Method for effectively removing antibiotic resistance genes from hydrogen peroxide aged biochar
By using hydrogen peroxide-aged biochar in combination with pig manure and rice bran composting, the problem of poor removal of antibiotic resistance genes in existing technologies has been solved. The modified properties of aged biochar have improved the degradation efficiency of ARGs and provided a new mechanism for ARGs removal during composting.
Patent Information
- Application Number
- CN202511794725.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-02
- Publication Date
- 2026-01-20
AI Technical Summary
Existing technologies have limited effectiveness in removing antibiotic resistance genes (ARGs) during livestock and poultry manure composting, and the impact of aged biochar on them is unclear. A more effective method is needed to control the spread of ARGs in soil and crops.
Hydrogen peroxide-aged biochar was used to compost pig manure and rice bran. Fresh biochar was prepared by high-temperature anaerobic pyrolysis, and aged biochar was prepared by oxidation with H2O2 solution. The aged biochar was then added to the pig manure and rice bran mixture for aerobic composting. The effect of this method on the removal of antibiotic resistance genes was studied.
The degradation rate of antibiotic resistance genes was significantly improved. The porosity, specific surface area and oxidized functional groups of aged biochar enhanced its adsorption and degradation capacity, limiting the spread of antibiotic resistance genes and providing a new mechanism for the removal of ARGs during composting.
Smart Images

Figure CN121362092A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of effective removal of antibiotic resistance genes by hydrogen peroxide aged biochar, in particular to a method for effective removal of antibiotic resistance genes by hydrogen peroxide aged biochar. BACKGROUND
[0002] Recycling livestock manure to farmland as fertilizer plays a crucial role in sustainable agricultural waste management. However, the misuse of antibiotics in livestock farming has led to the enrichment of antibiotic resistance genes (ARGs) in livestock manure, which are spread to soil and crops through the application of manure, further threatening human health (Liu et al., 2024).
[0003] Therefore, eliminating ARGs is a prerequisite for the agricultural use of livestock manure. Aerobic composting is an effective method for converting manure into organic fertilizer, which has been shown to reduce some ARGs (Zhang et al., 2024). However, this reduction effect is limited, as previous studies have confirmed that certain types of ARGs increase after composting (Cao et al., 2020; Wang et al., 2021).
[0004] Therefore, it is crucial to implement practical strategies during the composting process to enhance the elimination of ARGs.
[0005] Biochar, a porous material produced by pyrolysis of biomass under high-temperature anaerobic conditions, has been considered as an effective additive to eliminate ARGs in composting processes (Wang et al., 2023; Fu et al., 2024; Ma et al., 2024a). However, biochar will be modified in natural media such as soil and compost, which is called “aging” (Luo et al., 2024; Long et al., 2024). Aging will cause changes in the basic properties of biochar, including pore volume (PV), specific surface area (SSA), oxygen-containing functional groups (OFG), and pH (Mia et al., 2017; Fan et al., 2018; Yang et al., 2024). In addition, these changes further affect the adsorption capacity, electron exchange capacity, and microbial recruitment and colonization capacity of biochar (Liu and Chen, 2022; Li et al., 2023a; Li et al., 2023b). ARGs are generated from the selective pressure of antibiotics on microorganisms, and their spread in environmental media mainly occurs through two pathways: vertical gene transfer (VGT) and horizontal gene transfer (HGT) (Zhao et al., 2024). VGT involves the reproduction of microorganisms, while HGT is carried out by mobile genetic elements (MGEs) (Tong et al., 2023; Wen et al., 2024).
[0006] Previous studies have shown that biochar plays a crucial role in adsorbing and decomposing antibiotics, MGEs, and ARGs, and regulating microbial communities, ultimately removing ARGs from environmental media (Ejileugha, 2022; Li et al., 2024). Considering the effects of aging on biochar, it is expected that fresh biochar and aged biochar will have different effects on the removal of ARGs in the environment. A previous study has proven this inference in farmland soil (Cheng et al., 2021). However, the effects of fresh biochar and aged biochar on the removal of ARGs in the aerobic composting process are currently unknown.
[0007] Several laboratory-scale aging methods have been employed to simulate the natural aging of biochar, including oxidation (Mia et al., 2017), wet-dry cycles (Yang et al., 2021), freeze-thaw cycles (Tang et al., 2021), and microbial-induced aging (Oleszczuk and Kołtowski 2018). Liu and Chen (2022) found that oxidative aging was effective in simulating long-term aging, while Chen et al. (2022) demonstrated that hydrogen peroxide-oxidized biochar exhibited similar surface chemistry and organic matter release characteristics as biochar that had undergone 10 years of natural aging.
[0008] Therefore, the present application uses pig manure and rice bran composite compost, respectively adds fresh or hydrogen peroxide-oxidized aged biochar, detects ARGs and their related physicochemical properties and microbial community. The different effects of fresh and aged biochar on the degradation of ARGs in the aerobic composting process are elucidated; the potential microbial mechanism of aged biochar for eliminating ARGs is elucidated; and a new perspective is provided for controlling ARGs during the conversion of feces into agricultural fertilizer. SUMMARY
[0009] Therefore, the present application provides a method for effectively removing antibiotic resistance genes by hydrogen peroxide-oxidized biochar.
[0010] To solve the above technical problems, the present application adopts the following technical solutions:
[0011] The method for effectively removing antibiotic resistance genes by hydrogen peroxide-oxidized biochar comprises the following steps:
[0012] Step 1: Preparation of fresh biochar
[0013] Rice husk is prepared into fresh biochar by high-temperature anaerobic pyrolysis;
[0014] Step 2: Preparation of aged biochar
[0015] The fresh biochar is oxidized with H2O2 solution to prepare aged biochar;
[0016] Step 3: Composting process
[0017] Solid pig manure obtained after solid-liquid separation from a large-scale pig farm is collected, rice bran from a rice processing plant is used as filler, and after mixing, aged biochar is added and mixed thoroughly, and the moisture is adjusted for aerobic composting fermentation;
[0018] The compost is turned over on the 5th, 10th, 15th, 21st, 25th and 30th day; the high-temperature composting is completed on the 30th day, and after turning over, the compost enters the aging and maturation stage, and is turned over once on the 40th day, and then remains static until the 60th day, that is, the organic fertilizer product is prepared;
[0019] After screening and impurity removal, the product is packaged and stored.
[0020] Preferably, in step 1, the rice husk is prepared into fresh biochar by high-temperature anaerobic pyrolysis at 600 DEG C for more than 4 hours.
[0021] Preferably, step 2 is carried out under constant temperature of 80 DEG C, the mass fraction of H2O2 solution is 30%, and the oxidation is carried out for 6-7 hours at a mass-volume ratio of 1:10.
[0022] Preferably, in step 3, the solid pig manure and the filler are mixed at a dry matter weight ratio of 2:1, 12% of the dry weight of the aged biochar is added, and the mixture is uniformly mixed.
[0023] Preferably, in step 3, the moisture is adjusted to 55%-65% for aerobic composting fermentation.
[0024] The present application has the following technical effects relative to the prior art:
[0025] (1) The present application studies the fate of 27 ARGs and 3 MGEs by using pig manure and rice bran composite compost (NBC), adding fresh biochar (FBC) and hydrogen peroxide aged biochar (ABC), and the total degradation rate of 27 ARGs and 3 MGEs is significantly reduced in the three treatments, in turn, ABC (68.5%), FBC (55.7%) and NBC (15.7%);
[0026] (2) The absolute abundance change of the present application shows that 18 ARGs and 3 MGEs are degraded after 60 days of composting, and the remaining 9 ARGs are enriched;
[0027] (3) The network analysis and Mantel test of the present application show that the 18 degraded ARGs are mainly controlled by MGEs, and since the pore size (PS), pore volume (PV), specific surface area (SSA) and oxidation functional group (OFG) of the aged biochar are higher than those of the fresh biochar, the decrease of MGEs in the aged biochar treatment is greater, which further strengthens the elimination of the 18 degraded ARGs;
[0028] (4) Due to ecological competition, the relatively high abundance of thermus and clostridium in the late ABC limits the relative abundance of the potential host bacteria of the 9 enriched ARGs; therefore, compared with NBC or FBC, the abundance of the 9 enriched ARGs in ABC is obviously lower;
[0029] (5) The present application shows that hydrogen peroxide aging enhances the removal of ARGs in biochar, which provides new insights into the reduction of ARGs in compost. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 Scanning electron microscopy (SEM) of fresh biochar (a) and aged biochar (b) of the present application, and Brunauer-Emmett-Teller (BET) analysis (c) and Fourier transform infrared (FTIR) spectroscopy (d) of both biochars;
[0031] wherein SSA: specific surface area; PV: pore volume; PS, pore size;
[0032] Figure 2 Changes in antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) during composting process of the present application;
[0033] wherein (a) sulfonamide resistance genes; (b) macrolide resistance genes; (c) quinolone resistance genes; (d) aminoglycoside resistance genes; (e) tetracycline resistance genes; (f) β-lactam resistance genes; (g) transfer factor;
[0034] Bars represent the mean values; error bars represent the standard error (SE);
[0035] Figure 3 Degradation rates of ARGs and MGEs during composting process of the present application;
[0036] wherein (a) ARGs + MGEs; (b) sulfonamide resistance genes; (c) macrolide resistance genes; (d) quinolone resistance genes; (e) aminoglycoside resistance genes; (f) tetracycline resistance genes; (g) β-lactam resistance genes; (h) transfer factor;
[0037] Figure 4 Correlation of ARGs, composting factors and MGEs based on Mantel test of the present application; ARGs for degradation include dfrA1, ermB, mefA, qnrA, qnrB, qnrD, qnrS, aadA, aadE, strA, strB, tetA, tetC, tetM, tetO, tetW, blaCTX-M and blaTEM genes; ARGs for enrichment consist of sul1, sul2, ermF, ermX, qepA, tetG, tetL, tetQ and tetX genes;
[0038] Figure 5ARGs, MGEs were positively correlated with the general bacterial community (a), ARGs, MGEs were positively correlated with the fungal community (b) (p < 0.05), ARGs-enriched bacteria were negatively correlated with the bacterial community (c), ARGs-enriched bacteria were negatively correlated with the fungal community (d) (p < 0.05);
[0039] In subgraphs (a) and (b), the red line represents the relationship between the microbial community and the ARGs-enriched bacteria, the blue line represents the relationship between the microbial community and the ARGs-degrading bacteria, and the green line represents the relationship between the microbial community and the MGEs;
[0040] Figure 6 The relative abundance of 9 potential host bacteria for ARGs-enriched bacteria and 2 key bacterial genera that limit the enrichment of ARGs (a) and the absolute abundance of 9 ARGs-enriched bacteria (b). DETAILED DESCRIPTION
[0041] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor fall within the scope of the present application.
[0042] The present application discloses a method for effectively removing antibiotic resistance genes by hydrogen peroxide aging of biochar,
[0043] The compost materials include: pig manure, rice bran, fresh biochar and peroxide aging biochar. The present application reveals the source and pretreatment program of the raw materials in the recent study, and the detailed features are listed in Table S1.
[0044] Table S1 Physicochemical properties of raw materials
[0045]
[0046] A co-composting experiment was carried out for 60 days in a 100 L plastic barrel reactor, and the raw materials were pig manure and rice bran, with a dry weight ratio of 2:1.
[0047] The present application sets up 3 treatments: composting with the addition of 12% (dry weight) of fresh biochar (FBC) or aged biochar (ABC), and no addition of biochar as a control (NBC);
[0048] Manual turning was carried out on the 5th day, 10th day, 15th day, 21st day, 25th day, 30th day and 40th day.
[0049] The method comprises the following steps:
[0050] Step 1: sample collection
[0051] Sample collection was performed at day 1, 3, 9, 21, 30 and 60, representing the initial stage, the thermophilic stage, the mesophilic stage, the cooling stage, the humification stage and the final product, respectively.
[0052] Three sub-samples were taken randomly at 20 cm depth in the reactor, mixed thoroughly into one mixed sample, and divided into three parts, the first two parts were stored at -80 °C and -20 °C in sterilized bags, respectively, and the last part was air-dried and stored at room temperature.
[0053] Step 2: Biochar properties analysis
[0054] The surface morphology of fresh and aged biochar was analyzed by scanning electron microscopy (SEM, TESCAN MIRA LMS, Czech Republic). In addition, Fourier transform infrared spectroscopy (FTIR) from Thermo Nicolet Is20 (USA) was used to determine the functional groups of biochar, and SSA, PV and pore size (PS) were determined.
[0055] Step 3: ARG and MGE analysis
[0056] Quantitative PCR (qPCR) was used to evaluate 3 MGEs (Tn916 / 1545, int1, int2) and 27 ARGs, including 3 sulphonamides (sul1, sul2, dfrA1), 4 macrolides (ermB, ermF, ermX, mefA), 5 quinolones (qepA, qnrA, qnrB, qnrD, qnrS), 4 aminoglycosides (aadA, aadE, strA, strB), 9 tetracyclines (tetA, tetC, tetG, tetL, tetM, tetO, tetQ, tetW, tetX) and 2 beta-lactams (blaCTX-M, blaTEM). The total DNA of each compost sample was extracted by FastDNA®Spin Kit (MP-Bio, USA). The functional genes were quantified according to the corresponding primer sequences using SmartChip Real-Time PCR (WaferGen Biosystems Inc., USA) (Table S2).
[0057] Table S2 Primer sequences for quantitative PCR
[0058] Gene Forward sequence Reverse sequence dfrA1 GGAATGGCCCTGATATTCCA AGTCTTGCGTCCAACCAACAG sul1 GCCGATGAGATCAGACGTATTG CGCATAGCGCTGGGTTTC sul2 TCATCTGCCAAACTCGTCGTTA GTCAAAGAACGCCGCAATGT mefA TAATTATCGCAGCAGCTGGTTC GTTCCCAAACGGAGTATAAGAGTG ermB TAAAGGGCATTTAACGACGAAACT TTTATACCTCTGTTTGTTAGGGAATTGAA ermF CAGCTTTGGTTGAACATTTACGAA AAATTCCTAAAATCACAACCGACAA ermX GCTCAGTGGTCCCCATGGT ATCCCCCCGTCAACGTTT qepA GGGCATCGCGCTGTTC GCGCATCGGTGAAGCC qnrA AGGATTTCTCACGCCAGGATT CCGCTTTCAATGAAACTGCAA qnrB GCGACGTTCAGTGGTTCAGA GCTGCTCGCCAGTCGAA qnrD CGCTGGAATGGCACTGTGA GCTCTCCATCCAACTTCACTCC qnrS CCACTTTGATGTCGCAGATCTTC CCCTCTCCATATTGGCATAGGAAA aadA GTTGTGCACGACGACATCATT GGCTCGAAGATACCTGCAAGAA aadE TACCTTATTGCCCTTGGAAGAGTTA GGAACTATGTCCCTTTTAATTCTACAATCT strA CCGGTGGCATTTGAGAAAAA GTGGCTCAACCTGCGAAAAG strB GCTCGGTCGTGAGAACAATCT CAATTTCGGTCGCCTGGTAGT tetA CTCACCAGCCTGACCTCGAT CACGTTGTTATAGAAGCCGCATAG tetC ACTGGTAAGGTAAACGCCATTGTC ATGCATAAACCAGCCATTGAGTAAG tetG TCGCGTTCCTGCTTGCC CCGCGAGCGACAAACCA tetL ATGGTTGTAGTTGCGCGCTATAT ATCGCTGGACCGACTCCTT tetM GGAGCGATTACAGAATTAGGAAGC TCCATATGTCCTGGCGTGTC tetO CAACATTAACGGAAAGTTTATTGTATACCA TTGACGCTCCAAATTCATTGTATC tetQ CGCCTCAGAAGTAAGTTCATACACTAAG TCGTTCATGCGGATATTATCAGAAT tetW ATGAACATTCCCACCGTTATCTTT ATATCGGCGGAGAGCTTATCC tetX AAATTTGTTACCGACACGGAAGTT CATAGCTGAAAAAATCCAGGACAGTT blaCTX-M GCGATAACGTGGCGATGAAT GTCGAGACGGAACGTTTCGT blaTEM CGCCGCATACACTATTCTCAG GCTTCATTCAGCTCCGGTTC Tn916 / 1545 TCCTACAGCGACAGCCAGTGA TGCGTTGCTTTGGTCTGCTGGT intl1 GCCTTGATGTTACCCGAGAG GATCGGTCGAATGCGTGT intl2 TGCTTTTCCCACCCTTACC GACGGCTACCCTCTGTTATCTC
[0059] Step 4: Microbial community structure analysis
[0060] Microbial communities were detected by high-throughput sequencing. Specifically, DNA of 0.5 g sample was extracted by DNA kit (Omega Bio-Tek, USA). Then 16S rRNA and ITS gene fragments were amplified by primers 515F-907R, ITS5-1737F and ITS2-2043R. Subsequently, sequencing was performed by relying on Illumina NovaSeq 6000 platform. The raw data of sequencing was uploaded to NCBI (Accession ID: PRJNA1181613).
[0061] Step 5: Data analysis
[0062] Data analysis was performed by R (v 4.3.5) and SPSS (v 20.0) software. Significant differences (p < 0.05) of ARGs and MGEs among 3 treatments were analyzed by one-way ANOVA and least significant difference test. The relationship between compost properties and ARGs was detected by Mantel test and Spearman analysis of R (ggcor package). Network was visualized by Gephi (v 0.10).
[0063] Example 1: Changes in physicochemical properties of aged biochar
[0064] SEM showed that aging significantly increased the surface porosity of biochar Figure 1 a, b);
[0065] As shown in Figure 1 c, the SSA of fresh biochar and aged biochar was 10.88 and 14.02 m 2 ·g -1 , respectively; PV was 0.005 and 0.029 cm 3 ·g -1 , respectively; PS was 2.00 nm and 8.32 nm, respectively.
[0066] FTIR spectra showed that the peak intensity of C=O / C=C, C-O and Si-O functional groups in biochar increased Figure 1 d) after aging.
[0067] These findings indicated that oxidative aging further enhanced the porosity, SSA and OFG abundance of biochar; in addition, these modifications in biochar helped to improve the efficiency of ARGs removal, which will be discussed in the subsequent section.
[0068] Example 2: Kinetic changes of ARGs and MGEs
[0069] The absolute abundance changes of 27 ARGs and 3 MGEs are shown in Figure 2 .
[0070] At day 60, 18 ARGs were significantly reduced compared to day 1, including 1 sulfonamide (dfrAl, Figure 2 a), 2 macrolides (ermB and mefA, Figure 2 b), 4 quinolones (qnrA, qnrB, qnrD and qnrS, Figure 2 c), 4 aminoglycosides (aadA, aadE, strA and strB, Figure 2 d), 5 tetracyclines (tetA, tetC, tetM, tetO and tetW, Figure 2 e), and 2 beta-lactams (blaCTX-M and blaTEM, Figure 2 f).
[0071] In addition, 3 MGEs showed a decreasing trend during composting process Figure 2 g).
[0072] These results indicated that these ARGs and MGEs could be degraded by aerobic composting.
[0073] In contrast, 9 ARGs, including 2 sulfonamides (sul 1 and sul2, Figure 2 a), 2 macrolides (ermF and ermX, Figure 2 b), 1 quinolone (qepA, Figure 2 c), and 4 tetracyclines (tetG, tetL, tetQ and tetX, Figure 2 e), showed an enrichment pattern during composting, indicating that aerobic composting had limited effect on the removal of some ARGs;
[0074] The removal efficiency of ARGs in composting was closely related to the high temperature, which could destroy the structure of antibiotics, limit the activity of host microbial community, and further degrade ARGs and MGEs.
[0075] Therefore, as most of the degrading ARGs demonstrated, the warming and high temperature phases were the key periods for the removal of ARGs in the composting process Figure 2 ).
[0076] In addition, MGEs intl2 and Tn916 / 1545 were significantly reduced after the high temperature phase Figure 2 g), which partially supported the mechanism that high temperature eliminated ARGs by removing MGEs.
[0077] However, some ARGs showed stubborn heat resistance, which hindered their decomposition in the high temperature phase. With the decrease of temperature in the cooling phase, the abundance of these ARGs increased due to the proliferation of their host microorganisms.
[0078] In addition, the hosts of some ARGs include both thermophilic and mesophilic microorganisms. High temperature has little effect on the removal of ARGs coexisting with thermophilic microorganisms.
[0079] Therefore, this study found that the abundance of 9 ARGs showed enrichment trends during composting.
[0080] In addition, after 60 days of composting, the absolute abundance of 27 ARGs and 3 MGEs in NBC was significantly higher than that in FBC and ABC, among which the absolute abundance of ABC was the lowest ( Figure 2 ).
[0081] In particular, compared with day 1, the abundance of ermF, sul1 and sul2 genes in ABC and sul2 gene in FBC on day 60 were lower, while the abundance of these genes in NBC increased with the maturity of composting ( Figure 2 a, b).
[0082] In addition, the degradation rates of 27 ARGs and 3 MGEs changed as shown in Figure 3 .
[0083] After 60 days of composting treatment, the total degradation rate of all ARGs and MGEs in NBC was only 15.6%, while the degradation rates of FBC and ABC treatments reached 55.7% and 68.52%, respectively ( Figure 3 a).
[0084] Unfortunately, in NBC treatment, the degradation rates of sulfonamide, macrolide and tetracycline antibiotic resistance genes were negative ( Figure 3 b, c, f), but with the replacement of fresh or aged biochar, these degradation rates became positive.
[0085] In addition, among the 3 treatments, ABC had the highest total degradation rate of all ARGs and MGEs, while NBC had the lowest degradation rate ( Figure 3 ).
[0086] Compared with NBC, the abundance and degradation rate of all ARGs in the other two treatments were significantly reduced, indicating that biochar effectively reduced ARGs during composting. The removal efficiency of ARGs during biochar-mediated composting was closely related to the porous structure, large SSA and multiple organic functional groups of biochar, which made biochar have significant ability to absorb and degrade antibiotics and extracellular genetic material.
[0087] Therefore, during biochar-modified composting, the production and spread of ARGs were limited due to the reduction of antibiotic selection pressure and the reduction of MGEs-mediated HGT, and the abundance of MGEs in ABC and FBC was lower compared with NBC ( Figure 2 ).
[0088] In addition, the application of biochar to reduce ARGs is also closely related to the changes in microbial communities, which will be discussed later.
[0089] In addition, almost all ARGs, especially the 9 enriched ARGs, showed a decreasing trend at the end of composting in ABC compared to FBC ( Figure 2 ).
[0090] In addition, the degradability of all ARGs in ABC was higher than that in FBC ( Figure 3 ).
[0091] These findings support our hypothesis and indicate that the application of aged biochar during composting has a more significant effect on the elimination of ARGs. The PV, SSA, and OFGs of aged biochar are amplified, such as Figure 1 .
[0092] Changes in these properties positively affect the adsorption capacity of biochar, thereby improving the efficiency of ARG removal.
[0093] In addition, the increase in OFGs in biochar after aging, such as Figure 1 d, provides a stronger ability to degrade MGEs, thereby limiting the spread of ARGs. The mechanism is that OFGs are involved in the generation of ROS, leading to an increase in surface free radical oxygen (ROS), including ⋅OH, ⋅O, and ⋅O2.
[0094] Therefore, due to the important role of ROS in biochar in destroying extracellular genetic material, extracellular MGEs are reduced.
[0095] Example 3: Factors affecting ARGs
[0096] Mantel test showed that 12 ARGs were significantly related to compost properties and MGEs, including blaCTX-M, blaTEM, aadA, strA, strB, dfrA1, qnrA, qnrB, qnrS, tetA, tetC, and tetM genes ( Figure 4 a).
[0097] In addition, 18 degradation ARGs such as dfrA1, ermB, mefA, qnrA, qnrB, qnrD, qnrS, aadA, aadE, strA, strB, tetA, tetC, tetM, tetO, tetW, blaCTX-M, and blaTEM were significantly related to temperature, seed germination index (GI), and 3 MGEs ( Figure 4 b).
[0098] In contrast, 9 ARGs, including sul1, sul2, ermF, ermX, qepA, tetG, tetL, tetQ and tetX genes, were not significantly related to Tn916 / 1545 and int2 Figure 4 b}.
[0099] Composting characteristics and MGEs played a key role in modulating the abundance of 12 ARGs, including blaCTX-M, blaTEM, aadA, strA, strB, dfrA1, qnrA, qnrB, qnrS, tetA, tetC and tetM Figure 4 a}.
[0100] Notably, all of these ARGs belong to degradable ARGs Figure 2 , indicating that the degradation rate of ARGs during aerobic composting depends on composting characteristics and MGEs.
[0101] In addition, temperature was significantly correlated with degradable ARGs Figure 4 b}, indicating that temperature is a decisive factor in mediating ARGs removal during composting.
[0102] Furthermore, MGEs were not significantly related to 9 enriched ARGs Figure 4 a}, and enriched ARGs were also not significantly related to Tn916 / 1545, int2 Figure 4 b}, suggesting that the changes in MGEs have little effect on the 9 enriched ARGs.
[0103] These results suggest that these ARGs may not be primarily spread by HGT, which can explain their persistence during composting.
[0104] In addition, network analysis was performed on the positive correlations between ARGs, MGEs, the top 50 bacterial and fungal genera to determine co-occurrence associations. The bacterial network consisted of 72 nodes, including 25 ARGs, 3 MGEs and 44 bacterial genera, and 301 positive edges Figure 5 a}.
[0105] Notably, 23 ARGs and 3 MGEs, except for aadA, mefA, qnrA and qnrD, were positively correlated with multiple bacterial genera. In addition, the fungal network consisted of 68 nodes, including 25 ARGs, 3 MGEs and 40 fungal genera, with a total of 404 positive edges Figure 5 b}.
[0106] .Except for ermF, ermX, mefA and sul1, the rest 23 ARGs and 3 MGEs were positively correlated with multiple fungal genera. In addition, almost all degrading ARGs were positively correlated with at least one microbial genus that was positively correlated with MGEs, while the 9 enriched ARGs-positive bacterial genera had no significant correlation with MGEs.
[0107] In this study, co-occurrence network analysis showed that, except for mefA, the other 26 ARGs and 3 MGEs were positively correlated with at least two genera of microorganisms ( Figure 5 ).
[0108] This result indicated that most ARGs had multiple potential hosts, including bacteria and fungi.
[0109] In addition, almost all degrading ARGs had at least one common potential host with MGEs, which suggested that these ARGs were spread by MGEs-mediated HGT.
[0110] Therefore, the reduction of MGEs during composting might be a key mechanism for the removal of these ARGs.
[0111] On the contrary, the 9 enriched ARGs had no common potential bacterial hosts with MGEs, which suggested that the enriched ARGs were mainly spread by VGT, and their enrichment should be related to the increase in the number of potential hosts in the whole composting process.
[0112] The relative abundance of the bacterial genera associated with the 9 enriched ARGs showed an increasing trend during composting ( Figure 6 a), and showed similar temporal trends with the 9 enriched ARGs ( Figure 6 b), which partly supported this conclusion.
[0113] In addition, the abundance of these bacterial genera in ABC was lower than that in FBC and NBC on the last day of composting ( Figure 6 a), which suggested that the mechanism for the relatively low abundance of the 9 enriched ARGs in ABC was the decrease in their host bacteria.
[0114] In addition, the negative correlation between the 9 enriched ARGs and the top 50 bacterial and fungal genera was also explored by network analysis. The bacterial network consisted of 35 nodes and 74 edges ( Figure 5 c), and the fungal network consisted of 39 nodes and 48 edges ( Figure 5 d).
[0115] Notably, among all microbial nodes, the highest number of edges was observed for the genera Thermus and Clostridium, with 7 and 6 edges, respectively. This restriction might be related to the niche competition between these microorganisms and the 9 potential host microorganisms that enriched ARGs. The abundance of Thermus and Clostridium showed an inverse trend over time and with the treatment of potential host microorganisms (Fig. 4a), partially supporting this argument. Figure 6
[0116] In addition, the abundance of Thermus and Clostridium was significantly higher in ABC than in NBC and FBC at day 60 (Fig. 4a), which might be the reason for the lower abundance of the 9 potential host microorganisms that enriched ARGs. Therefore, the inoculation of Thermus and Clostridium might be an effective strategy for the removal of ARGs during composting. However, this hypothesis needs to be verified in future studies. Figure 6
[0117] Conclusion:
[0118] The removal of ARGs is crucial for the recycling of agricultural waste. In this study, we found that aerobic composting led to a decrease in the absolute abundance of 18 ARGs, while 9 ARGs showed an enrichment trend during composting. More importantly, the application of fresh or aged biochar promoted the elimination of ARGs during composting, including the 9 enriched ARGs. In addition, aged biochar had a better ability to remove ARGs than fresh biochar. The mechanism is that aging enhances the SSA, PV, PS, and OFGs in biochar, enhancing its ability to absorb and degrade MGEs, thereby reducing the abundance of 18 degrading ARGs. In addition, the addition of aged biochar led to an increase in Thermus and Clostridium, which might limit the abundance of potential host microorganisms, thereby promoting the removal of the 9 enriched ARGs. In summary, this study found the extraordinary ability of aged biochar to remove ARGs during composting, which might provide a new perspective for the development of waste recycling strategies.
[0119] The above merely describes preferred embodiments of the present application and should not be taken in a limiting sense but is made with reference to the following claims to which changes in form and details can be made. Thus, the scope of the application is defined only by the following claims.
Claims
1. A method for the effective removal of antibiotic resistance genes by hydrogen peroxide aged biochar, characterized by, The method comprises the following steps: Step 1: Fresh biochar preparation Rice husk is pyrolyzed under anaerobic condition at high temperature to prepare fresh biochar; Step 2: Preparation of aged biochar The fresh biochar is oxidized by H2O2 solution to prepare aged biochar; Step 3: Composting process Solid pig manure obtained after solid-liquid separation in a large-scale pig farm is mixed with rice bran as filler, and then the aged biochar is added and mixed thoroughly, and the moisture is adjusted for aerobic composting fermentation; The compost is turned over on the 5th, 10th, 15th, 21st, 25th and 30th day, and the high-temperature composting is completed on the 30th day; after turning over, the compost enters the aging and maturation stage, and is turned over once on the 40th day, and then is kept static until the 60th day, that is, the composting is completed, and the organic fertilizer product is prepared; After screening and impurity removal, the product is packaged and stored.
2. The method of claim 1, wherein the hydrogen peroxide aged biochar is effective in removing antibiotic resistance genes, characterized in that, In the step 1, the fresh biochar is prepared by pyrolyzing the rice husk under anaerobic condition at high temperature for more than 4 hours at 600 DEG C.
3. The method of claim 1, wherein the hydrogen peroxide aged biochar is effective in removing antibiotic resistance genes. The step 2 is carried out under constant temperature condition at 80 DEG C, and the H2O2 solution has a mass fraction of 30%, and the oxidation is carried out for 6-7 hours at a mass-volume ratio of 1:
10.
4. The method of claim 1, wherein the hydrogen peroxide aged biochar is effective in removing antibiotic resistance genes. In the step 3, the solid pig manure and the filler are mixed at a dry matter weight ratio of 2:1, and then the aged biochar is added at a dry weight of 12% and mixed thoroughly.
5. The method of claim 1, wherein the hydrogen peroxide aged biochar is effective in removing antibiotic resistance genes. In the step 3, the moisture is adjusted to 55%-65% for aerobic composting fermentation. In the step 3, the moisture is adjusted to 55%-65% for aerobic composting fermentation.
Citation Information
Patent Citations
Reinforced removal method for antibiotic resistance genes in aerobic compost
CN114315441A
Method for intensively removing antibiotic resistance genes in aerobic compost
CN115073230A