-(IRES)-(ORF)-(3'-spacer)-(CEl)-(DSl)-3’.In some embodiments, the linear polyribonucleotide further comprises at least one spacer region between (CE1) and DS1, and / or at least one spacer region between (CE2) and DS2.In some embodiments, each spacer region independently comprises a polyA sequence. In some embodiments, each spacer region independently comprises a polyA-C sequence. In some 48LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO embodiments, each spacer region independently comprises a polyA-G sequence. In some embodiments, each spacer region independently comprises a polyA-T sequence. In some embodiments, each spacer region independently comprises a random sequence.In some embodiments, component (CE2) further comprises (A)-(B)-(C); and / or component (CE1) further comprises (E)-(F)-(G). In these formulas, component (A) comprises a 3' half of Group I or Group II catalytic intron fragment; component (B) comprises a 3’ splice site; component (C) comprises a 3’ exon fragment; component (E) comprises a 5’ exon fragment; component (F) comprises a 5’ splice site; and component (G) comprises a 5' half of Group I or Group II catalytic intron fragment.In some embodiments, component (A) or (C) comprises the first annealing region, and component (E) or (G) comprises the second annealing region. In some embodiments, component (C) comprises the first annealing region and component (E) comprises the second annealing region. In some embodiments, component (A) comprises the first annealing region and component (G) comprises the second annealing region.In some embodiments, the linear polyribonucleotides (e.g., linear polyribonucleotide precursor or intermediate) may include one or more of the following: a 3’ intron fragment; a 3’ splice site; a 3’ exon; a polyribonucleotide cargo; a 5’ exon; a 5’ splice site; and a 5’ intron fragment. In some embodiments, the 3’ intron fragment corresponds to a 3’ portion of a catalytic Group I intron, for example, a catalytic Group I intron from a cyanobacterium Anabaena pre- tRNA-Leu gene, a Tetrahymena pre-rRNA, a T4 phage td gene, or a variant thereof. In some embodiments, the 5’ intron fragment corresponds to a 5’ portion of a catalytic Group I intron, for example, a catalytic Group I intron from a cyanobacterium Anabaena pre-tRNA-Leu gene, a Tetrahymena pre- rRNA, a T4 phage td gene, or a variant thereof.In some embodiments, the linear polyribonucleotide (e.g., linear polyribonucleotide precursor or intermediate) may include additional elements, e.g., outside of or between any of elements described above. For example, any of the above elements may be separated by a spacer sequence, as described herein. In some embodiments, a dsRNA (e.g., dsRNA hairpin) as described herein may be present in any region of the linear polyribonucleotide as described herein. In some embodiments, a linear polyribonucleotide includes, in the following 5’-to-3’ order: a first dsRNA (e.g., dsRNA hairpin), a first circularization element (e.g., a first intron fragment); a polyribonucleotide cargo; a second circularization element (e.g., a second intron fragment); and a second dsRNA (e.g., dsRNA hairpin). In some embodiments, a linear polyribonucleotides includes, in the following 5’-to-3’ order: a dsRNA (e.g., dsRNA hairpin), a 3’ intron fragment; a 3’ splice site; a 3’ exon; a polyribonucleotide cargo; a 5’ exon; a 5’ splice site; a 5' intron fragment; and a second dsRNA (e.g., dsRNA hairpin).In some embodiments, the linear polyribonucleotide has a length of from 50 to 20,000 ribonucleotides, e.g., 300 to 20,000 ribonucleotides (e.g., 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900,49LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO 2,000, 2,500, 3,000, 3,500, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 16,000, 17,000, 18,000, 19,000, or 20,000 ribonucleotides). The linear polyribonucleotide may be, e.g., at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1,000, at least 2,000, at least 3,000, at least 4,000, or at least 5,000 ribonucleotides in length.Circular polyribonucleotidesIn some embodiments, the disclosure features a circular polyribonucleotide purified by the methods described herein. In some embodiments, the circular polyribonucleotide includes a splice junction joining a 5’ exon and a 3’ exon. In some embodiments, the circular polyribonucleotide lacks an intron, e.g., after splicing. In some embodiments, the circular polyribonucleotide lacks a dsRNA (e.g., dsRNA hairpin), e.g., after splicing.In some embodiments, the circular polynucleotide further includes a polyribonucleotide cargo. In some embodiments, the polyribonucleotide cargo includes an expression (or coding) sequence, a non-coding sequence, or a combination of an expression (or coding) sequence and a noncoding sequence. In some embodiments, the polyribonucleotide cargo includes an expression (or coding) sequence encoding a polypeptide. In some embodiments, the polyribonucleotide includes at least one IRES (e.g., an IRES) operably linked to an expression sequence encoding a polypeptide. In some embodiments, the circular polyribonucleotide further includes a spacer region between the at least one IRES and the 5’ exon fragment or the 3’ exon fragment. The spacer region may be, e.g., at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. The spacer region may be, e.g., from 5 to 500 (e.g., 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides. In some embodiments, each spacer region may be from 5 to 10 (e.g., 5, 6, 7, 8, 9, or 10) ribonucleotides in length. In some embodiments, the spacer region includes a polyA sequence. In some embodiments, the spacer region includes a polyA-C, polyA-G, polyA-U, or other heterogenous or random sequence.In some embodiments, the circular polyribonucleotide is at least 20 nucleotides (e.g., at 30, 40, 50, 75, 100, 200, 300, 400, 500, 1,000, 2,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 12,000, 14,000, 15,000, 16,000, 17,000, 18,000, 19,000, or 20,000 nucleotides) in length.In some embodiments, the circular polyribonucleotide is of a sufficient size to accommodate at least one binding site for a ribosome. In some embodiments, the size of a circular polyribonucleotide is a length sufficient to encode useful polypeptides, and thus, lengths of at least 20,000 nucleotides (e.g., at least 15,000, 10,000, 7,500, 5,000, 4,000, 3,000, 2,000, 1,000, 500, 400, 300, 200, or 100 nucleotides) may be produced.In some embodiments, the circular polyribonucleotide includes one or more elements described herein. In some embodiments, the elements are separated from one another by a spacer sequence. In some embodiments, one or more elements are contiguous with one another, e.g., lacking 50LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO a spacer element.In some embodiments, the circular polyribonucleotide includes one or more repetitive elements. In some embodiments, the circular polyribonucleotide includes one or more modifications described herein. In one embodiment, the circular polyribonucleotide contains at least one nucleoside modification. In one embodiment, up to 100% of the nucleosides of the circular polyribonucleotide are modified. In one embodiment, at least one nucleoside modification is a uridine modification or an adenosine modification.As a result of its circularization, the circular polyribonucleotide may include certain characteristics that distinguish it from a linear polyribonucleotide. For example, the circular polyribonucleotide may not contain a dsRNA that is contained in the linear polyribonucleotide precursor or intermediate. In some embodiments, the circular polyribonucleotide is less susceptible to degradation by exonuclease as compared to the linear polyribonucleotide precursor or intermediate. As such, the circular polyribonucleotide is more stable than a linear polyribonucleotide, especially when incubated in the presence of an exonuclease. The increased stability of the circular polyribonucleotide compared with a linear polyribonucleotide makes circular polyribonucleotide more useful as a cell transforming reagent to produce polypeptides and can be stored more easily and for longer than a linear polyribonucleotide. The stability of the circular polyribonucleotide treated with exonuclease can be tested using methods standard in art which determine whether RNA degradation has occurred (e.g., by gel electrophoresis). Moreover, unlike a linear polyribonucleotide, the circular polyribonucleotide is less susceptible to dephosphorylation when the circular polyribonucleotide is incubated with phosphatase, such as calf intestine phosphatase.Polyribonucleotide CargoA polyribonucleotide cargo described herein includes any sequence including at least one polyribonucleotide. In some embodiments, the polyribonucleotide cargo includes an expression (or coding) sequence, a non-coding sequence, or an expression (or coding) sequence and a non-coding sequence. In some embodiments, the polyribonucleotide cargo includes an expression sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo includes an IRES operably linked to an expression sequence encoding a polypeptide. In some embodiments, the polyribonucleotide cargo includes an expression sequence that encodes a polypeptide that has a biological effect on a subject.A polyribonucleotide cargo may, for example, include at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 1,000 nucleotides, at least about 2,000 nucleotides, at least about 5,000 nucleotides, at least about 6,000 nucleotides, at least about 7,000 nucleotides, at least about 8,000 nucleotides, at least about 9,000 nucleotides, at least about 10,000 nucleotides, at least about 12,00051LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO nucleotides, at least about 14,000 nucleotides, at least about 15,000 nucleotides, at least about 16,000 nucleotides, at least about 17,000 nucleotides, at least about 18,000 nucleotides, at least about 19,000 nucleotides, or at least about 20,000 nucleotides. In some embodiments, the polyribonucleotides cargo includes from 1-20,000 nucleotides, 1-10,000 nucleotides, 1-5,000 nucleotides, 100-20,000 nucleotide, 100-10,000 nucleotides, 100-5,000 nucleotides, 500-20,000 nucleotides, 500-10,000 nucleotides, 500-5,000 nucleotides, 1,000-20,000 nucleotides, 1,000-10,000 nucleotides, or 1,000-5,000 nucleotides.In some embodiments, the polyribonucleotide cargo includes one or more expression (or coding) sequences, wherein each expression sequence encodes a polypeptide. In some embodiments, the polyribonucleotide cargo includes one or more noncoding sequences. In some embodiments, the polyribonucleotide consists entirely of non-coding sequence(s). In some embodiments, the polyribonucleotide cargo includes a combination of expression and noncoding sequences.In some embodiments, the polyribonucleotide cargo is used as an effector in therapy or agriculture. For example, a circular polyribonucleotide prepared by the methods described herein may be administered to a subject (e.g., in a pharmaceutical, veterinary, or agricultural composition). In another example, a circular polyribonucleotide prepared by the methods described herein may be delivered to a cell. In some embodiments, the polyribonucleotide includes any feature, or any combination of features as disclosed in PCT Publication No. WO 2019 / 118919, which is hereby incorporated by reference in its entirety.In some embodiments, the polyribonucleotide cargo includes an open reading frame (ORF). In some embodiments, the ORF is operably linked to an IRES. In some embodiments, the ORF encodes a polypeptide. In some embodiments, the polyribonucleotide cargo includes more than one ORF. In some embodiments, each ORF encodes a polypeptide. In some embodiments, the ORF encodes a polypeptide, and the polyribonucleotide (e.g., circular polyribonucleotide) provides increased expression (e.g., by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) of the polypeptide, e.g., as compared to a linear polyribonucleotide encoding the polypeptide. In some embodiments, increased purity of the polyribonucleotide, e.g., a circular polyribonucleotide, results in increased expression (e.g., by at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more) of the polypeptide, e.g., as compared to a population of circular and linear polyribonucleotides.Polypeptide expression sequencesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes one or more expression (or coding) sequences, wherein each expression (coding) sequence encodes a polypeptide. In some embodiments, the circular polyribonucleotide includes two, three, four, five, six, seven, eight, nine, ten or more expression sequences.Each encoded polypeptide may be linear or branched. The polypeptide may have a length 52LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO from about 5 to about 40,000 amino acids, about 15 to about 35,000 amino acids, about 20 to about 30,000 amino acids, about 25 to about 25,000 amino acids, about 50 to about 20,000 amino acids, about 100 to about 15,000 amino acids, about 200 to about 10,000 amino acids, about 500 to about 5,000 amino acids, about 1,000 to about 2,500 amino acids, or any range therebetween. In some embodiments, the polypeptide has a length of less than about 40,000 amino acids, less than about 35,000 amino acids, less than about 30,000 amino acids, less than about 25,000 amino acids, less than about 20,000 amino acids, less than about 15,000 amino acids, less than about 10,000 amino acids, less than about 9,000 amino acids, less than about 8,000 amino acids, less than about 7,000 amino acids, less than about 6,000 amino acids, less than about 5,000 amino acids, less than about 4,000 amino acids, less than about 3,000 amino acids, less than about 2,500 amino acids, less than about 2,000 amino acids, less than about 1,500 amino acids, less than about 1,000 amino acids, less than about 900 amino acids, less than about 800 amino acids, less than about 700 amino acids, less than about 600 amino acids, less than about 500 amino acids, less than about 400 amino acids, or less than about 300 amino acids.Suitable polypeptides may include naturally occurring polypeptides or non-naturally occurring polypeptides. In some instances, the polypeptide may be a functional fragment or variant of a reference polypeptide (e.g., an enzymatically active fragment or variant of an enzyme). For example, the polypeptide may be a functionally active variant of any of the polypeptides described herein with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, e.g., over a specified region or over the entire sequence, to a sequence of a polypeptide described herein or a naturally occurring polypeptide. In some instances, the polypeptide may have at least 50% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99%, or greater) identity to a protein of interest.Some examples of a polypeptide include, but are not limited to, a fluorescent tag or marker, an antigen, a therapeutic polypeptide, a plant-modifying polypeptide, or a polypeptide for agricultural applications.In some embodiments, the polyribonucleotide expresses a non-human protein.In some embodiments, polypeptides include multiple polypeptides, e.g., multiple copies of one polypeptide sequence, or multiple different polypeptide sequences. In some embodiments, multiple polypeptides are connected by linker amino acids or spacer amino acids.In some embodiments, the polynucleotide cargo includes a sequence encoding a signal peptide. Many signal peptide sequences have been described, for example, the Tat (Twin-arginine translocation) signal sequence is typically an N-terminal peptide sequence containing a consensus SRRxFLK (SEQ ID NO. 1) “twin-arginine” motif, which serves to translocate a folded protein containing such a Tat signal peptide across a lipid bilayer. Signal peptides are also useful for directing a protein to specific organelles as is known in the art.53LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO In some embodiments, the polynucleotide cargo includes sequence encoding a cellpenetrating peptide (CPP) as is known in the art. An example of a commonly used CPP sequence is a poly-arginine sequence, e.g., octoarginine or nonoarginine, which can be fused to the C-terminus of the CGI peptide.In some embodiments, the polynucleotide cargo includes sequence encoding a selfassembling peptide; see, e.g., Miki et al. (2021 ) Nature Communications, 21:3412, DOI:10.1038 / s41467-021-23794-6.In some embodiments, the expression (or coding) sequence includes a poly-A sequence (e.g., at the 3’ end of an expression sequence). In some embodiments, the length of a poly-A sequence is greater than 10 nucleotides in length. In one embodiment, the poly-A sequence is greater than 15 nucleotides in length (e.g., at least or greater than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the poly-A sequence is designed according to the descriptions of the poly-A sequence in
[0202] -
[0204] of WO 2019 / 118919, which is incorporated herein by reference in its entirety. In some embodiments, the expression sequence lacks a poly-A sequence (e.g., at the 3’ end of an expression sequence).In some embodiments, a circular polyribonucleotide includes a poly A, lacks a poly A, or has a modified polyA to modulate one or more characteristics of the circular polyribonucleotide. In some embodiments, the circular polyribonucleotide lacking a polyA or having modified polyA improves one or more functional characteristics, e.g., immunogenicity (e.g., the level of one or more marker of an immune or inflammatory response), half-life, and / or expression efficiency.Therapeutic polypeptidesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes at least one expression sequence encoding a therapeutic polypeptide. In some embodiments, the circular polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten or more therapeutic polypeptides. The protein may treat or prevent a disease, disorder, condition, or a symptom thereof in the subject in need thereof. In some embodiments, the therapeutic protein can compensate for a mutated, under-expressed, or absent protein in the subject in need thereof. In some embodiments, the therapeutic protein can target, interact with, or bind to a cell, tissue, or virus in the subject in need thereof. A therapeutic polypeptide can be a polypeptide that can be secreted from a cell, or localized to the cytoplasm, nucleus, or membrane compartment of a cell.A therapeutic polypeptide may be a hormone, a neurotransmitter, a growth factor, an enzyme (e.g., oxidoreductase, metabolic enzyme, mitochondrial enzyme, oxygenase, dehydrogenase, ATP-independent enzyme, lysosomal enzyme, desaturase), a cytokine, a transcription factor, an antigen binding polypeptide (e.g., antigen binding antibody or antibody-like fragments, such as single chain 54LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO antibodies, nanobodies or other Ig heavy chain or light chain containing polypeptides), an Fc fusion protein, an anticoagulant, a blood factor, a bone morphogenetic protein, an interferon, an interleukin, a thrombolytic, an antigen (e.g.,. a tumor, viral, or bacterial antigen), a nuclease (e.g., an endonuclease such as a Cas protein, e.g., Cas9), a membrane protein (e.g., a chimeric antigen receptor (CAR), a transmembrane receptor, a G-protein-coupled receptor (GPCR), a receptor tyrosine kinase (RTK), an antigen receptor, an ion channel, or a membrane transporter), a secreted protein, a gene editing protein (e.g., a CRISPR-Cas, TALEN, or zinc finger), or a gene writing protein (see, e.g., WO 2020 / 047124, which is incorporated herein by reference in its entirety).In some embodiments, the therapeutic polypeptide is an antibody, e.g., a full-length antibody, an antibody fragment, or a portion thereof. In some embodiments, the antibody expressed by the polyribonucleotide (e.g., circular polyribonucleotide) can be of any isotype, such as IgA, IgD, IgE, IgG, IgM. In some embodiments, the polyribonucleotide expresses a portion of an antibody, such as a light chain, a heavy chain, a Fc fragment, a CDR (complementary determining region), a Fv fragment, or a Fab fragment, a further portion thereof. In some embodiments, the polyribonucleotide expresses one or more portions of an antibody. For instance, the polyribonucleotide can include more than one expression sequence, each of which expresses a portion of an antibody, and the sum of which can constitute the antibody. In some embodiments, the polyribonucleotide includes one expression sequence coding for the heavy chain of an antibody, and another expression sequence coding for the light chain of the antibody. When the polyribonucleotide is expressed in a cell, the light chain and heavy chain can be subject to appropriate modification, folding, or other post-translation modification to form a functional antibody.Plant-modifying polypeptidesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes at least one expression (or coding) sequence encoding a plant-modifying polypeptide. A “plant-modifying polypeptide” refers to a polypeptide that can alter the genetic properties (e.g., increase gene expression, decrease gene expression, or otherwise alter the nucleotide sequence of DNA or RNA), epigenetic properties, or physiological or biochemical properties of a plant in a manner that results in a change in the plant’s physiology or phenotype, e.g., an increase or decrease in plant fitness. In some embodiments, the polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten or more different plant-modifying polypeptides, or multiple copies of one or more plant-modifying polypeptides. A plant-modifying polypeptide may change the physiology or phenotype of, or increase the fitness of, a variety of plants, or can be one that effects such change(s) in one or more specific plants (e.g., a specific species or genera of plants).Examples of polypeptides that can be used herein can include an enzyme (e.g., a metabolic recombinase, a helicase, an integrase, a RNAse, a DNAse, or a ubiquitination protein), a pore-forming protein, a signaling ligand, a cell penetrating peptide, a transcription factor, a receptor, an antibody, a 55LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO nanobody, a gene editing protein (e.g., CRISPR-Cas endonuclease, TALEN, or zinc finger), riboprotein, a protein aptamer, or a chaperone.Agricultural polypeptidesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes at least one expression (or coding) sequence encoding an agricultural polypeptide. An agricultural polypeptide is a polypeptide that is suitable for an agricultural use. In some embodiments, an agricultural polypeptide is applied to a plant or seed (e.g., by foliar spray, dusting, injection, or seed coating) or to the plant’s environment (e.g., by soil drench or granular soil application), resulting in an alteration of the plant’s physiology, phenotype, or fitness. Embodiments of an agricultural polypeptide include polypeptides that alter a level, activity, or metabolism of one or more microorganisms that are resident in or on a plant or non-human animal host, the alteration resulting in an increase in the host’s fitness. In some embodiments, the agricultural polypeptide is a plant polypeptide. In some embodiments, the agricultural polypeptide is an insect polypeptide. In some embodiments, the agricultural polypeptide has a biological effect when contacted with a non-human vertebrate animal, invertebrate animal, microbial, or plant cell. In some embodiments, the polyribonucleotide encodes two, three, four, five, six, seven, eight, nine, ten or more agricultural polypeptides, or multiple copies of one or more agricultural polypeptides.Embodiments of polypeptides useful in agricultural applications include, for example, bacteriocins, lysins, antimicrobial peptides, nodule C-rich peptides, and bacteriocyte regulatory peptides. Such polypeptides can be used to alter the level, activity, or metabolism of target microorganisms for increasing the fitness of insects, such as honeybees and silkworms. Embodiments of agriculturally useful polypeptides also include peptide toxins, such as those naturally produced by entomopathogenic bacteria (e.g., Bacillus thuringiensis, Photorhabdus luminescens, Serratia entomophila, or Xenorhabdus nematophila), as is known in the art. Embodiments of agriculturally useful polypeptides also include polypeptides (including small peptides such as cyclodipeptides or diketopiperazines) for controlling agriculturally important pests or pathogens, e.g., antimicrobial polypeptides or antifungal polypeptides for controlling diseases in plants, or pesticidal polypeptides (e.g., insecticidal polypeptides or nematicidal polypeptides) for controlling invertebrate pests such as insects or nematodes. Embodiments of agriculturally useful polypeptides also include antibodies, nanobodies, and fragments thereof, e.g., antibody or nanobody fragments that retain at least some (e.g., at least 10%) of the specific binding activity of the intact antibody or nanobody. Embodiments of agriculturally useful polypeptides also include transcription factors, e.g., plant transcription factors. Embodiments of agriculturally useful polypeptides also include nucleases, for example, exonucleases or endonucleases (e.g., Cas nucleases such as Cas9 or Casl2a). Embodiments of agriculturally useful polypeptides further include cell -penetrating peptides, enzymes (e.g., amylases, cellulases, peptidases, lipases, chitinases), peptide pheromones (for example, yeast mating pheromones, invertebrate 56LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO reproductive and larval signaling pheromones, see, e.g., Altstein (2004) PEPTIDES, 25:1373-76).Internal Ribosomal Entry SitesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes one or more internal ribosome entry site (IRES) elements. In some embodiments, the IRES is operably linked to one or more expression (or coding) sequences (e.g., each IRES is operably linked to one or more expression (or coding) sequences). In some embodiments, the IRES is located between a heterologous promoter and the 5’ end of a coding sequence.A suitable IRES element to include in a polyribonucleotide includes an RNA sequence capable of engaging a eukaryotic ribosome. In some embodiments, the IRES element is at least about 5 nt, at least about 8 nt, at least about 9 nt, at least about 10 nt, at least about 15 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, at least about 40 nt, at least about 50 nt, at least about 100 nt, at least about 200 nt, at least about 250 nt, at least about 350 nt, or at least about 500 nt.In some embodiments, the IRES element is derived from the DNA of an organism including, but not limited to, a virus, a mammal, and a Drosophila. Such viral DNA may be derived from, but is not limited to, picomavirus complementary DNA (cDNA), with encephalomyocarditis virus (EMCV) cDNA and poliovirus cDNA. In one embodiment, Drosophila DNA from which an IRES element is derived includes, but is not limited to, an Antennapedia gene from Drosophila melanogaster.In some embodiments, if present, the IRES sequence is an IRES sequence of Taura syndrome virus, Triatoma virus, Theiler’s encephalomyelitis virus, simian Virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, human poliovirus 1, Plautia stall intestine virus, Kashmir bee virus, Human rhinovirus 2 (HRV-2), Homalodisca coagulata virus-1, Human Immunodeficiency Virus type 1, Homalodisca coagulata virus- 1, Himetobi P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picoma-like virus, Encephalomyocarditis virus (EMCV), Drosophila C Virus, Crucifer tobamo vims, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black Queen Cell Virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus (AEV), Acute bee paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTPA1, Human AML1 / RUNX1, Drosophila antennapedia, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAPl, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1 alpha, Human n.myc, Mouse Gtx, Human p27kipl, Human PDGF2 / c-sis, Human p53, Human Pim-1, Mouse Rbm3, Drosophila reaper, Canine Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Salivirus, Cosavirus, Parechovirus, Drosophila hairless, S. cerevisiae TFIID, S. cerevisiae YAP1, Human c-src, Human FGF-1, Simian picomavirus, Turnip crinkle virus, Aichivirus, Crohivirus, Echovirus 11, an aptamer to eIF4G, Coxsackievirus B3 (CVB3) or Coxsackievirus A (CVB1 / 2). In yet another embodiment, the IRES is an IRES sequence of Coxsackievirus B3 (CVB3). In a further embodiment, the IRES is an IRES sequence of57LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Encephalomyocarditis virus (EMCV). In a further embodiment, the IRES is an IRES sequence of Theiler’s encephalomyelitis virus.In some embodiments, the polyribonucleotide includes at least one IRES flanking at least one (e.g., 2, 3, 4, 5 or more) expression sequence. In some embodiments, the IRES flanks both sides of at least one (e.g., 2, 3, 4, 5 or more) expression sequence. In some embodiments, the polyribonucleotide includes one or more IRES sequences on one or both sides of each expression sequence, leading to separation of the resulting peptide(s) and or polypeptide(s).In some embodiments, the polyribonucleotide cargo includes an IRES. For example, the polyribonucleotide cargo may include a circular RNA IRES, e.g., as described in Chen et al. Mol. Cell. 81(20):4300-18 (2021), which is hereby incorporated by reference in its entirety.Regulatory ElementsIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes one or more regulatory elements. In some embodiments, the polyribonucleotide includes a regulatory element, e.g., a sequence that modifies expression of an expression sequence within the polyribonucleotide.A regulatory element may include a sequence that is located adjacent to an expression sequence that encodes an expression product. A regulatory element may be linked operatively to the adjacent sequence. A regulatory element may increase an amount of product expressed as compared to an amount of the expressed product when no regulatory element exists. In addition, one regulatory element can increase the amount or number of products expressed for multiple expression sequences attached in tandem. Hence, one regulatory element can enhance the expression of one or more expression sequences. Multiple regulatory elements are well-known to persons of ordinary skill in the art.In some embodiments, the regulatory element is a translation modulator. A translation modulator can modulate translation of the expression sequence in the polyribonucleotide. A translation modulator can be a translation enhancer or suppressor. In some embodiments, the polyribonucleotide includes at least one translation modulator adjacent to at least one expression sequence. In some embodiments, the polyribonucleotide includes a translation modulator adjacent each expression sequence. In some embodiments, the translation modulator is present on one or both sides of each expression sequence, leading to separation of the expression products, e.g., peptide(s) and or polypeptide (s).In some embodiments, the regulatory element is a microRNA (miRNA) or a miRNA binding site.Further examples of regulatory elements are described, e.g., in paragraphs
[0154] -
[0161] of WO 2019 / 118919, which is hereby incorporated by reference in its entirety.58LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Translation Initiation SequencesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes at least one translation initiation sequence. In some embodiments, the polyribonucleotide includes a translation initiation sequence operably linked to an expression sequence.In some embodiments, the polyribonucleotide encodes a polypeptide and may include a translation initiation sequence, e.g., a start codon. In some embodiments, the translation initiation sequence includes a Kozak or Shine-Dalgamo sequence. In some embodiments, the polyribonucleotide includes the translation initiation sequence, e.g., Kozak sequence, adjacent to an expression sequence. In some embodiments, the translation initiation sequence is a non-coding start codon. In some embodiments, the translation initiation sequence, e.g., Kozak sequence, is present on one or both sides of each expression sequence, leading to separation of the expression products. In some embodiments, the polyribonucleotide includes at least one translation initiation sequence adjacent to an expression sequence. In some embodiments, the translation initiation sequence provides conformational flexibility to the polyribonucleotide. In some embodiments, the translation initiation sequence is within a single stranded region of the polyribonucleotide. Further examples of translation initiation sequences are described in paragraphs
[0163] -
[0165] of WO 2019 / 118919, which is hereby incorporated by reference in its entirety.The polyribonucleotide may include more than 1 start codon such as, but not limited to, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 50, at least 60 or more than 60 start codons. Translation may initiate on the first start codon or may initiate downstream of the first start codon.In some embodiments, the polyribonucleotide may initiate at a codon which is not the first start codon, e.g., AUG. Translation of the polyribonucleotide may initiate at an alternative translation initiation sequence, such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG. In some embodiments, translation begins at an alternative translation initiation sequence under selective conditions, e.g., stress induced conditions. As a nonlimiting example, the translation of the polyribonucleotide may begin at alternative translation initiation sequence, such as ACG. As another non-limiting example, the polyribonucleotide translation may begin at alternative translation initiation sequence, CTG / CUG. As another nonlimiting example, the polyribonucleotide translation may begin at alternative translation initiation sequence, GTG / GUG. As another non-limiting example, the polyribonucleotide may begin translation at a repeat-associated non- AUG (RAN) sequence, such as an alternative translation initiation sequence that includes short stretches of repetitive RNA e.g., CGG, GGGGCC, CAG, CTG.Termination Elements59LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO In some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes least one termination element. In some embodiments, the polyribonucleotide includes a termination element operably linked to an expression sequence. In some embodiments, the polynucleotide lacks a termination element.In some embodiments, the polyribonucleotide includes one or more expression sequences, and each expression sequence may or may not have a termination element. In some embodiments, the polyribonucleotide includes one or more expression sequences, and the expression sequences lack a termination element, such that the polyribonucleotide is continuously translated. Exclusion of a termination element may result in rolling circle translation or continuous expression of expression product.In some embodiments, the circular polyribonucleotide includes one or more expression sequences, and each expression sequence may or may not have a termination element. In some embodiments, the circular polyribonucleotide includes one or more expression sequences, and the expression sequences lack a termination element, such that the circular polyribonucleotide is continuously translated. Exclusion of a termination element may result in rolling circle translation or continuous expression of expression product, e.g., peptides or polypeptides, due to lack of ribosome stalling or fall-off. In such an embodiment, rolling circle translation expresses a continuous expression product through each expression sequence. In some other embodiments, a termination element of an expression sequence can be part of a stagger element. In some embodiments, one or more expression sequences in the circular polyribonucleotide includes a termination element.However, rolling circle translation or expression of a succeeding (e.g., second, third, fourth, fifth, etc.) expression sequence in the circular polyribonucleotide is performed. In such instances, the expression product may fall off the ribosome when the ribosome encounters the termination element, e.g., a stop codon, and terminates translation. In some embodiments, translation is terminated while the ribosome, e.g., at least one subunit of the ribosome, remains in contact with the circular polyribonucleotide.In some embodiments, the circular polyribonucleotide includes a termination element at the end of one or more expression sequences. In some embodiments, one or more expression sequences includes two or more termination elements in succession. In such embodiments, translation is terminated and rolling circle translation is terminated. In some embodiments, the ribosome completely disengages with the circular polyribonucleotide. In some such embodiments, production of a succeeding (e.g., second, third, fourth, fifth, etc.) expression sequence in the circular polyribonucleotide may require the ribosome to reengage with the circular polyribonucleotide prior to initiation of translation. Termination elements include an in-frame nucleotide triplet that signals termination of translation, e.g., UAA, UGA, UAG. In some embodiments, one or more termination elements in the circular polyribonucleotide are frame-shifted termination elements, such as but not limited to, off-frame or -1 and +1 shifted reading frames (e.g., hidden stop) that may terminate 60LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO translation. Frame-shifted termination elements include nucleotide triples, TAA, TAG, and TGA that appear in the second and third reading frames of an expression sequence. Frame-shifted termination elements may be important in preventing misreads of mRNA, which is often detrimental to the cell. In some embodiments, the termination element is a stop codon. Further examples of termination elements are described in paragraphs
[0169] -
[0170] of WO 2019 / 118919, which is hereby incorporated by reference in its entirety.Stagger ElementsIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes at least one stagger element adjacent to an expression sequence. In some embodiments, the polyribonucleotide includes a stagger element adjacent to each expression sequence. In some embodiments, the stagger element is present on one or both sides of each expression sequence, leading to separation of the expression products, e.g., peptide(s) and or polypeptide(s). In some embodiments, the stagger element is a portion of the one or more expression sequences. In some embodiments, the polyribonucleotide includes one or more expression sequences, and each of the one or more expression sequences is separated from a succeeding expression sequence by a stagger element on the circular polyribonucleotide. In some embodiments, the stagger element prevents generation of a single polypeptide (a) from two rounds of translation of a single expression sequence or (b) from one or more rounds of translation of two or more expression sequences. In some embodiments, the stagger element is a sequence separate from the one or more expression sequences. In some embodiments, the stagger element includes a portion of an expression sequence of the one or more expression sequences.In some embodiments, the polyribonucleotide includes a stagger element. To avoid production of a continuous expression product, e.g., peptide or polypeptide, while maintaining rolling circle translation, a stagger element may be included to induce ribosomal pausing during translation. In some embodiments, the stagger element is at 3’ end of at least one of the one or more expression sequences. The stagger element can be configured to stall a ribosome during rolling circle translation of the circular polyribonucleotide. Exemplary stagger elements include those disclosed on page 45 of WO 2023 / 069397, which is incorporated herein by reference in its entirety.In some embodiments, a stagger element includes one or more modified nucleotides or unnatural nucleotides that induce ribosomal pausing during translation. Unnatural nucleotides may include peptide nucleic acid (PNA), Morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Examples such as these are distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule. Modifications can include any modification to the sugar, the nucleobase, the intemucleoside linkage (e.g., to a linking phosphate / to a phosphodiester linkage / to the phosphodiester backbone), and any combination thereof that can induce ribosomal pausing during translation.61LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO In some embodiments, the stagger element is present in the polyribonucleotide in other forms. For example, a stagger element may include a termination element of a first expression sequence in the circular polyribonucleotide, and a nucleotide spacer sequence that separates the termination element from a first translation initiation sequence of an expression succeeding the first expression sequence. In some examples, the first stagger element of the first expression sequence is upstream of (5’ to) a first translation initiation sequence of the expression succeeding the first expression sequence in the circular polyribonucleotide. In some embodiments, the first expression sequence and the expression sequence succeeding the first expression sequence are two separate expression sequences in the circular polyribonucleotide. The distance between the first stagger element and the first translation initiation sequence can enable continuous translation of the first expression sequence and its succeeding expression sequence.In some embodiments, the first stagger element includes a termination element and separates an expression product of the first expression sequence from an expression product of its succeeding expression sequences, thereby creating discrete expression products. In some cases, the polyribonucleotide including the first stagger element upstream of the first translation initiation sequence of the succeeding sequence in the polyribonucleotide is continuously translated, while a corresponding circular polyribonucleotide including a stagger element of a second expression sequence that is upstream of a second translation initiation sequence of an expression sequence succeeding the second expression sequence is not continuously translated. In some embodiments, there is only one expression sequence in the circular polyribonucleotide, and the first expression sequence and its succeeding expression sequence are the same expression sequence. In some embodiments, a stagger element includes a first termination element of a first expression sequence in the circular polyribonucleotide, and a nucleotide spacer sequence that separates the termination element from a downstream translation initiation sequence. For instance, the first stagger element is upstream of (5’ to) a first translation initiation sequence of the first expression sequence in the polyribonucleotide. In some embodiments, the distance between the first stagger element and the first translation initiation sequence enables continuous translation of the first expression sequence and any succeeding expression sequences.In some embodiments, the first stagger element separates one round expression product of the first expression sequence from the next round expression product of the first expression sequences, thereby creating discrete expression products. In some embodiments, the polyribonucleotide including the first stagger element upstream of the first translation initiation sequence of the first expression sequence in the polyribonucleotide is continuously translated, while a corresponding circular polyribonucleotide including a stagger element upstream of a second translation initiation sequence of a second expression sequence in the corresponding circular polyribonucleotide is not continuously translated. In some embodiments, the distance between the second stagger element and the second translation initiation sequence is at least 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, or lOx greater in the 62LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO corresponding circular polyribonucleotide than a distance between the first stagger element and the first translation initiation in the circular polyribonucleotide. In some embodiments, the distance between the first stagger element and the first translation initiation and between the second stagger element and the second translation initiation may each independently be at least 2 nt, 3 nt, 4 nt, 5 nt, 6 nt, 7 nt, 8 nt, 9 nt, 10 nt, 11 nt, 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt, 20 nt, 25 nt, 30 nt, 35 nt, 40 nt, 45 nt, 50 nt, 55 nt, 60 nt, 65 nt, 70 nt, 75 nt, or greater. In some embodiments, the distance between the second stagger element and the second translation initiation is greater than the distance between the first stagger element and the first translation initiation. In some embodiments, the polyribonucleotide includes more than one expression sequence.Examples of stagger elements are described in paragraphs
[0172] -
[0175] of WO 2019 / 118919, which is hereby incorporated by reference in its entirety.Protein-binding SequencesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes one or more protein binding sites that enable a protein, e.g., a ribosome, to bind to an internal site in the RNA sequence. By engineering protein binding sites, e.g., ribosome binding sites, into the circular polyribonucleotide, the circular polyribonucleotide may evade or have reduced detection by the host’s immune system, have modulated degradation, or modulated translation, by masking the circular polyribonucleotide from components of the host’s immune system.In some embodiments, the polyribonucleotide includes at least one immunoprotein binding site, for example to evade immune responses, e.g., CTL (cytotoxic T lymphocyte) responses. In some embodiments, the immunoprotein binding site is a nucleotide sequence that binds to an immunoprotein and aids in masking the circular polyribonucleotide as exogenous. In some embodiments, the immunoprotein binding site is a nucleotide sequence that binds to an immunoprotein and aids in hiding the circular polyribonucleotide as exogenous or foreign.In some embodiments, the polyribonucleotide includes one or more RNA sequences including a ribosome binding site, e.g., an initiation codon.In some embodiments, the polyribonucleotide encodes a protein binding sequence that binds to a protein. In some embodiments, the protein binding sequence targets or localizes the circular polyribonucleotide to a specific target. In some embodiments, the protein binding sequence specifically binds an arginine-rich region of a protein.In some embodiments, the protein binding site includes, but is not limited to, a binding site to the protein such as ACINI, AGO, APOBEC3F, APOBEC3G, ATXN2, AUH, BCCIP, CAPRIN1, CELF2, CPSF1, CPSF2, CPSF6, CPSF7, CSTF2, CSTF2T, CTCF, DDX21, DDX3, DDX3X, DDX42, DGCR8, EIF3A, EIF4A3, EIF4G2, ELAVL1, ELAVL3, FAM120A, FBL, FIP1L1, FKBP4, FMRI, FUS, FXR1, FXR2, GNE3, GTF2F1, HNRNPA1, HNRNPA2B1, HNRNPC, HNRNPK, HNRNPE, HNRNPM, HNRNPU, HNRNPUE1, IGF2BP1, IGF2BP2, IGF2BP3, IEF3, KHDRBS1,63LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO LARP7, LIN28A, LIN28B, m6A, MBNL2, METTL3, MOVIO, MSI1, MSI2, NONO, NONO, NOP58, NPM1, NUDT21, PCBP2, POLR2A, PRPF8, PTBP1, RBFOX2, RBM10, RBM22, RBM27, RBM47, RNPS1, SAFB2, SBDS, SF3A3, SF3B4, SIRT7, SLBP, SLTM, SMNDC1, SND1, SRRM4, SRSF1, SRSF3, SRSF7, SRSF9, TAF15, TARDBP, TIA1, TNRC6A, TOP3B, TRA2A, TRA2B, U2AF1, U2AF2, UNK, UPF1, WDR33, XRN2, YBX1, YTHDC1, YTHDF1, YTHDF2, YWHAG, ZC3H7B, PDK1, AKT1, and any other protein that binds RNA.Spacer SequencesIn some embodiments, the polyribonucleotide described herein includes one or more spacer sequences. A spacer refers to any contiguous nucleotide sequence (e.g., of one or more nucleotides) that provides distance or flexibility between two adjacent polynucleotide regions. Spacers may be present in between any of the nucleic acid elements described herein. Spacer may also be present within a nucleic acid element described herein.The spacer may be, e.g., at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. In some embodiments, each spacer region is at least 5 (e.g., at least 10, at least 15, at least 20) ribonucleotides in length. Each spacer region may be, e.g., from 5 to 500 (e.g., 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500) ribonucleotides in length. In some embodiments, each spacer region may be from 5 to 10 (e.g., 5, 6, 7, 8, 9, or 10) ribonucleotides in length. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may include a polyA sequence. The first spacer region, the second spacer region, or the first spacer region and the second spacer region may include a polyA-C sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region includes a polyA-G sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region includes a polyA-T sequence. In some embodiments, the first spacer region, the second spacer region, or the first spacer region and the second spacer region includes a random sequence.Spacers may also be present within a nucleic acid region described herein. For example, a polynucleotide cargo region may include one or multiple spacers. Spacers may separate regions within the polynucleotide cargo. In some embodiments, the spacer sequence can be, for example, at least 10, at least 15, or at least 30 nucleotides in length. In some embodiments, the spacer sequence is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the spacer sequence is no more than 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides in length. In some embodiments the spacer sequence is from 20 to 50 nucleotides in length. In certain embodiments, the spacer sequence is 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.The spacer sequence can be polyA sequences, polyA-C sequences, polyC sequences, or poly- 64LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO U sequences. In some embodiments, the spacer sequences can be polyA-T, polyA-C, polyA-G, or a random sequence.A spacer sequence may be used to separate an IRES from adjacent structural elements to maintain the structure and function of the IRES or the adjacent element. A spacer can be specifically engineered depending on the IRES. In some embodiments, an RNA folding computer software, such as RNAFold, can be utilized to guide designs of the various elements of the vector, including the spacers.In some embodiments, the polyribonucleotide includes a 5’ spacer sequence. In some embodiments, the polyribonucleotide includes a 3’ spacer sequence.In one embodiment, the polyribonucleotide includes a 5’ spacer sequence, but not a 3’ spacer sequence. In another embodiment, the polyribonucleotide includes a 3’ spacer sequence, but not a 5’ spacer sequence. In another embodiment, the polyribonucleotide includes neither a 5’ spacer sequence, nor a 3’ spacer sequence. In another embodiment, the polyribonucleotide does not include an IRES sequence. In a further embodiment, the polyribonucleotide does not include an IRES sequence, a 5’ spacer sequence or a 3’ spacer sequence.In some embodiments, the spacer sequences can also include the non-coding sequences or the untranslated region sequences discussed infra.Non-coding SequencesIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes one or more non-coding sequence, e.g., a sequence that does not encode the expression of polypeptide. In some embodiments, the polyribonucleotide includes two, three, four, five, six, seven, eight, nine, ten or more than ten non-coding sequences. In some embodiments, the polyribonucleotide does not encode a polypeptide expression sequence.Noncoding sequences can be natural or synthetic sequences. In some embodiments, a noncoding sequence can alter cellular behavior, such as e.g., lymphocyte behavior. In some embodiments, the noncoding sequences are antisense to cellular RNA sequences.In some embodiments, the polyribonucleotide includes regulatory nucleic acids that are RNA or RNA-like structures typically from about 5-500 base pairs (depending on the specific RNA structure (e.g., miRNA 5-30 bps, IncRNA 200-500 bps) and may have a nucleobase sequence identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene within the cell. In some embodiments, the polyribonucleotide includes regulatory nucleic acids that encode an RNA precursor that can be processed to a smaller RNA, e.g., a miRNA precursor, which can be from about 50 to about 1000 bp, that can be processed to a smaller miRNA intermediate or a mature miRNA.Long non-coding RNAs (IncRNA) are defined as non-protein coding transcripts longer than 100 nucleotides. Many IncRNAs are characterized as tissue specific. Divergent IncRNAs that are 65LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO transcribed in the opposite direction to nearby protein-coding genes include a significant proportion (e.g., about 20% of total IncRNAs in mammalian genomes) and possibly regulate the transcription of the nearby gene. In one embodiment, the polyribonucleotide includes a sense strand or antisense strand of an IncRNA.In some embodiments, the polyribonucleotide encodes a regulatory nucleic acid that is substantially complementary, or fully complementary, to all or to at least one fragment of an endogenous gene or gene product (e.g., mRNA). In some embodiments, the regulatory nucleic acids complement sequences at the boundary between introns and exons, in between exons, or adjacent to an exon, to prevent the maturation of newly generated nuclear RNA transcripts of specific genes into mRNA for transcription. The regulatory nucleic acids that are complementary to specific genes can hybridize with the mRNA for that gene and prevent its translation. The antisense regulatory nucleic acid can be DNA, RNA, or a derivative or hybrid thereof. In some embodiments, the regulatory nucleic acid includes a protein-binding site that can bind to a protein that participates in regulation of expression of an endogenous gene or an exogenous gene.In some embodiments, the polyribonucleotide encodes a regulatory RNA that hybridizes to a transcript of interest wherein the regulatory RNA has a length of from about 5 to 30 nucleotides, from about 10 to 30 nucleotides (e.g., about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30), or more than 30 nucleotides. In some embodiments, the degree of sequence identity of the regulatory RNA to the targeted transcript is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.In some embodiments, the polyribonucleotide encodes a microRNA (miRNA) molecule identical to about 5 to about 25 contiguous nucleotides of a target gene or encodes a precursor to that miRNA. In some embodiments, the miRNA has a sequence that allows the mRNA to recognize and bind to a specific target mRNA. In some embodiments, miRNA sequence commences with the dinucleotide AA, includes a GC-content of about 30-70% (about 30-60%, about 40-60%, or about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the genome of the subject (e.g., a mammal) in which it is to be introduced, for example as determined by standard BLAST search. In some embodiments, the polyribonucleotide includes at least one miRNA (or miRNA precursor), e.g., 2, 3, 4, 5, 6, or more miRNAs or miRNA precursors. In some embodiments, the polyribonucleotide includes a sequence that encodes a miRNA (or its precursor) having at least about 75%, 80%, 85%, 90% 95%, 96%, 97%, 98%, or 99% or 100% nucleotide sequence complementarity to a target sequence. siRNAs and shRNAs resemble intermediates in the processing pathway of the endogenous miRNA genes. In some embodiments, siRNAs can function as miRNAs and vice versa. MicroRNAs, like siRNAs, use RNA-induced silencing complex (RISC) to downregulate target genes, but unlike siRNAs, most animal miRNAs do not cleave the mRNA. Instead, miRNAs reduce protein output through translational suppression or polyA removal and mRNA degradation. Known miRNA binding sites are within mRNA 3' UTRs;66LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO miRNAs target sites with near-perfect complementarity to nucleotides 2-8 from the miRNA's 5' end. This region is known as the seed region. Because mature siRNAs and miRNAs are interchangeable, exogenous siRNAs downregulate mRNAs with seed complementarity to the siRNA. Lists of known miRNA sequences can be found in databases maintained by research organizations, such as Wellcome Trust Sanger Institute, Penn Center for Bioinformatics, Memorial Sloan Kettering Cancer Center, and European Molecule Biology Laboratory, among others. Known effective siRNA sequences and cognate binding sites are also well represented in the relevant literature. RNAi molecules are readily designed and produced by technologies known in the art.Untranslated RegionsIn some embodiments, the polyribonucleotide described herein (e.g., the polyribonucleotide cargo) includes untranslated regions (UTRs). UTRs of a genomic region including a gene may be transcribed but not translated. In some embodiments, a UTR is included upstream of the translation initiation sequence of an expression sequence described herein. In some embodiments, a UTR is included downstream of an expression sequence described herein. In some instances, one UTR for a first expression sequence is the same as or continuous with or overlapping with another UTR for a second expression sequence.Exemplary untranslated regions are described in paragraphs
[0197] -
[0201] of WO 2019 / 118919, which is hereby incorporated by reference in its entirety.In some embodiments, the polyribonucleotide includes a poly -A sequence. Exemplary poly-A sequences are described in paragraphs
[0202] -
[0205] of WO 2019 / 118919, which is hereby incorporated by reference in its entirety. In some embodiments, the polyribonucleotide lacks a poly-A sequence.In some embodiments, the polyribonucleotide includes a UTR with one or more stretches of Adenosines and Uridines embedded within. These AU rich signatures may increase turnover rates of the expression product.Introduction, removal, or modification of UTR AU rich elements (AREs) may be useful to modulate the stability, or immunogenicity (e.g., the level of one or more marker of an immune or inflammatory response) of the polyribonucleotide. When engineering specific circular polyribonucleotides, one or more copies of an ARE may be introduced to the circular polyribonucleotide and the copies of an ARE may modulate translation and / or production of an expression product. Likewise, AREs may be identified and removed or engineered into the circular polyribonucleotide to modulate the intracellular stability and thus affect translation and production of the resultant protein.Any UTR from any gene may be incorporated into the respective flanking regions of the polyribonucleotide.In some embodiments, the polyribonucleotide lacks a 5’ -UTR and is competent for protein 67LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO expression from its one or more expression sequences. In some embodiments, the polyribonucleotide lacks a 3’-UTR and is competent for protein expression from its one or more expression sequences. In some embodiments, the polyribonucleotide lacks a poly-A sequence and is competent for protein expression from its one or more expression sequences. In some embodiments, the polyribonucleotide lacks a termination element and is competent for protein expression from its one or more expression sequences. In some embodiments, the polyribonucleotide lacks an internal ribosomal entry site and is competent for protein expression from its one or more expression sequences. In some embodiments, the polyribonucleotide lacks a cap and is competent for protein expression from its one or more expression sequences. In some embodiments, the polyribonucleotide lacks a 5’-UTR, a 3’-UTR, and an IRES, and is competent for protein expression from its one or more expression sequences. In some embodiments, the polyribonucleotide includes one or more of the following sequences: a sequence that encodes one or more miRNAs, a sequence that encodes one or more replication proteins, a sequence that encodes an exogenous gene, a sequence that encodes a therapeutic, a regulatory element (e.g., translation modulator, e.g., translation enhancer or suppressor), a translation initiation sequence, one or more regulatory nucleic acids that targets endogenous genes (e.g., siRNA, IncRNAs, shRNA), and a sequence that encodes a therapeutic mRNA or protein.In some embodiments, the polyribonucleotide lacks a 5’ -UTR. In some embodiments, the polyribonucleotide lacks a 3 ’-UTR. In some embodiments, the polyribonucleotide lacks a poly-A sequence. In some embodiments, the polyribonucleotide lacks a termination element. In some embodiments, the polyribonucleotide lacks an internal ribosomal entry site. In some embodiments, the polyribonucleotide lacks degradation susceptibility by exonucleases. In some embodiments, the fact that the polyribonucleotide lacks degradation susceptibility can mean that the polyribonucleotide is not degraded by an exonuclease, or only degraded in the presence of an exonuclease to a limited extent, e.g., that is comparable to or similar to in the absence of exonuclease. In some embodiments, the polyribonucleotide is not degraded by exonucleases. In some embodiments, the polyribonucleotide has reduced degradation when exposed to exonuclease. In some embodiments, the polyribonucleotide lacks binding to a cap-binding protein. In some embodiments, the polyribonucleotide lacks a 5’ cap.FormulationsIn some embodiments, the polyribonucleotide (e.g., the circular polyribonucleotide) purified by the methods described herein may be formulated in composition, e.g., a composition for delivery to a cell, a plant, an invertebrate animal, a non-human vertebrate animal, or a human subject, e.g., an agricultural, veterinary, or pharmaceutical composition. In some embodiments, the polyribonucleotide is formulated in a pharmaceutical composition. In some embodiments, the composition includes the polyribonucleotide and a diluent, a carrier, an adjuvant, or a combination thereof. In a particular embodiment, a composition includes a polyribonucleotide described herein 68LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO and a carrier or a diluent free of any carrier. In some embodiments, a composition including a polyribonucleotide with a diluent free of any carrier is used for naked delivery of the polyribonucleotide (e.g., circular polyribonucleotide) to a subject.Pharmaceutical compositions may optionally include one or more additional active substances, e.g., therapeutically and / or prophylactically active substances. Pharmaceutical compositions may optionally include an inactive substance that serves as a vehicle or medium for the compositions described herein (e.g., compositions including circular polyribonucleotides, such as any one of the inactive ingredients approved by the United States Food and Drug Administration (FDA) and listed in the Inactive Ingredient Database). Pharmaceutical compositions may be sterile and / or pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceutical agents may be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005, which is incorporated herein by reference in its entirety. Non-limiting examples of an inactive substance include solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersions, suspension aids, surface active agents, isotonic agents, thickening agents, emulsifying agents, preservatives, polymers, peptides, proteins, cells, hyaluronidases, dispersing agents, granulating agents, disintegrating agents, binding agents, buffering agents (e.g., phosphate buffered saline (PBS)), lubricating agents, oils, and mixtures thereof.Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g., non-human mammals. Modification of pharmaceutical compositions suitable for administration to humans to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions is contemplated include, but are not limited to, humans and / or other primates; mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats; and / or birds, including commercially relevant birds such as poultry, chickens, ducks, geese, and / or turkeys. Formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product.In some embodiments, the reference criterion for the amount of circular polyribonucleotides present in the preparation is at least 30% (w / w), 40% (w / w), 50% (w / w), 60% (w / w), 70% (w / w), 80% (w / w), 85% (w / w), 90% (w / w), 91% (w / w), 92% (w / w), 93% (w / w), 94% (w / w), 95% (w / w), 96% (w / w), 97% (w / w), 98% (w / w), 99% (w / w), 99.1% (w / w), 99.2% (w / w), 99.3% (w / w), 99.4%69LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO (w / w), 99.5% (w / w), 99.6% (w / w), 99.7% (w / w), 99.8% (w / w), 99.9% (w / w), or 100% (w / w) of the total ribonucleotides in the pharmaceutical preparation.In some embodiments, the reference criterion for the amount of linear polyribonucleotides present in the preparation is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) of the total ribonucleotides in the pharmaceutical preparation.In some embodiments, the reference criterion for the amount of nicked polyribonucleotide molecules present in the preparation is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), or 15% (w / w) of the total ribonucleotide molecules in the pharmaceutical preparation.In some embodiments, the reference criterion for the amount of combined nicked and linear polyribonucleotide molecules present in the preparation is no more than 0.5% (w / w), 1% (w / w), 2% (w / w), 5% (w / w), 10% (w / w), 15% (w / w), 20% (w / w), 25% (w / w), 30% (w / w), 40% (w / w), 50% (w / w) of the total ribonucleotide molecules in the pharmaceutical preparation.In some embodiments, a pharmaceutical preparation is an intermediate pharmaceutical preparation of a final circular polyribonucleotide drug product. In some embodiments, a pharmaceutical preparation is a drug substance or active pharmaceutical ingredient (API). In some embodiments, a pharmaceutical preparation is a drug product for administration to a subject.In some embodiments, a preparation of circular polyribonucleotides is (before, during or after the reduction of linear RNA) further processed to remove DNA, protein contamination (e.g., cell protein such as a host cell protein or protein process impurities), endotoxin, mononucleotide molecules, and / or a process-related impurity.SaltsIn some embodiments, the composition or pharmaceutical composition provided herein includes one or more salts. For controlling the tonicity, a physiological salt such as sodium salt can be included a composition provided herein. Other salts can include potassium chloride, potassium dihydrogen phosphate, disodium phosphate, and / or magnesium chloride, or the like. In some cases, the composition or pharmaceutical composition is formulated with one or more pharmaceutically acceptable salts. The one or more pharmaceutically acceptable salts can include those of the inorganic ions, such as, for example, sodium, potassium, calcium, magnesium ions, and the like. Such salts can include salts with inorganic or organic acids, such as hydrochloric acid, hydrobromic acid, phosphoric acid, nitric acid, sulfuric acid, methanesulfonic acid, p-toluene sulfonic acid, acetic acid, fumaric acid, succinic acid, lactic acid, mandelic acid, malic acid, citric acid, tartaric acid, or maleic acid. The polyribonucleotide can be present in either linear or circular form.Buffers / pHThe composition or pharmaceutical composition provided herein can include one or more 70LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO buffers, such as a Tris buffer; a borate buffer; a succinate buffer; a histidine buffer (e.g., with an aluminum hydroxide adjuvant); or a citrate buffer. Buffers, in some cases, are included in the 5-20 mM range.The composition or pharmaceutical composition provided herein can have a pH between about 5.0 and about 8.5, between about 6.0 and about 8.0, between about 6.5 and about 7.5, or between about 7.0 and about 7.8. In some embodiments, the composition or pharmaceutical composition can have a pH of about 7.Detergents / surfactantsThe composition or pharmaceutical composition provided herein can include one or more detergents and / or surfactants, depending on the intended administration route, e.g., polyoxymethylene sorbitan esters surfactants (commonly referred to as “Tweens”), e.g., polysorbate 20 and polysorbate 80; copolymers of ethylene oxide (EO), propylene oxide (PO), and / or butylene oxide (BO), sold under the DOWFAX™ tradename, such as linear EO / PO block copolymers; octoxynols, which can vary in the number of repeating ethoxy (oxy-1, 2-ethanediyl) groups, e.g., octoxynol-9 (Triton X-100, or t-octylphenoxypoly ethoxy ethanol); (octylphenoxy)polyethoxyethanol (IGEPAL CA-630 / NP-40); phospholipids such as phosphatidylcholine (lecithin); nonylphenol ethoxylates, such as the Tergitol™ NP series; polyoxyethylene fatty ethers derived from lauryl, cetyl, stearyl and oleyl alcohols (known as Brij surfactants), such as triethyleneglycol monolauryl ether (Brij 30); and sorbitan esters (commonly known as “SPANs”), such as sorbitan trioleate (Span 85) and sorbitan monolaurate, an octoxynol (such as octoxynol-9 (Triton X-100) or t-octylphenoxypolyethoxyethanol), a cetyl trimethyl ammonium bromide (“CT AB”), or sodium deoxycholate. The one or more detergents and / or surfactants can be present only at trace amounts. In some cases, the composition or pharmaceutical composition can include less than 1 mg / ml of each of octoxynol- 10 and polysorbate 80. Non-ionic surfactants can be used herein. Surfactants can be classified by their “HLB” (hydrophile / lipophile balance). In some cases, surfactants have a HLB of at least 10, at least 15, and / or at least 16.DiluentsThe composition or pharmaceutical composition may include a polyribonucleotide (e.g., a circular polyribonucleotide), and a diluent.A diluent can be a non-carrier excipient. A non-carrier excipient serves as a vehicle or medium for the composition or pharmaceutical composition, such as a circular polyribonucleotide as described herein. Non-limiting examples of a non-carrier excipient include solvents, aqueous solvents, non-aqueous solvents, dispersion media, diluents, dispersions, suspension aids, surface active agents, isotonic agents, thickening agents, emulsifying agents, preservatives, polymers, peptides, proteins, cells, hyaluronidases, dispersing agents, granulating agents, disintegrating agents, binding agents, buffering agents (e.g., phosphate buffered saline (PBS)), lubricating agents, oils, and 71LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO mixtures thereof. A non-carrier excipient can be any one of the inactive ingredients approved by the United States Food and Drag Administration (FDA) and listed in the Inactive Ingredient Database that does not exhibit a cell-penetrating effect. A non-carrier excipient can be any inactive ingredient suitable for administration to a non-human animal, for example, suitable for veterinary use.Modification of compositions suitable for administration to humans to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and / or perform such modification with merely ordinary, if any, experimentation.In some embodiments, the polyribonucleotide (e.g., circular polyribonucleotide) purified by the methods described herein is delivered as a naked delivery formulation, such as including a diluent. A naked delivery formulation delivers a polyribonucleotide, to a cell without the aid of a carrier and without modification or partial or complete encapsulation of the polyribonucleotide, capped polyribonucleotide, or complex thereof.A naked delivery formulation is a formulation that is free from a carrier and wherein the polyribonucleotide (e.g., circular polyribonucleotide) is without a covalent modification that binds a moiety that aids in delivery to a cell or without partial or complete encapsulation of the polyribonucleotide. In some embodiments, a polyribonucleotide without a covalent modification that binds a moiety that aids in delivery to a cell is a polyribonucleotide that is not covalently bound to a protein, small molecule, a particle, a polymer, or a biopolymer. A polyribonucleotide without covalent modification that binds a moiety that aids in delivery to a cell does not contain a modified phosphate group. For example, a polyribonucleotide without a covalent modification that binds a moiety that aids in delivery to a cell does not contain phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, or phosphotriesters.In some embodiments, a naked delivery formulation is free of any or all of transfection reagents, cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. In some embodiments, a naked delivery formulation is free from phtoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin, lipofectamine, polyethylenimine, poly(trimethylenimine), poly(tetramethylenimine), polypropylenimine, aminoglycoside-polyamine, dideoxy-diamino-b-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly(arginine), cationized gelatin, dendrimers, chitosan, l,2-Dioleoyl-3-Trimethylammonium-Propane(DOTAP), N-[l-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), l-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N,N'-Dimethylaminoethane)-carbamoyl]Cholesterol Hydrochloride (DC-Cholesterol HC1), diheptadecylamidoglycyl spermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide 72LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO (DDAB), N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (DMRIE), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin.In certain embodiments, a naked delivery formulation includes a non-carrier excipient. In some embodiments, a non-carrier excipient includes an inactive ingredient that does not exhibit a cell penetrating effect. In some embodiments, a non-carrier excipient includes a buffer, for example PBS. In some embodiments, a non-carrier excipient is a solvent, a non-aqueous solvent, a diluent, a suspension aid, a surface-active agent, an isotonic agent, a thickening agent, an emulsifying agent, a preservative, a polymer, a peptide, a protein, a cell, a hyaluronidase, a dispersing agent, a granulating agent, a disintegrating agent, a binding agent, a buffering agent, a lubricating agent, or an oil.In some embodiments, a naked delivery formulation includes a diluent. A diluent may be a liquid diluent or a solid diluent. In some embodiments, a diluent is an RNA solubilizing agent, a buffer, or an isotonic agent. Examples of an RNA solubilizing agent include water, ethanol, methanol, acetone, formamide, and 2-propanol. Examples of a buffer include 2-(N-morpholino)ethanesulfonic acid (MES), Bis-Tris, 2-[(2-amino-2-oxoethyl)-(carboxymethyl)amino]acetic acid (ADA), N-(2-Acetamido)-2-aminoethanesulfonic acid (ACES), piperazine-N,N'-bis(2-ethanesulfonic acid) (PIPES), 2-[[l,3-dihydroxy-2-(hydroxymethyl)propan-2-yl]amino]ethanesulfonic acid (TES), 3-(N-morpholino)propanesulfonic acid (MOPS), 4-(2-hydroxyethyl)-l -piperazineethanesulfonic acid (HEPES), Tris, Tricine, Gly-Gly, Bicine, or phosphate. Examples of an isotonic agent include glycerin, mannitol, polyethylene glycol, propylene glycol, trehalose, or sucrose.CarriersIn some embodiments, the composition or pharmaceutical composition includes the polyribonucleotide (e.g., a circular polyribonucleotide) purified by the methods described herein, and a carrier (e.g., in a vesicle or other membrane-based carrier).In other embodiments, the composition or pharmaceutical composition includes the polyribonucleotide (e.g., a circular polyribonucleotide) purified by the methods described herein, in or via a cell, vesicle or other membrane-based carrier. In one embodiment, the composition or pharmaceutical composition includes the polyribonucleotide (e.g., a circular polyribonucleotide) purified by the methods described herein, in liposomes or other similar vesicles. Liposomes are spherical vesicle structures composed of a uni- or multilamellar lipid bilayer surrounding internal aqueous compartments and a relatively impermeable outer lipophilic phospholipid bilayer.Liposomes may be anionic, neutral, or cationic. Liposomes are biocompatible, nontoxic, can deliver both hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their load across biological membranes and the blood brain barrier (BBB) (see, e.g., Spuch et al., Journal of Drug Delivery, 2011:469679 (2011), which is incorporated herein by reference in its entirety).73LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Vesicles can be made from several distinct types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for preparation of multilamellar vesicle lipids are known in the art (see for example U.S. Pat. No. 6,693,086, the teachings of which relating to multilamellar vesicle lipid preparation are incorporated herein by reference). Although vesicle formation can be spontaneous when a lipid film is mixed with an aqueous solution, it can also be expedited by applying force in the form of shaking by using a homogenizer, sonicator, or an extrusion apparatus (see, e.g., Spuch et al., Journal of Drug Delivery, 2011:469679 (2011), which is incorporated herein by reference in its entirety). Extruded lipids can be prepared by extruding through filters of decreasing size, as described in Templeton et al., Nature Biotech, 15:647-652 (1997), which is incorporated herein by reference in its entirety.In certain embodiments, the composition or pharmaceutical composition includes a polyribonucleotide (e.g., a circular polyribonucleotide) purified by the methods described herein, and lipid nanoparticles, as described herein. Lipid nanoparticles are another example of a carrier that provides a biocompatible and biodegradable delivery system for a polyribonucleotide molecule as described herein. Nanostructured lipid carriers (NLCs) are modified solid lipid nanoparticles (SLNs) that retain the characteristics of the SLN, improve drug stability and loading capacity, and prevent drug leakage. Polymer nanoparticles (PNPs) are a key component of drug delivery. These nanoparticles can effectively direct drug delivery to specific targets and improve drug stability and controlled drug release. Lipid-polymer nanoparticles (PLNs), a new type of carrier that combines liposomes and polymers, may also be employed. These nanoparticles possess the complementary advantages of PNPs and liposomes.Additional non-limiting examples of carriers include carbohydrate carriers (e.g., an anhydride-modified phytoglycogen or glycogen-type material), protein carriers (e.g., a protein covalently linked to the polyribonucleotide, or a protein covalently linked to the linear polyribonucleotide), or cationic carriers (e.g., a cationic lipopolymer or transfection reagent). Nonlimiting examples of carbohydrate carriers include phtoglycogen octenyl succinate, phytoglycogen beta-dextrin, and anhydride-modified phytoglycogen betadextrin. Non-limiting examples of cationic carriers include lipofectamine, polyethylenimine, poly(trimethylenimine), poly(tetramethylenimine), polypropylenimine, aminoglycoside-polyamine, dideoxy- diamino-b-cyclodextrin, spermine, spermidine, poly(2-dimethylamino)ethyl methacrylate, poly(lysine), poly(histidine), poly (arginine), cationized gelatin, dendrimers, chitosan, l,2-Dioleoyl-3- Trimethylammonium-Propane(DOTAP), N-[l-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), l-[2-(oleoyloxy)ethyl]-2-oleyl-3-(2-hydroxyethyl)imidazolinium chloride (DOTIM), 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA), 3B-[N-(N,N'-Dimethylaminoethane)-carbamoyl]Cholesterol Hydrochloride (DC-Cholesterol HC1), diheptadecylamidoglycyl spermidine (DOGS), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide 74LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO (DMRIE), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), human serum albumin (HSA), low-density lipoprotein (LDL), high-density lipoprotein (HDL), or globulin.Exosomes can also be used as drug delivery vehicles for a composition or pharmaceutical composition including a polyribonucleotide (e.g., a circular polyribonucleotide).Ex vivo differentiated red blood cells can also be used as a carrier for a composition or pharmaceutical composition including a polyribonucleotide (e.g., a circular polyribonucleotide). See, e.g., WO 2015 / 073587; WO 2017 / 123646; WO 2017 / 123644; WO 2018 / 102740; WO 2016 / 183482; WO 2015 / 153102; WO 2018 / 151829; WO 2018 / 009838; Shi et al. 2014. PROC NATL ACAD SCI USA. Ill (28): 10131-10136; US Patent 9,644,180; Huang et al. 2017. NATURE COMMUNICATIONS 8: 423; Shi et al. 2014. PROC NATL ACAD SCI USA. Ill (28): 10131-10136, all of which are incorporated by reference in their entirety.Fusosome compositions, e.g., as described in WO 2018 / 208728 (which is incorporated herein by reference in its entirety), can also be used as carriers for the composition or pharmaceutical composition including a polyribonucleotide (e.g., a circular polyribonucleotide) purified by the methods described herein.Virosomes and virus-like particles (VLPs) can also be used as carriers for the composition or pharmaceutical composition including a polyribonucleotide (e.g., a circular polyribonucleotide) to targeted cells.Plant nanovesicles and plant messenger packs (PMPs), e.g., as described in WO 2011 / 097480, WO 2013 / 070324, WO 2017 / 004526, or WO 2020 / 041784 (all of which are incorporated by reference in their entirety) can also be used as carriers for the composition or pharmaceutical composition including a polyribonucleotide (e.g., a circular polyribonucleotide) purified by the methods described herein.Microbubbles can also be used as carriers for the composition or pharmaceutical composition including a polyribonucleotide (e.g., a circular polyribonucleotide) purified by the methods described herein. See, e.g., US 7115583; Beeri et al., Circulation 106(14): 1756-59 (2002); Bez et al., Nat. Protoc. 14(4): 1015-26 (2019); Hernot et al., Adv. Drug Deliv. Rev. 60(10): 1153-66 (2008); Rychak et al., Adv. Drug Deliv. Rev. 72:82-93 (2014), all of which are incorporated by reference in their entirety.Silk fibroin can also be used as a carrier for the composition or pharmaceutical composition including a polyribonucleotide (e.g., a circular polyribonucleotide) purified by the methods described herein. See, e.g., Boopathy et al., PNAS 116(33): 16473-78 (2019); and He et al., ACS Biomater. Sci. Eng. 4(5): 1708-15 (2018), which are incorporated by reference in their entirety.The carrier for the composition or pharmaceutical composition including a polyribonucleotide (e.g., a circular polyribonucleotide) purified by the methods described herein may include a plurality of particles. The particles may have median article size of 30 to 700 nanometers (e.g., 30 to 50, 50 to 100, 100 to 200, 200 to 300, 300 to 400, 400 to 500, 500 to 600, 600 to 700, 100 to 500, 50 to 500, or 75LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO 200 to 700 nanometers). The size of the particle may be optimized to favor deposition of the pay load, including the polyribonucleotide into a cell. Deposition of the polyribonucleotide into certain cell types may favor different particle sizes. For example, the particle size may be optimized for deposition of the polyribonucleotide into antigen presenting cells. The particle size may be optimized for deposition of the polyribonucleotide into dendritic cells. Additionally, the particle size may be optimized for depositions of the polyribonucleotide into draining lymph node cells.Lipid NanoparticlesIn some embodiments, the composition or pharmaceutical composition of the disclosure includes the polyribonucleotide (e.g., circular polyribonucleotide) purified by the methods described herein, and lipid nanoparticles (LNPs).Lipid nanoparticles, in some embodiments, include one or more non-cationic lipids (e.g., neutral or anionic, or zwitterionic lipids). Non-limiting examples of non-cationic lipids include all the well-known phosphorous lipids such as phospholipids, as well as all the well-known non-phosphorous lipids such as, e.g., stearylamine, dodeeylamine, hexadecylamine, acetyl palmitate, glycerol ricinoleate, hexadecyl stereate, isopropyl myristate, amphoteric acrylic polymers, triethanolaminelauryl sulfate, alkyl-aryl sulfate polyethyloxylated fatty acid amides, dioctadecyl dimethyl ammonium bromide, ceramide, sphingomyelin, etc. In some embodiments, the LNPs include one or cationic lipids. In some embodiments, the LNPs include one or ionizable lipids. In some embodiments, the LNPs include one or more conjugated lipids (such as PEG-conjugated lipids or lipids conjugated to polymers). In some embodiments, the LNPs may include one or more sterols (e.g., cholesterol or a cholesterol derivative; phytosterols). Any cationic lipids, ionizable lipids, conjugated lipids (such as PEG-conjugated lipids or lipids conjugated to polymers), and sterols well-known to one skilled in the art that are suitable for LNP formulations are within the scope of the LNPs used herein.In some embodiments, the LNP includes an ionizable lipid, a non-cationic lipid, a conjugated lipid (e.g., a PEG-conjugated lipid), and / or a sterol. The amounts of these components can be varied independently. For example, in some embodiments, the lipid nanoparticle includes an ionizable lipid in an amount at about 20-90 mol% (e.g., about 20-70 mol%, about 30-60 mol%, about 40-50 mol%, or about 50-90 mol%) of the total lipids; a non-cationic lipid in an amount at about 0-60 mol% (e.g., about 5-60 mol%, about 20-60 mol%, about 0-30 mol%, or about 5-30 mol%) of the total lipids; a conjugated lipid (e.g., a PEG-conjugated lipid) in an amount at about 0.5-20 mol% (e.g., about 0.5-10 mol%, or about 0.5-3 mol%) of the total lipids; and / or a sterol in an amount at about 0-60 mol% (e.g., about 0-45 mol%, or about 7-45 mol%) of the total lipids.The ratio of the total lipids to the polyribonucleotide (e.g., circular polyribonucleotide) purified by the methods described herein can be varied as desired. For example, the total lipid to the polyribonucleotide (e.g., circular polyribonucleotide) purified by the methods described herein (mass or weight) ratio can be from about 10: 1 to about 30: 1. The amounts of lipids and the76LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO polyribonucleotide (e.g., circular polyribonucleotide) purified by the methods described herein can be adjusted to provide a desired N / P ratio, for example, N / P ratio of 3, 4, 5, 6, 7, 8, 9, 10 or higher.The following numbered embodiments describe non-limiting implementations of the inventions disclosed herein.Unless otherwise indicated or clearly incompatible, any embodiment may be combined with any other embodiment, and features described in connection with one embodiment may be included in another embodiment. The embodiments are provided for purposes of illustration and explanation and are not intended to limit the scope of the inventions, which are defined by the claims and equivalents thereof. Variations, modifications, and combinations of the embodiments described herein that fall within the scope of the disclosure are contemplated.Embodiment 1. A method of separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear polyribonucleotides and circular polyribonucleotides, the method comprising:(a) providing a sample comprising the plurality of polyribonucleotides, wherein the plurality of polyribonucleotides comprises one or more linear polyribonucleotides, each comprising one or more dsRNAs;(b) contacting the sample with a reagent that binds to the dsRNAs; and(c) separating the linear polyribonucleotides comprising the dsRNAs bound to the reagent from the plurality of polyribonucleotides.Embodiment 2. A method of separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear polyribonucleotides and circular polyribonucleotides, the method comprising:contacting a sample, comprising the plurality of polyribonucleotides that comprises one or more linear polyribonucleotides, each comprising one or more dsRNAs, with a reagent that binds to the dsRNAs; andseparating the linear polyribonucleotides comprising the dsRNAs bound to the reagent from the plurality of polyribonucleotides.Embodiment 3. The method of Embodiment 1 or 2, wherein the linear polyribonucleotide comprising the one or more dsRNAs is transcribed from a deoxyribonucleotide encoding the linear polyribonucleotide comprising the dsRNAs.Embodiment 4. The method of any one of Embodiments 1-3, wherein, in the linear polyribonucleotide comprising the one or more dsRNAs, each dsRNA is located at a 3' terminus, a 5' terminus, or at both the 3’ and 5’ termini of the linear polyribonucleotide.Embodiment 5. The method of Embodiment 4, wherein the linear polyribonucleotide comprises two or more dsRNAs, wherein at least one dsRNA is located at the 3' terminus of the linear77LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO polyribonucleotide, and at least one dsRNA is located at the 5' terminus of the linear polyribonucleotide.Embodiment 6. The method of Embodiment 5, wherein the linear polyribonucleotide comprises 1-10 dsRNAs at the 3' terminus of the linear polyribonucleotide, and 1-10 dsRNAs at the 5' terminus of the linear polyribonucleotide, wherein the numbers of the dsRNAs at the 3' terminus and at the 5' terminus may be the same or different.Embodiment 7. The method of Embodiment 6, wherein the linear polyribonucleotide comprises 1^4 dsRNAs at the 3' terminus and 1~4 dsRNAs at the 5' terminus.Embodiment 8. The method of any one of Embodiments 1-7, wherein at least one of the dsRNAs is a dsRNA hairpin.Embodiment 9. The method of Embodiment 8, wherein all of the dsRNAs are dsRNA hairpins. Embodiment 10. The method of any one of Embodiments 6-9, wherein the dsRNAs of at least one terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure.Embodiment 11. The method of Embodiment 10, wherein the dsRNAs at both the 5' terminus and the 3' terminus have a multi-dsRNA hairpin structure comprising 2-10 dsRNA hairpins connected by a linker or spacer sequence.Embodiment 12. The method of Embodiment 11, wherein the multi-dsRNA hairpin structure comprises 2, 3, or 4 dsRNA hairpins connected by a linker or spacer sequence.Embodiment 13. The method of any one of Embodiments 8-12, wherein each dsRNA hairpin independently has a stem region of at least 20 or at least 30 base pairs in length and a loop region of at least 2 or at least 3 nucleotides in length.Embodiment 14. The method of Embodiment 13, wherein each dsRNA hairpin independently has a stem region of at least 30, 35, 40, 45, or 50 base pairs in length.Embodiment 15. The method of Embodiment 13, wherein each dsRNA hairpin independently has a loop region of at least 4 nucleotides in length.Embodiment 16. The method of any one of Embodiments 1-15, wherein the separating step comprises collecting the polyribonucleotides in the sample that are not bound by the reagent.Embodiment 17. The method of Embodiment 16, wherein the polyribonucleotides in the sample that are not bound by the reagent comprise the circular polyribonucleotides.Embodiment 18. The method of any one of Embodiments 1-17, wherein the reagent is a polypeptide, a small molecule, or a nucleic acid.Embodiment 19. The method of Embodiment 18, wherein the reagent is contained in a dsRNA-binding column or resin.Embodiment 20. The method of Embodiment 19, wherein the dsRNA-binding column or resin operates in a flow-through mode.Embodiment 21. The method of any one of Embodiments 1-20, wherein the sample is contained in aqueous buffers prior to contacting with the reagent.78LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Embodiment 22. The method of Embodiment 21, wherein the aqueous buffers comprise a buffer solution containing a salt at a concentration of about 0.5-2 M, and optionally a chelating solution. Embodiment 23. The method of Embodiment 22, wherein the buffer solution containing the salt regulates the pH to about 5.0-9.5.Embodiment 24. The method of Embodiment 21, wherein the aqueous buffers comprise Tris and / or HEPES buffer solution containing about 0.5-1.5 M NaCl that regulates the pH to about 7.0-9.5 or about 8.0, and optionally EDTA.Embodiment 25. The method of any one of Embodiments 19-24, wherein the contacting and separating steps comprise:contacting the sample with the dsRNA-binding column or resin to allow the column or resin to bind the dsRNAs;optionally centrifugating the dsRNA-binding column or resin; andcollecting the flow-through solution comprising the polyribonucleotides in the sample that are not bound to the column or resin.Embodiment 26. The method of Embodiment 25, further comprising:washing the column or resin that binds the dsRNAs with the aqueous buffers one or more times;optionally centrifugating the dsRNA-binding column or resin; andcollecting the additional flow-through solution comprising the polyribonucleotides in the sample that are not bound to the column or resin.Embodiment 27. The method of any one of Embodiments 1-26, wherein the polyribonucleotides in the sample that are not bound by the reagent comprises the circular polyribonucleotide.Embodiment 28. The method of any one of Embodiments 1-27, wherein the separating step further comprises eluting the linear polyribonucleotides bound to the reagent to collect an eluate comprising the linear polyribonucleotides, using an eluant different from the aqueous buffers.Embodiment 29. The method of Embodiment 28, wherein the eluant is guanidine hydrochloride. Embodiment 30. The method of any one of Embodiments 1-26, further comprising circularizing a linear precursor polyribonucleotide to produce the circular polyribonucleotide prior to separation. Embodiment 31. The method of Embodiment 30, wherein the linear precursor comprises a 5' circularization element (CE2) and a 3' circularization element (CE1), and wherein the circular polyribonucleotide is produced by a circularization reaction of (CE1) and (CE2).Embodiment 32. The method of Embodiment 31, wherein (CE1) comprises a 5’ self-splicing intron fragment and (CE2) comprises a 3’ self-splicing intron fragment, and wherein the circular polyribonucleotide is produced by self-splicing of the linear precursor polyribonucleotide.Embodiment 33. The method of Embodiment 32, wherein the 5’ self-splicing and 3’ self-splicing intron fragments are each a Group I or Group II self-splicing intron fragment.79LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Embodiment 34. The method of Embodiment 30, wherein at least one dsRNA is adjacent and external to one of the circularization elements, optionally one of the 5’ and 3’ self-splicing intron fragments.Embodiment 35. The method of Embodiment 30, wherein the linear precursor polyribonucleotide comprises at least two dsRNAs, and wherein the dsRNAs are present at both the 5' and 3' ends of the polyribonucleotide, each being adjacent and external to the corresponding circularization element at that end, optionally adjacent and external to the corresponding self-splicing intron fragment at that end.Embodiment 36. The method of Embodiment 30, wherein the linear precursor polyribonucleotide comprises 1-10 dsRNAs at each end, and wherein the 1-10 dsRNAs at each end are adjacent and external to the corresponding circularization element at that end, optionally adjacent and external to the corresponding self-splicing intron fragment at that end.Embodiment 37. The method of Embodiment 36, wherein the linear precursor polyribonucleotide comprises 1-4 dsRNAs at each end, and wherein the 1^1 dsRNAs at each end are adjacent and external to the corresponding circularization element at that end, optionally adjacent and external to the corresponding self-splicing intron fragment at that end.Embodiment 38. The method of any one of Embodiments 34-37, further comprising:at least one spacer region between (CE1) and the dsRNA adjacent and external to (CE1), and / or at least one spacer region between (CE2) and the dsRNA adjacent and external to (CE2).Embodiment 39. The linear polyribonucleotide of Embodiment 38, wherein each spacer region is at least 5 nucleotides in length, or from 5 to 500 ribonucleotides in length, or from 5 to 10 ribonucleotides in length.Embodiment 40. The method of any one of Embodiments 34-39, wherein at least one dsRNA is a dsRNA hairpin.Embodiment 41. The method of Embodiment 40, wherein all dsRNAs are dsRNA hairpins.Embodiment 42. The method of Embodiment 41, wherein the dsRNAs have a multi-dsRNA hairpin structure, comprising 2-10 dsRNA hairpins connected by a linker or spacer sequence.Embodiment 43. The method of Embodiment 42, wherein the multi-dsRNA hairpin structure comprise 2, 3, or 4 hairpins.Embodiment 44. The method of Embodiment 42 or 43, wherein the linker or spacer sequence is 6-10 nucleotides in length, optionally wherein the linker or spacer sequence is a poly A sequence or a random sequence.Embodiment 45. The method of any one of Embodiments 1 44, wherein the circular polyribonucleotide comprises one or more open reading frames (ORF).Embodiment 46. The method of Embodiment 45, wherein each open reading frame encodes a polypeptide.80LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Embodiment 47. The method of Embodiment 45 or 46, wherein a level of expression from the ORF of the circular polyribonucleotide after purification is increased at least 10% relative to a level of expression from the ORF prior to purification.Embodiment 48. The method of any one of Embodiments 45-47, wherein the circular polyribonucleotide comprises one or more internal ribosome entry site (IRES) elements.Embodiment 49. The method of Embodiment 48, wherein the open reading frame is operably linked to the IRES.Embodiment 50. A population of circular polyribonucleotides produced by the method of any one of Embodiments 1-49.Embodiment 51. A pharmaceutical composition comprising the population of circular polyribonucleotides of Embodiment 50 and a diluent, carrier, and / or excipient.Embodiment 52. A linear polyribonucleotide comprising a formula 5'-(DS2)-(CE2)-(P)-(CEl)-(DSl)-3', wherein:(CE2) comprises a 5’ circularization element;(P) comprises a polyribonucleotide cargo;(CE1) comprises a 3’ circularization element; andeach of (DS2) and (DS1) is independently absent or comprises a dsRNA, provided at least one of DS1 and DS2 comprises a dsRNA.Embodiment 53. The linear polyribonucleotide of Embodiment 52, wherein (CE2) comprises a first annealing region comprising from 8 to 50 ribonucleotides and (CE1) comprises a second annealing region comprising from 8 to 50 ribonucleotides, and wherein the first annealing region and the second annealing region have from 80% to 100% complementarity, or comprise from zero to ten mismatched base pairs.Embodiment 54. The linear polyribonucleotide of Embodiment 52 or 53, wherein each of (DS2) and (DS1) independently comprises a same or different dsRNA.Embodiment 55. The linear polyribonucleotide of any one of Embodiments 52-54, wherein:(DS2) is at the utmost 5' terminus of the linear polyribonucleotide; and / or(DS1) is at the utmost 3' terminus of the linear polyribonucleotide.Embodiment 56. The linear polyribonucleotide of any one of Embodiments 52-54, further comprising:one or more ribonucleotides between (DS2) and the 5' terminus of the linear polyribonucleotide; and / orone or more ribonucleotides between (DS1) and the 3' terminus of the linear polyribonucleotide.Embodiment 57. The linear polyribonucleotide of any one of Embodiments 53-56, wherein at least one of the dsRNAs of (DS2) and / or (DS1) is a dsRNA hairpin.Embodiment 58. The linear polyribonucleotide of Embodiment 57, wherein the dsRNA hairpin has:81LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO a stem region of at least 20 or at least 30 base pairs in length; and / ora loop region of at least 2 or at least 3 nucleotides in length.Embodiment 59. The linear polyribonucleotide of Embodiment 58, wherein the dsRNA hairpin has:a stem region of at least 30, at least 35, at least 40, at least 45, or at least 50 base pairs in length; and / ora loop region of at least 4 nucleotides in length.Embodiment 60. The linear polyribonucleotide of any one of Embodiments 53-59, wherein:(CE1) comprises a 5' self-splicing intron fragment; and(CE2) comprises a 3' self-splicing intron fragment.Embodiment 61. The linear polyribonucleotide of Embodiment 60, wherein the 5' self-splicing intron fragment and the 3' self-splicing intron fragment are each a Group I or Group II self-splicing intron fragment.Embodiment 62. The linear polyribonucleotide of any one of Embodiments 53-61, wherein the polyribonucleotide cargo (P) comprises an expression sequence, a non-coding sequence, or an expression sequence and a non-coding sequence.Embodiment 63. The linear polyribonucleotide of Embodiment 62, wherein the polyribonucleotide cargo (P) comprises an expression sequence encoding one or more polypeptides.Embodiment 64. The linear polyribonucleotide of any one of Embodiments 53-63, wherein the polyribonucleotide cargo (P) comprises one or more open reading frames (ORF), optionally wherein the ORF encodes a polypeptide.Embodiment 65. The linear polyribonucleotide of any one of Embodiments 53-64, further comprising:at least one spacer region (5'-spacer) between (CE2) and (P); and / orat least one spacer region (3'-spacer) between (P) and (CE1).Embodiment 66. The linear polyribonucleotide of Embodiment 65, having a formula:5'-(DS2)-(CE2)-(5'-spacer)-(IRES)-(ORF)-(3'-spacer)-(CEl)-(DSl)-3'.Embodiment 67. The linear polyribonucleotide of any one of Embodiments 52-66, further comprising:a spacer region between (CE1) and (DS1); and / ora spacer region between (CE2) and (DS2).Embodiment 68. The linear polyribonucleotide of any one of Embodiments 65-67, wherein each spacer region is at least 5 ribonucleotides in length, from 5 to 500 ribonucleotides in length, or from 5 to 10 ribonucleotides in length.Embodiment 69. The linear polyribonucleotide of any one of Embodiments 65-68, wherein each spacer region independently comprises a polyA sequence, a polyA-C sequence, a polyA-G sequence, or a polyA-T sequence.82LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Embodiment 70. The linear polyribonucleotide of any one of Embodiments 52-69, wherein:(CE2) further comprises (A)-(B)-(C); and / or(CE1) further comprises (E)-(F)-(G);wherein:(A) comprises a 3' half of a Group I or Group II catalytic intron fragment;(B) comprises a 3' splice site;(C) comprises a 3' exon fragment;(E) comprises a 5' exon fragment;(F) comprises a 5' splice site; and(G) comprises a 5' half of a Group I catalytic intron fragment.Embodiment 71. The linear polyribonucleotide of Embodiment 70, wherein:(A) or (C) comprises a first annealing region; and(E) or (G) comprises a second annealing region;optionally wherein:(C) comprises the first annealing region and (E) comprises the second annealing region; or (A) comprises the first annealing region and (G) comprises the second annealing region. Embodiment 72. The linear polyribonucleotide of any one of Embodiments 52-71, wherein:the first annealing region comprises from 10 to 30 ribonucleotides, from 10 to 20 ribonucleotides, or from 10 to 15 ribonucleotides; andthe second annealing region comprises from 10 to 30 ribonucleotides, from 10 to 20 ribonucleotides, or from 10 to 15 ribonucleotides.Embodiment 73. The linear polyribonucleotide of any one of Embodiments 52-72, wherein:the first annealing region and the second annealing region have 90% to 100% complementarity, or are 100% complementary; orthe first annealing region and the second annealing region comprise zero or one mismatched base pair.Embodiment 74. A method of separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear polyribonucleotides and circular polyribonucleotides, the method comprising:providing a sample comprising the plurality of polyribonucleotides, wherein the plurality of polyribonucleotides comprises one or more linear polyribonucleotides, each comprising one or more dsRNAs transcribed from a deoxyribonucleotide encoding the linear polyribonucleotide comprising the dsRNAs;contacting the sample with a dsRNA-binding column or resin to allow the column or resin to bind the dsRNAs;separating the linear polyribonucleotides comprising the dsRNAs bound to the dsRNA- binding column or resin from the plurality of polyribonucleotides; and83LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO collecting the circular polyribonucleotides in the sample that are not bound by the dsRNA- binding column or resin.Embodiment 75. A method of separating linear polyribonucleotides from circular polyribonucleotides in a mixture thereof, comprising:(a) providing a sample comprising linear polyribonucleotides and circular polyribonucleotides, wherein the linear polyribonucleotides comprise one or more double-stranded RNAs (dsRNAs);(b) contacting the sample with a dsRNA-binding reagent under conditions in which the dsRNA-binding reagent binds the dsRNA present on the linear polyribonucleotides preferentially relative to the dsRNA present on the circular polyribonucleotides; and(c) separating the linear polyribonucleotides bound to the dsRNA-binding reagent from the circular polyribonucleotides.Embodiment 76. The method of Embodiment 75, wherein the sample is contained in aqueous buffers before contacting with the dsRNA-binding reagent, and wherein the contacting is performed under buffer conditions selected to suppress binding of the dsRNA-binding reagent to endogenous double-stranded RNA structures present in circular polyribonucleotides.Embodiment 77. The method of any one of Embodiments 75-76, further comprising, prior to the separating step, a splicing reaction wherein a linear precursor polyribonucleotide comprising an intron fragment produces the circular polyribonucleotides, and wherein the separating step reduces the amount of intron-containing or unspliced linear polyribonucleotides contained in the sample, relative to the amount present prior to contacting the sample with the dsRNA-binding reagent.Embodiment 78. The method of Embodiment 77, wherein the reduction of intron-containing or unspliced linear polyribonucleotides is at least 50%, at least 70%, at least 80%, or at least 90%. Embodiment 79. The method of any one of Embodiments 75-78, wherein the dsRNAs contained in the linear polyribonucleotides having a multi-dsRNA hairpin structure provides an increased binding of linear polyribonucleotides to the dsRNA-binding reagent relative to dsRNAs having a single dsRNA hairpin structure.Embodiment 80. The method of any one of Embodiments 75-79, further comprising collecting the polyribonucleotides in the sample that are not bound to the dsRNA-binding reagent to recover the circular polyribonucleotides, wherein the recovered circular polyribonucleotides exhibit lower innate immune activation in a mammalian immune cell assay than the circular polyribonucleotides purified by anion-exchange chromatography.Embodiment 81. The method of any one of Embodiments 75-80, wherein the dsRNA-binding reagent is contained in a dsRNA-binding column operating in a flow-through mode, and wherein the separating is performed at a linear flow rate for the dsRNA-binding column such that the circular polyribonucleotide is recovered with improved yield without a reduction in purity.84LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Embodiment 82. The method of Embodiment 81, wherein the separating is performed at a linear flow rate of at least 100 cm / hour, at least 300 cm / hour, at least 600 cm / hour, or at least 900 cm / hour.Embodiment 83. A linear precursor polyribonucleotide comprising one or more engineered doublestranded RNA (dsRNA) regions positioned external to a circularization element, wherein the engineered dsRNA regions are included to enable selective removal of uncircularized or partially circularized linear polyribonucleotides during purification of a circular polyribonucleotide.Embodiment 84. A linear precursor polyribonucleotide comprising:a 5' circularization element comprising a first intron fragment;a 3' circularization element comprising a second intron fragment;a polyribonucleotide cargo disposed between the first intron fragment and the second intron fragment; andone or more double-stranded RNA (dsRNA) hairpin regions located external to the first intron fragment and / or the second intron fragment,wherein the dsRNA hairpin regions are absent from a circular polyribonucleotide produced by circularization of the linear precursor polyribonucleotide.EXAMPLESThe following examples are for illustrative purposes only and are not intended to limit, in any way, the scope of the present invention.Example 1: Design of the constructsA double stranded RNA (dsRNA) binding column was used to remove immunogenic dsRNA that was generated during in vitro transcription (IVT) from single stranded RNA (ssRNA).To generate a circular RNA, a split permuted intron was encoded at the 5’ and 3’ end of the RNA within 5’ and 3’ circularization elements (CEs), so that the split regions of the intron can reform after IVT to form a functional intron that circularizes the RNA. This reaction generated a circular RNA, two remnant intron parts that were cleaved off in the process, as well as the initial linear RNA that has not undergone circularization. See FIG. 1.Here, dsRNA was intentionally encoded into the 5’ and 3’ ends of the RNA, adjacent and external to the 5’ and 3’ circularization elements, respectively, in order to enable a dsRNA binding column to bind and remove the remnant intron parts that are cleaved off in the circularization reaction. The dsRNA column also bound and removed any uncircularized RNA that contains one or both of the dsRNA regions. The circular RNA did not contain either of the dsRNA regions, which were cleaved off in the circularization reaction, and was therefore not bound by the dsRNA binding column. See FIG. 2. This enabled efficient purification of the desired circular RNA while removing linear85LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO impurities containing the dsRNA regions that were generated by the circularization reaction, as well as any dsRNA impurities generated by IVT.In this example, DNA constructs were designed to generate RNA by IVT that contain a 5’ circularization element, a 5’ spacer region, an internal ribosome entry sequence (IRES), an open reading frame (ORF), a 3’ spacer region and a 3’ circularization element.The 5’ and 3’ circularization elements were further designed to contain extensions at the 5’ and 3’ ends, respectively, which each contain dsRNA stem-loop hairpins with dsRNA stems that are 10 base pairs (bp), 20 bp, 30 bp, 40 bp, 50 bp, or 60 bp long and loops that are 4 nucleotides (nt) long. The dsRNA stems comprise nucleotides that are complementary to each other to form dsRNA once synthesized by IVT. As negative controls, extensions containing a random sequence of non-complementary RNA of equivalent length to the 40 bp dsRNA stem-loop hairpin was used.Example 2: dsRNA column binding assayIn this example, RNA constructs were built using circularization element CE0001. CE0001 includes a 5’ circularization element and 3’ circularization element prepared from a modified Anabaena Group I catalytic intron fragment with the following sequences:5’ circularization element AACAACAGATAACTTACAGCTAGTCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAA CGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAA GCTGCGGGAGAATGAAAATCCGTAGCGTCTAAACGGTCGTGTGGGTTCAAGTCCCTCCA CCCCC (SEQ ID NO. 2),3’ circularization element CCCACACGACCGTTTAGACGCTACGGACTTAAATAATTGAGCCTTAGAGAAGAAATTCTT TAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTG AGCCAAGCCGAAGTAGTAATTAGTAAGTT (SEQ ID NO. 3).The 5’ circularization element for CE0001 may contain an additional nucleotide “A” at the end of the sequence shown above (i.e., in SEQ ID NO.2), after the nucleotide “C.”Plasmids encoding each of the constructs were thawed on ice and digested using SapI enzyme for 3 hours at 37°C to linearize the plasmids. SapI was heat inactivated for 20 minutes at 65 °C and then kept overnight at 4 °C. IVT was performed on the DNA plasmid digests by mixing the DNA with T7 RNA polymerase (NEB), Yeast Inorganic Pyrophosphatase (YIPP), RNase inhibitor, 30 mM Mg(OAc)2, 7.5 mM Tris UTP, 7.5 mM Tris ATP, 7.5 mM Tris GTP, 7.5 mM Tris CTP, 10 mM DTT, and lx T7 RNA polymerase buffer (NEB). The mixture was incubated for 3 hours at 37 °C on a thermal mixer (300 rpm). After 3 hours, DNase was added into the mixture and further incubated for 20 minutes at 37 °C on a thermal mixer (300 rpm). The IVT reactions were cleaned up using the NEB Monarch RNA Cleanup Kit, and the RNA circularization efficiency was measured using AEX-HPLC.86LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO To test the binding efficiency of the components of each RNA construct to a dsRNA binding resin, 100 ul of AVIpure resin (Repligen) was loaded onto a UNIFILTER 96-well microplate (Cytiva). Storage buffer was removed by centrifugation on a swing bucket rotor (2000 x g for 2 minutes at ambient temperature), and the dsRNA binding resin was equilibrated by passing 500 ul of buffer through the resin three times with centrifugation. The buffer composition was 1 M NaCl, 20 mM Tris pH 8.0, 10 mM EDTA. After resin equilibration, 20 ng RNA in 500 ul of lx buffer (generated as described above) was loaded onto the resin and allowed to bind for 10 minutes at ambient temperature prior to centrifugation. The resin was washed three times with 500 ul of buffer and centrifuged to collect separate flow-throughs (FT). The leftover RNA bound to the resin was stripped with stripping buffer containing 6 M guanidine hydrochloride. The stripping buffer was collected separately by centrifugation.The RNA concentration in each fraction was quantified using a NanoDrop™ spectrophotometer, and 50 ng of RNA was separated on a 10% Urea-PAGE gel to monitor the population of RNA in each fraction.FIG. 3 shows the RNA species collected after FT (not binding to the dsRNA resin) and after strip (bound to the dsRNA resin) using the constructs listed in Table 1, with the detailed sequence information for the RNA constructs listed in Table 5C. It was observed that the amount of RNA bound to the dsRNA column increased in a proportional manner. That is, as the length of the dsRNA hairpins increased, more binding to the dsRNA column was observed. This was further confirmed in the 10% urea-PAGE gel. See FIG. 4. RNAs corresponding to the excised introns post-circularization are visible in the flow through in lane 2 (CE0001-scrambled40, negative control), whereas significantly less RNAs from excised introns are seen in lane 1 (CE0001-dsRNA40), suggesting the depletion of introns having the dsRNA hairpins.Table 1. The RNA constructs tested.87LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO* bp refers to the number of base pairs for the stem of each dsRNA hairpin; all the dsRNA hairpins have a loop of 4 nucleotides (nt) long.In a separate experiment, RNA constructs were made and tested. To test the binding efficiency of the components of each RNA construct to a dsRNA binding column, 1 ml AVIPure-dsRNA column (Repligen) was installed into a AKTA chromatography system (Cytiva). Bind and wash buffer (B&W buffer) was prepared as 1 M NaCl, 20 mM Tris, and 10 mM EDTA, and then the pH was adjusted to 8. The column was equilibrated with 10 Colum volume (CV) of B&W buffer, and the RNA was loaded. The RNA was diluted as 250 ug / ml in the presence of 1 M NaCl, 20 mM Tris, and 10 mM EDTA before loading. Then, 250 ug / mlR (ml per resin) of RNA was loaded. The column was washed with 5 CV of B&W buffer, and then stripped by 6 M guanidine HC1 stripped buffer. The flow-through or stripped fraction was collected by fraction collector and subjected to buffer exchange. 100K Amicon centrifuge filter was used for buffer exchange. Briefly, the flow-through or stripped fraction was loaded onto 30K Amicon filter and centrifuged 5000 g for 10 minutes. The flow-through was discarded and RNAse-free water was loaded onto the column. It was repeated for 5 times.The constructs made in this separate experiment were CE0001-dsRNA40, CE0001-dsRNA50 (RNA with two 50-bp dsRNA hairpins, one extended from the 5’ end of the 5’ circularization element and one extended from the 3’ end of the 3’ circularization elements), and CE0001-dsRNA60 (RNA with two 60-bp dsRNA hairpins, one extended from the 5’ end of the 5’ circularization element and one extended from the 3’ end of the 3’ circularization elements) using circularization element CE0001, with the detailed sequence information for the RNA constructs listed in Table 5C.The RNA concentration in each fraction was quantified using a NanoDrop™ spectrophotometer. In order to further analyze the binding efficiency of components of each RNA construct to the dsRNA binding resin, the RNA samples were concentrated and buffer exchanged into water (BEX samples). The samples were concentrated using Amicon 30K 0.5 mL spin columns. 0.5 mL nuclease-free water was added to each column, then the column was spun down at 5000 x g for 4 minutes and the flow-through was discarded. The samples were loaded onto the columns (250 uL per spin) and spun down twice. The columns were washed and spun down with water 5 times (400 uL wash, 5000 x g for 4 minutes at 4 °C). On the final wash, the columns were spun for 10 minutes. The88LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO retentate was collected and its concentration was measured with NanoDrop™. Analysis of different RNA species (i.e., percent linear RNA or percent circRNA) in the RNA samples collected from prior to loading on the column (input), the flow-through (FT) (post BEX), and after stripping the column (Strip) for CE0001-dsRNA40, CE0001-dsRNA50, and CE0001-dsRNA60 was measured by AEX-HPLC. The results are shown in Table 1A.Table 1A. Analysis of different RNA species for CE0001-dsRNA40, CE0001-dsRNA50, and CE0001-dsRNA60.Further analysis of the % molecules containing the intron-containing linear RNA in the Input, FT, and Strip samples, respectively, for various RNA constructs were measured by dPCR (digital PCR), and the results are shown in FIGs. 5A and 5B. Three primer pairs against the IRES, the intron-E2 junction (intron-exon 2 junction, or 3’ splice site), and the intron-El junction (intron-exon 1 junction, or 5’ splice site) were used to measure the total amount of all RNAs, the amount of the unspliced or partly spliced RNA, and the amount of unspliced RNA only, respectively. Briefly, 10 fmole of the RNA sample was mixed with intron-El junction (using fluorescein amidites (FAM)) and IRES (using hexachlorofluorescein (HEX)) primer sets or intron-E2 junction (using FAM) and IRES (using HEX) primer sets. The mixture was prepared for dPCR by mixing with QIAcuity master mix (QIAGEN), and the mixture was then loaded onto a 96 well plate. The amplified PCR product was monitored by QIAcuity one digital PCR instrument (QIAGEN). The level of intron-E2 junction (FAM) and intron-El junction (FAM) were normalized to the level of IRES (HEX).The figures show that there were partly spliced linear RNAs in the FT samples for CE0001-dsRNA40 construct. In the case of CE0001-dsRNA50 and CE0001-dsRNA60 constructs, there was significant depletion of both un-spliced and partly-spliced linear RNA, indicating that the linear RNA in the FT samples appear to be mainly nicked RNA.89LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Example 3: Buffer salt concentration on binding favorabilityIn this example, RNA constructs were built using circularization element base CE0001. The binding efficiency of CE0001-dsRNA40 in different buffer conditions was tested by comparing six different buffers during the purification process. To test the binding efficiency of the components of each RNA construct to a dsRNA binding column, 1 ml AVIPure-dsRNA column (Repligen) was installed into a AKTA chromatography system (Cytiva). Bind and wash buffer (B&W buffer) was prepared as 20 mN Tris and 10 mN EDTA, and then the pH was adjusted to 8. Each buffer contained 20 mN Tris and 10 mM EDTA at pH 8.0, but the salt concentration varied from 0.7 M, 0.75 M, 0.8 M, 0.85 M, 1 M, or 1.5 M NaCl. The column was equilibrated with 10 Colum volume (CV) of B&W buffer, and the RNA was loaded. The RNA was diluted as 250 ug / ml in the presence of 1 M NaCl, 20 mM Tris, and 10 mM EDTA before loading. Then, 250 ug / mlR (ml per resin) of RNA was loaded. The column was washed with 5 CV of B&W buffer, and then stripped by 6 M guanidine HC1 stripped buffer. The flow-through or stripped fraction was collected by fraction collector and subjected to buffer exchange. 100K Amicon centrifuge fdter was used for buffer exchange. Briefly, the flow-through or stripped fraction was loaded onto 30K Amicon filter and centrifuged 5000 g for 10 minutes. The flow-through was discarded and RNAse-free water was loaded onto the column. It was repeated for 5 times.The RNA concentration in each fraction was quantified using a NanoDrop™ spectrophotometer. In order to further analyze the binding efficiency of components of each RNA construct to the dsRNA binding resin, the RNA samples were concentrated and buffer exchanged into water (BEX samples). The samples were concentrated using Amicon 30K 0.5 mL spin columns. 0.5 mL nuclease-free water was added to each column, then the column was spun down at 5000 x g for 4 minutes and the flow-through was discarded. The samples were loaded onto the columns (250 uL per spin) and spun down twice. The columns were washed and spun down with water 5 times (400 uL wash, 5000 x g for 4 minutes at 4 °C). On the final wash, the columns were spun for 10 minutes. The retentate was collected and its concentration was measured with NanoDrop™. The analysis results of the circRNA % in the flow-through, the flow-through yield, the circRNA recovery, and the intron depletion % for each circular RNA sample purified, using various buffers, are shown in Table 2. The circRNA % in the FT (post-BEX) and the intron depletion % were measured by AEX-HPLC. The flow-through yield % was measured as (amount of RNA in FT) / (amount of RNA in column input). The circRNA recovery % was measured as (circRNA % in FT post BEX x amount of RNA in FT) / (circRNA % in column input x amount of RNA in column input). As shown in Table 2, the buffer salt concentration impacted the dsRNA binding efficiency and the circular RNA purification efficiency.90LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Table 2. Analysis of the CE0001-dsRNA40 construct in different buffer conditions containing different salt concentrations.In a separate experiment, the analysis of intron and linear RNA depletions was measured by AEX-HPLC. The binding efficiency of CE0001-dsRNA40 was tested in comparison to WT (CE0001) constructs, under the buffer condition using 0.75 M NaCl. The RNA constructs were prepared with IVT reactions as described in Example 2.To test the binding efficiency of the components of each RNA construct to a dsRNA binding column, 5ml AVIPure-dsRNA column (Repligen) was installed into a AKTA chromatography system (Cytiva). Bind and wash buffer (B&W buffer) was prepared as 1 M NaCl, 20 mN Tris, and 10 mM EDTA, and then the pH was adjusted to 8. The column was equilibrated with 10 Colum volume (CV) of B&W buffer, and the RNA was loaded. The RNA was diluted as 250 ug / ml in the presence of 1 M NaCl, 20 mM Tris, and 10 mM EDTA before loading. Then, 250 ug / mlR (ml per resin) of RNA was loaded. The column was washed with 5 CV of B&W buffer, and then stripped by 6 M guanidine HC1 stripped buffer. The flow-through or stripped fraction was collected by fraction collector and subjected to buffer exchange. 30K Amicon centrifuge filter was used for buffer exchange. Briefly, the flow-through or stripped fraction was loaded onto 30K Amicon filter and centrifuged 5000 g for 10 minutes. The flow-through was discarded and RNAse-free water was loaded onto the column. It was repeated for 5 times.In order to further analyze the binding efficiency of components of each RNA construct to the dsRNA binding resin, the RNA samples collected from prior to loading on the column (Load), from the flow through (FT) and after stripping the column (Strip) were concentrated and buffer exchanged into water (BEX samples). The samples were concentrated using Amicon 30K 0.5 mL spin columns.0.5 mL nuclease-free water was added to each column, then the column was spun down at 5000 x g for 4 minutes and flow-through was discarded. The samples were loaded onto the columns (250 uL per spin) and spun down twice. The columns were washed and spun down with water 5 times (400 uL wash, 5000 x g for 4 minutes at 4 °C). On the final wash, the columns were spun for 10 minutes. The retentate was collected and its concentration was measured with NanoDrop™. Analysis of different RNA species (i.e., introns, linear, or circular) were analyzed via AEX-HPLC. FIG. 6A shows the chromatograms of the Load and FT from WT (CE0001) constructs, indicating little to no change. FIG. 6B shows the chromatograms of the Load, FT, and strip samples from the CE0001-91LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO dsRNA40 constructs, indicating the purification of the circular RNA constructs and the depletion of the intron and linear RNA species in the FT samples.Example 4: dsRNA column binding assay using different salt concentrations and encoded ORFs In this example, RNA constructs were built using circularization element base CE0001 or CE0062. CE0062 includes a 5’ circularization element and 3’ circularization element prepared from a modified Scytonema hofmanni Group I catalytic intron fragment with the following sequences: 5’ circularization element AGAAATGGAGAAGGTGTAGAGACTGGAAGGCAGGCACCCTAACGTTAAAGGCGAGGGT GAAGGGACAGTCCAGACCACAAACCAGTAAATCTGGGCAGCGAAAGCTGTAGATGGTA AGCATAACCCGACGAGCTACCAGGCAAATCCACTTCCCGCCACCAAATTAAAAAAACAA TAA (SEQ ID NO. 4), and3’ circularization element GCCTGGTAGCTCGTCGGGCTCAACAAGCAAAGTTAACTAAACGCTTATCAGTTAGTTTTG CAATGGGCGGTACGTGAAGAAACTTACGTGCGTTTACCTGTCAAACTCGGGGAAGCCAT TAGCGTGGTAATCCCGAACCAAGCTCC (SEQ ID NO. 5).The constructs were either bicistronic, encoding two different proteins via two open reading frames (ORFs), or were monocistronic, encoding one protein via one open reading frame (ORF), as shown in Table 3. A positive control of dsRNA (consisting of a 141-bp dsRNA) and a negative control of ssRNA (consisting of a 141 -nucleotide ssRNA) were included.Plasmids samples were prepared as described in Example 2. To test the binding efficiency of the components of each RNA construct to a dsRNA binding column, 5 ml AVIPure-dsRNA column (Repligen) was installed into a AKTA chromatography system (Cytiva). Three different buffers were tested to determine how NaCl concentration impacts binding. The compositions of three different buffers were 0.75 M NaCl, 20 mN Tris pH 8.0, and 10 mM EDTA; IM NaCl, 20 mM Tris pH 8.0, and 10 mM EDTA; and 1.25 M NaCl, 20 mM Tris pH 8.0, and 10 mM EDTA. The column was equilibrated with 10 Colum volume (CV) of B&W buffer, and then the RNA was loaded. The RNA was diluted as 250ug / ml in the presence of IM NaCl, 20mM Tris, and lOmM EDTA before loading. Then, 250 ug / mlR (ml per resin) of RNA was loaded. The column was washed with 5 CV of B&W buffer, and then stripped by 6 M guanidine HC1 stripped buffer. The flow-through or stripped fraction was collected by fraction collector and subjected to buffer exchange. 30K Amicon centrifuge filter was used for buffer exchange. Briefly, the flow-through or stripped fraction was loaded onto 30K Amicon filter and centrifuged 5000 g for 10 minutes. The flow-through was discarded and RNAse-free water was loaded onto the column. It was repeated for 5 times.The RNA concentration in each fraction was quantified using a NanoDrop™ spectrophotometer.92LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO FIGS. 7A-7C show the RNA species collected after FT (not binding to the dsRNA resin) and after strip (bound to the dsRNA resin) using the constructs listed in Table 3. The construct names used have been described in Table 1, except substituting for the respective circularization element. It was observed that the salt concentration in the buffer and the size of the construct impacted the efficacy of the purification. FIG. 7D shows the control species collected after FT and after strip. FIGS. 7A-7D show that more dsRNA leaked into the flow-through at the higher salt concentrations.Table 3. The RNA constructs tested.Example 5: dsRNA column binding assay with different circularization element baseIn this example, RNA constructs were built using circularization element base CE0001 or CE0062. The constructs were either bicistronic, encoding two different proteins via two open reading frames (ORFs), or were monocistronic, encoding only one protein via one open reading frame (ORF), as shown in Table 4.Plasmids samples were prepared as described in Example 2. To test the binding efficiency of the components of each RNA construct to a dsRNA binding resin, 200 ul of AVIpure resin (Repligen) at a 50% resin in 20% ethanol was loaded onto the UNIFILTER 96- well microplate (Cytiva). Storage buffer was removed by centrifugation on a swing bucket rotor (2000 xg for 2 minutes at ambient temperature), and the dsRNA binding resin was equilibrated by passing 500 ul of buffer through the resin three times with centrifugation. The composition of the buffer was 1 M NaCl, 20 mN Tris pH 8.0, 10 mM EDTA. After resin equilibration, 20 ng RNA in 500 ul of lx buffer (generated as described above) was loaded onto the resin and allowed to bind for 10 minutes at ambient temperature prior to centrifugation. The resin was washed three times with 500 ul of buffer and centrifuged to collect separate flow-throughs (FT). The leftover RNA bound to the resin was stripped with stripping buffer containing 6 M guanidine hydrochloride. The stripping buffer was collected separately by93LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO centrifugation. The RNA concentration in each fraction was quantified using a NanoDrop™ spectrophotometer.FIG. 8 shows the RNA species collected after FT (not binding to the dsRNA resin) and after strip (bound to the dsRNA resin) using the constructs listed in Table 4. The construct names used have been described in Table 1, except substituting for the respective circularization element. It was observed that both circularization element bases performed well, and that the dsRNA40 with a CE0062 base performed well across the constructs encoding various ORFs.Table 4. The RNA constructs tested.Example 6: dsRNA column binding assay using circularization elements containing a multi-dsRNA hairpin extensionIn this example, RNA constructs were built using circularization element CE0001, as described in Example 2.The design of the RNA constructs was similar to those described in Example 1, except the extensions contained in the 5’ and 3’ circularization elements at the 5’ and 3’ ends. The 5’ circularization element (5’CE) and 3’ circularization element (3’CE) each contain a multi-dsRNA hairpin structure, with a series of (2, 3, or 4) dsRNA hairpins operably linked by linkers(s) or spacer sequences(s) sequentially, and with the dsRNA stems for each of the dsRNA hairpins that are 30 base pairs (bp), 35 bp, 40 bp, or 50 bp long and loops that are 4 nucleotides (nt) long. The dsRNA stems comprise nucleotides that are complementary to each other to form dsRNA once synthesized by IVT. As negative controls, the 5’ circularization element (5’CE) and 3’ circularization element (3’CE) containing no dsRNA hairpin extension was used. The results of the constructs having the 5’CE and 3’CE each containing a multi-dsRNA hairpin structure at each of the 5’ and 3’ ends, as described above, were also compared against the constructs having the 5’CE and 3’CE each containing a single94LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO dsRNA hairpin at each of the 5’ and 3’ ends, with the dsRNA stems that are 40 bp or 50 bp long and loops that are 4 nucleotides (nt) long.The details of the RNA constructs used in this example are shown in FIG. 9, with the RNA constructs and their corresponding labels listed in Table 5A, and the detailed sequence information for each RNA construct listed in Table 5B. The wild type 5’CE and 3’CE are the WT (CE0001) containing no dsRNA extension used in Example 2, discussed in Table 1. In the diagrams, bp refers to the number of base pairs for the stem of each dsRNA hairpin; all the dsRNA hairpins have a loop of 4 nucleotides (nt) long. The left column labeled “5’CE” shows the extension contained in the 5’CE, and the right column labeled “3’CE” shows the extension contained in the 3’CE for each RNA construct. The label “x” indicates the number of dsRNA hairpin structure contained in the extension of the CE. For instance, the construct of 5’CE / dsRNA40-lx and 3’CE / dsRNA40-lx indicates that the RNA was built with each of the 5’ circularization element and 3’ circularization element containing a 40-bp dsRNA hairpin structure. As another example, the construct of 5’CE / dsRNA30-3x and 3’CE / dsRNA30-3x indicates that the RNA was built with each of the 5’ circularization element and 3’ circularization element containing a multi -dsRNA hairpin structure, which is three 30-bp dsRNA hairpins operably linked by a linker or spacer sequence of 6-10 nucleotides (e.g., 6-10 polyA nucleotides). In addition, the dsRNA hairpin structure (whether a single dsRNA hairpin or a multi-dsRNA hairpin structure) and the CE element is also operably linked by a linker or spacer sequence of 5-10 nucleotides (e.g., 5-10 polyA nucleotides).Table 5 A. The RNA constructs tested in FIG. 995LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO Table 5B. The sequences for the RNA constructs listed in Table 5A96LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO97LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO98LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO99LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO100LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WOThe 5' CE / dsRNA complete DNA Sequence listed in this table for CE0100, CE0101, CE0103, CE0104, CE0105, CE0106, CE0107, CE0108, and CE0109 may or may not contain the nucleotide “A” at the end of its respective sequence: i.e., the 5' CE / dsRNA complete DNA Sequence for each identified construct may end with the nucleotide “A” as listed, or may end with the nucleotide “C,” without the last nucleotide “A.”5 Table 5C. The sequences for the RNA constructs listed in Table 1, Example 2, Table 9, and Table 10.101LEGALM 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO102LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO103LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO104LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WOThe 5' CE / dsRNA complete DNA Sequence listed in this table for CE0102, CE0110, CE0112, CE0113, CE0114, CE0115, and CE0116 may or may not contain the nucleotide “A” at the end of its respective sequence: i.e., the 5' CE / dsRNA complete DNA Sequence for each identified construct may end with the nucleotide “A” as listed, or may end with the nucleotide “C,” without the last nucleotide “A.”105LEGAL\112096584\8Docket No.: 32324.0220-US-PCT SBM24-113WO Plasmids samples were prepared as described in Example 2.A. The first round of purificat...
Claims
Docket No.: 32324.0220-US-PCT SBM24-113WO WHAT IS CLAIMED IS:
1. A method of separating linear polyribonucleotides from a plurality of polyribonucleotides comprising a mixture of linear polyribonucleotides and circular polyribonucleotides, the method comprising:(a) providing a sample comprising the plurality of polyribonucleotides, wherein the plurality of polyribonucleotides comprises one or more linear polyribonucleotides, each comprising one or more double-stranded RNA (dsRNA) regions;(b) contacting the sample with a reagent that binds to the dsRNA regions; and(c) separating the linear polyribonucleotides bound to the reagent from the plurality of polyribonucleotides.
2. The method of claim 1, wherein the contacting step is performed under conditions in which the reagent binds dsRNA present on the linear polyribonucleotides preferentially relative to dsRNA present in the circular polyribonucleotides.
3. The method of claim 1 or 2, wherein each dsRNA region is located at a 5' terminus, a 3' terminus, or both a 5' and a 3' terminus of the linear polyribonucleotide.
4. The method of any one of claims 1-3, wherein at least one dsRNA region is a dsRNA hairpin.
5. The method of claim 4, wherein the dsRNAs of at least one terminus of the linear polyribonucleotide have a multi-dsRNA hairpin structure.
6. The method of any one of claims 1-5, wherein the linear polyribonucleotide comprises one or more dsRNAs positioned adjacent and external to a circularization element.
7. The method of any one of claims 1-6, wherein the dsRNAs are absent from the circular polyribonucleotides recovered after separation.
8. The method of any one of claims 1-7, wherein the linear polyribonucleotide comprises at least one dsRNA at a 5' terminus and at least one dsRNA at a 3' terminus.
9. The method of any one of claims 1-8, wherein the reagent is contained in a dsRNA-binding column or resin operated in a flow-through mode.113LEGALXl 12096584X8Docket No.: 32324.0220-US-PCT SBM24-113WO 10. The method of claim 9, wherein the dsRNA-binding column or resin operates in a flow-through mode.
11. The method of claim 10, wherein the polyribonucleotides not bound by the column or resin comprise the circular polyribonucleotides.
12. A linear polyribonucleotide comprising a formula of 5’-(DS2)-(CE2)-(P)-(CEl)-(DSl)-3’, wherein:(CE2) comprises a 5’ circularization element;(P) comprises a polyribonucleotide cargo;(CE1) comprises a 3’ circularization element;each of (DS2) and (DS1) is independently absent or comprises a dsRNA, provided at least one of (DS2) and (DS1) comprises a dsRNA.
13. The linear polyribonucleotide of claim 12, wherein the dsRNA is positioned external to a circularization element and is removed upon circularization.114LEGALXl 12096584X8