Saccharomyces caribbicans and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a strain of Caribik Meyer yeast and application thereof. The strain is isolated from natural plant enzymes. In an in-vitro test, the strain has relatively high TG (Triglyceride) degradation capacity and T-CHO (T-CHO) degradation capacity; in an in-vivo test, the enzyme prepared by fermenting a seed solution of the strain can effectively reduce the weight, fat coefficient and blood fat level of obese mice and relieve pathological changes of fatty liver, has no obvious toxic or side effect, and can be used as a candidate for replacing weight-reducing medicines, so that the enzyme has good practical application value.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology, and particularly relates to a strain of Meyerozyma caribbica and application thereof. BACKGROUND

[0002] The information disclosed in this Background section is only for the purpose of increasing the understanding of the general background of the application and does not necessarily constitute an admission or a recognition that the information forms part of the prior art that is already known in any country in the world.

[0003] Obesity is a nutritional metabolic disorder caused by multiple factors. When the energy contained in the food intake is more than the energy consumed by the body metabolism, fat will accumulate and gradually become the material basis of obesity. Due to high-energy and high-fat dietary habits and the convenience of transportation leading to reduced physical activity, the incidence of obesity is increasing year by year and has become a worldwide health problem, more prominent in economically developed countries in the Americas and Europe. Obesity not only affects appearance and action, but also increases the risk of diseases such as type II diabetes, hyperlipidemia, new coronavirus-induced lung infection, sleep disorders, coronary heart disease, hypertension and non-alcoholic fatty liver disease, and causes physical damage to various tissues and organs.

[0004] Lifestyle changes, energy intake restriction and increased physical exercise are ideal means to combat the development of obesity, but the weight loss range is limited, and it is difficult to persist for a long time, and it is easy to have weight rebound. Weight loss drugs are the main means of treating obesity, among which GLP-1 receptor agonists (GLP-1RA) are the dominant weight loss drugs on the market, including semaglutide, liraglutide and tirzepatide, etc., which mainly lower blood sugar by promoting insulin secretion, inhibit appetite, delay gastric emptying, regulate lipid and energy metabolism, and can be used for the treatment of obesity and type II diabetes. Although GLP-1RA effectively reduces the body weight of obese patients, long-term use will produce certain side effects, including abdominal pain, nausea, vomiting, gastroesophageal reflux disease, gastritis, acute pancreatitis, hypotension, syncope, arthritis, arthralgia, interstitial nephritis and kidney stones, etc. In addition, GLP-1RA drugs are expensive, and more than 50% of patients choose to stop taking them within a year. Studies have found that obese people have severe weight rebound after stopping the use of GLP-1RA, and even return to the weight level before weight loss. Therefore, how to develop safe and effective weight loss drug substitutes has become a problem to be solved. SUMMARY

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a strain of *Callibac Mayerii* and its applications. This strain is isolated from natural plant enzymes and has high safety. Furthermore, experimental verification has shown that it has weight-loss and lipid-lowering effects, thus making it suitable for use as a medicine or health food. Based on the above research results, this invention is thus completed.

[0006] To achieve the above-mentioned technical objectives, the present invention provides the following technical solution: The first aspect of the invention provides a strain of *Callibik Mayerii* (…). Meyerozyma caribbica The strain JSY004 was deposited on August 11, 2025, at the China General Microbiological Culture Collection Center (address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, China), with accession number CGMCC No. 35578.

[0007] A second aspect of the present invention provides a microbial inoculant containing the aforementioned *Callibik Mayerii* yeast. Meyerozyma caribbica JSY004 or its culture.

[0008] In this invention, the Calibick Mayer's yeast JSY004 culture is a substance obtained by culturing Calibick Mayer's yeast JSY004 in a culture medium (all substances in the culture container).

[0009] A third aspect of the present invention provides the above-mentioned *Calibic Mayerii* yeast ( Meyerozyma caribbica The application of JSY004 or the above-mentioned microbial agents in any one or more of the following: (a1) Degradation of TG and / or T-CHO; (a2) Weight loss and lipid reduction and / or preparation of weight loss and lipid reduction products.

[0010] The product may be a pharmaceutical or a food product. The food product may be a health food product.

[0011] In one specific embodiment of the present invention, the product is an enzyme.

[0012] Therefore, in a fourth aspect of the present invention, an enzyme for weight loss and lipid reduction is provided, wherein the enzyme is prepared by inoculating the Calibick Mayer's yeast JSY004 or a microbial agent into fruits or vegetables and then subjecting them to anaerobic fermentation.

[0013] In this invention, the weight loss and lipid reduction specifically manifests as any one or more of the following: (b1) Reduce the weight of obese individuals; (b2) Reduce food intake in obese individuals; (b3) Increase serum leptin levels; (b4) Lowering blood lipid levels; (b5) Reduce the proportion or coefficient of fat; (b6) Improves the pathological changes of fatty liver.

[0014] In a fifth aspect, the present invention provides the above-mentioned *Calibic Mayerii* yeast ( Meyerozyma caribbica )JSY004, The application of the above-mentioned microbial agents and / or enzymes in the preparation of products for the prevention and / or treatment of obesity, hyperlipidemia and their complications.

[0015] The aforementioned products may be food or medicine, preferably food, and further, the food may be health food.

[0016] A sixth aspect of the present invention provides a method for weight loss and lipid reduction, the method comprising: administering the above-mentioned *Libycium erythrorhizon* yeast (…) to a subject. Meyerozyma caribbica )JSY004, the above-mentioned microbial agents and / or enzymes.

[0017] The beneficial technical effects of one or more of the above technical solutions are as follows: The above technical solution reports for the first time a strain of *Callibik Mayerii*, and experiments have confirmed that the *Callibik Mayerii* strain (… Meyerozyma caribbica JSY004 exhibits high degradation capabilities for TG and T-CHO in in vitro experiments. Furthermore, the enzyme prepared from the seed culture of this strain shows a significant decrease in crude polysaccharide content and a significant increase in total acid and polyphenol content. It significantly reduces the body weight and food intake of obese mice, decreases blood lipids and lipid coefficient, increases serum leptin levels, and alleviates pathological changes in fatty liver, demonstrating significant weight loss and lipid-lowering effects. Simultaneously, the enzyme has no significant effect on the liver, spleen, and kidney coefficients or liver and kidney function indicators in mice, indicating relatively safe use. The above technical solutions provide technical support for the development of natural alternatives to weight-loss drugs, thus possessing good practical application value. Attached Figure Description

[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the following description of the embodiments will be briefly introduced. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] Figure 1 The colony morphology (A) and microscopic examination (B) of the *Calibic Mayer's yeast* JSY004 of this invention are shown.

[0020] Figure 2 This is the phylogenetic tree of the *Calibic Mayer's yeast* JSY004 of this invention.

[0021] Figure 3 The effects of fruit enzyme prepared using *Saccharomyces cerevisiae* JSY004 of this invention on weight gain and average daily feed intake in mice were investigated. (A) Average daily weight gain in the first 4 weeks, (B) Average daily weight gain in the last 4 weeks, (C) Total average daily weight gain (n = 6–7), (D) Average daily feed intake per week (n = 8). * indicates a significant difference compared to the high-fat diet (HFD) group. P<0.05 ).

[0022] Figure 4 This invention relates to the effects of the enzyme on fat and visceral coefficients in mice. (A) Epididymal fat coefficient, (B) Perirenal fat coefficient, (C) Total fat coefficient, (D) Spleen coefficient, (E) Liver coefficient, (F) Kidney coefficient; * indicates a significant difference from the HFD group. P <0.05 ).

[0023] Figure 5 This invention relates to the improvement effect of the enzyme on HFD-induced fatty liver in mice.

[0024] Figure 6 This invention relates to the effects of an enzyme on serum biochemical parameters in mice. (A)-(I) Serum ALT(A), AST(B), CRE(C), TG(D), T-CHO(E), GLU(F), HDL-C(G), LDL-C(H), LEP(I); * indicates significant difference from the HFD group ( P< 0.05 ); # indicates a significant difference from the ND group ( P<0.05 ). Detailed Implementation

[0025] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0026] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0027] The application will be further described in connection with the following examples. The application will be further described in the following manner by way of examples, but the application is not limited in the scope of the examples. Based on the examples in the application, any change of the application by those skilled in the art without making a creative premise belongs to the protection scope of the application. Meanwhile, in the examples of the application, if no special description, all the raw materials for preparation are the commercially available products well known to those skilled in the art.

[0028] In one typical embodiment of the application, a strain of Meyerozyma caribbica (Meyerozyma caribbica) JSY004 is provided, which has been preserved in the China General Microbiological Culture Collection Center (address: No. 1, Beichen West Road, No. 3, Chaoyang District, Beijing, China) on August 11, 2025, and the preservation number is CGMCC No. 35578. Meyerozyma caribbica

[0029] In another embodiment of the application, a microbial inoculant is provided, which contains the Meyerozyma caribbica (Meyerozyma caribbica) JSY004 or its culture. Meyerozyma caribbica

[0030] In the application, the culture of the Meyerozyma caribbica JSY004 is a substance obtained by culturing the Meyerozyma caribbica JSY004 in a culture medium (all substances in the culture container).

[0031] In the above culture, the substance includes the Meyerozyma caribbica JSY004 (the microorganism itself) and the metabolites of the Meyerozyma caribbica JSY004.

[0032] In the application, the term "culture" refers to a general term for a liquid or solid culture medium that has grown a microbial population after being artificially inoculated and cultured. That is, the product obtained by growing and / or amplifying microorganisms, which can be a biologically pure culture of microorganisms, or can contain a certain amount of culture medium, metabolites or other components produced during the culture process. The term "culture" also includes a subculture obtained by subculturing microorganisms, which can be a culture of a certain generation or a mixture of several generations.

[0033] ​​In this invention, the term "metabolite" refers to primary and / or secondary metabolites produced during microbial metabolism. Primary metabolism refers to the process by which microorganisms absorb various nutrients from the external environment and generate substances and energy to sustain life activities through catabolism and anabolism. The products of primary metabolism are called primary metabolites, such as monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, and lipids. Secondary metabolism refers to the process by which microorganisms, during a certain growth stage, use primary metabolites as precursors to synthesize substances that have no clear function for their life activities. The products of secondary metabolism are called secondary metabolites, and most are compounds with relatively complex molecular structures.

[0034] In this invention, the metabolites can be obtained from the culture of *Calibic Mayerii* JSY004. The metabolites can be sterile metabolites of *Calibic Mayerii* JSY004 or bacterial metabolites of *Calibic Mayerii* JSY004. The sterile metabolites of *Calibic Mayerii* JSY004 can be prepared by culturing *Calibic Mayerii* JSY004 in a liquid culture medium, and filtering to remove *Calibic Mayerii* JSY004 from the liquid culture (fermentation broth) to obtain the sterile metabolites of *Calibic Mayerii* JSY004 (such as fermentation supernatant). The bacterial metabolites of *Calibic Mayer's yeast* JSY004 can be prepared by the following method: *Calibic Mayer's yeast* JSY004 is cultured in a liquid fermentation medium, and the fermentation broth is collected. This fermentation broth is the bacterial metabolites of *Calibic Mayer's yeast* JSY004.

[0035] In this invention, the liquid culture medium used for fermentation culture comprises: 5-10 g / L potato extract powder, 3-5 g / L yeast extract powder, 20-25 g / L glucose, 1-2 g / L dipotassium hydrogen phosphate, pH adjusted to 6.0 ± 0.2, and autoclaved at 121 °C for 15 min.

[0036] In another specific embodiment of the present invention, the microbial agent may further include excipients acceptable to the microbial agent, which are not specifically limited here.

[0037] In another specific embodiment of the present invention, the above-mentioned *Calibic Mayerii* yeast is provided. Meyerozyma caribbica The application of JSY004 or the above-mentioned microbial agents in any one or more of the following: (a1) Degradation of TG and / or T-CHO; (a2) Weight loss and lipid reduction and / or preparation of weight loss and lipid reduction products.

[0038] The product can be a medicine or a food. The food can be a health food.

[0039] In one embodiment of the present application, the product is a ferment.

[0040] Therefore, in another embodiment of the present application, a ferment for reducing weight and lowering lipid is provided, which is prepared by inoculating the Meyerozyma caribbica strain JSY004 or a microbial inoculum into fruits or vegetables, and then performing anaerobic fermentation.

[0041] In the present application, the inoculation amount of the Meyerozyma caribbica strain JSY004 is controlled to be 1×10 7 ~ 1×10 8 CFU·mL -1 The fermentation time can be controlled to be 60 days or more, which is not specifically limited herein.

[0042] The fruits and vegetables are not specifically limited, and in one embodiment of the present application, the fruits and vegetables include, but are not limited to, lemon, blueberry, konjac, strawberry, mulberry, grape, red berry, banana and apple.

[0043] In the present application, the preparation method of the ferment further includes the steps of filtering and centrifuging after anaerobic fermentation.

[0044] The ferment is proved by experiments to be safe and non-toxic, the content of crude polysaccharide is lower than the standard of plant ferment, the content of total acid and polyphenol is higher than the standard of plant ferment, and the ferment has no obvious damage to internal organs such as liver, spleen and kidney, and has no effect on liver function and kidney function, and has good effects of reducing weight and lowering lipid.

[0045] In the present application, the effects of reducing weight and lowering lipid are any one or more of the following: (b1) reducing the weight of an obese individual; (b2) reducing the food intake of an obese individual; (b3) increasing the leptin level in serum; (b4) reducing the blood lipid level; (b5) reducing the fat proportion or coefficient; (b6) improving the pathological changes of fatty liver.

[0046] In another embodiment of the present application, the use of the above-mentioned Meyerozyma caribbica strain (Meyerozyma caribbica) JSY004, the above-mentioned microbial inoculum and / or the ferment in the preparation of a product for preventing and / or treating obesity, hyperlipidemia and complications thereof is provided. Meyerozyma caribbica In another embodiment of the present application, the use of the above-mentioned Meyerozyma caribbica strain (Meyerozyma caribbica) JSY004, the above-mentioned microbial inoculum and / or the ferment in the preparation of a product for preventing and / or treating obesity, hyperlipidemia and complications thereof is provided.

[0047] The product can be a food or a medicine, preferably a food, and the food can be a health food.

[0048] When the product is a food, the food can further comprise a food additive.

[0049] The food additive can be selected from any one or more of acidity regulators, anti-caking agents, antifoaming agents, antioxidants, bleaching agents, bulking agents, coloring agents, color fixatives, enzyme preparations, flavor enhancers, nutrient supplements, preservatives, sweeteners, thickening agents, and flavorings.

[0050] The food can be a solid food or a liquid food, such as a drink, a tablet, a chewable tablet, a solid beverage, and the like, without being limited thereto.

[0051] When the product is a medicine, the medicine can further comprise a pharmaceutically acceptable excipient.

[0052] Further, the pharmaceutically acceptable excipient can be selected from any one or more of buffers, excipients, diluents, preservatives, wetting agents, emulsifiers, lubricants, thickening agents, stabilizers, solubilizers, suspending agents, and suspending aids.

[0053] Preferably, the pharmaceutically acceptable excipient can be selected from glucose, water, sucrose, glycerol, ethanol, propylene glycol, mannitol, corn starch, gelatin, alginic acid, kaolin, dicalcium phosphate, sodium chloride, croscarmellose sodium, and sodium starch glycolate, and the like.

[0054] The dosage form of the medicine can include, but is not limited to, oral dosage, powder, granule, tablet, emulsion, injection, or spray.

[0055] In another embodiment of the present application, a method for reducing weight and lowering lipid is provided, which comprises administering the Leurella mirabilis (Lm) Meyerozyma caribbica ) JSY004, the microbial agent, and / or the enzyme to a subject.

[0056] The present application is further illustrated by the following examples. The present application is further illustrated by the following examples, but the present application is not limited to the examples. Based on the examples, any change of the present application made by those skilled in the art without creativity falls within the protection scope of the present application. Meanwhile, in the examples of the present application, all the raw materials are commercially available and well known to those skilled in the art, unless otherwise specified.

[0057] Example 1: Isolation, purification, and preservation of yeast strains in natural enzyme MRS agar medium and MRS-calcium carbonate agar medium were prepared according to the instructions, sterilized at 121℃ for 20 min, then cooled and poured into sterile culture dishes and allowed to solidify naturally. Natural ferment, including lemon ferment (FLE), blueberry ferment (FBL), konjac ferment (FKO), strawberry ferment (FST), mulberry ferment (FMU), grape ferment (FGR), raspberry ferment (FRA), banana ferment (FBA) and apple ferment (FAP), which were naturally fermented for 1 month, were diluted 10 times with sterile saline and mixed uniformly. The mixed natural ferment was inoculated into MRS agar medium and MRS-calcium carbonate medium using an inoculation loop by streak culture method. After 48 h of incubation at 30℃ in an incubator, colonies without calcium ring (formed by dissolving calcium carbonate after lactic acid bacteria produced acid) were selected, smeared and dyed, and the morphology of the bacteria was observed under a microscope. Four strains of yeast (JSY001-004) were isolated from the natural ferment according to the streak culture and microscopic examination. The colonies with yeast morphology were picked and inoculated into MRS agar medium, and the colonies were scraped after 48 h of incubation at 30℃ and stored in a glycerol tube at -80℃.

[0058] Example 2: Screening of yeast strains with weight loss and lipid-lowering function (1) Test of reproduction speed by growth curve To ensure that the fermentation process is not contaminated by other bacteria, the growth speed of the strains was compared by growth curve to select strains with fast growth speed, so that they can form a dominant position in the early stage of fermentation and prevent the growth of other bacteria. The yeast strains stored in a glycerol tube were inoculated into sterile MRS agar medium using an inoculation loop, and incubated at 30℃ in a biochemical incubator for 48 h. Samples were taken every 6 h, stored at 4℃, and the absorbance of each sample was measured at a wavelength of 600 nm after fermentation, and a growth curve was plotted. The pH of each sample was also measured, and a pH change curve was plotted.

[0059] Table 1: Absorbance of yeast growth curve of JSY001-004

[0060] As can be seen from Table 1, JSY004 maintained a high reproduction speed from 6 h to 48 h of fermentation, and the number of bacteria reached a peak at 30 h. JSY002 reproduced faster after 18 h of fermentation, and the whole process was only slightly slower than JSY004. JSY001 and JSY002 grew slowly and had similar growth curves. Therefore, according to the growth curve data, JSY004 and JSY002 were the dominant strains in the yeast.

[0061] (2) Test of cholesterol and triglyceride removal activity To prepare a ferment with weight loss and lipid-lowering function, dominant strains with high degradation rates of cholesterol and triglycerides were selected.

[0062] The isolated strains were streaked on MRS agar medium, incubated at 37 °C for 24 h, and single colonies that did not form a piece were inoculated in MRS medium and incubated at 37 °C for 24 h. The seed liquid was inoculated into MRS-cholesterol liquid medium at a 5% inoculation amount, and incubated at 37 °C for 24 h. The culture liquid sample was centrifuged at 4000 rpm for 10 min, and the supernatant was detected for the cholesterol content in the fermentation liquid to calculate the cholesterol removal rate. At the same time, the seed liquid was inoculated into MRS-triglyceride medium at a 5% inoculation amount, and incubated at 37 °C for 24 h. The culture liquid sample was centrifuged at 4000 rpm for 10 min, and the supernatant was detected for the triglyceride content in the fermentation liquid to calculate the triglyceride removal rate.

[0063] Based on the growth curve and the test results of cholesterol and triglyceride removal activity, the target strain for preparing a weight loss and lipid reduction enzyme was screened, and the bacterial liquid was sent to Shanghai Sangon Biotech for 16S rDNA sequencing. The sequencing results were subjected to BLAST sequence comparison and homology analysis in the NCBI database for strain identification.

[0064] As shown in Table 2, the degradation rates of yeast JSY002 and JSY004 on TG were relatively high, reaching 63.85% and 62.31%, respectively; the degradation rates of yeast JSY004 and JSY001 on T-CHO were relatively high, reaching 40.70% and 39.65%, respectively.

[0065] Table 2 Degradation rates of fruit enzyme separation strains on TG and T-CHO

[0066] Based on the above data, the yeast JSY004 has good growth curve and TG and T-CHO degradation ability, and can be used as a special strain for enzyme fermentation. The 16S rDNA gene sequencing sequence is as follows: 5'-CTGCGGAAGGATCATTACAGTATTCTTTTGCCAGCGCTTAACTGCGCGGCGAAAAACCTTACACACAGTGTCTTTTTGATACAGAACTCTTGCTTTGGTTTGGCCTAGAGATAGGTTGGGCCAGAGGTTTAACAAAACACAATTTAATTATTTTTATTGATAGTCAAATTTTGAATTAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCCCCGGGTTTGGTATTGAGTGATACTCTTAGTCGAACTAGGCGTTTGCTTGAAAAGTATTGGCATGGGTAGTACTGGATAGTGCTGTCGACCTCTCAATGTATTAGGTTTATCCAACTCGTTGAATGGTGTGGCGGGGTATTTCTGGTATTGTTGGCCCGGCCTTACAACAACCAAACAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAA-3' (SEQ ID NO: 1).

[0067] According to the Genebank alignment and homology analysis in NCBI, combined with the colony morphology, Figure 1 A), microscopic examination after staining, Figure 1 B) and phylogenetic tree analysis, Figure 2 JSY004 is a strain of Meyerozyma caribbica. Meyerozyma caribbica

[0068] Example 3: JSY004 is used as a strain to ferment a weight loss and lipid-lowering enzyme ​According to the literature, the varieties of enzymes with obvious effects on lipid-lowering and blood sugar-lowering and the local easily available fruit varieties, fresh lemon, blueberry, konjac, strawberry, mulberry, grape, red berry, banana and apple were selected as fermentation raw materials. First, 9 kinds of raw materials were washed with purified water, drained, and then irradiated with ultraviolet light for 2 h (to remove the surface bacteria of the raw materials), and the skin and core were removed under sterile conditions, and they were cut into thin slices (about 2 mm thick) using sterile knives. Each fruit and sterile water was loaded into a narrow-mouth glass container at a ratio of 2:5 (mass ratio), and the yeast JSY004 seed liquid was inoculated into the container, so that the final viable bacteria number reached 2×10 7 CFU·mL -1 . Control the temperature of the sterile room, anaerobic fermentation for 60 d, except for proper exhaust for the first 3 d, no air exchange during fermentation. Filtered with 400 mesh filter cloth sterilized at 100 ℃ for 30 min in advance and dried, then centrifuged at 5000 rpm for 10 min, collect the supernatant, then use a peristaltic pump to filter through a sterile filter (pore size 0.22 μm) to collect the filtrate, and store it in a sterile environment. Complete the preparation of 9 kinds of fruit enzymes, and store them in a refrigerator at -20 °C for standby.

[0069] Example 4: Detection of active ingredients in the enzyme according to the standard of "plant enzyme" According to the general physicochemical indicators and characteristic indicators of edible plant enzymes in "Plant Enzyme" (QB / T 5323-2018), the indicators such as pH (according to GB / T 10468), crude polysaccharide (according to SN / T 4260), total acid (according to GB / T 12456) and polyphenol (according to GB / T 31740.2) were detected.

[0070] Table 3 Detection of crude polysaccharide, pH, total acid and polyphenol content in fruit enzyme

[0071] As shown in Table 3, the crude polysaccharide contents of the nine fruit fermentations were all lower than the edible plant fermentation standard (1 mg / mL), among which the crude polysaccharide contents of FBL, FGR and FAP were relatively low, reaching 0.11, 0.16 and 0.12 mg / mL respectively, and the rest were about 0.20 mg / L; the pH was between 3.34 and 3.56, all meeting the edible plant fermentation standard (pH ≦ 4.50), among which FBL, FGR and FAP were as low as 3.34, 3.38 and 3.35 respectively; the total acid contents were all higher than the food fermentation standard (8 mg / mL), among which the total acid contents of FBL, FST and FAP reached 30.53, 25.35 and 28.88 mg / mL respectively; except for FMU and FGR, the polyphenol contents of the other fruit fermentations were all higher than the food fermentation standard (0.5 mg / mL), among which the polyphenol contents of FBL, FST, FRA and FAP reached 1.48, 0.69, 0.63 and 0.77 mg / mL respectively. After fermentation, the crude polysaccharide content of the fruit fermentations was significantly reduced, while the total acid and polyphenol contents were significantly improved, which had potential weight loss and lipid reduction effects.

[0072] Example 5: Weight loss and lipid reduction effects of fermentations prepared by fermentation of JSY004 on obese mice (1) Test method Four-week-old male C57BL / 6J mice were raised at 25 °C and 55% humidity, and a 12 h day-night cycle mode was adopted. After 1 W of adaptive feeding, the mice were randomly divided into a control group (n = 7, fed with LFD) and a high-fat diet group (n = 93, fed with HFD). During the feeding process, mice with low body weight and not suitable for making obesity models were eliminated, and the mouse obesity model group was identified when the average body weight of the HFD feeding group was more than 20% higher than that of the control group.

[0073] On the basis of establishing the mouse obesity model, the mice were grouped and treated as follows: ND group: given LFD and distilled water (9.0 mL / kg·BW / d) by gavage (n = 7); HFD group: given HFD and distilled water (9.0 mL / kg·BW / d) by gavage (n = 7); HFD + fruit fermentation group: fed with HFD, and the mice were given single variety of fermentation (FLE or FBL or FKO or FST or FMU or FGR or FRA or FBA or FAP) by gavage at a dose of 9.0 mL / kg·BW / d.

[0074] During the experiment, mice had free access to food and water. Feed consumption was recorded weekly, and body weight was measured every 4 weeks. After 8 weeks of feeding, mice were fasted for 12 hours, and blood was collected from the retroorbital plexus. Mice were euthanized by inhaling excessive amounts of ether in a fume hood. Serum samples were centrifuged (1500 rpm, 10 min, 4 ℃) and stored at -20 ℃. Liver, spleen, and kidneys were removed, weighed, and stored at -80 ℃. Epididymal fat and perirenal fat were separated from the adipose tissue attached to both testes and visceral fat tissue, weighed, and stored at -80 ℃. Fresh liver was immersed in 10% formalin solution, embedded in paraffin, and sliced. These slices were then stained with hematoxylin and eosin (HE), and the pathological sections were photographed using an electron microscope (Olympus-IX73-DP80, Japan). Blood lipid levels (TC, TG, LDL-C, and HDL-C), blood glucose levels (GLU), and liver and kidney function indicators (ALT, AST, and CRE) were measured using ELISA kits produced by Nanjing Jiancheng Bioengineering Institute. Serum leptin levels were measured using mouse LEP enzyme-linked immunosorbent assay (ELISA) kits.

[0075] (2) Test results like Figure 3 As shown in the data, after gavage treatment with distilled water or nine kinds of fruit enzymes, both the ND group and the HFD group showed significant weight gain in the first four weeks, with the HFD group showing greater weight gain than the ND group. Except for the HFD+FKO group, which showed no significant effect due to large individual differences within the group, all eight enzyme treatment groups showed a significant reduction in weight gain. P<0.05 Among them, the HFD+FAP group, HFD+FBA group, HFD+FGR group, and HFD+FST group showed significant weight loss. In the last 4 weeks, the ND group showed weight loss, while the HFD group continued to gain weight. All nine enzyme treatment groups showed a significant effect in reducing weight gain. P<0.05 Among them, the HFD+FKO group, HFD+FLE group, HFD+FRA group, and HFD+FMU group experienced the largest decreases in body weight. Looking at the overall data over 8 weeks, the body weight of mice in the ND group increased slightly, while the body weight of mice in the HFD group increased significantly. P<0.05 Compared with the weight gain of HFD, the weight gain of the nine enzyme treatment groups was significantly lower. P<0.05 The body weight decreased by 13.5%, 9.75%, 12.58%, 12.23%, 10.55%, 13.01%, 14.11%, 15.70%, and 14.87%, respectively. Based on feed intake data, after gavage treatments with FLE, FBL, FST, FMU, FGR, FBA, and FAP, ADFI decreased by 13.59%, 17.09%, 26.36%, 12.95%, 28.64%, 29.71%, and 22.02%, respectively.

[0076] From Figure 4 (A-C) can be seen, compared with the ND group, HFD group mice epididymal fat coefficient, perirenal fat coefficient and total fat coefficient were significantly increased ( P<0.05 ), and after the enzyme gavage treatment, except for FMU and FRA treatment group, epididymal fat coefficient of 7 enzyme treatment groups were significantly lower than HFD model group ( P<0.05 ), while the perirenal fat of each group had no obvious change. Compared with the HFD group, FAP, FBL, FST, FBA, FGR and FLE treatment group total fat coefficient decreased significantly ( P<0.05 ), while FKO, FMU and FRA treatment group also had a downward trend. From Figure 4 (D-F) data, relative to the ND group, HFD model group spleen and kidney coefficient had no obvious change, while the liver coefficient decreased significantly ( P<0.05 ); compared with the HFD group, after the fruit enzyme treatment, the liver and kidney coefficient of mice had no obvious change; except for FBL and FGR treatment group, the spleen coefficient of mice was slightly higher, other enzyme treatment groups had no obvious change.

[0077] From Figure 5 The mouse liver tissue section can be seen that after 8 weeks of gavage test, the hepatocytes of ND group had no obvious fatty degeneration and fatty liver pathological changes (including fatty ballooning, hepatocyte necrosis and inflammatory cell infiltration, etc.), the liver sinus boundary was obvious, the hepatocyte edge was relatively neat, the cell nucleus and cytoplasm were clear. After feeding HFD to establish mouse obesity model, the liver of HFD group mice appeared severe fatty degeneration and ballooning, the liver sinus became narrow, the edge appeared hepatocyte necrosis, and there were more inflammatory cell infiltrations, which had typical fatty liver pathological changes. After the enzyme gavage treatment, the mouse hepatocytes had different degrees of fatty degeneration, among which the FLE treatment group had more severe degeneration, the degree of fatty degeneration was close to the HFD group, and there were inflammatory cell nuclei enlargement, inflammatory cell infiltration and ballooning; the fatty degeneration of FBA, FMU and FRA treatment groups was significantly reduced, the degeneration foci were significantly reduced, and there were only a small amount of inflammatory cell infiltration; FST and FGR treatment groups had mild steatosis, no obvious ballooning and inflammatory cell infiltration foci, and the liver sinus was close to normal mice; the liver histological morphology of FBL and FAP treatment group mice was similar to that of ND group mice.

[0078] From Figure 6 The results can be seen: (1) Liver and kidney function: compared with the ND group, the ALT level of the HFD group had no obvious change, and on the basis of feeding HFD, FBL gavage treatment could significantly reduce the ALT level ( P<0.05 ), while other enzyme treatment groups had no obvious change. Compared with the ND group, the AST level of the HFD group and each enzyme treatment group decreased significantly (P<0.05 ), and the AST level of the FST treatment group was significantly increased (P < 0.05) relative to the HFD group, but there was no significant change in the other enzyme treatment groups. The CRE level of the HFD group and the nine enzyme treatment groups was significantly lower than that of the ND group, and there was no significant difference between the HFD group and each enzyme treatment group. Overall, feeding fruit enzymes had no significant effect on liver and kidney function indicators in obese mice. P<0.05

[0079] (2) Blood lipid and blood glucose indicators: relative to the HFD group, FLE, FBL, FST and FRA significantly reduced the TG level in serum (P < 0.05), but the effect of the other enzyme treatment groups was not obvious; relative to the ND group, the T-CHO level of the HFD group was significantly increased, and after FMU, FGR, FRA, FBA and FAP treatment, the T-CHO level was significantly reduced (P < 0.05); compared with the HFD group, the HDL-C level of the FKO, FST, FMU, FGR and FBA treatment groups was significantly decreased (P < 0.05), and there was no significant difference compared with the ND group, but FAP, FRA, FBL and FLE had no significant reducing effect; after enzyme treatment, the LDL-C level of each test group did not change significantly; compared with the ND group, the blood glucose of the HFD group was significantly increased (P < 0.05), and there was no significant change in blood glucose after enzyme treatment. Overall, fruit enzymes had a significant effect on reducing blood lipids in obese mice, but had no significant improvement effect on high blood glucose caused by HFD. P<0.05 P<0.05 P<0.05 P<0.05 (3) Leptin level: the leptin level of the HFD group was significantly lower than that of the ND group (P < 0.05), indicating that HFD-induced obesity in mice can significantly reduce the level of leptin in serum, and after FLE, FST, FMU, FRA, FBA and FAP treatment, the leptin level was significantly increased (P < 0.05), combined with the ADFI data (FBL, FST, FGR, FRA, FBA and FAP decreased), indicating that fruit enzymes can inhibit appetite, reduce food intake and inhibit obesity in mice by increasing the secretion of leptin.

[0080] P<0.05 P<0.05

[0081] In summary, the enzyme prepared by JSY004 as a strain, especially FBL, FST, FGR and FAP, has a significant effect on reducing obesity and reducing lipids in obese mice, and has no significant toxic side effects.

[0082] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.​​​​​​​

Claims

1. A strain of *Calibic Mayer's yeast* ( Meyerozyma caribbica The strain JSY004 was deposited on August 11, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 35578.

2. A microbial inoculant, characterized in that, The microbial agent contains the Meyerozyma caribbica (ex Pichia caribbica) Meyerozyma caribbica ) JSY004 or a fermentation product thereof or a culture thereof.

3. The microbial inoculant of claim 2, wherein, The microbial agent also comprises a microbial agent-acceptable adjuvant.

4. The *Calibic Mayer's yeast* as described in claim 1 ( Meyerozyma caribbica The application of JSY004 or the microbial agent according to claim 2 in any one or more of the following: (a1) degrading TG and / or T-CHO; (a2) losing weight and / or preparing a product for losing weight and / or reducing lipid.

5. The use according to claim 4, wherein the compound is ###0002### The product is a pharmaceutical product or a food product; further, the food product is a health-care food product; Further, the product is a ferment.

6. A weight loss and lipid lowering enzyme, characterized in that, The ferment is prepared by inoculating the Meyerozyma caribbica JSY004 of claim 1 or the microbial agent of claim 2 into fruits or vegetables, and then performing anaerobic fermentation.

7. The enzyme of claim 6, wherein The fruits and vegetables include, but are not limited to, lemon, blueberry, konjac, strawberry, mulberry, grape, red berry, banana and apple.

8. The enzyme of claim 6, wherein The weight loss and lipid reduction specifically exhibit any one or more of the following: (b1) reducing the body weight of an obese individual; (b2) reducing the food intake of an obese individual; (b3) increasing the leptin level in serum; (b4) reducing the blood lipid level; (b5) reducing the fat proportion or coefficient; (b6) improving the pathological changes of fatty liver.

9. The use of the microorganism of Kluyveromyces cali- f ornicus (K. cali- f ornicus) JSY004 according to claim 1, the microbial agent according to claim 2 and / or the enzyme according to any one of claims 6 to 8 for the preparation of a product for the prevention and / or treatment of obesity, hyperlipidemia and its complications. Meyerozyma caribbica ) JSY004, the microbial agent according to claim 2 and / or the enzyme according to any one of claims 6 to 8 for the preparation of a product for the prevention and / or treatment of obesity, hyperlipidemia and its complications. Further, the product is a food product or a pharmaceutical product, preferably a food product, and the food product is a health-care food product; When the product is a food product, specifically, the food product further comprises a food additive; The food additive is selected from any one or more of acidity regulators, anti-caking agents, antifoaming agents, antioxidants, bleaching agents, bulking agents, coloring agents, color-protecting agents, enzyme preparations, flavor enhancers, nutrient fortifiers, preservatives, sweeteners, thickening agents and flavorings; The food product is a solid food product or a liquid food product, including but not limited to a drink, a tablet, a chewable tablet and a solid beverage; When the product is a pharmaceutical product, specifically, the pharmaceutical product further comprises a pharmaceutically acceptable adjuvant; Further, the pharmaceutically acceptable adjuvant is selected from any one or more of buffers, excipients, diluents, preservatives, wetting agents, emulsifiers, lubricants, thickening agents, stabilizers, solubilizers, suspending agents and suspending aids; Preferably, the pharmaceutically acceptable adjuvant is selected from glucose, water, sucrose, glycerol, ethanol, propylene glycol, mannitol, corn starch, gelatin, alginic acid, kaolin, dicalcium phosphate, sodium chloride, cross-linked sodium carboxymethylcellulose and sodium starch glycolate; The dosage form of the pharmaceutical product includes oral dosage, powder, granules, tablets, emulsion, injection or spray.

10. A method for reducing weight and lowering lipid, characterized by, The method comprises administering to the subject the Leuconostoc pseudomesenteroides bacteria of claim 1 Meyerozyma caribbica Meyerozyma caribbica ) JSY004, the microbial inoculant of claim 2 and / or the enzyme of any one of claims 6-8.

Images