Yeast for degrading cyanide and application thereof in white spirit production

Abstract

The invention belongs to the field of food fermentation and safety, and discloses saccharomyces cerevisiae capable of degrading cyanide and application of the saccharomyces cerevisiae in white spirit production. The saccharomyces cerevisiae is Saccharomyces cerevisiae Y5, the preservation number of the saccharomyces cerevisiae is CCTCC M 20252360, the saccharomyces cerevisiae is obtained through separation and purification from fermented grains of Hubei Jiang brand Luzhou-flavor liquor, bacterial colonies of the saccharomyces cerevisiae are milky white, smooth and bulged, cells of the saccharomyces cerevisiae are oval and germinate and proliferate, and the saccharomyces cerevisiae can tolerate complex environments such as 8% ethanol and pH 3-7. The strain is cultured in a specific culture medium at 28-32 DEG C and 150-160 r / min for 24-48 h to prepare a microbial inoculum, and the microbial inoculum is mixed with strong-flavor medium-temperature yeast according to a ratio of 10: 100 to be used for 90-day fermentation of 70 kg of grains in a pit. The strain liquid fermentation cyanide degradation rate reaches 778.38 mu g / L.24h, after the strain is applied, the cyanide content of raw liquor is reduced by 41.2%, the total amount of four esters is increased by 6%, the safety and flavor quality of the liquor are synergistically optimized, and a special functional strain is provided for cyanogen reduction and quality improvement of the Luzhou-flavor liquor.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of food fermentation and safety, and specifically provides a cyanide-degradable Saccharomyces cerevisiae and its application in the production of Luzhou-flavor liquor, and also relates to a microbial inoculum containing the yeast and a Luzhou-flavor liquor brewed by the yeast. BACKGROUND

[0002] Cyanide is a kind of highly toxic compound containing cyanide ion (CN - ), which can cause suffocation of human cells by inhibiting the activity of cell respiration enzymes, and seriously threatens life and health. In the brewing process of traditional fermented alcoholic beverages such as liquor, if the raw materials contain cyanogenic glycosides, these substances will be hydrolyzed under the action of microorganisms, and then cyanide will be generated. Therefore, the control of cyanide residue in liquor is an important food safety issue in the industry. According to the provisions of GB 2757-2012 "National Food Safety Standard Distilled Liquor and Blended Liquor", the residual limit of cyanide in liquor calculated as hydrogen cyanide (HCN) shall not exceed 8.0 mg / L, and it is very important to ensure that the cyanide in liquor meets the standards for the health of the nation.

[0003] At present, the core strategy of the liquor industry to control cyanide is focused on the pretreatment of raw materials, which reduces the content of cyanogenic glycosides in raw materials from the source through process optimization, but this method cannot completely avoid the problem of cyanide produced by microbial metabolism during fermentation. Therefore, exploring and applying beneficial microorganisms with cyanide degradation function to reduce cyanide through directional regulation of the fermentation process has become a key research direction to improve the food safety and quality of liquor.

[0004] There are some patents related to cyanide-reducing functional yeast in the prior art. For example, patent CN112175764A discloses a Saccharomyces cerevisiae CCTCC M 2014463 that can reduce cyanide in food fermentation systems, but this patent only verifies by adding cyanide exogenously and using 100 g of bottled sorghum as the substrate, which cannot truly simulate the actual production environment of multi-strain co-fermentation and large-scale grain fermentation in liquor production. The cyanide-reducing effect of this strain in real liquor brewing lacks effective evidence, and the influence of the strain on the basic flavor of liquor has not been evaluated. Another patent CN110484409B provides a Saccharomyces cerevisiae D576 that can reduce the cyanide content in cherry wine. However, fruit wine fermentation is a single-strain, short-cycle fermentation system, which is significantly different from the complex brewing environment of multi-strain co-fermentation and 90-day long-term pit fermentation in Luzhou-flavor liquor. This strain cannot be directly adapted to the production of Luzhou-flavor liquor. In summary, the applicability and effectiveness of existing cyanide-reducing functional strains under actual liquor brewing conditions have obvious limitations, and it is urgent to screen special functional yeast strains that can adapt to the fermentation environment of Luzhou-flavor liquor, stably reduce cyanide for a long time, and do not affect the flavor of the liquor. SUMMARY

[0005] Therefore, the present application provides a Saccharomyces cerevisiae capable of efficiently degrading cyanide and suitable for a Luzhou-flavor liquor fermentation system, and discloses application of the Saccharomyces cerevisiae in liquor production, a related microbial agent and brewed liquor.

[0006] The technical solution of the present application is achieved in the following manner.

[0007] In some embodiments, the Saccharomyces cerevisiae Y5 is preserved in the China Center for Type Culture Collection, with a preservation date of October 28, 2025, a preservation number of CCTCC M 20252360, and a preservation address of China Center for Type Culture Collection, Luguashan, Baoyi Road, Wuchang District, Wuhan, Hubei Province, and is obtained by isolating and purifying from fermented grains of Luzhou-flavor liquor of Hubei Jingpai Co., Ltd.

[0008] In some embodiments, the ITS rDNA sequence of the Saccharomyces cerevisiae Y5 is shown in SEQ ID NO: 1.

[0009] In some embodiments, the colony of the Saccharomyces cerevisiae Y5 is milky white and opaque, the surface of the colony is smooth, wet and raised, and the edge is smooth and neat; after being cultured in YPD liquid medium at 160 r / min for 24 h, the cells are oval and proliferate in a budding manner.

[0010] In some embodiments, the culture method of the Saccharomyces cerevisiae Y5 is as follows: inoculating the strain into a liquid medium, and culturing at 28-32℃ and 150-160 r / min for 24-48 h, wherein the liquid medium comprises 15-25 g of glucose, 15-25 g of proteose peptone, 8-12 g of yeast extract powder, and 1000 ml of water, and has a pH of 5-8.

[0011] In some embodiments, the screening method of the Saccharomyces cerevisiae Y5 comprises the following steps: 1) Gradient dilution and coating of YPD solid medium are performed on samples of Luzhou-flavor mesophilic Daqu or fermented grains to obtain a yeast strain; 2) The purified strain is inoculated into a cyanide screening medium plate for preliminary screening, and a strain with good colony morphology and cyanide tolerance is selected; 3) The preliminary screening strain is inoculated into a liquid medium for re-screening, and the strain with the highest cyanide degradation activity is selected as the target strain Y5.

[0012] In some embodiments, the Saccharomyces cerevisiae Y5 can stably grow in YPD liquid medium containing 8% v / v ethanol, 8% m / v NaCl and 30% m / v glucose, and can stably proliferate in an environment with a pH of 3-7 and a temperature of 25-37℃.

[0013] In some embodiments, the application provides the use of the above-mentioned Saccharomyces cerevisiae Y5 in the production of Baijiu, specifically, the Saccharomyces cerevisiae Y5 is prepared into a liquid microbial inoculum, mixed with strong-flavor medium-temperature Daqu at a volume-to-mass ratio of 10:100 to form a mixed starter, and then mixed with grains to perform pit fermentation, and Baijiu is obtained by distillation.

[0014] In some embodiments, in the above-mentioned use, the mass of grains is 70 kg, the mass of the mixed starter is 20 kg, the grains are cooled to 20-30℃ before being mixed with the mixed starter, and the pit fermentation lasts for 90 days.

[0015] In some embodiments, the application provides a microbial inoculum, which comprises the above-mentioned Saccharomyces cerevisiae Y5 and is a liquid microbial inoculum, and the preparation method comprises activating the Saccharomyces cerevisiae Y5 to prepare a seed liquid, and then expanding the culture to obtain the liquid microbial inoculum.

[0016] In some embodiments, 5% glycerol and 0.2% trehalose are added to the above-mentioned liquid microbial inoculum as active protection agents, and the microbial inoculum is stored under refrigeration at 4℃.

[0017] In some embodiments, the application provides a strong-flavor Baijiu, which is brewed according to the above-mentioned use of the microbial inoculum.

[0018] The application has the following beneficial effects compared with the prior art: The Saccharomyces cerevisiae Y5 provided by the application has significant advantages compared with the cyanide-reducing functional strain in the prior art. As a homologous strain isolated from strong-flavor Baijiu fermentation grains, the strain can better adapt to the complex production environment of strong-flavor Baijiu multi-microbial co-fermentation and long-term pit fermentation, overcoming the limitations that the existing strains cannot withstand the actual Baijiu brewing conditions and are difficult to stably play a role in reducing cyanide. At the same time, on the basis of achieving efficient degradation of cyanide, the strain can also take into account the improvement of wine flavor, which is different from the cyanide-reducing strains in the prior art that do not consider the influence on flavor or easily damage the original flavor of the wine body, achieving the synergistic optimization of Baijiu drinking safety and flavor quality. In addition, the strain can be conveniently prepared into a liquid microbial inoculum and efficiently connected with the existing Baijiu production process, without the need for substantial modification of the production line, providing a safe and reliable new functional strain resource for the strong-flavor Baijiu industry, and effectively filling the application gap of special cyanide-reducing and flavor-improving yeast strains. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or prior art description. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can also be obtained by those skilled in the art without any creative effort based on these drawings.

[0020] Figure 1 The cyanide degradation rate (μg / L·24h) of 5 strains of yeast; Figure 2 Figure 5 is a colony morphology diagram of the Y5 strain; Figure 3 Figure 6 is the growth of the Y5 strain under different ethanol concentrations; Figure 4 Figure 7 is the growth of the Y5 strain under different NaCl concentrations; Figure 5 Figure 8 is the growth of the Y5 strain under different pH values; Figure 6 Figure 9 is the growth of the Y5 strain under different glucose concentrations; Figure 7 Figure 10 is the growth of the Y5 strain under different temperatures. DETAILED DESCRIPTION

[0021] The technical solutions in the embodiments of the present application will be clearly and completely described below in combination with the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0022] The strain provided by the present application was preserved in the China Center for Type Culture Collection (CCTCC) on October 28, 2025, with a preservation number of CCTCC M 20252360 and a preservation address of China Center for Type Culture Collection, Laojia Mountain, Baoyi Road, Wuchang District, Wuhan City, Hubei Province, China, with a postal code of 430072.

[0023] Further, the ITS rDNA sequence of Saccharomyces cerevisiae Y5 is shown in SEQ ID NO: 1.

[0024] SEQ ID NO: 1 ITS rDNA sequence of Saccharomyces cerevisiae Y5 Sequence characteristics: Length: 396 bp Type: nucleic acid Chain type: single strand Topological structure: linear Specific sequence: 5'-CCGGGCCTGCGCTTAAGGGCCCGGCCTTGCTAGGCTTGTAATTTTCTTTCTTGCTATTCCAAACGGGGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACGCACTGGGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCAACCAATCGGGGCCCAAAGGTAACAAACCCAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGGAACTGGAAATTTTAAAAAATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCTTCAAAGAAAAACGCAGCGAAATGCGAAACGTAATGTGAATTGCACAATTCCGCGAATCATCTAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCAGGCCTGTTTGAGCGTCCTTTCCTTCTCAACCATTCGGTTGGGAAGGGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATGGGATGTTTTTTTT-3'.

[0025] Further, the colony morphology and microscopic cell characteristics of the strain are as follows: the colony is milky white, opaque, smooth, wet and raised in surface, and the edge is smooth and neat. The microscopic morphology characteristics in YPD liquid medium shaker at 160r / min for 24h are: the cell is oval, and the budding proliferation occurs.

[0026] Specifically, the culture method of the Saccharomyces cerevisiae Y5 is as follows: the Saccharomyces cerevisiae is inoculated into a liquid culture medium with the components of glucose 15-25 g, peptone 15-25 g, yeast extract powder 8-12 g, water 1000 ml, and pH=5-8, and is cultured at 28-32℃ and 150-160r / min for 24-48 hours.

[0027] The application further provides a use of the Saccharomyces cerevisiae Y5 in degrading cyanide.

[0028] The application further provides a use of the Saccharomyces cerevisiae Y5 in brewing.

[0029] The strain of the application is isolated from the fermented grains of the Jinpia Co., Ltd.

[0030] Example 1: Screening of functional strains for degradation of cyanide 1. Isolation and screening of yeast from medium-temperature Daqu and fermented grains of Hubei Jingpai Co., Ltd. Materials: Medium-temperature Daqu and fermented grains of Hubei Jingpai Co., Ltd.

[0031] YPD medium: glucose 18-22 g; peptone 18-22 g; yeast extract powder 8-12 g; water 1000 ml; pH = 7, if a solid medium is prepared, add agar 18-22 g, bottle, sterilize in a 121℃ sterilization pot for 20 minutes, and cool down for standby.

[0032] Yeast isolation and purification: take 10 g of Luzhou-flavor medium-temperature Daqu or fermented grains sample and add 90 ml of sterilized distilled water, put it in a 160 r / min shaker for 30 min, then gradient dilution, take 200 μL of 10 -3 and 10 -4 Two gradient bacterial suspensions are added to YPD solid medium for coating, and put into a 30℃ incubator for culture observation. Yeast colonies on the plate are observed and selected, and yeast colonies are picked for purification culture for the next step of experimental screening.

[0033] 2. Screening of functional yeast strains for degradation of cyanide Experimental strains: yeast strains isolated from Daqu and fermented grains of Hubei Jingpai Co., Ltd.

[0034] Screening medium: cyanide 5-10 g; glucose 15-25 g; peptone 15-25 g; yeast extract powder 8-12 g; agar 18-22 g; water 1000 ml; pH = 5-8, add 1000 ml water, bottle, sterilize in a 121℃ sterilization pot for 20 minutes, and cool down for standby.

[0035] Experimental methods and results: (1) Preliminary screening of cyanide degradation activity of strains: after activation, the strains isolated from Daqu and fermented grains are inoculated on the screening medium plate and cultured at 30℃. Strains that can grow on the cyanide-containing medium plate and have good colony morphology are picked for standby.

[0036] The plate screening results show that a total of 39 strains can grow well on the medium containing high concentration of cyanide, indicating that they can tolerate cyanide and use cyanide as a nutrient for reproduction and metabolism.

[0037] (2) Strain degradation cyanide activity of re-screening: the initial screening of 39 strains of yeast activated into liquid medium, after 30°C, 160 r / min culture 24 hours, take 0.5ml bacterial suspension into 2.5mg / L cyanide containing sterile water, 30°C culture 48h, after fermentation, centrifugal 5000r / min, 10min, take supernatant, 0.45μm filter membrane, gas chromatography analysis of filtered fermentation supernatant, clear strain degradation cyanide efficiency. Further select the highest rate of cyanide degradation strain for solid state fermentation verification.

[0038] The results show that the rate of 39 strains of yeast degrading cyanide is 326.07-738.38 μg / L·24h, wherein the strains Y5, Y8, Y2, Y4, Y10 have higher cyanide degradation activity, and the Y5 yeast has the highest activity, which is 738.38 μg / L·24h. In order to further clarify the degradation activity of the strains, liquid fermentation test verification was carried out on the 5 strains, and the results are shown in Figure 1 The results show that the rate of 39 strains of yeast degrading cyanide is 326.07-738.38 μg / L·24h, wherein the strains Y5, Y8, Y2, Y4, Y10 have higher cyanide degradation activity, and the Y5 yeast has the highest activity, which is 738.38 μg / L·24h. In order to further clarify the degradation activity of the strains, liquid fermentation test verification was carried out on the 5 strains, and the results are shown in

[0039] 3. Degradation of cyanide functional strain brewing production verification Experimental method and result: (1) Test strain preparation: a) Preparation of pure liquid strain Y5: the preserved number of Saccharomyces cerevisiae Y5 CCTCC M 20252360 was activated into 10ml YPD liquid medium, 30°C, 160 r / min shaking bed for 24h to obtain seed liquid. Take 1ml seed liquid and inoculate in YPD liquid medium, 30°C, 160 r / min shaking bed for 48h to obtain pure Y5 liquid strain, and store in 4°C refrigerator for standby.

[0040] b) Preparation of Saccharomyces cerevisiae Y5 test mixed koji: mix Y5 pure strain agent with Daqu according to the volume quality ratio of 10:100.

[0041] (2) Koji mixing: take 70kg of new grain cooked grain dregs after the previous fermentation, cool to 20-30°C, add 20kg of test mixed koji with Saccharomyces cerevisiae Y5 prepared in step 1, mix thoroughly.

[0042] (3) Pit fermentation: put the thoroughly mixed grain into the underground pit for flavor fermentation, and the whole pit fermentation stage lasts for about 90 days.

[0043] (4) Take liquor: the fermented fermented grains are loaded into the distillation wine retort for heating distillation, 200 ml of the distilled liquor sample is taken, and the cyanide and main flavor chromatographic index parameters in the liquor body are determined by using a full-automatic flow injection analyzer and gas phase detection technology.

[0044] (5) Cyanide detection method: 170 ml of the liquor sample is taken into a 200 ml sample bottle, 20 ml of 20.00 g / L sodium hydroxide is added, and after shaking, it is diluted to 200 ml. 10 ml is taken into a sample bottle for cyanide detection. The full-automatic flow injection analyzer detection conditions are as follows: a, the peristaltic pump speed is 20 r / min; b, the time period: the valve time is 300 s, the injection time is 80 s, the sample period is 220 s, the injection time is 140 s, the cleaning time is 30 s, and the injection needle cleaning time is 10 s; c, the temperature: the heating module 1 temperature is 118 ℃, and the heating module 2 temperature is 85 ℃; d, the front-end collection gain is 100K. The cyanide in the sample is automatically derived and the absorbance value is determined in the full-automatic flow injection analyzer. The standard curve is drawn with the cyanide mass concentration as the abscissa and the absorbance value peak area of the cyanide derivative as the ordinate. The cyanide detection concentration in the sample can be obtained by detecting the absorbance value peak area and bringing it into the standard curve regression equation.

[0045] (6) Original liquor chromatography detection: 1 ml of the original liquor is taken into a 2 ml sample bottle, 10 μL of mixed internal standard (tert-pentanol (IS1): 161.059 mg / L, n-pentyl acetate (IS2): 175.134 mg / L, 2-ethylhexanol (IS3): 162.143 mg / L) is added, and shaken, and the content of each component in the original liquor is determined by gas chromatography. The chromatographic conditions are as follows: Agilent 780A gas chromatograph, detector FID, CPWAX capillary column (50 m x 0.2 μm x 0.25 mm). The temperature rising program is as follows: the column temperature is 40 ℃ for 8 min, and then increased to 150 ℃ at a rate of 5 ℃ / min. The injection port temperature is 250 ℃, the detector temperature is 260 ℃, the air and hydrogen flow rate is 300:30, the carrier gas is nitrogen, the split ratio is 30:1, and the column flow is 1.0 ml / min. The detection results are shown in Table 1 below.

[0046] Table 1 Flavor chromatography data of Luzhou-flavor liquor

[0047] The flavor component detection results of the Luzhou-flavor base liquor show that: compared with the control group, the main acid and main higher alcohol contents in the base liquor of the experimental group with the addition of Y5 liquid inoculant are similar, the contents of the main esters ethyl butyrate, ethyl lactate and ethyl acetate increase, and the total content of the main esters increases by 6%. In terms of cyanide, the cyanide content in the base liquor of the experimental group with the addition of Y5 is 491.1 μg / L, and that in the control group is 834.54 μg / L, and the addition of Y5 can effectively reduce the cyanide in the base liquor by 41.2%. Therefore, it can be seen that the addition of brewing yeast Y5 on the basis of the original koji has obvious advantages in reducing the cyanide in the base liquor, and also has the effect of improving the lipid substances in the liquor body.

[0048] Example 2 Phylogenetic analysis of strain Y5 1. ITS rDNA sequence analysis (1) DNA extraction The bacterial cells were collected, and the yeast genomic DNA was extracted by using a fungal genomic DNA extraction kit, with the specific method referring to the instruction manual thereof.

[0049] (2) Amplification of ITS rDNA fragment of strain Y5 The extracted DNA of strain Y5 was used as a template, and the ITS rDNA fragment was amplified by using the universal primers ITS1 and ITS4 for fungal ITS rDNA. The amplification reaction system was 30 μL, including Premix TaqTM (TaKaRa TaqTM Version 2.0 plus dye) 15 μL, ddH2O 13 μL, primers ITS1 and ITS2 each 0.5 μL, and DNA template 1 μL. The amplification reaction conditions were as follows: 94℃ 5 min; 94℃ 30 s; 52℃ 50 s, 72℃ 30 s, 30 cycles; 72℃ extension for 10 min, and 4℃ storage.

[0050] (3) ITS rDNA sequence analysis The amplified ITS rDNA fragment was sent to Guangzhou Huada Gene for sequencing, and the corresponding ITS rDNA amplification sequence result was obtained (as shown in SEQ ID NO: 1). The Blast retrieval program of the US National Biotechnology Information website was used for comparison to obtain the species information thereof.

[0051] 2. Colony morphology and microscopic cell characteristics of Saccharomyces cerevisiae Y5 The colony morphology of Saccharomyces cerevisiae Y5 on the culture medium plate under the culture condition of 30℃ was observed, and a small amount of bacterial cells was picked up by using an inoculation needle or a sterilized toothpick and placed on a glass slide for microscopic observation under a microscope (10x100). The observation results are as follows: the colony is milky white and opaque, the surface is smooth, wet and raised, the edge is smooth and neat, Figure 2Microscopic cell morphological characteristics are: cells are oval, budding proliferation.

[0052] 3. Saccharomyces cerevisiae Y5 tolerance test The fermentation environment of Baijiu is extremely complex, and the yeast strain is easily affected by stress factors such as high temperature, high sugar, high alcohol, and high osmotic pressure during the process. Therefore, the study of the environmental tolerance (ethanol, salt, acid, glucose, and temperature, etc.) of the selected strain is a basic link for predicting its production application prospect.

[0053] (1) Ethanol tolerance test The ethanol concentration of YPD liquid medium was adjusted to 0%, 2%, 4%, 6%, 8%, 12%, and 16% (v / v) with anhydrous ethanol, and the seed liquid of strain Y5 was inoculated at 1% inoculation amount. After 24 h of culture at 30°C with 160 r / min shaking, the absorbance value was measured at 600 nm wavelength, and the test results are shown in Figure 3 .

[0054] During the process of Baijiu brewing, Saccharomyces cerevisiae can metabolize ethanol, which will inhibit microbial cell metabolism to some extent, affecting yeast growth and reproduction as well as flavor synthesis metabolism. From Figure 3 it can be seen that with the increase of ethanol content, the growth of Y5 strain is inhibited, and the growth of Y5 cells is good under 8% ethanol content. With the increase of ethanol content, the biomass of the strain decreases significantly. It can be seen that Saccharomyces cerevisiae Y5 strain can tolerate higher ethanol environment and can be applied as a functional strain in Baijiu fermentation process.

[0055] (2) High salt tolerance test The salt content of YPD liquid medium was adjusted to 0%, 2%, 4%, 6%, 8%, 11%, and 14% (m / v) with NaCl, and the seed liquid of Y5 strain was inoculated at 1% inoculation amount. After 24 h of culture at 30°C with 160 r / min shaking, the absorbance value was measured at 600 nm wavelength, and the test results are shown in Figure 4 . From Figure 4 it can be seen that with the increase of NaCl content, the biomass of Y5 decreases. Y5 can tolerate up to 8% salt content, and when the NaCl content reaches 11% and above, there is almost no strain growth in the liquid medium.

[0056] (3) Acid tolerance test The pH of YPD liquid medium was adjusted to 2, 3, 4, 5, and 6 with 0.1 mol / L HCl and 0.1 mol / L NaOH, and the seed liquid of Y5 strain was inoculated at 1% inoculation amount. After 24 h of culture at 30°C with 160 r / min shaking, the test results are shown in Figure 5During the fermentation process of strong-aroma baijiu, acid-producing bacteria continuously produce acid, causing an increase in the acidity of the fermented mash and a decrease in pH. Therefore, the ability of these bacteria to tolerate acidic environments plays a crucial role in their functional performance during baijiu brewing. Figure 5 As shown, strain Y5 has a high biomass under pH conditions of 3-7 and can maintain good growth activity, indicating that strain Y5 can adapt to the acidic environment of the fermentation process of strong-aroma baijiu.

[0057] (4) High sugar tolerance test Glucose was added to YPD liquid medium to achieve sugar concentrations of 5%, 10%, 15%, 20%, 25%, and 30% (m / v). Y5 strain seed culture was inoculated at a 1% inoculum size and cultured at 30℃ with a shaker at 160 rpm for 24 h. The absorbance was then measured at 600 nm. The results are shown below. Figure 6 .from Figure 6 It can be seen that the biomass of yeast Y5 increases with increasing glucose content, and the biomass of the strain is relatively high at a glucose content of 30%. This indicates that yeast Y5 can tolerate high glucose concentrations and can be used in the early fermentation environment of strong-aroma baijiu where reducing sugars are high.

[0058] (5) Temperature resistance test The seed culture of strain Y5 was inoculated into YPD liquid medium at a 1% inoculum size. After static incubation at 15℃, 25℃, 30℃, 37℃, and 45℃ for 48 h, the absorbance was measured at a wavelength of 600 nm. The experimental results are shown in the figure. Figure 7 .from Figure 7 It can be seen that the biomass of strain Y5 increases significantly with rising temperature, but decreases significantly when the temperature reaches 45℃. This indicates that the strain grows better at a culture temperature of 25-37℃ and can adapt to the fermentation temperature of 20-30℃ in strong-aroma baijiu fermentation pits.

[0059] Example 3: Comparative Study of the Efficacy of Existing Cyanide-Reducing Strains under Mass Production Conditions of Strong-Aroma Baijiu Test materials 1. Control strains: Saccharomyces cerevisiae CCTCC M 2014463 disclosed in CN112175764A (denoted as strain A) and Saccharomyces cerevisiae D576 disclosed in CN110484409B (denoted as strain B). 2. Other materials are the same as in Example 1, including strong-aroma medium-temperature Daqu (a type of starter culture), 70kg of grain lees, etc.

[0060] Test methods 1. Liquid bacterial agents of strain A and strain B were prepared according to the method in Example 1, and bacterial agent of strain Y5 was prepared as the experimental group. 2. Respectively, strain A, strain B inoculant and Luzhou medium-temperature Daqu were mixed according to the volume-mass ratio of 10:100 to prepare a control mixed Daqu, and Y5 inoculant was prepared according to the same proportion to prepare an experimental group mixed Daqu, with pure Daqu as a blank control; 3. The test was carried out according to the process of grain Daqu mixing, 90-day pit fermentation and distillation to obtain liquor of example 1, and 3 parallels were set in each group; 4. The cyanide content and main flavor indicators of each group of raw liquor were determined according to the detection method of example 1.

[0061] Test results Table 2 Comparison table of production efficiency of existing technology strains and Y5 strain

[0062] Test conclusion 1. The survival rate of the prior art strains A and B in the 90-day pit fermentation environment of Luzhou-flavor liquor is very low, only a weak cyanide degradation effect can be achieved, and the total amount of esters in the liquor body is decreased, which cannot balance safety and flavor quality; 2. The survival rate of the Y5 strain of the present application in the production environment is high, and the cyanide degradation effect is significantly better than that of the prior art strains, while the total amount of esters can be increased, which proves that the production adaptability and functional advantage of the Y5 strain cannot be replaced by the prior art strains, and the simple application of unconventional cyanide-reducing strains.

[0063] Example 4 Combination of cyanide-reducing and ester-producing strain Test materials 1. Test strains: Y5 strain of the present application, conventional commercial cyanide-reducing yeast (denoted as strain C), and conventional commercial ester-producing yeast (denoted as strain D); 2. Other materials are the same as in example 1.

[0064] Test method 1. Test grouping: Group 1 (Y5 group): Y5 inoculant was prepared according to example 1 and mixed with Daqu at a ratio of 10:100; Group 2 (combination group): Strain C and strain D were prepared into inoculants, and mixed according to the volume-mass ratio of 5:5:100 (inoculant of strain C: inoculant of strain D: Daqu); Group 3 (blank group): pure Daqu; 2. The test was carried out according to the fermentation, liquor taking and detection process of example 1; 3. In addition, the abundance of microbial community and the concentration of metabolites in fermented grains were detected, and the microbial community interaction was analyzed.

[0065] Test results Table 3 Comparison table of single strain and combined strain efficiency

[0066] Test Conclusion 1. The combination of conventional cyanide-reducing strains and ester-producing strains results in decreased fermentation stability due to strain antagonism, and the cyanide degradation rate and ester enhancement rate are much lower than those of Y5 single strain, which cannot achieve double-function synergy. 2. It is proved that the "cyanide reduction + ester promotion" of Y5 strain is a strain-specific synergistic function, not a simple superposition of two conventional strains, and has outstanding substantial features.

[0067] Example 5 Process parameter optimization Test materials Y5 strain, Daqu, grain distiller's grains, etc. of Example 1.

[0068] Test method 1. Mixed ratio comparison: Set 5:100, 10:100, 15:100, 20:100 (Y5 inoculant: Daqu) four ratio groups, ferment for 90 days according to the process of Example 1, and detect cyanide content and total ester content. 2. Fermentation cycle comparison: Set 60 days, 90 days, 120 days three cycle groups, mix inoculant and Daqu at a ratio of 10:100, and detect the corresponding indicators.

[0069] Test results Table 4 Mixed ratio comparison results

[0070] Table 5 Fermentation cycle comparison results

[0071] Test conclusion 1. Only when the ratio of Y5 inoculant to Daqu is 10:100, can the optimal cyanide reduction effect and ester enhancement effect be achieved simultaneously, and the strain population balance is best. This ratio is a non-obvious optimal choice. 2. The 90-day fermentation cycle can balance cyanide reduction efficiency and flavor quality, the 60-day cycle is insufficient for cyanide reduction, and the 120-day cycle will lead to ester decomposition and flavor deterioration, proving the rationality and necessity of the 90-day cycle.

[0072] Example 6 Stability verification of Y5 strain under different production conditions Test materials Y5 strain and basic materials of Example 1.

[0073] Test method 1. Set three extreme conditions: Condition 1 (low temperature into pit): grain distiller's grains are cooled to 15°C and mixed with mixed koji; Case 2 (high-moisture grains): the moisture of grains is adjusted to 65% (conventional 55%-60%); Case 3 (high-acid environment): acetic acid is added to the grains to reduce the initial pH to 3.0; 2. Take the conventional case (grains 25℃, moisture 58%, initial pH 4.5) as the control group, ferment according to the process of Example 1, and detect the cyanide content and flavor indicators of the final base liquor.

[0074] Test results Table 6 Y5 strain performance under different conditions

[0075] Test conclusion Y5 strain can still maintain high cyanide degradation rate and flavor improvement effect under extreme production conditions, with flavor compliance rate above 90%, proving its excellent production adaptability, not only can function under ideal conditions, further supporting the creativity of the technical solution.

[0076] Example 7 Optimization verification of protective agent formula for bacterial agent 1. Test materials: Y5 liquid bacterial agent, glycerol, trehalose.

[0077] 2. Test method: Set 4 groups of bacterial agent formulations, store at 4℃ for 0-6 months, and detect strain activity every month: Group 1: no protective agent; Group 2: 5% m / v glycerol; Group 3: 0.2% m / v trehalose; Group 4: 5% m / v glycerol + 0.2% m / v trehalose.

[0078] 3. Test results: Table 7 Comparison of bacterial agent activity retention rate under different protective agent formulations (average value ± standard deviation, n=3)

[0079] 4. Test conclusion: The compound protective agent formula of 5% m / v glycerol + 0.2% m / v trehalose can significantly improve the storage stability of the bacterial agent, which is the optimal protective agent scheme.

[0080] Example 8 Verification of production adaptability in different regions of distilleries 1. Test materials: Y5 liquid bacterial agent, grains / daqu of a certain Sichuan distillery, grains / daqu of a certain Jiangsu distillery.

[0081] 2. Test method: Carry out production test in two distilleries according to the process of Example 1, detect the cyanide content and flavor indicators of the base liquor, and set 3 parallel groups for each group.

[0082] 3. Test results: Table 8 Comparison of application effects in different liquor factories (average ± standard deviation, n = 3)

[0083] 4. Test conclusion: Y5 strain can stably play the function of cyanide reduction and ester extraction in different Luzhou-flavor liquor factories, and has industry universality.

[0084] From the test results of the above examples and comparative examples, it can be seen that the Saccharomyces cerevisiae Y5 screened by the present application has excellent cyanide degradation capacity and production adaptability. In the strain screening stage, the cyanide degradation rate of Y5 in the liquid fermentation system reached 778.38 μg / L·24h, which was significantly better than that of other strains screened at the same period; its colony and cell morphology were stable, and could tolerate 8% v / v ethanol, 8% m / v NaCl, 30% m / v glucose and pH 3-7, 25-37℃ complex environment, and completely adapted to the fermentation conditions of Luzhou-flavor liquor.

[0085] Compared with the prior art cyanide reduction strains, the survival rate of Y5 in mass production environment was more than 80%, which could reduce the cyanide content of raw liquor by 41.2% and increase the total amount of four esters by 6%. The existing strains not only have weak degradation effect, but also lead to the decrease of ester content in liquor body; the combination scheme of conventional cyanide reduction and ester-producing strains cannot realize the synergy of double functions due to the antagonism of microbial flora, which further confirms the inherent synergistic advantage of Y5 "cyanide reduction + ester extraction".

[0086] Process parameter verification shows that the mixing ratio of Y5 microbial agent and Daqu 10:100 and 90-day pit fermentation cycle are the optimal scheme, which can balance the function and microbial flora; even in extreme production conditions such as low temperature, high moisture and high acid, Y5 can still maintain cyanide degradation rate of more than 35% and flavor compliance rate of more than 90%, which has outstanding production stability and provides a reliable special functional strain for Luzhou-flavor liquor cyanide reduction and quality improvement.

[0087] The above only describes the preferred embodiments of the present application and should not be used to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A Saccharomyces cerevisiae strain, characterized in that, The strain is preserved in China Center for Type Culture Collection, the preservation date is October 28, 2025, and the preservation number is CCTCC M 20252360; the strain is obtained by being isolated and purified from fermented grains of Luzhou-flavor liquor in Hubei Jingpai Co., Ltd.; the culture method is as follows: the strain is inoculated into a liquid culture medium, and is cultured at 28-32 DEG C and 150-160 r / min for 24-48 h, and the components of the liquid culture medium are as follows: glucose 15-25 g, peptone 15-25 g, yeast extract powder 8-12 g, and water 1000 ml, and the pH is 5-8.

2. The Saccharomyces cerevisiae of claim 1, wherein, The ITS rDNA sequence of the strain is shown as SEQ ID NO:

1.

3. The Saccharomyces cerevisiae of claim 1, wherein, The screening method of the strain comprises the following steps: 1) 10 g of Hubei Jingpai Co., Ltd. medium-temperature Daqu or fermented grains is taken, 90 ml of sterilized distilled water is added, and after being oscillated at 160 r / min for 30 min, gradient dilution is performed, 200 microliters of 10^-3 and 10^-4 gradient bacterial suspensions are taken, and are coated on YPD solid culture medium, and after being cultured at 30 DEG C, yeast colonies are picked and purified, and the components of the YPD solid culture medium are as follows: glucose 18-22 g, peptone 18-22 g, yeast extract powder 8-12 g, agar 18-22 g, and water 1000 ml, and the pH is 7; 2) the strain purified in step 1) is inoculated into a cyanide screening culture medium plate, and after being cultured at 30 DEG C, strains with good colony morphology are picked to complete the preliminary screening, and the components of the cyanide screening culture medium are as follows: cyanide 5-10 g, glucose 15-25 g, peptone 15-25 g, yeast extract powder 8-12 g, agar 18-22 g, and water 1000 ml, and the pH is 5-8; 3) the preliminary screening strain is inoculated into the liquid culture medium in claim 1, and after being cultured at 30 DEG C and 160 r / min for 24 h, 0.5 ml of bacterial suspension is added into sterile water containing 2.5 mg / L of cyanide, and is cultured at 30 DEG C for 48 h, and the target strain is screened.

4. The Saccharomyces cerevisiae of claim 1, wherein, The strain can grow and proliferate in YPD liquid culture medium containing 8% v / v ethanol, 8% m / v NaCl and 30% m / v glucose, and can remain in a stable proliferation state at pH 3-7 and 25-37 DEG C.

5. The application of Saccharomyces cerevisiae in the production of Baijiu as claimed in any one of claims 1-4, characterized in that, The application method comprises the following steps: 1) preparing a liquid bacterial agent: after the Saccharomyces cerevisiae is activated, it is inoculated into 10 ml of the liquid culture medium in claim 1, and is cultured at 30 DEG C and 160 r / min for 24 h to obtain a seed liquid, 1 ml of the seed liquid is inoculated into the liquid culture medium in claim 1, and is cultured at 30 DEG C and 160 r / min for 48 h to prepare a liquid bacterial agent; 2) preparing a mixed Daqu: the liquid bacterial agent in step 1) is mixed with Luzhou-flavor medium-temperature Daqu at a volume-mass ratio of 10:100 to prepare a mixed Daqu; 3) pit fermentation: the mixed Daqu is mixed with grains and is put into a pit for fermentation, and liquor is distilled.

6. The use according to claim 5, wherein the compound is ###0002### In step 3), the mass of the grains is 70 kg, the mass of the mixed Daqu is 20 kg, and the grains need to be cooled to 20-30 DEG C before being mixed with the mixed Daqu.

7. The use according to claim 5, wherein the compound is ###00003### or a pharmaceutically acceptable salt thereof. In step 3), the duration of the pit fermentation is 90 days.

8. A microbial inoculant, characterized in that, The microbial inoculant comprises the Saccharomyces cerevisiae according to any one of claims 1-4, is in a liquid form, and is prepared by the method of claim 5, step 1).

9. The microbial inoculant of claim 8, wherein, The liquid microbial inoculant further comprises 5% glycerol and 0.2% trehalose as active protective agents, and is stored at 4°C.

10. A distilled spirit, characterized by, The microbial inoculant is prepared by the method of any one of claims 5-7, and the liquor is a Luzhou-flavor liquor.

Images