Novel neurophilic adeno-associated virus capsid with peripheral organ detargeting

Abstract

The present invention relates to novel neurotropic adeno-associated virus (AAV) capsid variants. In particular, the present invention relates to novel AAV capsid variants that are effective to transduce cells in the CNS after systemic administration, but show reduced transduction of the peripheral organ. The present invention further relates to methods for identifying AAV capsid variants having one or more desired characteristics such as, for example, a combination of CNS tropism and peripheral organ de-targeting.

Description

Technical Field

[0001] This invention relates to the fields of medicine, molecular biology, gene therapy, and insect cell culture. In particular, this invention relates to novel neurotropic adeno-associated virus (AAV) capsids. The invention further relates to methods for identifying AAV capsid variants having desired characteristics. Background Technology

[0002] Adeno-associated virus (AAV) has become a preferred platform for gene therapy. However, the success of AAV-based therapeutic strategies is particularly limited by nonspecific tropism. In particular, developing novel AAV capsids that can transduce cells in the central nervous system (CNS) via systemic administration is one of the most interesting challenges in the field of AAV-based gene therapy for CNS diseases. The narrow therapeutic window, inefficient blood-brain barrier (BBB) ​​crossing, and high levels of isolation and transduction in peripheral organs have limited the CNS application of first-generation AAV-based vectors. Therefore, several next-generation AAV capsids have been engineered in recent years, resulting in CNS capsid variants with different modes of action.

[0003] For example, Hanlon et al. (2019, Mol Ther Methods Clin Dev. [Molecular Therapy - Methods & Clinical Development] 15:320-332) and Nonnenmacher et al. (2020, Mol Ther Methods Clin Dev. [Molecular Therapy - Methods & Clinical Development] 20:366-378) reported variant AAV9 capsids with increased CNS transduction efficiency compared to wild-type AAV9. However, after systemic administration, these variant AAV9 capsids still transduced peripheral organs (such as the liver, skeletal muscle, and heart) with similar efficiency to wild-type AAV9. Goersten et al. (2022, Nat Neurosci. [Nature Neuroscience] 25(1):106-115) disclosed AAV capsid variants with whole-brain transgene expression and reduced liver targeting after intravenous delivery. Pulicherla et al. (2011, Mol Ther. [Molecular Therapy] 19(6):1070-8) reported the generation of variant AAV9 capsids through random mutagenesis of residues in the surface-exposed regions of the major AAV9 capsid protein. These capsid variants were classified into three functional subgroups relative to the parental AAV9, exhibiting: (i) a functionally defective phenotype with reduced transduction efficiency across multiple tissues; (ii) reduced selectivity in liver transduction; or (iii) similar transduction profiles.

[0004] However, there remains a need in the art for further improved AAV capsids that effectively transduce cells in the CNS after systemic administration, but show reduced transduction in peripheral organs. The object of this invention is to provide such AAV capsids with CNS tropism and peripheral organ detargeting, and to provide means and methods for screening such AAV capsids.

[0005] A further object of the present invention is to provide means and methods for screening and identifying AAV capsid variants having desired characteristics, such as, for example, a combination of CNS tropism and peripheral organ detargeting. Summary of the Invention

[0006] In a first aspect, an adeno-associated virus (AAV) serotype 9 (AAV9) or clade F AAV capsid protein variant is provided, the AAV serotype 9 (AAV9) or clade F AAV capsid protein variant containing a mutation in one or more amino acids, the one or more mutations conferring at least one of the following: i) a phenotype of reduced liver transduction compared to a control capsid protein without the one or more mutations; and ii) a phenotype of reduced overall transduction compared to a control capsid protein without the one or more mutations, and wherein the capsid protein variant further comprises an amino acid sequence that confers increased CNS transduction compared to a control capsid protein without the amino acid sequence.

[0007] In one embodiment, the AAV capsid protein variant is a variant in which at least one of the following is true: i) the variant contains a mutation in one or more amino acids in amino acid regions 452-458, 498-504, 590-595 and / or 582-589, and wherein the one or more mutations result in a phenotype of reduced liver transduction compared to a control without the one or more mutations; ii) the variant contains a mutation at T138, S414, G453, K557, T568, T582 and Q590 or any combination thereof, and wherein the one or more mutations result in a phenotype of reduced overall transduction compared to a control capsid protein without the one or more mutations; and iii) the amino acid sequence conferring increased CNS transduction to the variant comprises an amino acid sequence selected from the group consisting of STTLYSP, FVVGQSY, DGTLAVPFK and WPTSYDA, and a sequence differing from the above amino acid sequences by no more than four, three, two or one amino acid.

[0008] In one embodiment, the AAV capsid protein variant is a variant in which at least one of the following is true: i) the variant contains at least one mutation selected from the group consisting of mutations at positions W595, Q592, W503, N498, and E500, and the amino acid sequence DGAATKN at positions 452-458, and wherein the one or more mutations result in a phenotype of reduced liver transduction compared to a control without the one or more mutations; ii) the variant contains mutations at both T568 and Q590, or both S414 and G453, or all of T138, S414, G453, K557, and T582, or all of S414, G453, K557, and T582, and wherein the one or more mutations result in a phenotype of reduced overall transduction compared to a control capsid protein without the one or more mutations; and iii) The amino acid sequence conferring increased CNS transduction to this variant comprises the following amino acid sequence, selected from the group consisting of: FVVGQSY, FVVAQSY, FVVVQSY, FVVLQSY, FVVIQSY, FVVNQSY, FVVSQSY, FVVEQSY, FVVQQSY, FVVCQSY, FVVTQSY, FVVPQSY, FVVQSY, FVGVQSY, FVVQGSY, FVQGVSY, FSVGQVY, and FSQGVVY, preferably selected from the group consisting of: FVVGQSY, FVVAQSY, FVVPQSY, FVGVQSY, and FVVQGSY.

[0009] In one embodiment, the AAV capsid protein variant is a variant in which at least one of the following is true: i) the variant contains a W595C mutation, a Q592L mutation, a W503R mutation, an N498Y mutation, an E500D mutation, or any combination thereof, wherein the one or more mutations result in a phenotype of reduced liver transduction compared to a control without the one or more mutations; ii) the variant contains a T568P and Q590L mutation, or a S414 and G453D mutation, or a T138A, S414N, G453D, K557E, and T582I mutation, or a S414N, G453D, K557E, and T582I mutation; and iii) an inserted amino acid sequence is inserted into the variant, inserted into a hypervariable region of the AAV capsid protein sequence, preferably inserted into a hypervariable region selected from ring IV or ring VIII.

[0010] In one embodiment, the AAV capsid protein variant comprises the following variants: a) T138A, S414N, G453D, K557E, and T582I mutations and an insertion into loop VIII, preferably an amino acid sequence FVVGQSY inserted between amino acid positions 588 and 589; b) S414N, G453D, K557E, and T582I mutations and an insertion into loop VIII, preferably an amino acid sequence FVVGQSY or FVVAQSY inserted between amino acid positions 588 and 589; c) T138A, S414N, G453D, K557E, and T582I mutations and an insertion into loop VIII, preferably an amino acid sequence WPTSYDA inserted between amino acid positions 588 and 589; d) S414N, G453D, K557E and T582I mutations and the insertion ring VIII, preferably the amino acid sequence WPTSYDA inserted between amino acid positions 588 and 589; e) the amino acid sequence DGAATKN at positions 452-458 and the insertion ring VIII, preferably the amino acid sequence FVVGQSY inserted between amino acid positions 588 and 589; or, f) the amino acid sequence DGAATKN at positions 452-458 and the insertion ring VIII, preferably the amino acid sequence WPTSYDA inserted between amino acid positions 588 and 589.

[0011] In one embodiment, the AAV capsid protein variant is a variant contained in the amino acid sequence selected from the group consisting of SEQ ID NO: 6, 7, 9, 10 and 96.

[0012] In one embodiment, the AAV capsid protein variant is a variant of at least one of the VP1, VP2, and VP3 capsid proteins.

[0013] In a second aspect, a nucleic acid encoding a variant of the AAV capsid protein as described herein is provided.

[0014] In a third aspect, a host cell is provided that contains a nucleic acid molecule or expression construct for expressing a capsid protein variant as described herein.

[0015] In a fourth aspect, a method for generating AAV vector viral particles as described herein, the AAV vector viral particles comprising a capsid protein variant as described herein are provided.

[0016] In a fifth aspect, a recombinant AAV (rAAV) vector viral particle comprising at least one variant of the AAV capsid protein as described herein is provided, wherein the rAAV vector viral particle preferably does not contain at least one of the wild-type VP1, VP2 and VP3 capsid proteins.

[0017] In one embodiment, the rAAV vector viral particle comprises a nucleic acid molecule capsidated by at least one capsid protein variant, and wherein the nucleic acid molecule comprises a transgene flanked by at least one AAV inverted terminal repeat (ITR).

[0018] In a sixth aspect, a composition comprising AAV vector viral particles as described herein is provided, wherein preferably, the composition is a pharmaceutical composition comprising the AAV vector viral particles and at least one pharmaceutically acceptable carrier.

[0019] In a seventh aspect, an AAV vector viral particle or composition as described herein is provided for use as a pharmaceutical agent, wherein preferably, the pharmaceutical agent is used to treat central nervous system disorders.

[0020] In an eighth aspect, an AAV vector viral particle as described herein, or a composition comprising the AAV vector viral particle, is provided for use (as a pharmaceutical agent) in gene therapy. In one embodiment, a method of gene therapy is provided, comprising the step of administering an effective amount of the AAV vector viral particle as described herein, or a composition comprising the AAV vector viral particle, to a subject requiring gene therapy. In one embodiment, the gene therapy is used to treat a disease as defined above (e.g., a disease or condition treatable by gene therapy of the central nervous system).

[0021] In a ninth aspect, a method for identifying AAV capsid variants having desired characteristics is provided, the method comprising: a) providing a library containing a plurality of individually generated AAV capsid variants, wherein each member in the library differs from the amino acid sequence of the AAV capsid variants of other members in the library by at least one amino acid, and wherein each member in the library comprises a DNA construct, wherein the DNA construct comprises: i) a unique molecular identifier (UMI) that is unique to the member in the library; ii) a reporter gene operatively linked to a promoter for driving expression in mammalian cells; and iii) at least one AAV ITR; b) contacting the library with a culture of cells, organoids, or tissues, or administering the library to a nonhuman animal; c) allowing the AAV capsid variants in the library to transduce these cells, these organoids, these tissues, or cells in the animal; and d) applying b) At least one AAV capsid variant of these cells, these organoids, these tissues, or at least one cell of the desired cell type in the animal is identified as an AAV capsid variant having the desired characteristics by sequencing its UMI, and optionally, an AAV capsid variant having the desired characteristics is recovered from cells of the desired cell type.

[0022] In one embodiment of the method, step d) includes detecting cell transduction of the desired cell type by detecting the expression of the reporter gene in at least one cell of the desired cell type.

[0023] In one embodiment of the method, in step d), in at least one cell of the desired cell type, for at least two members in the library, at least one of the mRNA expressed by the at least two members and the genome copy number of the at least two members is quantified and identified by sequencing their UMI, and the member having the highest mRNA expression level and at least one of the genome copy number is identified as an AAV capsid variant having the desired characteristic.

[0024] In one embodiment, the method is a method in which, in cells comprising more than one cell type including at least one desired cell type, for at least two members in the library, at least one of the mRNA expressed by the at least two members and the genomic copy number of the at least two members is quantified and identified by sequencing their UMI, and wherein the member having the most desired distribution on more than one cell type is identified as an AAV capsid variant having the desired characteristic. Detailed Implementation

[0025] definition

[0026] Unless otherwise defined, the technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Those skilled in the art will recognize that many methods and materials similar to or equivalent to those described and used herein can be employed in the practice of this invention. In fact, this invention is by no means limited to these methods.

[0027] In this document and its claims, the verb "comprising" and its inflections are used in their non-limiting sense to mean including the items that follow the word, but not excluding items not specifically mentioned. Furthermore, unless the context explicitly requires the presence of one / a and only one / a type of element, mentioning an element by the indefinite article "a / a (a or an)" does not preclude the possibility of more than one / a type of element. Therefore, the indefinite article "a / a (a or an)" generally means "at least one / a type".

[0028] As used herein, the term “and / or” indicates that one or more of the stated circumstances may occur individually or in combination with at least one of the stated circumstances, up to and including all of the stated circumstances.

[0029] As used in this article, “at least” a specific value means that specific value or more. For example, “at least 2” is understood as the same as “2 or more” (i.e., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, etc.).

[0030] The word “about” or “approximately” when used in conjunction with a numerical value (e.g., about 10) preferably means that the value can be a given value (10) plus or minus 0.1% of that value.

[0031] As used herein, "effective amount" means the amount of a drug agent required to improve the symptoms of a disease relative to an untreated patient. The effective amount of one or more active agents used in the practice of this invention for therapeutic treatment of, for example, cancer or neurological disorders, varies depending on the manner of administration, the subject's age, weight, and general health condition. Ultimately, the attending physician or veterinarian will determine the appropriate amount and dosage regimen. This amount is referred to as the "effective" amount and can be determined, for example, as genome copies / kilogram (GC / kg) or GC / dose. Therefore, in the context of this disclosure, when referring to the administration of a drug that is "effective" against a disease or condition, this indicates that administration in a clinically appropriate manner would produce a beneficial effect on at least a statistically significant proportion of patients, such as improvement of symptoms, cure, reduction of at least one sign or symptom of the disease, increased lifespan, improved quality of life, or other positive effects generally recognized by physicians familiar with treating that particular type of disease or condition.

[0032] As described in this document, the use of a substance as a pharmaceutical agent can also be interpreted as its use in the manufacture of a pharmaceutical agent. Similarly, whenever a substance is used for treatment or as a pharmaceutical agent, it can also be used to manufacture a pharmaceutical agent for treatment. Products used as pharmaceutical agents as described herein can be used in treatment methods, wherein such treatment methods include the application of the product for use.

[0033] The terms “homology,” “sequence identity,” etc., are used interchangeably herein. Sequence identity is defined herein as the relationship between two or more amino acid (peptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by sequence comparison. In the art, “identity” and “similarity” also mean the degree of sequence correlation between amino acid or nucleic acid sequences, as determined, as in the case of matching strings of such sequences. “Identity” and “similarity” can be readily calculated using known methods.

[0034] "Sequence identity" and "sequence similarity" can be determined by aligning two peptide or nucleotide sequences using global or local alignment algorithms, depending on the length of the two sequences. Global alignment algorithms (e.g., Needleman-Wunsch) are preferred for aligning sequences of similar length, as these algorithms optimally align sequences across their entire length; while local alignment algorithms (e.g., Smith-Waterman) are preferred for aligning sequences of significantly different lengths. Sequences (when optimally aligned using default parameters via, for example, programs GAP or BESTFIT) can be described as "substantially identical" or "commonly similar" when they have at least a minimum percentage of sequence identity (as defined below). GAP uses Needleman and Wunsch global alignment algorithms to align two sequences across their entire length (full length), maximizing the number of matches and minimizing the number of gaps. Global alignment is suitable for determining sequence identity when two sequences have similar lengths. Typically, the default GAP parameters are used, where the vacancy creation penalty = 50 (nucleotides) / 8 (proteins) and the vacancy extension penalty = 3 (nucleotides) / 2 (proteins). For nucleotides, the default scoring matrix used is nwsgapdna, and for proteins, the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS [Proceedings of the National Academy of Sciences] 89, 915-919). Sequence alignment and sequence identity percentage scores can be determined as follows: using a computer program, such as GCG Wisconsin software package version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, 92121-3752, USA; or using open-source software, such as the programs "needle" (using the global Needman-Onsch algorithm) or "water" (using the local Smith-Waltman algorithm) in EmbossWIN version 2.10.0, using the same parameters as GAP above, or using the default settings (both for "needle" and "water," and both for protein and DNA alignments, the default gap opening penalty is 10.0, and the default gap extension penalty is 0.5; for protein, the default score matrix is ​​Blossum62; and for DNA, the default score matrix is ​​DNAFull). When sequences have significantly different total lengths, local alignment, such as local alignment using the Smith-Waltman algorithm, is preferred.

[0035] Alternatively, the similarity or identity percentage can be determined by searching public databases using algorithms such as FASTA, BLAST, etc. Therefore, the nucleic acid and protein sequences of this invention can be further used as "query sequences" to search public databases, for example, to identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul et al. (1990) J. Mol. Biol. [Journal of Molecular Biology] 215:403-10. BLAST nucleotide searches can be performed using the NBLAST program (score = 100, word length = 12) to obtain nucleotide sequences homologous to the oxidoreductase nucleic acid molecules of this invention. BLAST protein searches can be performed using the BLASTx program (score = 50, word length = 3) to obtain amino acid sequences homologous to the protein molecules of this invention. To obtain gap-filled alignments for comparison targets, Gapped BLAST can be used, as described in Altschul et al., (1997) Nucleic Acids Res. 25(17): 3389-3402. When using BLAST and Gapped BLAST procedures, the default parameters of the respective procedures (e.g., BLASTx and BLASTn) can be used. See the homepage of the National Center for Biotechnology Information (NCBI). http: / / www.ncbi.nlm.nih.gov /

[0036] As used herein, the terms "selectively hybridizing," "hybridizes selectively," and similar terms are intended to describe hybridization and washing conditions under which nucleotide sequences that are at least 66%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, or more preferably at least 99% homologous to each other typically maintain hybridization. That is, such hybridized sequences may have at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, more preferably at least 85%, even more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, or more preferably at least 99% sequence identity.

[0037] Preferred, non-limiting examples of such hybridization conditions are hybridization in 6X sodium chloride / sodium citrate (SSC) at about 45°C, followed by washing once or more in 1X SSC, 0.1% SDS at about 50°C, preferably about 55°C, preferably about 60°C, and even more preferably about 65°C.

[0038] Highly stringent conditions include, for example, hybridization at approximately 68°C in 5x SSC / 5x Denhardt solution / 1.0% SDS, followed by washing at room temperature in 0.2x SSC / 0.1% SDS. Alternatively, washing can be performed at 42°C.

[0039] Skilled technicians will know which conditions are suitable for stringent and highly stringent hybridization conditions. Further guidance on such conditions is readily available in the field, for example in the following literature: Sambrook et al., 1989, *Molecular Cloning, A Laboratory Manual*, Cold Spring Harbor Press, New York; and Ausubel et al. (eds.), Sambrook and Russell (2001) "Molecular Cloning: A Laboratory Manual" (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York; and 1995, *Current Protocols in Molecular Biology*, (John Wiley & Sons, New York).

[0040] Of course, polynucleotides that hybridize only with a multi-A sequence (such as the 3' end multi(A) bundle of mRNA) or a complementary segment of T (or U) residues will not be included in the polynucleotides of the present invention for specific hybridization with a portion of the nucleic acid of the present invention, because such polynucleotides will hybridize with any nucleic acid molecule containing a multi(A) segment or its complement (e.g., virtually any double-stranded cDNA clone).

[0041] The terms "nucleic acid construct" or "nucleic acid vector" should be understood herein to refer to artificial nucleic acid molecules produced using recombinant DNA technology. Therefore, the term "nucleic acid construct" does not include naturally occurring nucleic acid molecules, although a nucleic acid construct may contain (a portion of) a naturally occurring nucleic acid molecule. A "vector" is a nucleic acid construct (typically DNA or RNA) used to transfer a foreign nucleic acid sequence (i.e., DNA or RNA) into a host cell. The vector is preferably maintained in the host by at least one method of autonomous replication and integration into the genome of the host cell. The terms "expression vector" or "expression construct" refer to a nucleotide sequence capable of influencing the expression of a gene in a host cell or host organism compatible with such a sequence. These expression vectors typically contain at least one "expression cassette," a functional unit capable of influencing the expression of a sequence encoding a product to be expressed, wherein the coding sequence is operatively linked to an appropriate expression control sequence, which at least contains a suitable transcriptional regulatory sequence and optionally a 3' transcription termination signal. Additional factors necessary or helpful in influencing expression, such as expression enhancer elements, may also be present. The expression vector will be introduced into a suitable host cell and is capable of influencing the expression of the coding sequence in an in vitro cell culture of the host cell. Preferred expression vectors will be suitable for expressing viral proteins and / or nucleic acids, particularly recombinant parvovirus proteins and / or nucleic acids, such as baculovirus vectors for expressing parvovirus proteins and / or nucleic acids in insect cells.

[0042] A “parvovirus vector” is defined as a recombinant parvovirus or parvovirus particle containing a polynucleotide delivered in vivo, in vitro, or extracellularly to a host cell. Adeno-associated virus (AAV) vectors are examples of parvovirus vectors. In this document, parvovirus or AAV vector refers to a polynucleotide containing a portion of the parvovirus genome (typically at least one ITR) and a transgenic polynucleotide, preferably packaged within a parvovirus or AAV capsid.

[0043] As used herein, the term "promoter" or "transcriptional regulatory sequence" refers to a nucleic acid fragment that controls the transcription of one or more coding sequences, is upstream of the transcription start site relative to the coding sequence, and is structurally identified by the presence of a DNA-dependent RNA polymerase binding site, a transcription start site, and any other DNA sequence, including but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequence known to those skilled in the art to directly or indirectly regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically or developmentally regulated (e.g., by the application of a chemical inducer or biological entity).

[0044] The term “reporter” can be used interchangeably with “marker”, although it is primarily used to refer to visible markers such as green fluorescent protein (GFP) or luciferase.

[0045] The terms “protein” or “polypeptide” are used interchangeably and refer to molecules composed of chains of amino acids without specifying a particular mode of action, size, three-dimensional structure, or origin.

[0046] The term "gene" refers to a segment of DNA contained in a cell that is operatively linked to a suitable regulatory region (e.g., a promoter) and transcribed into an RNA molecule (e.g., mRNA). A gene typically contains several operatively linked segments, such as a promoter, a 5' leader sequence, a coding region, and a 3' untranslated sequence (3' end) containing a polyadenylation site. "Gene expression" refers to the process in which a DNA region operatively linked to a suitable regulatory region (particularly a promoter) is transcribed into RNA that is biologically active, i.e., capable of being translated into a biologically active protein or peptide.

[0047] The term "homologous," when used to indicate the relationship between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, should be understood to mean that in nature, the nucleic acid or polypeptide molecule is produced by a host cell or organism of the same species (preferably the same strain or lineage). If homologous to a host cell, the nucleic acid sequence encoding the polypeptide will typically (but not necessarily) be operatively linked to another (heterologous) promoter sequence and (if applicable) another (heterologous) secretory signal sequence and / or terminator sequence, distinct from its natural environment. It should be understood that regulatory sequences, signal sequences, terminator sequences, etc., can also be homologous to a host cell. In this context, the use of only "homologous" sequence elements allows for the construction of "self-cloning" genetically modified organisms (GMOs) (self-cloning is defined herein as in Annex II of European Directive 98 / 81 / EC). When used to indicate the relevance of two nucleic acid sequences, the term "homologous" means that a single-stranded nucleic acid sequence can hybridize with a complementary single-stranded nucleic acid sequence. The degree of hybridization can depend on a variety of factors, including the amount of identity between the sequences and hybridization conditions (such as temperature and salt concentration, discussed later).

[0048] The terms “heterologous” and “exogenous” when used with respect to nucleic acids (DNA or RNA) or proteins refer to nucleic acids or proteins that are not naturally present as part of the organism, cell, genome, or DNA or RNA sequence in which they are found, or in one or more locations in a cell or genome or DNA or RNA sequence that are not found in nature. Heterologous and exogenous nucleic acids or proteins are not endogenous to the cell in which they are introduced, but have been acquired from another cell or synthesized or recombined. Typically, but not necessarily, such nucleic acids encode proteins that are not typically produced by a cell that transcribes or expresses DNA, i.e., exogenous proteins. Similarly, exogenous RNA encodes proteins that are typically not expressed in cells in which the exogenous RNA is present. Heterologous / exogenous nucleic acids and proteins may also be referred to as foreign nucleic acids or proteins. Any nucleic acid or protein that is foreign to the cell in which it is expressed, as will be recognized by those skilled in the art, is covered herein by the terms heterologous or exogenous nucleic acids or proteins. The terms heterologous and exogenous also apply to non-natural combinations of nucleic acid or amino acid sequences, i.e., combinations in which at least two of the sequences are foreign relative to each other.

[0049] As used herein, the term "non-naturally occurring" when referring to an organism means that the organism possesses at least one genetic alteration that is not typically found in naturally occurring strains of the reference species (including wild-type strains of the reference species). Genetic alterations include, for example, modifications to expressible nucleic acids encoding proteins or enzymes, additions of other nucleic acids, deletions of nucleic acids, substitutions of nucleic acids, or other functional disruptions of the organism's genetic material. Such modifications include, for example, coding regions and functional segments of heterologous or homologous polypeptides of the reference species. Additional modifications include, for example, non-coding regulatory regions, where modifications alter the expression of genes or operons. Genetic modifications to nucleic acid molecules encoding enzymes or functional segments thereof can confer on non-naturally occurring organisms biochemical reactivity or metabolic pathway capabilities altered from their naturally occurring state.

[0050] As used herein, the term "operably ligated" refers to the ligation of polynucleotide (or polypeptide) elements in a functional relationship. A nucleic acid is "operably ligated" when it is positioned to have a functional relationship with another nucleic acid sequence. For example, if a transcriptional regulatory sequence affects the transcription of a coding sequence, then the transcriptional regulatory sequence is operably ligated to the coding sequence. Operable ligation means that the ligated DNA sequences are typically contiguous, and in cases where the binding of two protein-coding regions is required, contiguous and within the reading frame.

[0051] When expression control sequences control and regulate the transcription and / or translation of nucleotide sequences, they are "operably linked" to the nucleotide sequence. Therefore, expression control sequences can include promoters, enhancers, internal ribosome entry sites (IRES), transcription terminators, start codons preceding protein-coding genes, intron splicing signals, and stop codons.

[0052] The term "expression control sequence" is intended to include at least a sequence whose presence is designed to influence expression, and may also include additional advantageous components. For example, leader sequences and fusion mating sequences are expression control sequences. The term may also include nucleic acid sequence designs that remove unwanted potential start codons, both inside and outside the frame. It may also include nucleic acid sequence designs that remove unwanted potential splicing sites. It includes sequences that guide the addition of multi-A tails or multi-adenosylated sequences (pA), i.e., a string of adenine residues at the 3' end of mRNA, referred to as multi-A sequences. It may also be designed to enhance mRNA stability. Expression control sequences (e.g., promoters) that influence transcriptional and translational stability, and sequences that influence translation (e.g., Kozak sequences), are known in insect cells. Expression control sequences may have properties that allow regulation of nucleotide sequences operatively linked to them, resulting in either lower or higher expression levels.

[0053] As used herein, the term "library" refers to a collection of elements or members that differ from each other in at least one respect. For example, a library of nucleic acid molecules or a library of nucleic acid constructs is a collection of at least two nucleic acid molecules or at least two nucleic acid constructs that differ from each other by at least one nucleotide. Similarly, a library of AAV capsid variants is a collection of at least two AAV capsid variants (viral particles) that differ from each other by at least one nucleotide and / or at least one amino acid in their capsid proteins.

[0054] As used herein, the term "tropism" refers to a virus (e.g., AAV) preferentially targeting cells of a particular host species or specific cell types within that host species. For example, a virus that can infect cells of the heart, lungs, liver, and muscle has a broader (i.e., increased) tropism than a virus that can only infect lung and muscle cells. Trophism can also include a virus's dependence on a specific type of cell surface molecule of the host. For example, some viruses can only infect cells with surface glycosaminoglycans, while others can only infect cells with sialic acid (such dependence can be tested using a variety of cell lines lacking a specific molecule class as potential host cells for viral infection). In some cases, viral tropism describes a relative preference of the virus. For example, a first virus may be able to infect all cell types but is more successful in infecting those with surface glycosaminoglycans. Even if the absolute transduction efficiencies are not similar, a second virus can be considered to have similar (or the same) tropism as the first virus if it also prefers the same characteristics (e.g., the second virus is also more successful in infecting those with surface glycosaminoglycans). For example, a second virus may infect each given cell type tested more effectively than a first virus, but if the relative preferences are similar (or identical), the second virus can still be considered to have similar (or the same) tropism as the first virus. In some embodiments, the tropism of viral particles containing the theme variant AAV capsid protein is unchanged relative to naturally occurring viral particles. In some embodiments, the tropism of viral particles containing the theme variant AAV capsid protein is expanded (i.e., broadened) relative to naturally occurring viral particles. In some embodiments, the tropism of viral particles containing the theme variant AAV capsid protein is reduced relative to naturally occurring viral particles.

[0055] Any references in this document to nucleotide or amino acid sequences accessible in public sequence databases refer to the version of the sequence entry available as of the date of this document's submission. Invention Details

[0057] The inventors have unexpectedly discovered that the defective phenotype of the AAV9 capsid variant can be rescued by introducing additional modifications into the amino acid sequence of the defective capsid that promote CNS tropism, resulting in novel capsid variants that combine enhanced CNS targeting with hepatoretargeting characteristics.

[0058] Adeno-associated virus capsid protein variants

[0059] In a first aspect, an adeno-associated virus (AAV) capsid protein variant is provided. In one embodiment, the AAV capsid protein is a variant of AAV serotype 9 (AAV9) or clade F AAV capsid protein. A “variant” of AAV9 or clade F AAV capsid protein is understood herein as an AAV capsid protein containing at least one amino acid difference (mutation) compared to wild-type AAV9 or clade F AAV capsid protein. The at least one amino acid difference can be a substitution, insertion, or deletion of an amino acid in the amino acid sequence of the wild-type capsid protein.

[0060] Wild-type AAV9 capsid protein is understood herein to comprise, consist of, or include the amino acid sequence of SEQ ID NO: 2 (AAV9 VP1 capsid protein; GenBank® accession number AY530579.1; GenBank® accession number AAS99264.1). Wild-type clade F AAV capsid protein is understood herein to be the capsid protein of clade F AAV isolates as defined by Gao et al. (2004, J. Virol. [Journal of Virology] 78: 6381-6388), and in addition to AAV9, the isolate also includes hu.31 (encoded by GenBank® accession number JA400111.1) and hu.32 (encoded by GenBank® accession number JA400112.1). In one embodiment, the wild-type clade F AAV capsid protein is understood herein as the capsid protein of an AAV isolate, comprising, consisting of, or included within the following: an amino acid sequence having more than 87.5%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with SEQ ID NO: 2.

[0061] As used herein, the names of all amino acid positions in the AAV capsid protein and its variants refer to the AAV9 VP1 capsid subunit number of SEQ ID NO:2. Sequence alignment is used, preferably with the algorithm and settings described above, to identify the corresponding positions in the amino acid sequences other than SEQ ID NO:2.

[0062] Therefore, in one embodiment, a variant of the AAV9 or clade FAAV capsid protein containing a mutation in one or more amino acids is provided, the one or more mutations conferring at least one of the following on the capsid protein: i) a phenotype of reduced liver transduction compared to a control capsid protein without the one or more mutations; and ii) a phenotype of reduced overall transduction compared to a control capsid protein without the one or more mutations, wherein the capsid protein further comprises an amino acid sequence that confers increased CNS transduction compared to a control capsid protein without the amino acid sequence.

[0063] In one embodiment, the phenotype of reduced liver transduction, reduced overall transduction, and increased CNS transduction of the capsid protein variant compared to the control capsid protein is a phenotype achieved after systemic administration of a recombinant AAV (rAAV) vector containing the capsid protein variant.

[0064] The phenotype of reduced liver transduction, reduced overall transduction, and increased CNS transduction of the capsid protein variant compared to the control capsid protein can be determined by administering an rAAV vector containing the capsid protein variant to a non-human animal and determining the transduction profile (i.e., distribution) of the rAAV vector in various target tissues in the animal, and preferably, under otherwise identical conditions, comparing the transduction profile of the rAAV vector containing the capsid protein variant with that of the control rAAV vector. In one embodiment, the transduction profile is determined after administration as a systemic administration. In one embodiment, the transduction profile is determined at 2, 3, 4, 5, or 6 weeks after administration. In one embodiment, the non-human animal is a mouse or other research animal, such as, but not limited to, a rabbit, rat, monkey, or non-human primate.

[0065] As will be understood, the target tissue for determining the transduction spectrum depends on the desired tropism and detargeting of the capsid protein variant. To improve CNS tropism and liver detargeting, the target tissue will include at least the CNS (brain) and liver, but may include other major organs such as the heart, lungs, and skeletal muscle. To more specifically determine the CNS transduction spectrum, individual brain regions (e.g., anterior brain, posterior brain, and cerebellum) may be examined.

[0066] Methods for determining transduction spectra are known in the art and are described, for example, in the following and in the examples herein: Pulicherla et al. (2011, ibid.), Hanlon et al. (2019, ibid.), Nonnenmacher et al. (2020, ibid.), Goersten et al. (2022, ibid.).

[0067] Therefore, in one embodiment, the capsid protein variant as described herein has at least one mutation that confers a phenotype of reduced liver transduction compared to a control capsid protein without one or more mutations. A phenotype of reduced liver transduction is understood herein to exhibit a significantly reduced liver transduction (at least 2, 3, 5, 10, 20, 50, 100, 200, or 500-fold) compared to a control capsid protein without one or more mutations, but shows a modest to no change or reduction (two-fold or less) in other tissue types.

[0068] In one embodiment, the capsid protein variant as described herein has at least one mutation that confers a phenotype of reduced overall transduction compared to a control capsid protein without one or more mutations. A phenotype of reduced overall transduction is understood herein to be a phenotype exhibiting a significant reduction in transduction across multiple organ / tissue types (at least 2, 3, 5, 10, 20, 50, 100, 200, or 500-fold) compared to a control capsid protein without one or more mutations.

[0069] In one embodiment, the capsid protein variant as described herein comprises an amino acid sequence that confers increased CNS transduction compared to a control capsid protein lacking that amino acid sequence. An increased CNS transduction phenotype is understood herein as exhibiting a significantly increased (at least 2, 3, 5, 10, 20, 50, 100, 200, or 500-fold) transduction in CNS tissues compared to a control capsid protein lacking that amino acid sequence. In one embodiment, the capsid protein variant as described herein comprises an amino acid sequence conferring increased transduction in at least one of the anterior brain, posterior brain, and cerebellum. In a preferred embodiment, an increased CNS transduction phenotype is understood herein as exhibiting a significantly increased (at least 2, 3, 5, 10, 20, 50, 100, 200, or 500-fold) transduction in CNS tissues compared to a control capsid protein lacking that amino acid sequence, but showing a modest to no change or an increase (two-fold or less) phenotype in other tissue types.

[0070] In one embodiment, the capsid protein variant as described herein contains at least one mutation that confers a phenotype of reduced liver transduction compared to a control capsid protein without one or more mutations, wherein the at least one mutation comprises one or more mutations in amino acid regions 452-458, 498-504, 590-595, and / or 582-587. In one embodiment, the at least one mutation comprises at least one mutation selected from the group consisting of mutations at positions W595, Q592, W503, N498, and E500, and the amino acid sequence DGAATKN at positions 452-458. In one embodiment, the capsid protein variant contains the W595C mutation, Q592L mutation, W503R mutation, N498Y mutation, E500D mutation, or any combination thereof. Therefore, it should be understood that the at least one mutation results in a phenotype of reduced liver transduction compared to a control without the one or more mutations.

[0071] In one embodiment, the capsid protein variant as described herein contains at least one mutation that confers a phenotype of reduced overall transduction compared to a control capsid protein without one or more mutations, wherein the capsid protein variant contains mutations at T138, S414, G453, K557, T568, T582, and Q590, or any combination thereof. In one embodiment, the capsid protein variant contains mutations at T568 and Q590, or at T138, S414, G453, K557, and T582. In one embodiment, the capsid protein variant contains mutations at T568P and Q590L, or mutations at T138A, S414N, G453D, K557E, and T582I. In one embodiment, the capsid protein variant contains mutations at S414 and G453, or at S414, G453, K557, and T582. Therefore, it should be understood that, compared with controls that do not have the one or more mutations, the at least one mutation results in a phenotype of overall transduction.

[0072] In one embodiment, the capsid protein variant as described herein comprises an amino acid sequence conferring enhanced CNS transduction, wherein the amino acid sequence comprises or consists of the following: an amino acid sequence selected from the group consisting of STTLYSP, FVVGQSY, DGTLAVPFK, and WPTSYDA, and an amino acid sequence differing from the above amino acid sequence by no more than four, three, two, or one amino acid. In one embodiment, the amino acid sequence conferring enhanced CNS transduction comprises or consists of an amino acid sequence selected from the group consisting of: FVVGQSY, FVVAQSY, FVVVQSY, FVVLQSY, FVVIQSY, FVVNQSY, FVVSQSY, FVVEQSY, FVVQQSY, FVVCQSY, FVVTQSY, FVVPQSY, FVVQSY, FVGVQSY, FVVQGSY, FVQGVSY, FSVGQVY, and FSQGVVY. In a preferred embodiment, the amino acid sequence conferring increased CNS transduction comprises or consists of an amino acid sequence selected from or composed of the group consisting of: FVVGQSY, FVVAQSY, FVVPQSY, FVGVQSY, and FVVQGSY. In one embodiment, the amino acid sequence conferring increased CNS transduction is inserted into a hypervariable region of the AAV capsid protein sequence, preferably into a hypervariable region selected from ring IV or ring VIII.

[0073] In one embodiment, the capsid protein variant as described herein is a capsid protein variant comprising the T138A, S414N, G453D, K557E, and T582I mutations and the amino acid sequence FVVGQSY inserted into loop VIII, preferably between amino acid positions 588 and 589.

[0074] In one embodiment, the capsid protein variant as described herein is the following capsid protein variant comprising the S414N, G453D, K557E, and T582I mutations and an amino acid sequence selected from groups FVVGQSY, FVVAQSY, and FVVQGSY inserted into loop VIII, preferably between amino acid positions 588 and 589. In another embodiment, the capsid protein variant as described herein is the following capsid protein variant comprising the S414N, G453D, K557E, and T582I mutations and an amino acid sequence selected from groups FVVGQSY inserted into loop VIII, preferably between amino acid positions 588 and 589. In an alternative embodiment, the capsid protein variant as described herein is the following capsid protein variant comprising the S414N, G453D, K557E, and T582I mutations and an amino acid sequence selected from groups FVGVQSY inserted into loop VIII, preferably between amino acid positions 587 and 588.

[0075] In one embodiment, the capsid protein variant as described herein is a capsid protein variant comprising the T138A, S414N, G453D, K557E, and T582I mutations and the amino acid sequence WPTSYDA inserted into loop VIII, preferably between amino acid positions 588 and 589.

[0076] In one embodiment, the capsid protein variant as described herein is a capsid protein variant comprising the S414N, G453D, K557E, and T582I mutations and the amino acid sequence WPTSYDA inserted into loop VIII, preferably between amino acid positions 588 and 589.

[0077] In one embodiment, the capsid protein variant as described herein is a capsid protein variant comprising the amino acid sequence DGAATKN at positions 452-458 and the amino acid sequence FVVGQSY inserted in insertion loop VIII, preferably between amino acid positions 588 and 589.

[0078] In one embodiment, the capsid protein variant as described herein is a capsid protein variant comprising the amino acid sequence DGAATKN at positions 452-458 and the amino acid sequence WPTSYDA inserted in insertion loop VIII, preferably between amino acid positions 588 and 589.

[0079] In one embodiment, the capsid protein variant as described herein is a capsid protein variant comprising, including, or consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 6, 7, 9, and 10. In another embodiment, the capsid protein variant as described herein is a capsid protein variant comprising, including, or consisting of an amino acid sequence selected from the group consisting of SEQ ID NO: 6, 7, 9, 10, and 96.

[0080] In one embodiment, the capsid protein variants described herein are variants of at least one of the capsid proteins VP1, VP2, and VP3. Those skilled in the art will understand that if the modifications described herein are inserted into the AAV cap gene, these modifications can result in modifications of the VP1, VP2, and / or VP3 capsid subunits, depending on the position of these modifications in the VP1 amino acid sequence. However, in one embodiment, the capsid subunits can be expressed independently to achieve modification only in one or both of the capsid subunits, for example, modification only in VP1, VP2, VP3, VP1 and VP2, VP1 and VP3, or VP2 and VP3.

[0081] Nucleic acid molecules, host cells, and methods for producing AAV vectors

[0082] In a second aspect, a nucleic acid encoding a variant of the AAV capsid protein as described herein is provided. In one embodiment, the nucleic acid molecule is an expression construct for expressing one or more capsid proteins. Preferably, the expression construct is a construct for expressing one or more capsid proteins in a host cell suitable for producing AAV (such as a mammalian or insect cell line as further defined below).

[0083] Therefore, in one embodiment, the expression construct used to express one or more capsid proteins is an insect cell-compatible vector or a mammalian cell-compatible vector. "Mammalian cell-compatible vector" should be understood as a nucleic acid molecule capable of productively transforming or transfecting mammalian cells or cell lines. Mammalian cell-compatible vectors are well known in the art. "Insect cell-compatible vector" should be understood as a nucleic acid molecule capable of productively transforming or transfecting insects or insect cells. Exemplary insect cell-compatible vectors include plasmids, linear nucleic acid molecules, and recombinant viruses (such as baculoviruses). Any vector can be used, as long as it is insect cell-compatible. Mammalian or insect cell-compatible vectors can be integrated into the genome of a cell, but the presence of the vector in the cell does not need to be permanent, and transient attachable vectors are also included. The vector can be introduced by any known means, such as through chemical treatment of the cell, electroporation, or infection.

[0084] In one embodiment, the vector is a baculovirus, a viral vector, or a plasmid. In a more preferred embodiment, the insect cell-compatible vector is a baculovirus, i.e., the nucleic acid construct is a baculovirus expression vector (BEV). It is well known that baculovirus expression vectors are particularly well-suited for transferring nucleic acids into insect cells, and their use is described in, for example, the following: Summers and Smith, 1986, “A Manual of Methods for Baculovirus Vectors and Insect Culture Procedures”, Texas Agricultural Experimental Station Bulletin, Issue 7555, Texas College Station; Luckow, 1991, in Prokop et al., “Cloning and Expression of Heterologous Genes in Insect Cells with Baculovirus Vectors' Recombinant DNA Technology and Applications”, 97-152; King and Possee, 1992, “The baculovirus expression system”, Chapman and Hall. [Chapman & Hall, UK]; O'Reilly, Miller, and Luckow, 1992, "Baculovirus Expression Vectors: A Laboratory Manual", New York; Freeman and Richardson, 1995, "Baculovirus Expression Protocols", Methods in Molecular Biology, Vol. 39; US 4,745,051; US ​​2003148506; and WO 03 / 074714.

[0085] In one embodiment, at least one expression construct is provided comprising a separate expression cassette for each of the VP1, VP2, and VP3 capsid protein variants as described herein. In another embodiment, at least one expression construct is provided comprising a separate expression cassette for the VP1 capsid protein variant as described herein and separate expression cassettes for the VP2 and VP3 protein variants as described herein. The various expression cassettes for different capsid protein variants as described herein may coexist on a single expression construct / nucleic acid molecule, or one or more expression cassettes for different capsid proteins may coexist on two or three separate expression constructs / nucleic acid molecules, each expression construct / nucleic acid molecule comprising one of the expression cassettes for a different capsid protein. As will be understood, the use of separate expression cassettes for one or more different capsid proteins allows for the generation of AAV vectors having the aforementioned modifications / mutations only in some capsid proteins (e.g., only in VP1 and not in VP2 and VP3, or vice versa), or allows for the generation of AAV vectors having different aforementioned modifications / mutations in different capsid proteins. Expression constructs for the individual expression of various capsid proteins in mammalian cells are disclosed, for example, in Judd et al. (Mol Ther Nucleic Acids. [Molecular Therapy Nucleic Acids] 2012; 1:e54). Expression constructs for the individual expression of various capsid proteins in insect cells are disclosed in WO 2022 / 253955.

[0086] In another embodiment, an expression construct is provided comprising a single expression cassette for preferably expressing all three of the VP1, VP2, and VP3 capsid protein variants as described herein from a single coding sequence. Expression constructs for expressing all three of the VP1, VP2, and VP3 capsid proteins from a single expression cassette in mammalian cells are disclosed, for example, in the following: Clark et al. (1995, Hum. Gene Ther. [Human Gene Therapy] 6, 1329-134), Gao et al. (1998, Hum. Gene Ther. [Human Gene Therapy] 9, 2353-2362), Inoue and Russell (1998, J. Virol. [Journal of Virology] 72, 7024-7031), Grimm et al. (1998, Hum. Gene Ther. [Human Gene Therapy] 9, 2745-2760), and Xiao et al. (1998, J. Virol. [Journal of Virology] 72, 2224-2232). Expression constructs for expressing all three of the VP1, VP2, and VP3 capsid proteins from a single expression cassette in insect cells are disclosed, for example, in the following: Urabe et al. (2002, Hum. Gene Ther. [Human Gene Therapy] 13:1935-1943), WO 2007 / 046703, WO 2015 / 137802, and WO 2019 / 016349. As will be understood, expression of all three of the VP1, VP2, and VP3 capsid protein variants as described herein from a single coding sequence (in a single expression cassette) allows for the generation of AAV vectors containing the mutations / modifications as described herein in all three of their VP1, VP2, and VP3 capsid proteins.

[0087] In a third aspect, a host cell is provided comprising a nucleic acid molecule or expression construct for expressing a capsid protein variant as described herein. The host cell is preferably a host cell suitable for generating an AAV vector. Therefore, the host cell is a host cell suitable for in vitro culture, preferably large-scale culture. Host cells suitable for generating AAV vectors are well known in the art and will typically be mammalian or insect cell lines. Mammalian cell lines used for generating AAV vectors are selected from any mammalian species, including but not limited to cells such as: A549, WEHI, 3T3, 10T1 / 2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO, WI38, HeLa, HEK 293 cells (expressing functional adenovirus E1), Saos, C2C12, L cells, HT1080, HepG2, and primary fibroblasts, hepatocytes, and myoblasts derived from mammals, including humans, monkeys, mice, rats, rabbits, and hamsters. The choice of mammalian species for providing cells is not a limitation of this disclosure; nor is the type of mammalian cell (i.e., fibroblasts, hepatocytes, tumor cells) a limitation of this invention. Mammalian cell lines used to generate AAV vectors particularly include a wide range of HEK293 cell lines, with HEK293T cell lines being preferred.

[0088] The insect cell line used to generate the AAV vector can be any cell line suitable for producing the heterologous protein. Preferably, the insect cells allow for the replication of the baculovirus vector and can be maintained in a culture, more preferably in a suspension culture. In a preferred embodiment, the insect cells allow for the replication of recombinant parvovirus vectors, including the rAAV vector. For example, the cell line used can be derived from the fall armyworm (Spodoptera frugiperda), fruit fly (Drosophila), or mosquito, such as a cell line derived from Aedes albopictus. Preferred insect cells or cell lines are derived from insect species susceptible to baculovirus infection, including, for example, S2 (CRL-1963, ATCC), Se301, SeIZD2109, SeUCR1, Sf9, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAm1, Ha2302, Hz2E5, High Five (Invitrogen, California, USA), and expresSF+. ® (US 6,103,526; Protein Sciences Corp., Connecticut, USA).

[0089] In one embodiment, a host cell containing one or more expression constructs for expressing one or more capsid protein variants as described herein includes additional nucleotide sequences for expressing an AAV vector. Such additional nucleotide sequences typically include expression constructs for expressing the AAV rep protein in the host cell in question. Furthermore, such additional nucleotide sequences generally include nucleic acid constructs containing a transgene flanked by at least one AAV ITR sequence.

[0090] Therefore, when generated in suitable host cells expressing AAV rep and cap gene products, a nucleic acid construct containing a transgene flanked by at least one AAV ITR sequence is preferably incorporated into the genome of a recombinant parvovirus (rAAV) vector. In one embodiment, the transgene-containing nucleotide sequence is flanked by two AAV ITR nucleotide sequences, whereby the transgene-containing nucleotide sequence is located between the two AAV ITR nucleotide sequences. In one embodiment, the transgene-containing nucleotide sequence can be incorporated into an rAAV vector generated in insect cells if it is located between two conventional ITRs or on either side of an ITR engineered with two D regions. Thus, in a preferred embodiment, a nucleic acid construct containing two AAV ITR nucleotide sequences is provided, with the transgene-containing nucleotide sequence located between the two AAV ITR nucleotide sequences.

[0091] Typically, the nucleic acid construct (containing an ITR and an expression cassette containing an AAV capsid variant and an enhancer element operatively linked to the expression cassette) is 5,000 nucleotides (nt) or less in length to avoid exceeding the maximum AAV packaging limit of 5.5 kbp. However, other embodiments in which ultra-large nucleic acid constructs (e.g., exceeding 5,000 nt in length, or even exceeding the maximum AAV packaging limit of 5.5 kbp) are used still allow for the generation of rAAV vectors and are therefore not excluded.

[0092] The AAV sequences that can be used to generate recombinant AAV viral particles (i.e., AAV vectors) in insect cells, as described herein, can be derived from the genome of any AAV serotype. Typically, AAV serotypes have genome sequences that are significantly homologous at the amino acid and nucleic acid levels, provide the same set of genetic functions, and produce essentially physically and functionally equivalent viral particles, and replicate and assemble through virtually the same mechanisms. For an overview of the genomic sequences and genomic similarities of various AAV serotypes, see, for example, GenBank accession number U89790; GenBank accession number J01901; GenBank accession number AF043303; GenBank accession number AF085716; Chlorini et al. (1997, J. Vir. [Journal of Virology] 71:6823-33); Srivastava et al. (1983, J. Vir. [Journal of Virology] 45:555-64); Chlorini et al. (1999, J. Vir. [Journal of Virology] 73:1309-1319); Rutledge et al. (1998, J. Vir. [Journal of Virology] 72:309-319); and Wu et al. (2000, J. Vir. [Journal of Virology] 74: 8635-47). Any AAV serotype can be used as a source of AAV nucleotide sequences for use in the context of this invention. Preferably, the AAV ITR sequence used in the context of this invention is derived from AAV1, AAV2, AAV4 and / or AAV7. Similarly, the Rep (Rep78 / 68 and Rep52 / 40) coding sequences are preferably derived from AAV1, AAV2, AAV4 and / or AAV7.

[0093] AAV Rep and ITR sequences are particularly conserved across most serotypes. The Rep78 protein of various AAV serotypes, for example, exhibits over 89% identity, and the total nucleotide sequence identity at the genomic level is approximately 82% among AAV2, AAV3A, AAV3B, and AAV6 (Bantel-Schaal et al., 1999, J. Virol. [Journal of Virology], 73(2):939-947). Furthermore, it is known that the Rep sequences and ITRs of many AAV serotypes are effectively cross-complementary (i.e., functionally substituted) with corresponding sequences from other serotypes when generating AAV particles in mammalian cells. US2003148506 reports that AAV Rep and ITR sequences are also effectively cross-complementary with other AAV Rep and ITR sequences in insect cells. Modified “AAV” sequences can also be used in this context, for example, for generating rAAV vectors in insect cells. Such modified sequences (e.g., sequences having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or higher nucleotide and / or amino acid sequence identity with AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 or AAV13 ITR or Rep (e.g., sequences having about 75%-99% nucleotide sequence identity)) can be used in place of wild-type AAV ITR or Rep sequences.

[0094] In a fourth aspect, a method is provided for generating AAV vector viral particles as described herein, the AAV vector viral particles comprising a capsid protein variant as described herein. The method preferably comprises the steps of: a) culturing host cells as defined above under conditions conducive to the generation of an AAV vector; and b) optionally, performing one or more of the following: recovery, purification, and formulation of the AAV vector.

[0095] AAV in the supernatant can be recovered and / or purified using suitable techniques known to those skilled in the art. For example, monolithic columns (e.g., in ion exchange, affinity, or IMAC mode), chromatography (e.g., capture chromatography, fixed-method chromatography, and expanded-bed chromatography), centrifugation, filtration, and precipitation can be used for purification and concentration. These methods can be used alone or in combination. In one embodiment, capture chromatography (including column-based or membrane-based systems) is used in combination with filtration and precipitation. Those skilled in the art can readily select a suitable precipitation method, for example, using polyethylene glycol (PEG) 8000 and NH3SO4. The precipitate can then be treated with a totipotent nuclease and purified using a suitable technique. Furthermore, recovery may preferably include the step of affinity purification of the recombinant parvovirus (rAAV) vector (containing viral particles) using an anti-AAV antibody (preferably an immobilized antibody). The anti-AAV antibody is preferably a monoclonal antibody. Particularly suitable antibodies are single-chain camelid antibodies or fragments thereof, such as those obtained from camels or llamas (see, for example, Muyldermans, 2001, Biotechnol. [Biotechnology]). 74 (277-302). Antibodies used for affinity purification of rAAV are preferably antibodies that specifically bind to epitopes on AAV capsid proteins, whereby the epitopes are preferably epitopes present on capsid proteins of more than one AAV serotype. For example, antibodies can be generated or selected based on specific binding to the AAV2 capsid, but can also specifically bind to the AAV9 or clade F capsid at the same time.

[0096] Generally, suitable methods and means (such as expression constructs for expressing the AAV rep protein) for generating AAV vector viral particles as described herein in mammalian or insect host cells are described in the following literature, for mammalian cells: Clark et al. (1995, Hum. Gene Ther. [Human Gene Therapy] 6, 1329-134), Gao et al. (1998, Hum. Gene Ther. [Human Gene Therapy] 9, 2353-2362), Inoue and Russell (1998, J. Virol. [Journal of Virology] 72, 7024-7031), Grimm et al. (1998, Hum. Gene Ther. [Human Gene Therapy] 9, 2745-2760), Xiao et al. (1998, J. Virol. [Journal of Virology] 72, 2224-2232), and Judd et al. (Mol Ther Nucleic Acids. [Molecular Therapy Nucleic Acids]). 2012; 1: e54), and for insect cells: Urabé et al. (2002, Hum. Gene Ther. [Human Gene Therapy] 13:1935-1943), WO 2007 / 046703, WO 2007 / 148971, WO 2009 / 014445, WO 2009 / 104964, WO 2011 / 122950, ​​WO 2013 / 036118, WO 2015 / 137802, WO 2019 / 016349 and co-pending applications EP 21177449.2, PCT / EP2021 / 058794 and PCT / EP2021 / 058798, all of which are incorporated herein by reference in their entirety.

[0097] Recombinant AAV vector viral particles

[0098] In a fifth aspect, a recombinant AAV (rAAV) vector viral particle is provided, the recombinant AAV (rAAV) vector viral particle comprising at least one variant of the AAV capsid protein as described herein.

[0099] “rAAV vector,” “rAAV viral particle,” or “rAAV vector viral particle” are defined herein as recombinant AAV or AAV particles containing polynucleotides to be delivered in vivo, in vitro, or ex vivo to host cells. In this document, “AAV vector construct” or “AAV pre-vector” refers to a polynucleotide containing a viral genome or a portion thereof (typically at least one ITR) and a transgene.

[0100] In one embodiment, the rAAV vector viral particle containing at least one variant of the AAV capsid protein as described herein does not contain at least one of the wild-type VP1, VP2, and VP3 capsid proteins. Therefore, the rAAV vector viral particle as described may contain one or at most two, but not all three, of the VP1, VP2, and VP3 capsid proteins in wild-type form.

[0101] In one embodiment, an rAAV vector viral particle comprising at least one AAV capsid protein variant as described herein comprises a nucleic acid molecule capsidated by at least one capsid protein variant. Thus, the rAAV vector viral particle as described herein consists of a capsid comprising one or more of the VP1, VP2, and VP3 AAV capsid protein variants as described herein, which contains (or “packages”) a nucleic acid molecule. In one embodiment, the nucleic acid molecule comprises a transgene (nucleotide sequence encoding the transgene) flanked by at least one AAV inverted terminal repeat (ITR). In one embodiment, the nucleic acid molecule comprises a transgene flanked by two ITRs, one ITR on each side of one or more transgenes. When present in a suitable host cell expressing the AAV rep and cap gene products (i.e., the AAV Rep and Cap proteins), such nucleic acid molecules (i.e., AAV pre-vectors) can replicate and be packaged into infectious viral particles.

[0102] genetically modified

[0103] Therefore, the nucleotide sequence containing the transgene as defined above can contain a nucleotide sequence encoding a target gene product (for expression in mammalian cells) or a nucleotide sequence encoding a target gene (for silencing the target gene in mammalian cells), and can be positioned such that it will be incorporated into a recombinant parvovirus (rAAV) vector that replicates in insect cells. It should be understood that the particularly preferred mammalian cell in which the “target gene product” is to be expressed or silenced is a human cell. Any nucleotide sequence can be incorporated for later expression in mammalian cells transfected with a recombinant parvovirus (rAAV) vector produced as provided herein. The nucleotide sequence can, for example, encode a protein or it can express an RNAi agent, i.e., an RNA molecule capable of RNA interference, such as, for example, shRNA (short hairpin RNA) or siRNA (short interfering RNA). “siRNA” refers to small interfering RNA, which is a short, non-toxic, double-stranded RNA in mammalian cells (Elbashir et al., 2001, Nature 411: 494-98; Caplen et al., 2001, Proc. Natl. Acad. Sci. USA 98: 9742-47). In a preferred embodiment, the nucleotide sequence containing the transgene may comprise two coding nucleotide sequences, each encoding a target gene product expressed in mammalian cells. Each of the two nucleotide sequences encoding the target product is positioned such that it will be incorporated into a recombinant parvovirus (rAAV) vector replicating in insect cells.

[0104] The target product expressed in mammalian cells can be a therapeutic gene product. A therapeutic gene product can be a peptide, an RNA molecule (si / sh / miRNA), or another gene product that provides the desired therapeutic effect when expressed in target cells. The desired therapeutic effect can be, for example, ablation of unwanted activity (e.g., VEGF), supplementation of genetic defects, silencing of disease-causing genes, restoration of enzyme activity defects, or any other disease-modifying effect. Examples of therapeutic peptide gene products include, but are not limited to, growth factors, factors forming part of a coagulation cascade, enzymes, lipoproteins, cytokines, neurotrophic factors, hormones, and therapeutic immunoglobulins and their variants. Examples of therapeutic RNA molecule products include miRNAs that effectively silence diseases, including but not limited to polyglutamine disorders, dyslipidemia, or amyotrophic lateral sclerosis (ALS).

[0105] There are no particular limitations on the diseases that can be treated with the recombinant parvovirus (rAAV) vectors described herein, except for diseases that typically have a genetic cause or underlying condition. For example, diseases that can be treated with the disclosed vectors may include, but are not limited to, acute intermittent porphyria (AIP), age-related macular degeneration, Alzheimer's disease, arthritis, Batten disease, Canavan disease, type 1 citrullinemia, Crigler-Najjar syndrome, congestive heart failure, cystic fibrosis, Duchenne muscular dystrophy, dyslipidemia, type I glycogen storage disease (GSD-I), hemophilia A, hemophilia B, hereditary emphysema, homozygous familial hypercholesterolemia (HoFH), Huntington's disease (HD), Lieber's congenital amaurosis, methylmalonic acidemia, ornithine carbamoyltransferase deficiency (OTC), Parkinson's disease, phenylketonuria (PKU), spinal muscular atrophy, paralysis, and Weill's disease. Diseases including: Schizophrenia, epilepsy, Pompe disease, amyotrophic lateral sclerosis (ALS), Tay-Sachs disease, hyperoxaluria (PH-1), spinocerebellar ataxia type 1 (SCA-1), SCA-2, SCA-3, micro-anti-dystrophin, type II or III Gaucher disease, arrhythmogenic right ventricular cardiomyopathy (ARVC), Fabry disease, familial Mediterranean fever (FMF), propionic acidemia, Fragile X syndrome, Rett syndrome, Niemann-Pick disease, and Clabbit disease. Because the preferred AAV vectors described herein are CNS-tropic, preferred diseases treatable with such AAV vectors as provided herein are diseases of the central nervous system (preferably genetic diseases), and / or (genetic) diseases that can be treated by targeting the AAV vectors to the CNS.

[0106] Examples of therapeutic gene products to be expressed include antibodies, N-acetyl-α-glucosamine glycosidase (NaGLU), Treg167, Treg289, EPO, IGF, IFN, GDNF, FOXP3, factor VIII, factor IX, insulin, aromatic L-amino acid decarboxylase (AADC), ApoE2, coagulant, survivor motor neuron (SMN) protein, glucocerebrosidase, N-sulfoglucosamine sulfonylhydrolase, iduronate-2-sulfatase, α-L-iduronase, palmitoyl-protein thioesterase 1, tripeptidyl peptidase 1, battenin, CLN5, CLN6 (linclin), MFSD8, CLN8, asparagyltransferase (ASPA), granuloprotein precursor (GRN), MeCP2, β-galactosidase (GLBl), and / or giant axonin (GAN). Since the preferred AAV vectors provided herein are CNS tropism, the preferred therapeutic gene products are those that can be used to treat genetic diseases of the central nervous system.

[0107] Examples of endogenous genes whose expression can be inhibited and / or modified by targeting with RNAi agents to achieve therapeutic effects include: superoxide dismutase 1 (SOD1), chromosome 9 open reading frame 72 (C9ORF72), TAR DNA-binding protein (TARDBP), ataxia protein-1 (ATXN1), ataxia protein-2 (ATXN2), ataxia protein-3 (ATXN3), huntingtin protein (HTT), amyloid precursor protein (APP), apolipoprotein E (ApoE), microtubule-associated protein τ (MAPT), α-synuclein (SNCA), voltage-gated sodium channel α subunit 9 (SCN9A), and / or voltage-gated sodium channel α subunit 10 (SCN1OA). Because the preferred AAV vectors provided herein are CNS tropisms, preferred endogenous genes whose expression can be inhibited and / or modified by targeting with RNAi agents to achieve therapeutic effects include those endogenous genes that function in genetic diseases of the central nervous system.

[0108] Alternatively, or additionally as another gene product, the nucleotide sequence containing the transgene as defined above may further include a nucleotide sequence encoding a polypeptide that acts as a selection marker protein to assess cell transformation and expression. Suitable marker proteins for this purpose are, for example, fluorescent protein GFP and the selective marker gene HSV thymidine kinase (for selection on HAT medium), bacterial hygromycin B phosphotransferase (for selection on hygromycin B), Tn5 aminoglycoside phosphotransferase (for selection on G418), and dihydrofolate reductase (DHFR) (for selection on methotrexate), CD20, and low-affinity nerve growth factor genes. Sambrook and Russell (ibid.) provide sources for obtaining these marker genes and methods for their use. Furthermore, the nucleotide sequence containing the transgene as defined above may include additional nucleotide sequences encoding a polypeptide that can act as a failsafe mechanism, if deemed necessary, to protect the subject from cells transduced with a recombinant parvovirus (rAAV) vector as described herein. These nucleotide sequences (often referred to as suicide genes) encode proteins capable of converting prodrugs into toxic substances that kill transgenic cells in which the protein is expressed. Suitable examples of such suicide genes include, for example, the cytosine deaminase gene from *E. coli* or one of the thymidine kinase genes from herpes simplex virus, cytomegalovirus, and varicella-zoster virus, in which case ganciclovir can be used as a prodrug to kill transgenic cells in a subject (see, for example, Clair et al., 1987, *Antimicrob. Agents Chemother*, 31: 844-849).

[0109] The nucleotide sequence comprising the transgene for expression in mammalian cells as defined herein further preferably comprises at least one mammalian cell-compatible expression control sequence, such as a promoter, operatively linked to the sequence encoding the product of the target gene. Many such promoters are known in the art (see Sambrook and Russell, 2001, ibid.). Constitutive promoters widely expressed in many cell types, such as CMV, CAG, and PGK promoters, can be used. However, inducible, tissue-specific, cell-type-specific, or cell cycle-specific promoters will be preferred. For example, for liver-specific expression (as disclosed in PCT / EP2019 / 081743), promoters can be selected from α1-antitrypsin promoters, thyroid hormone-binding globulin promoters, albumin promoters, LPS (thyroid hormone-binding globulin) promoters, HCR-ApoCII hybrid promoters, HCR-hAAT hybrid promoters, apolipoprotein E promoters, LP1, HLP, minimal TTR promoters, FVIII promoters, hyperon enhancers, and ealb-hAAT. Other examples include the E2F promoter for tumor-selective expression, and particularly for neuronal tumors (Parr et al., 1997, Nat. Med. [Nature Medicine] 3:1145-9) or the IL-2 promoter for use in mononuclear blood cells (Hagenbaugh et al., 1997, J Exp Med [Journal of Experimental Medicine]; 185: 2101-10). For example, for neuron-specific expression, the promoter can be selected from neuron-specific enolase (NSE) promoters, platelet-derived growth factor (PDGF) promoters, platelet-derived growth factor B chain (PDGF-3) promoters, synaptophysin or synaptophysin-1 (Syn or Syn-1) promoters, methyl-CpG binding protein 2 (MeCP2) promoters, Ca + / Promoters include calmodulin-dependent protein kinase II (CaMKII), metabolotropic glutamate receptor 2 (mGluR2), neurofilament light chain (NFL) or neurofilament heavy chain (NFH), β-globin small gene nβ2, proenkephalinogen (PPE), enkephalin (Enk), and excitatory amino acid transporter 2 (EAAT2). For astrocyte-specific expression, promoters can be selected from glial fibrillary acidic protein (GFAP) and EAAT2 promoters. For oligodendrocyte-specific expression, myelin basic protein (MBP) promoters can be selected. A particularly preferred promoter for expressing transgenes in the peripheral and / or central nervous system is the CBh promoter (Gray et al., 2011, Hum. Gene Ther. [Human Gene Therapy] 22:1143-1153).

[0110] In one embodiment, where the transgenic / therapeutic gene product is or includes a (small) RNA molecule (such as siRNA, shRNA, miRNA, crRNA, or guide RNA), the promoter is an RNA polymerase III promoter, such as a promoter from the U6 snRNA gene, preferably a primate or human U6 promoter.

[0111] The various modifications made to the nucleotide sequences (including, for example, wild-type parvovirus sequences) as defined above for proper expression in insect cells are achieved through the application of well-known genetic engineering techniques, such as those described in, for example, Sambrook and Russell (2001), "Molecular Cloning: A Laboratory Manual" (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York. Various additional modifications to the coding regions are known to those skilled in the art and can increase the yield of the encoded protein. These modifications are within the scope of this disclosure.

[0112] Composition

[0113] In a sixth aspect, a composition is provided comprising AAV vector viral particles as described herein, i.e., AAV vector viral particles comprising at least one variant of the AAV capsid protein as described herein.

[0114] In one embodiment, a composition comprising AAV vector viral particles as described herein and suitable excipients (such as buffers, stabilizers, antioxidants, etc.) is provided. In a particular embodiment, these compositions are used to transduce cells in vitro or ex vivo, in which case the excipients will need to be compatible with the cell culture.

[0115] In other preferred embodiments, the composition is used to treat (human) subjects. For this purpose, a pharmaceutical composition is provided comprising AAV vector viral particles as described herein and at least one pharmaceutically acceptable carrier. In the case of AAV gene delivery mediators, the pharmaceutical composition typically comprises a physiological buffer (e.g., PBS) containing additional stabilizers, such as sucrose. Such compositions are compatible with and intended for use in subsequent intravenous, intrathecal, intraparenchymal, intravitreal, subretinal, organ-targeted vascular delivery (e.g., intraportal or coronary delivery or isolated limb perfusion).

[0116] use

[0117] In a seventh aspect, there is provided the use of AAV vector virus particles or compositions comprising AAV vector virus particles as described herein.

[0118] In one embodiment, an AAV vector virus particle or a composition containing an AAV vector virus particle as described herein is provided for use as a pharmaceutical agent. In one embodiment, the AAV vector virus particle or a composition containing an AAV vector virus particle as described herein is used (as a pharmaceutical agent) in the treatment of central nervous system disorders.

[0119] In an eighth aspect, an AAV vector viral particle or a composition comprising the AAV vector viral particle as described herein is provided for use (as a pharmaceutical agent) in gene therapy. In one embodiment, a method of gene therapy is provided, comprising the step of administering an effective amount of the AAV vector viral particle or a composition comprising the AAV vector viral particle as described herein to a subject requiring gene therapy.

[0120] In one embodiment, gene therapy is used to treat diseases as defined above (e.g., diseases or conditions that can be treated with gene therapy of the central nervous system), preferably using therapeutic genes as indicated above and / or using RNAi agents to inhibit or modify the expression of endogenous genes as indicated above.

[0121] Methods for identifying AAV capsid variants with desired characteristics

[0122] In a ninth aspect, a method for identifying AAV capsid variants having desired characteristics is provided. In one embodiment, the method includes: a) providing a library comprising a plurality of individually generated AAV capsid variants, wherein each member in the library differs from the amino acid sequence of an AAV capsid variant of other members in the library by at least one amino acid, and wherein each member in the library comprises a DNA construct, wherein the DNA construct comprises: i) a unique molecular identifier (UMI) that is unique to the member in the library; ii) a reporter gene operatively linked to a promoter for driving expression in mammalian cells; and iii) at least one AAV ITR; b) contacting the library with cultures of cells, organoids, or tissues, or administering the library to a non-human animal; c) allowing the AAV capsid variants in the library to transduce these cells, organoids, tissues, or cells in the animal; and d) applying b) At least one AAV capsid variant of at least one desired cell type has been transduced in these cells, organoids, tissues, or animals to identify an AAV capsid variant having the desired characteristics by sequencing its UMI, and optionally recovering an AAV capsid variant having the desired characteristics from the desired cells.

[0123] Therefore, in this method, each member in the library differs from the AAV capsid variants of other members in the library in terms of amino acid sequence by at least one amino acid. In one embodiment, the amino acid sequence of the AAV capsid variant of a member in the library contains a mutation (e.g., insertion, deletion, and / or substitution) of one or more amino acids. In one embodiment, the amino acid sequence of the AAV capsid variant of a member in the library contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein. The wild-type AAV capsid protein is understood herein as an AAV capsid protein having the amino acid sequence of a naturally occurring AAV isolate (e.g., a clinical isolate). In one embodiment, the amino acid sequence of the AAV capsid variant of a member in the library contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein in the VR region of the surface loop of the capsid protein variant (including at least one of VR-I, VR-II, VR-III, VR-IV, VR-V, VR-VI, VR-VII, VR-VIII, and VR-IX, wherein VR-IV and VR-VIII are preferred, and VR-VIII is more preferred). In one embodiment, the amino acid sequence of an AAV capsid variant of a member in the library contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein, and this at least one amino acid difference (mutation) includes the insertion of a peptide. The inserted peptide may contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acids.

[0124] In one embodiment, at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein is introduced into AAV capsid proteins VP1, VP2, or VP3, or into two capsid proteins in any combination, or into all three. In some embodiments, the mutation is introduced into VP1. In some embodiments, the mutation is introduced into VP2. In some embodiments, the mutation is introduced into VP3. In some embodiments, the mutation is introduced into VP1 and VP2. In some embodiments, the mutation is introduced into VP1 and VP3. In some embodiments, the mutation is introduced into VP2 and VP3. In some embodiments, the mutation is introduced into VP1, VP2, and VP3.

[0125] In one embodiment, the aforementioned at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein is a single mutation (e.g., insertion, deletion, and / or substitution of an amino acid) introduced at a single site in the amino acid sequence of the capsid protein, while in other embodiments, more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 100 or more (including any number between 1 and 100 or more) of mutations (e.g., insertion, deletion, and / or substitution) are introduced in the amino acid sequence of the capsid protein.

[0126] In one embodiment, the amino acid sequence of an AAV capsid variant of a member in the library contains at least one amino acid difference (mutation) compared to the wild-type AAV capsid protein, whereby the wild-type AAV capsid protein can be a serotype capsid protein selected from the group consisting of: AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, and AAVrh10. In a further embodiment, the wild-type AAV capsid protein may be the capsid protein of AAV isolates from clades A, B, C, D, E, or F, as defined by Gao et al. (2004, J. Virol. [Journal of Virology] 78: 6381-6388), whose exemplary sequences are disclosed in WO2005 / 033321 and are available from the GenBank® database with accessions AY530553 to AY530629.

[0127] In the method for identifying AAV capsid variants with the desired characteristics as described herein, each member in the library contains a DNA construct, wherein the DNA construct contains: i) a unique molecular identifier (UMI) that is unique to that member in the library; ii) a reporter gene operatively linked to a promoter for driving expression in mammalian cells; and iii) at least one AAV ITR.

[0128] Therefore, in one embodiment, the nucleic acid construct comprises a reporter gene operatively linked to a promoter for driving expression in mammalian cells. As understood herein, the reporter gene preferably encodes a protein that, when expressed in mammalian cells, produces a colorimetric, fluorescent, or luminescent signal that allows identification of cells containing and expressing the reporter gene from surrounding cells that do not contain the reporter gene. In one embodiment, the reporter gene encodes a protein that produces a colorimetric signal, such as a gene encoding secretory alkaline phosphatase (SEAP) or β-galactosidase. In one embodiment, the reporter gene encodes a protein that produces a fluorescent signal, with preferred examples including EGFP, mCherry, mCloverS, mRubyS, mApple, iRFP, tdTomato, mVenus, YFP, and RFP. In one embodiment, the reporter gene encodes a protein that produces a luminescent signal, with preferred examples including genes encoding firefly (Photinus pyralis) luciferase and sea kidney (Renilla reniformis, sea pansy) luciferase and nanoluciferase. In one embodiment of the nucleic acid construct, the promoter operatively linked to the reporter gene to drive its expression in mammalian cells is a constitutive promoter. In other embodiments, the promoter operatively linked to the reporter gene is a cell-type and / or tissue-specific promoter. As those skilled in the art will understand, the cell-type and / or tissue-specificity of the promoter will depend on the desired cell-type tropism and / or tissue tropism of the AAV capsid variant to be obtained. In some embodiments, the cell-type and / or tissue-specific promoter for driving the expression of the reporter gene in mammalian cells is a promoter selected from the group consisting of: human synaptophysin promoter (hSynl), thyroxine transporter promoter (TTR), cytokeratin 18, cytokeratin 19, unc-45 myosin chaperone B (unc45b) promoter, cardiac troponin T (cTnT) promoter, glial fibrillary acidic protein (GFAP) promoter, myelin basic protein (MBP) promoter, and methyl-CpG-binding protein 2 (Mecp2) promoter. In a preferred embodiment, the cell type and / or tissue-specific promoter is the human synaptophysin promoter (hSynl).

[0129] In one embodiment, the nucleic acid construct contains a unique molecular identifier (UMI), also known as a “barcode.” A UMI is a substantially unique sequence or barcode, preferably fully unique, and is specific to the nucleic acid molecule, i.e., unique for each nucleic acid construct used in the library. The UMI can have a random, pseudo-random, or partially random or non-random nucleotide sequence. The UMI can be used to uniquely identify the original molecule from which the derived sequencing read is derived. For example, reads from amplified nucleic acid molecules can be merged from each original nucleic acid molecule into a single common sequence. As indicated above, a UMI can be fully or substantially unique. Fully unique should be understood herein as each nucleic acid molecule or construct provided herein contains a unique tag that differs from all other tags contained in other nucleic acid molecules / constructs used herein. Substantially unique should be understood herein as each nucleic acid molecule or construct provided herein contains a random UMI, but a low percentage of these nucleic acid molecules / constructs may contain the same UMI. Preferably, a substantially unique molecular identifier is used where the chance of labeling identical molecules containing the same sequence with the same UMI is negligible. Preferably, the UMI is completely unique relative to a specific sequence of a nucleic acid molecule or construct, for example, completely unique relative to a specific capsid variant of a nucleic acid construct containing a specific UMI. The UMI preferably has sufficient length to ensure this uniqueness. The identifier sequence can range in length from about 2 to 100 nucleotide bases or more, and preferably has a length between about 4 and 18 nucleotide bases, typically between about 8 and 12 nucleotide bases. Preferably, the identifier sequence does not contain two or more consecutive identical bases. Furthermore, preferably, there are differences between individual identifier sequences of at least two, preferably at least three bases.

[0130] In one embodiment, the nucleic acid construct comprises at least one AAV ITR as described above. In the nucleic acid construct, a reporter gene is operatively linked to a promoter for driving expression in mammalian cells, and the UMI is preferably flanked by at least one AAV ITR sequence, more preferably present between two AAV ITR sequences, such that the reporter gene linked to its promoter and UMI is incorporated into the genome of an rAAV vector generated in a suitable host cell expressing the AAV rep and cap gene products.

[0131] The method for identifying AAV capsid variants with desired characteristics as described herein further includes step (b), wherein the library is contacted with a culture of cells, organoids, or tissues, or wherein the library is administered to a nonhuman animal. In one embodiment, the culture of cells, organoids, or tissues, or the nonhuman animal, contains at least one desired cell type, such as the cell type for which an AAV capsid variant with improved tropism is to be identified. In one embodiment, the culture of cells, organoids, or tissues, or the nonhuman animal, may further contain at least one undesired cell type, such as the cell type for which the AAV capsid variant to be identified has reduced transduction efficiency. In one embodiment, the library is administered systemically to the nonhuman animal, for example, using an intravenous administration route.

[0132] In the next step (c) of the method for identifying AAV capsid variants having the desired characteristics as described herein, the AAV capsid variants in the library are allowed to transduce cells, organoids, tissues, or cells in an animal. Thus, in one embodiment of step (c), sufficient time is allowed to permit the AAV capsid variants in the library to transduce the (desired) cells, organoids, tissues, or cells in an animal and to express the reporter gene.

[0133] In the next step (d) of the method for identifying an AAV capsid variant having the desired characteristics as described herein, at least one AAV capsid variant is identified, which has been transduced into at least one cell of the desired cell type in cells, organoids, tissues, or animals. In one embodiment, the at least one AAV capsid variant is identified by sequencing its UMI. In one embodiment, the at least one AAV capsid variant is identified as an AAV capsid variant having the desired characteristics. In one embodiment, step (d) further includes recovering the AAV capsid variant having the desired characteristics from cells of the desired cell type.

[0134] In one embodiment, step (d) includes detecting cell transduction of the desired cell type by detecting the expression of a reporter gene in at least one cell of the desired cell type.

[0135] In one embodiment of the method for identifying AAV capsid variants with the desired characteristics as described herein, the desired cell type (e.g., the cell type for which an AAV capsid variant with improved tropism is to be identified) is a cell selected from organs or tissues such as the liver, skeletal muscle, heart, diaphragm, kidney, brain, stomach, intestine, skin, endothelial cells, and lung. In one embodiment of the method for identifying AAV capsid variants with the desired characteristics as described herein, the AAV capsid variant having the desired characteristics to be identified has reduced transduction efficiency in a non-desired cell type, which may be a cell selected from organs or tissues such as the liver, skeletal muscle, heart, diaphragm, kidney, brain, stomach, intestine, skin, endothelial cells, and lung.

[0136] In one embodiment, a method for identifying AAV capsid variants with desired characteristics as described herein is a method in which, in step d), for at least two members in a library, in at least one cell of a desired cell type, at least one of the mRNA expressed by at least two members and the genomic copy number of at least two members is quantified and identified by sequencing their UMIs, and the member having the highest mRNA expression level and at least one of the genomic copy number is identified as an AAV capsid variant with the desired characteristics. In one embodiment of the method, in step d), in cells comprising more than one cell type including at least the desired cell type, for at least two members in a library, at least one of the mRNA expressed by at least two members and the genomic copy number of at least two members is quantified and identified by sequencing their UMIs, and the member having the most desired distribution on more than one cell type is identified as an AAV capsid variant with the desired characteristics. In one embodiment, the cells of more than one cell type also include at least one non-desired cell type.

[0137] The invention has been described above with reference to several exemplary embodiments as shown in the accompanying drawings. Modifications and alternative implementations of some parts or elements are possible and are included within the scope of protection as defined by the appended claims. Attached Figure Description

[0138] Figure 1 A barcoded genome for AAV production in HEK293T cells. This consists of a GFP and nanoluciferase reporter gene, followed by a 12-nucleotide barcode, then a polyadenylation signal, and is controlled by the CBh promoter.

[0139] Figure 2 The AAV titer of the novel variant (black bar) remains comparable to that of the known variant (gray bar), as measured by qPCR specific to the GFP reporter.

[0140] Figure 3 SDS-PAGE gels were run using purified AAV and known capsid batches. The resulting capsid VP123 ratios represent the native stoichiometry of AAV at approximately 1:1:10:VP1:VP2:VP3.

[0141] Figure 4 Composition of the final AAV capsid library injected into mice. The capsid library consisted of 26 different capsid variants, which were not equally represented. Data markers focused on the percentage of each novel capsid to known capsids in the capsid library.

[0142] Figure 5 Enrichment folds of novel and known capsids relative to AAV9 in the anterior, posterior, and cerebellum of C57BL6 mice. Bars show the mean values ​​for four mice.

[0143] Figure 6 Enrichment folds of novel and known capsids relative to AAV9 in the anterior, posterior, and cerebellum of BALBc mice. Bars show the mean values ​​for four mice.

[0144] Figure 7 The enrichment folds of novel and known capsids relative to AAV9 in the livers of both C57BL6 and BALBc mice.

[0145] Figure 8 Vector genomes and transcripts from harvested tissues. Vector genomes in the brain (A), cerebellum (B), and liver (C), and vector transcripts in the brain (D), cerebellum (E), and liver (F). The dashed horizontal line indicates the limit of quantitation (LLOQ) of the assay. Each bar represents the mean and standard deviation (SD) of 6 mice, and each point represents the value per mouse.

[0146] Figure 9 Levels of nanoluciferase (nLuc) protein in brain, cerebellum, and liver tissue. Each bar represents the mean and standard deviation (SD) of 6 mice, and each dot represents the value per mouse.

[0147] Figure 10 The fold change in relative fluorescent units (RFU) of nanoluciferase in cells overexpressing the Ly6C1 receptor compared to cells overexpressing the negative control receptor TMEM30a.

[0148] Figure 11 In vivo validation of xBBB capsid experimental design.

[0149] Figure 12 The concentration of vDNA in liver tissue after 4 weeks in vivo was compared with that of the control capsid (AAV9) and two BBBs crossing the capsid.

[0150] Figure 13 The concentration of vDNA in the cerebellum of the control capsid (AAV9) and two BBBs crossing the capsid.

[0151] Figure 14 Brain enrichment relative to AAV-F library input normalization and relative to AAV9. Horizontal lines indicate no enrichment and correspond to the AAV9 wild-type capsid.

[0152] Example

[0153] introduction

[0154] Developing novel adeno-associated virus (AAV) capsids that can be effectively and specifically transduced into cells of the central nervous system (CNS) via systemic administration is one of the most interesting challenges in the field of AAV-based gene therapy. The presence of the blood-brain barrier (BBB) ​​restricts the entry of macromolecules and viruses from the bloodstream into the CNS. Additionally, the broad tissue tropism of first-generation AAVs leads to high levels of vector retention and transduction in peripheral non-target organs (such as the liver) after systemic delivery. This not only raises safety concerns (including immune activation and hepatotoxicity) but also reduces the amount of AAV vector successfully delivered to the CNS, resulting in a narrow therapeutic window. To date, several novel AAV capsids with improved CNS targeting or improved liver detargeting characteristics have been engineered and discovered. These novel capsid candidates are generated by in vivo or in vitro screening of capsid collections (called capsid libraries) and by using next-generation sequencing (NGS) as experimental readout to retrieve the most enriched capsid candidates in the target tissue. Initial capsid libraries can be generated through a variety of methods, such as random mutagenesis, peptide insertion / display in one or more exposed loops of the capsid gene, or scientifically sound design.

[0155] In the first example, we investigated whether novel capsids (AAV.CAP-B10-9P31, AAV.CAP-B10-F, 9.47-9P31, and 9.47-AAV-F) lead to successful assembly of vector particles carrying a barcoded genome. Furthermore, in the second example, we provide in vivo evidence of enhanced CNS-targeting and liver-detargeting characteristics of the novel capsids compared to known variants harvested from the literature.

[0156] 1. Example 1: AAV generation of a novel capsid

[0157] 1.1 Method

[0158] 1.1.1 Construction of novel capsid variants

[0159] We generated 26 AAV capsids and screened them in parallel in vivo in multiple “competitions” to determine which capsid would most effectively transduce the brain when administered systemically. For reference, our capsid library contained wild-type variants, i.e., known variants harvested from the literature containing random mutations or peptide insertions that provided their hepatic detargeting or CNS-targeting properties. The library further included novel capsids generated by combining known peptides or point mutations. Each capsid was generated individually in HEK293T cells using a triple plasmid transfection method. Thus, all capsids carried a self-complementary (sc) barcoded genome (composed of two reporter genes: green fluorescent protein (GFP) and nanoluciferase (nLuc)), and a unique 12-nucleotide barcode (Table 1) following the nLuc stop codon and preceding the multi-A tail, under the control of the CBh promoter ( Figure 1 Following generation, the capsids were merged, and the resulting capsid library was administered intravenously (IV) to 7-week-old C57BL6 and BALBc mice via tail vein injection at a dose of 1.4e11 vg / mouse (5.4e9 vg / capsid / mouse; vg = vector genome). Two weeks after vector delivery, the anterior brain, tail brain, cerebellum, and liver (representing peripheral organs) were harvested. Barcoded reporter transgenes were amplified by PCR, and the resulting amplicons were analyzed by next-generation sequencing (NGS) to assess the enrichment level of each CNS capsid in each tissue.

[0160] Table 1 The barcode sequence (12 nucleotides) of each AAV capsid merged in the capsid library. Novel capsids are marked in bold.

[0161]

[0162] 1.1.2 Generation of novel capsid variants in HEK293T cells

[0163] AAV viral vectors were generated in HEK293T cells using a standard triple plasmid transfection method. Briefly, HEK293T cells were maintained in Durbeco modified Eagle medium containing GlutaMAX and 10% fetal bovine serum. Polyethyleneimine hydrochloride transfection (PEImax®) was performed using 16.6 μg of adenovirus helper plasmid (pHelper), 16.6 μg of barcoded transgenic plasmid (pITR), and 16.6 μg of pRepCap plasmid containing AAV2 replicase (Rep) and the capsid gene for each test (Genewiz).

[0164] 72 hours post-transfection, cells were lysed at 28°C for 1 hour with lysis buffer (1.5 M NaCl, 0.5 M Tris-HCl, 1 mM MgCl2, 10% Triton X-100, pH 8.5), followed by treatment with a totipotent nuclease at 37°C for 1 hour. Cell debris was removed by centrifugation at 1900 xg for 15 minutes, and then POROS was used for cell removal. TM CaptureSelect TM AAVX affinity resin (Thermo Fisher Scientific) was used to purify the supernatant (crude lysate) containing viral particles using a batch binding protocol over 2 hours. After 2 hours, the affinity resin was washed with 0.2 M HPO4 (pH 7.5) buffer, and the bound vector was eluted by adding 0.2 M glycine (pH 2.5). The pH of the eluted vector was immediately neutralized by adding 0.5 M Tris-HCl (pH 8.5). The purified AAV vector batch was stored at -20°C.

[0165] 1.1.3 Analysis of novel capsid variants by qPCR and SDS-PAGE gel electrophoresis

[0166] The titer of purified vector batches was determined using qPCR with primers and probes specific to GFP transgenes. AAV was treated with DNase at 37°C to degrade exogenous DNA. AAV DNA was then released from the particles by a brief (30 min) heat treatment (37°C) in the presence of 1 M NaOH. Next, the alkaline environment was neutralized by adding an equal volume of 1 M HCl. The neutralized DNA was diluted 10-fold in WFI 16 ng / µl dHA, and the samples were then used for qPCR using primers specific to GFP transgenes: forward AGCAAAGACCCCAACGAGAA, reverse GCGGCGGTCACGAACTC, and probe Fam-CGCGATCACATGGTCCTGCT-mgb.

[0167] The VP protein composition of the purified vector was determined by SDS-PAGE gel electrophoresis. Briefly, 15 µl of purified vector was mixed with 5 µl of 4 x Laemmli loading buffer (Biorad) supplemented with β-mercaptoethanol (Biorad). After denaturing the protein at 95°C for 5 min, the material was loaded onto a clean polyacrylamide gel (Biorad). The sample was then electrophoretically separated at 200 volts for 35 min. Following electrophoresis, staining (tryptophan-based) was performed under UV light for 5 min, followed by visualization of the VP protein under UV light on a Chemidoc imaging system (Biorad).

[0168] 1.2 Results

[0169] The novel capsid successfully assembled vector particles carrying a barcoded genome. After generation and purification, AAV titers were determined using qPCR specific for GFP transgenes. For all novel capsids, and using the same transfection method and the same amount of plasmid DNA / culture dish, we found genome titers similar to those of previously described capsids, ranging between 2.2e11 and 7.1e11 vector genome (vg) / mL AAV capsid bulk binding (BB) material. Figure 2 To investigate whether the novel AAV capsid produces the correct VP stoichiometry, we performed SDS-PAGE gel electrophoresis on batches of bound purified materials. Figure 3 The resulting capsid VP1:2:3 ratio has a natural ratio of approximately 1:1:10, reflecting the infectious AAV capsid.

[0170] 2. Example 2: In vivo analysis of the composition of the AAV capsid library and its tissue distribution in mice after intravenous administration.

[0171] 2.1 Methods

[0172] 2.1.1 Composition, quality control, and preparation of AAV capsid libraries

[0173] As described in Example 1.1.2, 26 individual library members were generated, as indicated in Table 1. Cells were lysed with lysis buffer 72 hours post-transfection, followed by lysis with a totipotent nuclease, and cell debris was removed by centrifugation as described.

[0174] After centrifugation, aliquots were taken from each crude capsid lysate batch (CLB) for titration (qPCR), and the remaining CLBs were combined and titrated using POROS. TM CaptureSelect TM AAVX affinity resin (Thermo Fisher Scientific) was purified into a library using affinity chromatography (ÄKTA system). After purification, ultrafiltration / difiltration (UD / DF) was performed in a hollow fiber apparatus, and the buffer was exchanged to PCR-0.001% Pluronic acid.

[0175] As described in Example 1.1.3, qPCR was used to determine the titer of the final library in the preparation buffer using primers and probes that bind to the GFP transgene.

[0176] 2.1.2 In vivo studies, tissue processing, and amplicon NGS analysis

[0177] The final library was administered intravenously (IV) to 7-week-old C57BL6 and BALBc mice via tail vein injection at a dose of 1.4e11 vg / mouse. Two weeks after vector delivery, anterior brain, caudal brain, cerebellum, and liver (representing peripheral organs) were harvested. Tissue samples were pulverized, and DNA and RNA were separated using AllPrep DNA / RNA Mini (Qiagen). OligodT was used... (18) Total RNA was reverse transcribed using Maxima H minus reverse transcriptase (Thermo Fisher Scientific). Viral DNA was also isolated from the original AAV capsid library injected into mice according to the Purelink Viral DNA / RNA Mini Kit (Thermo Fisher Scientific) protocol. Barcoded reporter transgenes were amplified from DNA, cDNA, and the original library for 40 cycles by PCR using Q5® hot-start high-fidelity DNA polymerase (NEB) with specific primers (forward CGCCGAACATGATCGACTATT, reverse CCCTTGGACGAGACTGAAC). The resulting amplicons were processed using the NEBNext® Ultra II DNA Library Preparation Kit (Illumina). Library quality and yield were measured using a fragment analyzer, and cluster generation was further performed in a NovaSeq 6000 flow cell according to the manufacturer's (Illumina) protocol. Each sample was sequenced with a paired-end 151 bp read length (PE150), and at least 10 million paired-end reads were obtained (GenomeScan). Data was collected from GitHub. https: / / github.com / JonasWeinmann / AAV-barcode- detection and normalization The downloaded barcode identification and Python counting script identifies and counts known 12-nucleotide barcode sequences from sequencing reads. The script is adapted to our barcode sequences (Table 1) (length (12 nucleotides)) and flanking sequences (BCV_left = "GTGGTCTTCTCA" and BCV_right = "TTACGCCAGAAT"). The script runs on a Linux virtual machine running Ubuntu 20.04.3 LTS. The script outputs a text file indicating the barcode identity and the number of sequencing reads aligned to it. For each sample, the number of reads aligned to each barcode is divided by the total number of reads aligned to multiple barcodes in the given sample, and to further normalize capsid variability in the injected raw capsid library, the proportion of each barcode in each tissue is divided by the proportion of each barcode in the raw library. The resulting numbers represent the enrichment fold of each capsid in each tissue relative to the injected library. Finally, all numbers are scaled relative to 1 to represent the normalized proportion of each capsid in a given organization.

[0178] 2.2 Results

[0179] Prior to injection into mice, the titer of the finally purified AAV capsid library was determined using primers and probes targeting the GFP transgene, yielding a result of 7.7e11 vg / mL. Additionally, DNA packaged in the capsids from the library was extracted, barcode sequences were amplified by PCR, and the resulting amplicones were sequenced using NGS to evaluate the contribution of each capsid in the initial library. Figure 4 Then it is used to normalize the expression level of each capsid in each tissue.

[0180] Mice of two strains (BALBc and C57BL6) received 175 µL of capsid library via intravenous injection into the tail vein, resulting in a dose of 1.4e11 vg / mouse. Two weeks after library injection, liver and brain tissue (divided into anterior and posterior brain and cerebellum) were harvested, and amplicon was sequenced using NGS after DNA and RNA isolation, cDNA synthesis, and PCR to amplify barcodes present in the transgene. Sequencing data were analyzed to evaluate the enrichment and proportion of each capsid relative to the injected library in each tissue.

[0181] Figure 5 and Figure 6 The C57BL6 (AAV9) is shown to be superior to the AAV9. Figure 5 ) or BALBc strain ( Figure 6 The transcriptional enrichment folds of all novel and known capsids in ), while Figure 7 The liver enrichment folds of the two strains relative to AAV9 are shown.

[0182] As expected from previous results published in the literature, AAV-F targets all brain regions in both mouse strains, demonstrating a 33- to 52-fold increase in transduction compared to AAV9 in C57BL6 mice. Figure 5 ) and increased by 136 to 219 times in BALBc ( Figure 6 This depends on the brain region. However, for both mouse strains, AAV-F liver transduction remains almost identical to AAV9 ( Figure 7 When the F peptide was constructed on top of the transduction-deficient 9.47 capsid (which, according to our NGS results, does not transduce the brain at the delivered dose in any mouse strain), brain transduction remained superior to AAV9 (47-fold increase) in both mouse strains, particularly in the BALBc brain tail. Figure 6 For liver transduction, compared to AAV9, it was reduced by 24-fold in C57BL6 and by 55-fold in BALBc. Figure 7 On the other hand, in the known AAV.CAP-B10 capsid variant (which has lower liver transduction than AAV9 in both strains), Figure 7When constructing the F peptide on top of AAV9, and based on our results at the delivered dose, it showed higher brain transduction (up to 24-fold) only in the C57BL6 mouse strain compared to AAV9. Figure 5 In the C57BL6 strain, brain and liver transduction remained similar to AAV.CAP-B10, but in the BALBc strain, brain transduction was rescued, with transcription up to 61 times higher than AAV9. Figure 6 ), while maintaining liver detoxification ( Figure 7 ).

[0183] Regarding the 9P31 peptide display capsid, as expected from the published results, compared to AAV9, brain transcription was enhanced, particularly in the anterior brain, up to 104-fold in C57BL6 and up to 291-fold in BALBc (respectively). Figure 5 and Figure 6 ), while targeting the liver ( Figure 7 When the 9P31 peptide was constructed on the transduction-deficient 9.47 capsid, brain transduction in both strains remained higher than that of AAV9 (again, particularly in the anterior brain), while liver transcription was significantly reduced compared to AAV9, especially in BALBc. Figure 7 On the other hand, when the 9P31 peptide was constructed on top of the known AAV.CAP-B10 capsid variant, a slight increase in brain transduction was observed in the C57BL6 strain compared to the 9P31 capsid variant alone; however, this effect was only observed in the cerebellopontine and cerebellum of the BALBc strain. Figure 6 Regarding hepatic transduction of the AAV.CAP-B10-9P31 variant, it was reduced by up to 32-fold compared to AAV9, but still similar to the parental capsid 9P31, though higher than the parental capsid AAV.CAP-B10, indicating no synergistic effect between the two capsid characteristics in hepatic detargeting. Figure 7 ).

[0184] In summary, we have generated and tested four novel capsids (9.47-F, 9.47-9P31, AAV.CAP-B10-F, and AAV.CAP-B10-9P31) in vivo and compared their brain and liver performance with known parental capsids (9.47, AAV.CAP-B10, AAV-F, and 9P31) and the gold standard AAV9 to investigate whether the synergistic effect of capsid characteristics (peptide insertion, random mutation) leads to the novel capsids having better brain transduction capabilities than AAV9 while maintaining liver detargeting characteristics (Table 2).

[0185] Table 2: List of mutations in novel and known capsid sequences (VP1 labeled). Underlined letters indicate amino acid changes compared to wild-type AAV9 (sequence 1).

[0186]

[0187] Our results show that the novel capsids 9.47-F and 9.47-9P31 transduced the brain more effectively than AAV9, although not as effectively as the parental capsids AAV-F and 9P31. However, both capsids significantly detargeted the liver compared to the parental capsid (due to a random mutation in the 9.47 backbone), and thus potentially reduced hepatotoxicity and increased the therapeutic window. In both mouse strains, the novel capsids AAV.CAP-B10-F and AAV.CAP-B10-9P31 transduced the brain better than AAV9, although not as effectively as the parental capsid AAV-F in both strains. Regarding liver detargeting, capsid 9P31 has shown significant liver detargeting compared to AAV9, making AAV.CAP-B10-9P31 a very small phenotypic advantage, as the liver detargeting of the two capsids is similar. However, AAV.CAP-B10-F does retain the liver detargeting characteristic due to the AAV.CAP-B10 backbone. Furthermore, according to our results, AAV.CAP-B10 can only transduce the brain in the C57BL6 mouse strain (i.e., the mouse strain in which AAV.CAP-B10 was previously discovered), but not in the BALBc brain, and the addition of F peptide can rescue the phenotype in this mouse strain.

[0188] 3. Example 3: In vivo single-component validation of 9.47-F candidate

[0189] 3.1 Method

[0190] 3.1.1 Generation of AAV capsid variants

[0191] AAV viral vectors AAV9, AAV-F, and 9.47-F were generated in HEK293T cells using a standard triple plasmid transfection method. 72 hours post-transfection, the virus was harvested and purified by capture with Poros CaptureSelect AAV9 resin (Thermo Fisher Scientific), further concentrated with Amicon ULTRA 15 (Ultracel PL membrane, 100 kDa), prepared in PBS-0.001% Prönkel buffer, and filtered. AAV was titrated by qPCR using ITR-specific PCR primers. AAV purity was checked by isolating viral proteins in 10% SDS-PAGE, and the integrity of the packaged vector genome was checked on 0.8% agarose. Additionally, endotoxin levels in the final product were determined using an Endosafe-nestgen-PTS spectrometer (Charles River Laboratories). The sequence of the transgene to be expressed is identical for all three capsids (SEQ ID NO: 70), while the sequences of the AAV9, AAV-F, and 9.47-F capsid proteins are SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 6, respectively.

[0192] 3.1.2 In vivo studies and tissue harvesting in BALBc mice

[0193] Each of the three AAV capsids was administered intravenously (IV) to 7-week-old BALBc mice via tail vein injection at a dose of 5e12 vg / mouse, with 6 mice in each capsid group. Four weeks after vector delivery, the mice were anesthetized with 5% isoflurane, perfused with saline solution, decapitated, and the whole brain and liver were sampled. Furthermore, the whole brain was further divided into two parts: the cerebellum and the remainder of the brain (cerebrum). Finally, all samples were rapidly frozen until further molecular analysis.

[0194] 3.1.3 Sample processing for molecular biology readout

[0195] Frozen tissue samples were homogenized using a CryoPrep CP02 system (Covaris) and lysed with RLT lysis buffer in a Tissue Lyser II device (Qiagen). For protein analysis, total protein was measured from homogenized tissue using the Bradford assay, and nanoLuc protein was quantified using the Nano-Glo® luciferase assay system (Promega) after normalization of total protein in the samples. Additionally, DNA and RNA were simultaneously isolated from each sample using the Allprep DNA / RNA96 kit (Qiagen). Following nucleic acid isolation, 100 μg of total RNA was reverse transcribed using the Maxima First-Strand cDNA Synthesis Kit with dsDNAase for RT-qPCR (Thermo Fisher Scientific), which was initiated with random hexamer.

[0196] Transgenic genes (SEQ ID NO: 74) from DNA or cDNA templates were quantified using TaqMan Rapid Universal PCR MasterMix 2X (Thermo Fisher Scientific). For vector genomic DNA (vDNA) quantification, primers / probes were used targeting the CMV enhancer sequence (forward: AGTAACGCCAATAGGGACTTTC, reverse: GGCGTACTTGGCATATGATACA, probe: TTACGGTAAACTGCCCAC TTGGCA; SEQ ID Nos. 75 to 77), while for vector transcripts from cDNA samples, primers / probes were used targeting the NLuc transgene (forward: GGAGGTGTGTCCAGTTTGTT, reverse: ATGTCGATCTTCAGCCC ATTT, probe: ATCCAAAGGATTGTCCTGAGCGG; SEQ ID Nos. 78 to 80).

[0197] 3.2 Results

[0198] In this example, we investigated whether the 9.47-F candidate could be successfully transduced into the brain while maintaining liver detargeting characteristics. Genomic analysis of the vector in the brain and cerebellum showed that both AAV-F and the 9.47-F capsid delivered more than 10-fold more vector to these tissues compared to AAV9. Figure 8 A- Figure 8 B), while liver analysis showed that although the vector genomes of AAV9 and AAV-F are similar, the levels in the livers of mice injected with the 9.47-F capsid were reduced by more than 500-fold (B). Figure 8 C). Analysis of vector transcripts in the brain, cerebellum, and liver ( Figure 8 D- Figure 8F) Consistent with vector genome results, it showed increased functional transduction of capsid AAV-F and 9.47-F in two brain regions (particularly in the cerebellum), while transduction was reduced in the liver of mice injected with 9.47-F.

[0199] Furthermore, luciferase (nLuc) protein levels in the forebrain and cerebellum showed that the nLuc readouts of both AAV-F and 9.47-F capsids were higher than those of AAV9, particularly in the cerebellum. Figure 9 ), while the level of nLuc protein in the liver of 9.47-F capsid was reduced by at least 30-fold compared to AAV9.

[0200] Overall, in this example, we evaluated the in vivo behavior of an AAV9-derived 9.47-F candidate in a singleton manner. This candidate possesses point mutations S414N, G453D, K557E, and T582I, and has a 7-mer FVVGQSY peptide inserted between Q588 and A589. We can conclude that, due to the presence of the 7-mer peptide, 9.47-F exhibits increased biodistribution and functional transduction in both the cerebellum and cerebrum compared to wild-type AAV9, while maintaining the liver-detargeting characteristics derived from the four point mutations.

[0201] Example 4: In vitro Ly6C1 binding assay of AAV-F capsid variants

[0202] 4.1 Methods

[0203] 4.1.1 Generation of AAV-F variants

[0204] Each AAV-F capsid variant (including AAV-F) was individually generated in HEK293T cells using a standard triple plasmid transfection method. 72 hours post-transfection, the virus was harvested and transfected using POROS. TM CaptureSelect TMPurification was performed using AAVX affinity resin (Thermo Fisher Scientific). The transgene sequence was identical for all capsids and is indicated in SEQ ID NO: 83. Briefly, each capsid carries a self-complementary (sc) genome consisting of two reporter genes (GRP and nLuc). After generation, AAV was titrated using primers and probes targeting GFP (forward primer: AGCAAAGACCCCAACGAGAA, reverse primer: GCGGCGGTCACGAACTC, probe: CGCGATCACATGGTCCTGCT; SEQ ID Nos. 11 to 13), and viral proteins were evaluated in 4%–10% SDS-PAGE gels. Based on QC results, each of the 28 candidates that successfully generated AAV capsid assemblies was used for in vitro assays to evaluate their ability to interact with the Ly6c1 receptor.

[0205] 4.1.2 In vitro binding assay of Ly6C1

[0206] To evaluate the interaction between each AAV-F capsid variant and the Ly6c1 receptor, HEK293T cells were seeded in 48-well plates (1e5 cells / well) and reverse-transfected with either the mouse Ly6C1 overexpression plasmid (SEQ ID NO: 81) or the human TMEM30a plasmid (SEQ ID NO: 82) (as a negative control, an unrelated transmembrane protein). Forty-eight hours post-reverse transfection, cells were transduced with either AAV-F variant. Forty-eight hours post-transduction, cells were lysed, and the activity of the capsid-derived nanoluciferase in each well was measured using the Nano-Glo® luciferase assay kit (Promega). Finally, the fold change in nLuc readout between Ly6C1 and the TMEM30a receptor was calculated to evaluate the enrichment of each capsid in Ly6C1-overexpressing cells.

[0207] 4.2 Results

[0208] In this example, we generated 28 AAV-F variants (Table 3) and explored their ability to bind to the Ly6C1 receptor in vitro.

[0209]

[0210] Table 3. Sequences and insertion locations of alternative AAV-F peptide insertions. Numbering is based on the AAV9 viral protein 1 (VP1) sequence.

[0211] After transfection of cells with either Ly6C1 overexpression or a negative control receptor (TMEM30a), the self-derived nLuc activity of each transfected cell was measured. The fold change was calculated by dividing the Ly6C1 receptor nLuc RLU readout by the same activity derived from cells overexpressing TMEM30a. Based on these results ( Figure 10 Only the AlF1 peptide (FVVAQSY inserted between amino acids Q588-A589) showed a Ly6C1 enrichment level relative to the TMEM30a receptor that was similar to that found in the AAV-F capsid.

[0212] Based on these results, we can conclude that AAV-AlF1 maintains its ability to interact with the Ly6C1 receptor in vivo. To demonstrate this in vivo while preserving the hepatic detargeting characteristics of 9.47-AAV, we conducted in vivo studies to evaluate whether 9.47-AAV-AlF1 (SEQ ID NO: 84) retains its ability to cross the blood-brain barrier upon systemic administration while maintaining its hepatic detargeting characteristics. Additionally, modifications to the 9.47-AAV backbone were tested in vivo, excluding two of the mutations (from four point mutations (S414N, G453D, K557E, T582I) to only two point mutations (S414N, G453D) and including the AlF1 peptide 9.47ND-AAV-AIF1 (SEQ ID NO: 85).

[0213] 5. Example 5: In vivo verification of the capsid

[0214] 5.1 Method

[0215] 5.1.1 Isolation of DNA / RNA from in vivo samples

[0216] For DNA and RNA isolation, the manufacturer's protocol was followed, and the AllPrep Mini Kit (catalog number 80204) from Qiagen was used in all the experiments described. RLT Plus lysis buffer was applied to the pulverized animal tissue. The tissue suspension was then applied to lysis matrix D tubes with Matrix D beads (MP Biomedicals 116913100) and homogenized using a tissue lyser system (Qiaagen). DNA and RNA were then isolated from the extract by first applying DNA and RNA to a DNA-binding column from the All Prep DNA / RNA Mini Kit. Flow-through from the DNA column was then added to the RNA-binding column. After centrifugation and washing steps, DNA and RNA were eluted from the respective columns. In this way, DNA and RNA were isolated from the same sample. The quantity and integrity of DNA and RNA were determined using Nanodrop.

[0217] 5.1.2 Quantification of vector DNA from in vivo samples

[0218] Vector genome copies were quantified using TaqMan qPCR assays (Thermo Fisher Scientific) with primers and probes targeting the CMV enhancer region of the vector and primers and probes targeting mouse β-actin as a housekeeping gene control (SEQ ID NOs 74-76 and 89-91). Quantification was performed using a linear plasmid (GC / ug DNA) to generate a standard curve with dilution ranges of the plasmid. This standard curve was used to calculate the vector DNA copy number of DNA isolated from in vivo tissue samples.

[0219] 5.2 Results

[0220] This in vivo experiment further evaluated the efficacy of blood-brain barrier (BBB) ​​transcapsid crossing by comparing the BBB crossing with a control capsid (AAV9). Our study employed vectors encoding two proteins expressed from two open reading frames (ORFs). Male wild-type C57BL / 6J mice were used, with a total of n = 6 animals receiving intravenous injection of 2.2E11 gc / animal for each vector. After 4 weeks in vivo, mice were euthanized, and liver and cerebellar tissues were harvested and processed to assess vector DNA (vDNA) levels. The experimental design (…) Figure 11 The study aimed to elucidate the transduction efficiency of the BBB across the capsid and its potential tissue-specific role.

[0221] The concentration of vDNA in liver tissue was compared between the control capsid (AAV9) and two BBB transcapsids (9.47-AAV-AIF1 and 9.47ND-AAV-AIF1, also referred to as 4mut 9.47-AAV-AIF-1 and 2mut 9.47ND-AAV-AIF-1; SEQ ID NO. 84 and 85). Figure 12 The results showed that the vDNA level (measured in ug / ml) in the control AAV9 capsid was significantly higher than that of 9.47-AAV-AIF1 and 9.47ND-AAV-AIF1 (unpaired t-tests, p = 0.03425 and p = 0.03502, respectively).

[0222] like Figure 13The study also compared vDNA concentrations in cerebellar tissue between the control capsid (AAV9) and two BBB-crossing capsids (9.47-AAV-AIF1 and 9.47ND-AAV-AIF1). A significantly higher vDNA concentration was observed in 9.47-AAV-AIF1 compared to the control AAV9 capsid (unpaired t-test, p = 0.04748). Additionally, AIF1 showed a trend toward increasing vDNA levels compared to the control capsid, although this trend did not reach statistical significance.

[0223] The findings of this study indicate that, compared with BBB transcapsulation of 9.47-AAV-AIF1 and 9.47ND-AAV-AIF1, the control AAV9 capsid resulted in significantly higher vDNA concentrations in liver tissue. This suggests a potential advantage of BBB transcapsulation in reducing non-targeted transduction in the liver, which could be beneficial for achieving targeted gene delivery to the brain.

[0224] The study also indicated that 9.47-AAV-AIF1 resulted in significantly higher vDNA concentrations in cerebellar tissue compared to the control AAV9 capsid. Conversely, 9.47ND-AAV-AIF1 showed a trend toward increasing vDNA levels compared to the control, although this was not statistically significant. These findings suggest different effects of BBB crossing the capsid on vDNA distribution in the cerebellum.

[0225] 6. Case Study 6: In vivo study of AAV-F variant

[0226] 6.1 Method

[0227] 6.1.1 Generation of AlF variants

[0228] Each AAV-F capsid variant (including AAV-F) was generated in HEK293T cells using a standard triple plasmid transfection method, and POROS was used to generate each variant. TM CaptureSelect TMPurified using AAVX affinity resin (Thermo Fisher Scientific). Each AAV-F variant carried its own complementary (sc) barcoded genome (plasmid backbone SEQ ID NO: 86) (consisting of two reporter genes (GFP, nLuc)), followed by a 12-nucleotide barcode (unique for each capsid, Table 4), and under the control of the human synaptophysin promoter (hSyn1). After titration (qPCR) of each individual variant, all variants were mixed to produce a capsid mixture, which was further buffer-exchanged to PBS-0.001% Pluronic acid using a D-Tube dialyzer with Mega MWCO 6–8 kDa (Merk) and concentrated using an Amicon® ultracentrifuge filter with 100 kDa MWCO (Sigma). The final mixture was titrated prior to in vivo studies in mice to test endotoxin and its potency was validated in vitro in neuroblastoma-derived (SH-SY5Y) cells. In addition, viral DNA was isolated from the original AAV capsid mixture injected into mice, following the Purelink Viral DNA / RNA Mini Kit (Thermo Fisher Scientific) protocol.

[0229]

[0230] Table 4. Barcode sequences (12 nucleotides) of each AAV-F variant incorporated into the mixture used for in vivo testing.

[0231] 6.1.2 In vivo studies and tissue harvesting in BALBc mice

[0232] The capsid mixture was administered intravenously (IV) to 7-week-old BALBc mice via tail vein injection at a dose of 2.2e11 vg / mouse, with 5 mice in each capsid group. Four weeks after vector delivery, the mice were anesthetized with 5% isoflurane, perfused with saline solution, decapitated, and samples were taken from the whole brain and liver. All samples were rapidly frozen until further molecular analysis.

[0233] 6.1.3 Sample processing, amplicon NGS and analysis

[0234] Frozen tissue samples were pulverized using a CryoPrep CP02 system (Covaris) and lysed with RLT lysis buffer in a Tissue Lyser II device (Qiagen). DNA and RNA were simultaneously isolated from each sample using the Allprep DNA / RNA 96 kit (Qiagen). Following nucleic acid isolation, 100 μg of total RNA was reverse transcribed using the Maxima First-Strand cDNA Synthesis Kit with dsDNAase for RT-qPCR (Thermo Fisher Scientific), which was initiated with random hexamers. Transgenes (SEQ ID NO: 74) from the DNA or cDNA template were quantified using a TaqMan Rapid Universal PCR MasterMix 2X (Thermo Fisher Scientific). For vector genomic DNA (vDNA) quantification, primers / probes targeting the CMV enhancer sequence were used (forward: AGTAACGCCAATAGGGACTTTC, reverse: GGCGTACTTGGCATATGATACA, probe: TTACGGTAAACTGCCCACTTGGCA; SEQ ID NO. 75 to 77), while for quantification of vector transcripts from cDNA samples, primers / probes targeting the NLuc transgene were used (forward: GGAGGTGTGTCCAGTTTGTT, reverse: ATGTCGATCTTCAGC CCATTT, probe: ATCCAAAGGATTGTCCTGAGCGGT; SEQ ID NO. 78 to 80). Additionally, using Q5® hot-start high-fidelity DNA polymerase (NEB), barcodes from the transgene were amplified by PCR from brain cDNA and a mixture of input AAV capsids administered to mice using the forward primer CGCCGAACATGATCGACTATT and the reverse primer CCCTTGGACGAGACTGAAC, for 35 cycles (SEQ ID No. 87 and 88). Sequencing libraries were generated using the TruSeq Nano DNA Library Preparation Kit (Inmena), and sequenced in a NovaSeq 6000 flow cell according to the manufacturer's (Inmena) protocol. Each sample was sequenced with 151 bp reads at paired ends (PE150), and a minimum of 10 million paired-end reads were achieved (Macrogen Europe). Sequencing was performed using data from GitHub (…). https: / / github.com / JonasWeinmann / AAV-barcode-detection- and-normalizationThe downloaded barcode identification and Python counting script identifies and counts known 12-nucleotide barcode sequences from sequencing reads. The script is adapted to our barcode sequences (Table 3) (length (12 nucleotides)) and flanking sequences (BCV_left="GTGGTCTTCTCA" and BCV_right="TTACGCCAGAAT"). The script runs on a Linux virtual machine running Ubuntu 20.04.3 LTS. The script outputs a text file indicating the barcode identity and the number of sequencing reads aligned to it. For each sample, the number of reads aligned to each barcode is divided by the total number of reads aligned to multiple barcodes in the given sample, and to further normalize capsid variability in the injected raw capsid library, the proportion of each barcode in each tissue is divided by the proportion of each barcode in the raw library. The resulting numbers represent the enrichment fold of each capsid in each tissue relative to the injected library. Finally, all numbers are scaled relative to the AAV values ​​to visualize the enrichment factor relative to AAV9.

[0235] 6.2 Results

[0236] A mixture of AAV-F variants carrying barcoded genomes with GFP and nLuc transgenes under neuron-specific hSyn1 promoter control was intravenously administered to BALBc mice to evaluate the transduction levels of each capsid in the brain (independent of its ability to bind the Ly6C1 receptor in vitro) and its biodistribution in the liver. This was done because AAV9 with brain expression is known not to bind the Ly6C1 receptor. The barcoded genomes were amplified from the administered AAV mixture, and the resulting amplicon was sequenced using NGS to evaluate the contribution of each capsid in the initial library, which was then used to normalize the expression levels of each capsid in the mouse brain (cDNA). Finally, all capsids were normalized relative to wild-type AAV9 expressed in the brain to calculate brain enrichment compared to input and relative to AAV9. Figure 14 ).

[0237] By analyzing brain enrichment scores ( Figure 14 We can conclude that the 10 AAV-F variants are more enriched in the mouse brain than the original AAV-F capsid, and based on Example 4, our results indicate that these 10 variants are not mLy6C1 receptor binders. This suggests that other receptors are used to cross the blood-brain barrier in mice.

[0238] Based on these results, a transient transfection method was used, followed by baculovirus infection for replication, to produce the three best-yielding capsids (SEQ ID No. 92 to 94) of these 10 top candidates on a large scale in Sf+ cells, and they were used in single-weight mouse studies to confirm their BBB crossing ability.

Claims

1. An adeno-associated virus (AAV) serotype 9 (AAV9) or clade F AAV capsid protein variant comprising one or more mutations in one or more amino acids that confer at least one of the following to the capsid protein variant: i) a phenotype of reduced liver transduction compared to a control capsid protein that does not have the one or more mutations; and ii) a phenotype of reduced overall transduction compared to a control capsid protein that does not have the one or more mutations, and wherein the capsid protein variant further comprises an amino acid sequence that confers increased CNS transduction compared to a control capsid protein that does not have the amino acid sequence.

2. The AAV capsid protein variant of claim 1, wherein at least one of: i) the capsid protein variant comprises a mutation in one or more amino acids in amino acid regions 452-458, 498-504, 590-595, and / or 582-587, and wherein the one or more mutations result in a phenotype of reduced liver transduction compared to a control that does not have the one or more mutations; ii) the capsid protein variant comprises a mutation at T138, S414, G453, K557, T568, T582, and Q590, or any combination thereof, and wherein the one or more mutations result in a phenotype of reduced overall transduction compared to a control capsid protein that does not have the one or more mutations; and iii) the amino acid sequence that confers increased CNS transduction comprises an amino acid sequence selected from the group consisting of STTLYSP, FVVGQSY, DGTLAVPFK, and WPTSYDA, and sequences that differ from the above amino acid sequences by no more than four, three, two, or one amino acids.

3. The AAV capsid protein variant of claim 1 or 2, wherein at least one of: i) the capsid protein variant comprises at least one mutation selected from the group consisting of mutations at positions W595, Q592, W503, N498, E500, and the amino acid sequence DGAATKN at positions 452-458, and wherein the one or more mutations result in a phenotype of reduced liver transduction compared to a control that does not have the one or more mutations; ii) the capsid protein variant comprises mutations at both T568 and Q590, or at both S414 and G453, or at all of T138, S414, G453, K557, and T582, or at all of S414, G453, K557, and T582, and wherein the one or more mutations result in a phenotype of reduced overall transduction compared to a control capsid protein that does not have the one or more mutations; and iii) the amino acid sequence that confers increased CNS transduction comprises an amino acid sequence selected from the group consisting of STTLYSP, FVVGQSY, DGTLAVPFK, and WPTSYDA, and sequences that differ from the above amino acid sequences by no more than four, three, two, or one amino acids. iii) the amino acid sequence conferring increased CNS transduction comprises an amino acid sequence selected from the group consisting of FVVGQSY, FVVAQSY, FVVVQSY, FVVLQSY, FVVIQSY, FVVNQSY, FVVSQSY, FVVEQSY, FVVQQSY, FVVCQSY, FVVTQSY, FVVPQSY, FVVQSY, FVGVQSY, FVVQGSY, FVQGVSY, FSVGQVY and FSQGVVY, preferably selected from the group consisting of FVVGQSY, FVVAQSY, FVVPQSY, FVGVQSY and FVVQGSY.

4. The AAV capsid protein variant of any one of claims 1 to 3, wherein at least one of: i) the capsid protein variant comprises a W595C mutation, a Q592L mutation, a W503R mutation, a N498Y mutation, a E500D mutation, or any combination thereof, wherein the one or more mutations result in a phenotype of reduced liver transduction compared to a control without the one or more mutations; ii) the capsid protein variant comprises T568P and Q590L mutations, or S414 and G453D mutations, or T138A, S414N, G453D, K557E and T582I mutations, or S414N, G453D, K557E and T582I mutations; and iii) the inserted amino acid sequence is inserted into a hypervariable region of the AAV capsid protein sequence, preferably into a hypervariable region selected from loop IV or loop VIII.

5. The AAV capsid protein variant of any one of claims 1 to 3, wherein the capsid protein variant comprises: a) T138A, S414N, G453D, K557E and T582I mutations and an amino acid sequence FVVGQSY or FVVAQSY inserted into loop VIII, preferably between amino acid positions 588 and 589; b) S414N, G453D, K557E and T582I mutations and an amino acid sequence FVVGQSY or FVVAQSY inserted into loop VIII, preferably between amino acid positions 588 and 589; c) T138A, S414N, G453D, K557E and T582I mutations and an amino acid sequence WPTSYDA inserted into loop VIII, preferably between amino acid positions 588 and 589; d) S414N, G453D, K557E and T582I mutations and an amino acid sequence WPTSYDA inserted into loop VIII, preferably between amino acid positions 588 and 589; e) an amino acid sequence DGAATKN at positions 452-458 and an amino acid sequence FVVGQSY or FVVAQSY inserted into loop VIII, preferably between amino acid positions 588 and 589; or, f) the amino acid sequence DGAATKN at positions 452-458 and the amino acid sequence WPTSYDA inserted into loop VIII, preferably between amino acid positions 588 and 589.

6. The AAV capsid protein variant according to any one of the preceding claims, wherein the AAV capsid protein variant is comprised in an amino acid sequence selected from the group consisting of SEQ ID NO: 6, 7, 9, 10, 96.

7. The AAV capsid protein variant according to any one of the preceding claims, wherein the AAV capsid protein variant is a variant of at least one of the VP1, VP2 and VP3 capsid proteins.

8. A nucleic acid encoding the AAV capsid protein variant according to any one of claims 1 to 7.

9. A recombinant AAV (rAAV) vector virion comprising at least one AAV capsid protein variant according to any one of claims 1 to 7, and preferably not comprising at least one of the wild-type VP1, VP2 and VP3 capsid proteins.

10. The rAAV vector virion according to claim 9, wherein the rAAV vector virion comprises a nucleic acid molecule encapsidated by the at least one capsid protein variant, and wherein the nucleic acid molecule comprises a transgene flanked by at least one AAV inverted terminal repeat (ITR).

11. A composition comprising the AAV vector virion according to claim 9 or 10, wherein preferably the composition is a pharmaceutical composition comprising the AAV vector virion and at least one pharmaceutically acceptable carrier.

12. The AAV vector virion according to claim 9 or 10, or the composition according to claim 11, for use as a medicament, wherein preferably the medicament is for use in the treatment of a central nervous system disorder.

13. A method for identifying an AAV capsid variant having a desired characteristic, the method comprising: a) providing a library comprising a plurality of individually produced AAV capsid variants, wherein each member of the library differs from the amino acid sequence of the AAV capsid variants of the other members of the library by at least one amino acid, and wherein each member of the library comprises a DNA construct, wherein the DNA construct comprises: i) a unique molecular identifier (UMI) that is unique for the member of the library; ii) a reporter gene operably linked to a promoter for driving expression in a mammalian cell; and iii) at least one AAV ITR, b) contacting the library with a culture of cells, organoids or tissues, or administering the library to a non-human animal; c) allowing the AAV capsid variants of the library to transduce cells in the cells, the organoids, the tissues or the animal; and d) identifying the AAV capsid variant having the desired characteristic. d) identifying at least one AAV capsid variant from the cells in b), the organoids, the tissues, or the at least one cell of the desired cell type that has been transduced in the animal by sequencing the UMIs thereof as the AAV capsid variant having the desired characteristic, and optionally recovering the AAV capsid variant having the desired characteristic from the cells of the desired cell type.

14. The method of claim 13, wherein step d) comprises detecting transduction of cells of the desired cell type by detecting expression of the reporter gene in at least one cell of the desired cell type.

15. The method of claim 13 or 14, wherein in step d), for at least two members of the library, at least one of the mRNA expressed by the at least two members and the genomic copy number of the at least two members is quantified and identified by sequencing the UMIs thereof in at least one cell of the desired cell type, and wherein the member having the highest at least one of mRNA expression level and genomic copy number is identified as the AAV capsid variant having the desired characteristic.

16. The method of claim 15, wherein for at least two members of the library, at least one of the mRNA expressed by the at least two members and the genomic copy number of the at least two members is quantified and identified by sequencing the UMIs thereof in cells comprising more than one cell type of the at least desired cell type, and wherein the member having the most desired distribution across the more than one cell type is identified as the AAV capsid variant having the desired characteristic.

Images