Genetically engineered bacterium for producing heparin precursor with adjustable molecular weight as well as construction method and application of genetically engineered bacterium
By optimizing the start codons of the kps gene family in Escherichia coli Nissle 1917, a genetically engineered bacterium with adjustable molecular weight was constructed, solving the problem of inaccurate molecular weight control of heparin precursors and realizing customized production of heparin precursors, which is suitable for heparin drug development.
Patent Information
- Application Number
- CN202511486615.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-17
- Publication Date
- 2026-01-20
AI Technical Summary
Existing technologies make it difficult to precisely control the molecular weight of heparin precursors, resulting in poor product uniformity and limiting their clinical application.
By optimizing the start codon of the target gene of the kps gene family in Escherichia coli Nissle 1917 and replacing ATG with GTG, a genetically engineered bacterium with adjustable molecular weight was constructed to achieve customized production of heparin precursor molecular weight.
It has achieved precise control of the molecular weight of heparin precursors, producing heparin precursors with a molecular weight range from 4.9 kDa to 24.5 kDa, meeting different clinical application needs, reducing production costs and pollution risks, and is suitable for large-scale production.
Smart Images

Figure CN121362715A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of bioengineering, and particularly relates to a genetically engineered bacterium for producing heparin precursor with adjustable molecular weight, a construction method and application, and especially to a genetically engineered bacterium for realizing molecular weight regulation of heparin precursor by weakening expression of the kps gene family in Escherichia coli Nissle 1917 through genetic engineering means. BACKGROUND
[0002] Heparin is an important sulfated polysaccharide anticoagulant drug, which is widely used in the prevention and treatment of thrombotic diseases. Natural heparin is mainly extracted from animal tissues (such as pig intestines or cow lungs), but there are risks of pathogen contamination, large batch-to-batch differences, and ethical issues. Chemically synthesized heparin has complex steps, high cost, and difficulty in controlling molecular weight distribution. Therefore, developing a safe and controllable biosynthesis method to produce heparin precursor has become a research hotspot.
[0003] Heparin precursor (such as heparin analog or unsulfated polysaccharide) is a key intermediate in the biosynthesis of heparin, and its molecular weight directly affects the biological activity and pharmacological properties of the final heparin. Currently, there have been reports on the production of heparin precursor by microbial fermentation, such as expressing heparin synthesis pathway-related enzymes in engineered Escherichia coli. However, existing methods are difficult to accurately control the molecular weight of heparin precursor, resulting in poor product uniformity and limiting clinical application.
[0004] Escherichia coli Nissle 1917 (EcN) is a probiotic bacterium with good safety and ease of genetic manipulation, and has been used to produce a variety of high-value biomolecules. The kps gene family is involved in the synthesis and transport of bacterial capsular polysaccharide, and its expression level affects the elongation and molecular weight of polysaccharide chains, but there is no report on the production of heparin precursor with customized molecular weight using EcN.
[0005] Therefore, how to modify the kps gene in EcN to achieve the customized production of heparin precursor molecular weight has become a new strategy for heparin drug development. SUMMARY
[0006] To overcome the shortcomings of the prior art, the present application provides a genetically engineered bacterium for producing heparin precursor with adjustable molecular weight, a construction method and application. The present application realizes the regulation of the molecular weight of heparin precursor by optimizing the start codon of the target gene of the kps gene family in EcN, thereby obtaining a series of genetically engineered bacteria capable of producing heparin precursor with different molecular weights.
[0007] To solve the above problems, the technical scheme adopted by the present application is:
[0008] In a first aspect, the present application provides a genetically engineered bacterium for producing heparin precursors with adjustable molecular weight, which is based on Escherichia coli Nissle 1917 (EcN) as a chassis bacterium, and in which the start codon ATG of at least one target gene in the kps gene family of the chassis bacterium is replaced by GTG through homologous recombination, wherein the target gene is selected from one or more of kpsC, kpsS, kpsM, kpsT, kpsE and kpsD.
[0009] In a second aspect, the present application also provides a method for constructing a genetically engineered bacterium, comprising the following steps:
[0010] Step 1: constructing a knockdown fragment containing a GTG mutation site, which contains an upstream sequence and a downstream sequence homologous to the target kps gene locus, and a selection marker gene located therebetween;
[0011] Step 2: introducing the knockdown fragment into EcN competent cells containing pKD46 plasmid, replacing the start codon ATG of at least one target gene in the kps gene family of the chassis bacterium with GTG through homologous recombination to obtain a positive clone with a selection marker;
[0012] Step 3: eliminating the selection marker in the positive clone obtained in step 2 to obtain a strain without the resistance marker, which is a genetically engineered bacterium for producing heparin precursors.
[0013] As a preferred embodiment of the present application, the knockdown fragment in step 1 is any one or several of the following:
[0014] (1) kpsC with a nucleotide sequence as shown in SEQ ID NO. 1 GTG -FRT-Kan-FRT;
[0015] (2) kpsS with a nucleotide sequence as shown in SEQ ID NO. 2 GTG -FRT-Kan-FRT;
[0016] (3) kpsM with a nucleotide sequence as shown in SEQ ID NO. 3 GTG -FRT-Kan-FRT;
[0017] (4) kpsT with a nucleotide sequence as shown in SEQ ID NO. 4 GTG -FRT-Kan-FRT;
[0018] (5) kpsE with a nucleotide sequence as shown in SEQ ID NO. 5 GTG -FRT-Kan-FRT;
[0019] (6) kpsD with a nucleotide sequence as shown in SEQ ID NO. 6GTG -FRT-Kan-FRT.
[0020] As a preferred embodiment of this application, the weight-average molecular weight of the heparin precursor is in the range of 4.9 kDa to 24.5 kDa.
[0021] As a preferred embodiment of this application, the genetically engineered bacteria are selected from EcN / kpsC. GTG EcN / kpsS GTG EcN / kpsM GTG EcN / kpsT GTG EcN / kpsE GTG Or EcN / kpsD GTG The group consisted of mutant strains that expressed heparin precursors with molecular weights ranging from 4.9 kDa to 24.5 kDa.
[0022] This invention optimizes the start codon of the target gene in the kps gene family of EcN by weakening mutations of the start codons ATG to GTG, and constructs a series of genetically engineered bacteria for producing heparin precursors with a weight-average molecular weight of 4.9 kDa to 24.5 kDa, thereby achieving molecular weight regulation of heparin precursors to meet different clinical application needs.
[0023] Thirdly, the present invention also provides the application of the genetically engineered bacteria described above in the fermentation production of heparin precursors.
[0024] Fourthly, the present invention also provides a method for producing a customized molecular weight heparin precursor, comprising selecting the engineered strain described above for fermentation and purifying the heparin precursor by resin adsorption.
[0025] Fourthly, the present invention also provides a method for producing a customized molecular weight heparin precursor, comprising:
[0026] (a) The genetically engineered bacteria are seed cultured and then inoculated into fermentation medium one or fermentation medium two, and fermented at 37°C and pH 6.75 for 20-24 h. The fermentation product is centrifuged to obtain the supernatant.
[0027] (b) The supernatant is purified by resin adsorption to obtain the heparin precursor.
[0028] As preferred in the present application, the fermentation culture in step (a) is a flask fermentation or a reactor fermentation, and the flask fermentation culture parameters are as follows: 37℃, 250 rpm oscillation culture for 24h; the reactor fermentation uses a fed-batch strategy to supplement glucose to maintain carbon source supply; wherein the fermentation culture parameters are as follows: temperature 37℃, pH 6.75, stirring speed 200 rpm, ventilation volume 4L / min; the fed-batch strategy is as follows: supplement glucose at a rate of 20 g / h for 4.5-12h, and 40 g / h for 12-20h.
[0029] As preferred in the present application, the fermentation medium I used for flask fermentation is an inorganic salt medium, and the components are as follows: Na2HPO46.8 g / L, KH2PO43 g / L, NH4Cl 1 g / L, NaCl 0.5 g / L; before use, 1 M MgSO42 mL / L, 1 M CaCl20.1 mL / L, 20% casein amino acid 20 mL / L, and 40% glucose 20 mL / L are supplemented and sterilized by filtration.
[0030] As preferred in the present application, the fermentation medium II used for reactor fermentation is an inorganic salt medium, and the components are as follows: glucose 20 g / L, KH2PO413.5 g / L, (NH4)2HPO44 g / L, MgSO4·7H2O 1.4 g / L, citric acid 1.7 g / L, trace element solution 1 mL / L, defoaming agent 0.5 mL / L, and VB1 20 mg / L.
[0031] As preferred in the present application, the resin adsorption method for purifying the supernatant of the fermentation broth in step (b) comprises the following steps: after dilution, the supernatant of the fermentation broth is mixed and adsorbed with a macroporous resin, impurities are washed with a NaCl solution, and elution is performed, and the eluate is collected, concentrated, and dried to obtain a heparin precursor product.
[0032] More preferably, the resin adsorption method for purifying the supernatant of the fermentation broth in step (b) comprises the following steps: after dilution, the supernatant of the fermentation broth obtained in step (a) is mixed and adsorbed with a macroporous resin, impurities are washed with a NaCl solution, and elution is performed, and the eluate is collected, concentrated, and freeze-dried to obtain a heparin precursor.
[0033] Specifically, the resin adsorption method for purifying the supernatant of the fermentation broth in step (b) comprises the following steps: after dilution to a conductivity <5 ms / cm, the supernatant of the fermentation broth obtained in step (a) is mixed with a macroporous resin LH42, and oscillation adsorption is performed at 200 rpm for 6h, then impurities are washed with a 0.2 M NaCl solution, elution is performed with a 1 M NaCl solution, and the eluate is collected, concentrated, and freeze-dried to obtain a heparin precursor.
[0034] In a fifth aspect, the present application further provides a heparosan precursor produced by the method, wherein the heparosan precursor has a weight average molecular weight in the range of 4.9 kDa to 24.5 kDa.
[0035] In a sixth aspect, the present application further provides a use of the heparosan precursor or the heparosan precursor obtained by the method in the production of heparin or heparin analogs.
[0036] Compared with the prior art, the present application has the following beneficial effects:
[0037] (1) The present application realizes the customized production of heparosan precursor molecular weight by precisely weakening the mutation of the kps gene family, and can obtain heparosan precursor with a molecular weight in the range of 4.9 kDa to 24.5 kDa, which meets the needs of different clinical applications.
[0038] (2) The fermentation process of the engineering strain provided by the present application is stable, the purification method is simple, and it is suitable for large-scale production, which significantly reduces the production cost and pollution risk of heparosan precursor.
[0039] (3) The present application provides a new technical route for the microbial production of heparosan precursor, which breaks the dependence on animal tissues and has important industrial value and market prospect. BRIEF DESCRIPTION OF DRAWINGS
[0040] Figure 1 Schematic diagram of heparosan synthesis pathway and kps gene family action.
[0041] Figure 2 Schematic diagram for construction of knockdown fragments.
[0042] Figure 3 Comparison chart of wild type and mutant strain fermentation in shake flask.
[0043] Figure 4 Fermentation parameters of EcN in a 5-L tank.
[0044] Figure 5 Molecular weight of heparosan precursor synthesized by EcN / kpsM GTG in a 5-L tank.
[0045] Figure 6 Molecular weight of heparosan precursor synthesized by EcN in a 5-L tank.
[0046] Figure 7 Molecular weight of heparosan precursor synthesized by EcN / kpsM GTG in a 5-L tank. DETAILED DESCRIPTION
[0047] Following, the advantages and effects of the present application can be easily understood by those skilled in the art from the description. The present application can also be implemented or applied by different specific embodiments, and the details in the description can be modified or changed based on different views and applications without departing from the spirit of the present application.
[0048] It should be noted that the process equipment or device not specifically mentioned in the following examples is the conventional equipment or device in the art.
[0049] In addition, it should be understood that the one or more method steps mentioned in the present application do not exclude that there can be other method steps before and after the combination steps or other method steps can be inserted between the explicitly mentioned steps, unless otherwise specified; it should also be understood that the combination connection relationship between the one or more devices / apparatuses mentioned in the present application does not exclude that there can be other devices / apparatuses before and after the combination devices / apparatuses or other devices / apparatuses can be inserted between the two explicitly mentioned devices / apparatuses, unless otherwise specified. Moreover, unless otherwise specified, the numbering of each method step is only a convenient tool to identify each method step, and is not a limitation on the arrangement order of each method step or a limitation on the range of the present application, and the change or adjustment of the relative relationship without substantial change of the technical content is also considered as the range of the present application that can be implemented.
[0050] The present application will be further described below in conjunction with specific embodiments, but the protection scope of the present application is not limited thereto.
[0051] In the following examples, the mother liquor concentration of carbenicillin (Carb R ) is 50 g / L, the mother liquor concentration of kanamycin (Kan R ) is 50 g / L, and the mother liquor concentration of L-arabinose (L-Ara) is 1 M.
[0052] The composition of the seed medium includes: yeast powder 4-6 g / L, peptone 8-12 g / L, sodium chloride 4-6 g / L.
[0053] The composition of the LB liquid medium includes: yeast powder 4-6 g / L, peptone 8-12 g / L, sodium chloride 8-12 g / L.
[0054] The composition of the LLB liquid medium includes: yeast powder 4-6 g / L, peptone 8-12 g / L, sodium chloride 4-6 g / L.
[0055] The composition of the LB plate includes: yeast powder 4-6 g / L, peptone 8-12 g / L, sodium chloride 8-12 g / L, agar powder 10-30 g / L.
[0056] The composition of LLB plates includes: yeast extract 4–6 g / L, peptone 8–12 g / L, sodium chloride 8–12 g / L, and agar powder 10–30 g / L.
[0057] The composition of kanamycin agar plates includes: yeast extract 4–6 g / L, peptone 8–12 g / L, sodium chloride 8–12 g / L, and agar powder 10–30 g / L. After sterilization and cooling to approximately 50°C, kanamycin is added. R ) Mother liquor 1‰ (V / V).
[0058] The composition of carbenicillin agar plates includes: 4–6 g / L yeast extract, 8–12 g / L peptone, 8–12 g / L sodium chloride, and 10–30 g / L agar powder. After sterilization and cooling to approximately 50°C, carbenicillin (Carb) is added. R ) Mother liquor 1‰ (V / V).
[0059] The SOB medium consists of: 20 g / L tryptone basal medium, 5 g / L yeast extract, 0.5 g / L sodium chloride, and 0.186 g / L potassium chloride. To prepare, the above components are thoroughly dissolved in approximately 800 mL of ultrapure water, the pH is adjusted to 7.0 with 5M NaOH solution, and the volume is brought to 1 L before autoclaving. The aseptic replenishment solution is a 2 M magnesium chloride stock solution, prepared by dissolving 19 g of magnesium chloride and bringing the volume to 100 mL of ultrapure water, followed by separate sterilization. The complete medium is assembled under aseptic conditions, with 5 mL of sterile 2 M magnesium chloride stock solution added to each liter of sterilized basal medium, mixed thoroughly, and stored at 4°C for later use.
[0060] The composition of SOC medium includes: preparing a 1 M glucose solution by dissolving 18 g of glucose in 90 mL of deionized water, bringing the volume up to 100 mL, and then filtering it through a 0.22 μm filter membrane for sterilization; adding 2 mL of sterilized 1 M glucose solution to 100 mL of SOB medium and mixing thoroughly to obtain the SOC medium.
[0061] Fermentation medium one is an inorganic salt medium used for shake flask fermentation. Its components are: Na2HPO4 6.8 g / L, KH2PO4 3 g / L, NH4Cl 1 g / L, NaCl 0.5 g / L. Before use, it is necessary to add 2 mL / L of filtered and sterilized 1 M MgSO4, 0.1 mL / L of 1 M CaCl2, 20 mL / L of 20% casein amino acids, and 20 mL / L of 40% glucose.
[0062] The fermentation medium II is an inorganic salt medium used for reactor fermentation, and its components are: glucose 20 g / L, KH2PO4 13.5 g / L, (NH4)2HPO4 4 g / L, MgSO4·7H2O 1.4 g / L, citric acid 1.7 g / L, trace element solution 1 mL / L, defoaming agent 0.5 mL / L, VB1 20 mg / L.
[0063] The primer sequence information used in the examples is shown in Table 1.
[0064] Table 1: Primer sequence information table
[0065] Primer name Primer sequence (5'-3') kpsC-F1 CGCCCTGATGGCACAGGAACTGGCTGAAAACGCATGA TTGTGTAGGCTGGAGCTGCTTC <!-- 4 -->]]> kpsC-R1 GAATACGCCAGATGCCAGGCGAGTAAATGCCAATCAC TATCCTCCTTAGTTCCTATTCC ]]> kpsC-F2 CGTCGACACCCCAGCATGCCTGGAAAAAGTGCGCGCCCTGATGGCACAGGAAC kpsC-R2 TGGCACGGTTGCGCCAGAAATTTCTCCAGATGCGGAATACGCCAGATGCCAGGC kpsS-F1 TAAACAATTTCACAGTTGACTATTACACAAATTATTT TTGTGTAGGCTGGAGCTGCTTC ]]> kpsS-R1 TACCGGATAATAAAACGGTTAGTGCATTACCTTGCAC TATCCTCCTTAGTTCCTATTCC ]]> kpsS-F2 AAATTAATTATGTTCTGCAAGGTCAGATTTGGCTAAACAATTTCACAGTTGACTATTAC kpsS-R2 GGTCCCATTGGCCCCTGCAATAGCAGATATTTTTTACCGGATAATAAAACGGTTAGTG kpsM-F1 GGTAGCGTACCTGAAGAGATTAGGATCACATCATCAA TTGTGTAGGCTGGAGCTGCTTC ]]> kpsM-R1 CGGTGACTTTCTGGACTTCAAATCCACTTCTTGCCAC TATCCTCCTTAGTTCCTATTCC ]]> kpsM-F2 CTCCAGTGTATTGGTAGCTGTTAAGCCAAGGGCGGTAGCGTACCTGAAGAGATTAG kpsM-R2 CGTGTTCGTATTTCTCGTAGAAATAATGCCTCTACGGTGACTTTCTGGACTTCAAAT kpsT-F1 ATACCGAACTCGTGAGGAGGCAATGCTGACATCATGA TTGTGTAGGCTGGAGCTGCTTC ]]> kpsT-R1 TACGATATGACTTCGTCAAATTCTCAATCTTAATCAC TATCCTCCTTAGTTCCTATTCC ]]> kpsT-F2 CACTCTGGTCACCCTGTTCATCGGTCTGGCGTTATACCGAACTCGTGAGGAGGC kpsT-R2 GTTTAAATCCTTAAACACATAGTGTCGCCCCGTTGGCGTACGATATGACTTCGTCAAAT kpsE-F1 TGAGTTTGCGCCCCACTGAAACTTTGATAATCGTTAC TTGTGTAGGCTGGAGCTGCTTC ]]> kpsE-R1 GCATCCAGGATACGGCAGACTTCACTTTTATCAACAC TATCCTCCTTAGTTCCTATTCC ]]> kpsE-F2 TAAGCAACGGGGTGCGAGAGGTTAGTCTCTCATTGAGTTTGCGCCCCACTGAAAC kpsE-R2 ATATCTGCCAGTGAGATGGCAGACAGACGAGCACGCATCCAGGATACGGCAGAC kpsD-F1 ATCACCGAGACTAACGCTGTCGCTGAATGAGTTTGTG TTGTGTAGGCTGGAGCTGCTTC ]]> kpsD-R1 TATCCTCCTTAGTTCCTATTCC AGGCGGCAATCAGTAAAATTGATTTAAATAATTTCAC TATCCTCCTTAGTTCCTATTCC ]]> kpsD-F2 GCACCCTGAAACTGTTGCTGGCTGTTATTGAAGATCACCGAGACTAACGCTGTC kpsD-R2 ATATCAATGGTCGCGCTGGCCTGCGCCGCGTGACAGGCGGCAATCAGTAAAATTGAT Kan-VF GATATTGCTGAAGAGCTTGGC kC-VR GGCGATAGCATCAACTTCTTG kS-VR AAGCTAGGTATTGTCGATGGC kM-VR TCGTGCGGTGCATAATGTAAC kT-VR CGGTTAAACTTCCCTGGAATC kE-VR GCTGTTTAAATCATCCGAGCG kD-VR GCCGCTCATGTTTTGCGTATC 46-VF GAGGCAGAACTGGCAGACGAC 46-VR CCGAGCCGTAATTTGTGCCAC
[0066] Note: The underlined part in Table 1 is the sequence of the non-homologous arm of the gene.
[0067] Example 1: EcN wild-type strain shake flask production of heparosan
[0068] This example serves as a control to illustrate the basic performance of the wild-type strain in producing heparosan.
[0069] (1) Strain and medium
[0070] Strain and plasmid: Escherichia coli Nissle 1917 wild-type, purchased from Hangzhou Baosai Biotechnology Co., Ltd., product number T0023
[0071] Seed medium: LB liquid medium.
[0072] Fermentation medium I: inorganic salt medium (components: Na2HPO4 6.8 g / L, KH2PO4 3 g / L, NH4Cl 1 g / L, NaCl 0.5 g / L), before use, supplement with 1 M MgSO4 2 mL / L, 1 M CaCl2 0.1 mL / L, 20% casein amino acid 20 mL / L, 40% glucose 20 mL / L.
[0073] (2) Shake flask fermentation
[0074] Take the preserved Escherichia coli Nissle 1917 wild-type strain from -80℃, streak LB plate, and incubate at 37℃ overnight for 16 h. Pick a single colony and inoculate in 3 mL LB liquid medium, incubate at 37℃ with 220 rpm shaking for 12 h to prepare the seed solution.
[0075] The seed liquid was transferred to a 250 mL flask containing 90 mL of fermentation medium 1 at an inoculation volume of 1:100 (v / v) and incubated at 37 °C with 250 rpm shaking for 24 h.
[0076] After fermentation, the OD 600 of the culture solution was measured, and the supernatant was collected by centrifugation at 8000 rpm for 10 min and used for purification.
[0077] The content was determined by the carbazole sulfate method. The main reagents included: (1) borax sulfuric acid test solution: accurately weigh 18.068 g of sodium borate decahydrate (Na2B4O7-10H2O), dissolve with concentrated sulfuric acid and dilute to 1 L; (2) carbazole test solution: accurately weigh 0.125 g of carbazole, dissolve with anhydrous ethanol and dilute to 100 mL, store in a brown bottle and keep at 4 °C in the dark. When measuring, take 1 mL of sample, slowly add 5 mL of borax sulfuric acid test solution in an ice bath, shake gently and repeatedly cool in ice until the heat is released, then heat in boiling water for 10 minutes, quickly cool in cold water to room temperature; then add 0.2 mL of carbazole test solution, mix well and quickly cool, then heat in boiling water for 15 minutes, and measure the OD 530 value after cooling to room temperature again; if the OD value exceeds the linear range, the sample should be diluted appropriately. For quantitative analysis, a standard curve was prepared using glucuronic acid as the standard: 20 mg of glucuronic acid was diluted to 100 mL to obtain a stock solution, and then 0.5, 1.0, 1.5, 2.0, and 2.5 mL of the stock solution were diluted to 10 mL to obtain standard solutions of 10, 20, 30, 40, and 50 mg / L, respectively, and the OD 530 values were measured in the same way. The concentration of glucuronic acid (X, mg / L) was taken as the abscissa and the OD 530 value (Y) as the ordinate for linear regression, and the equation Y = 0.0173X + 0.0052 (R² = 0.9999) was obtained, indicating that heparosan had a good linear relationship in the concentration range of 0-329.960 mg / L.
[0078] (3) Purification of heparin precursors
[0079] Resin pretreatment: weigh 100 g of macroporous resin LH42 (purchased from Jiangsu Linhai Resin Technology Co., Ltd.) and activate with purified water.
[0080] Adsorption: dilute 100 mL of supernatant to a conductivity of <5 ms / cm, add macroporous resin LH42, and adsorb for 6 h with 200 rpm shaking.
[0081] Washing and elution: sequentially wash with 250 mL of 0.2 M NaCl, then elute the product with 250 mL of 1 M NaCl solution, and shake for 2 h.
[0082] Product collection: The eluent was collected and dried in vacuum at -20°C for more than 24 h to obtain the heparosan precursor.
[0083] Results: The OD of EcN wild-type strain shake flask fermentation 600 was 1.66, the heparosan precursor yield was 0.95 g / L, and the weight average molecular weight (Mw) was 22.1 kDa.
[0084] Example 2: Construction of EcN / kpsC GTG mutant strains and heparosan precursor production
[0085] Plasmids: pKD4, pKD46 and pCP20 were purchased from Vazyme Biotech Co., Ltd. with product numbers VT1690, VT1692 and VT1693.
[0086] (1) EcN / kpsC GTG Construction of mutant strains
[0087] a. Fusion PCR to construct the knockdown fragment
[0088] According to the 70 homologous arms upstream and downstream of the kpsC start codon ATG in the EcN genome and the plasmid pKD4 as a reference, the kpsC-F1, kpsC-R1 and kpsC-F2, kpsC-R2 primers were designed and synthesized. Using plasmid pKD4 as a template, the first round of PCR amplification was performed using kpsC-F1 and kpsC-R1 primers (98°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 2 min, 35 cycles; enzymes purchased from Beijing Kangrunchengye Biotechnology Co., Ltd., 2x Taq PCR StarMix (Dye), product number A012-01) to obtain the FRT-Kan-FRT resistance fragment. Using the first round of PCR product as a template, the kpsC-F2 and kpsC-R2 primers were used for PCR amplification to obtain the FRT-Kan-FRT resistance fragment with about 70 bp of homologous arms UP and DOWN upstream and downstream of the kpsC gene start codon ATG, i.e. to obtain the GTG knockdown fragment for replacing the kpsC gene start codon ATG. The GTG knockdown fragment was purified using the Genview DNA Fragment Purification Kit, the DNA concentration was determined by NanoDrop, and the sequencing was confirmed by Genview Biotechnology. It was stored at -20°C for standby use.
[0089] b. Construction of EcN / pKD46 strain
[0090] Single colony was picked from EcN wild type plate and inoculated into 5 mL LLB liquid medium for overnight culture. 1 mL bacterial solution was transferred into 50 mL LLB liquid medium and incubated at 37°C, 250 rpm for 1.5 h. The bacteria were collected by centrifugation at 4°C, 5500 rpm for 1 min, resuspended in pre-cooled 0.1 M CaCl2solution and incubated in ice bath for 30 min. The bacteria were collected again by centrifugation at 4°C, 5500 rpm for 1 min, washed once with pre-cooled 0.1 M CaCl2solution mixed with 15% glycerol, and finally resuspended in 100 μL of the same solution and stored at -80°C for later use. 6 μL pKD46 plasmid was added into 100 μL competent cells, mixed gently, and incubated in ice bath for 30 min. The cells were heat-shocked at 42°C for 90 s, immediately incubated in ice bath for 3 min, added with 1 mL LLB liquid medium, and incubated at 30°C, 220 rpm for 2 h. The whole bacterial solution was spread on carbenicillin plate (Carb R , 50 μg / mL) and incubated at 30°C overnight.
[0091] Single colony was picked and colony PCR was performed using primers 46-VF and 46-VR. EcN / pKD46 engineering strain was successfully obtained.
[0092] c. Preparation of EcN / pKD46 electro-competent cells
[0093] Single colony was picked from EcN / pKD46 glycerol tube and inoculated into 3 mL LLB plate (containing 1‰ Carb R ) and incubated at 30°C for 8 h. The bacterial solution was transferred into 3 mL SOB medium (containing 1‰ Carb R and 1% L-arabinose) and incubated at 30°C for 16 h. The bacteria were inoculated into 50 mL SOB medium (containing 1‰ Carb R and 1% L-arabinose) at 2% inoculation amount and incubated at 30°C until OD600≈0.6. The whole process was operated at 4°C, the bacteria were washed once with 20 mL sterile water and twice with 20 mL pre-cooled 10% glycerol solution. Finally, the bacteria were resuspended in appropriate amount of 10% glycerol, aliquoted at 100 μL per tube, and stored at -80°C for later use.
[0094] d. Electro-transformation of EcN / kpsC gene knockout
[0095] Take 100 μL EcN / pKD46 electrotransformation competent cells, thaw on ice, add 10 μL purified kpsC GTG knockdown fragment, gently mix and then transfer into pre-cooled electroshock cup, ice bath for 5 min. Set the electrotransformation instrument parameters: voltage 2.5 kV. Use a paper towel to wipe the outer wall of the electroshock cup, put it into the electroshock chamber for electroshock, and the electroshock pulse time is about 5.3-5.6 ms. Immediately after electroshock, add 0.9 mL of pre-cooled SOC medium. Transfer the mixture into a 1.5 mL sterile centrifuge tube, and recover at 30°C, 220 rpm for 3.5 h. After concentrating the bacterial solution, take 100 μL and spread on a kanamycin plate, and incubate at 37°C for 16 h. Pick single colonies for colony PCR verification using Kan-VR and KC-VR, and send positive clones to GenScript for sequencing to confirm that the kpsC gene start codon has been successfully mutated from ATG to GTG and the resistance gene has been correctly integrated.
[0096] e. Kan resistance elimination
[0097] Inoculate the above-mentioned verified positive clone into 3 mL SOB medium (containing 1‰ Kan) and incubate at 37°C overnight. Inoculate into 4 mL SOB medium (containing 1‰ Kan) at a 2% inoculation amount, and incubate at 37°C until the OD 600 ≈0.6. Throughout the process, wash the bacterial cells with pre-cooled 10% glycerol solution twice, and finally resuspend with 100 μL 10% glycerol to prepare electrotransformation competent cells. Take 100 μL competent cells, add 4 μL pCP20 plasmid (expressing FLP recombinase), and ice bath for 5 min. Perform electroshock according to the above parameters (2.5 kV), and immediately after electroshock, add 0.9 mL of pre-cooled SOB medium. Transfer the bacterial solution into a sterile centrifuge tube and incubate at 30°C for 16 h to eliminate the Kan resistance gene between the FRT sites. Streak the bacterial solution onto a non-resistant LB plate and incubate at 37°C overnight. Pick single colonies and streak them onto a carbenicillin plate (Carb R ) and a non-resistant LB plate for verification. Select the colonies that grow on the non-resistant plate but do not grow on the Carb R plate, which are the EcN / kpsC GTG mutant strain that successfully eliminates Kan resistance and loses the pCP20 plasmid.
[0098] (2) Shake flask fermentation
[0099] The method is the same as in Example 1. Use the verified EcN / kpsC GTG mutant strain for fermentation.
[0100] (3) Purification of heparosan precursor
[0101] The method is the same as in Example 1.
[0102] Results: The mutant strain shake flask fermentation OD 600 was 1.62, heparosan production was 0.52 g / L, and the weight average molecular weight (Mw) was 19.2 kDa.
[0103] Example 3: Construction of EcN / kpsS GTG Mutant strain and its production of heparosan
[0104] Construction, fermentation and purification methods were the same as Example 2, except that in PCR and all verification steps, the primers used were designed for the kpsS gene.
[0105] Results: EcN / kpsS GTG Mutant strain shake flask fermentation OD 600 was 1.58, heparosan production was 0.48 g / L, and the weight average molecular weight (Mw) was 24.5 kDa.
[0106] Example 4: Construction of EcN / kpsM GTG Mutant strain and its production of low molecular weight heparosan
[0107] Construction, fermentation and purification methods were the same as Example 2, except that in fusion PCR and all verification steps, the primers used were designed for the kpsM gene.
[0108] Results: EcN / kpsM GTG Mutant strain shake flask fermentation OD 600 was 1.70, heparosan production was 0.41 g / L, and the weight average molecular weight (Mw) was 6.3 kDa.
[0109] Example 5: Construction of EcN / kpsT GTG Mutant strain and its production of heparosan
[0110] Construction, fermentation and purification methods were the same as Example 2, except that in fusion PCR and all verification steps, the primers used were designed for the kpsT gene.
[0111] Results: EcN / kpsT GTG Mutant strain shake flask fermentation OD 600 was 1.68, heparosan production was 0.39 g / L, and the weight average molecular weight (Mw) was 22.4 kDa.
[0112] Example 6: Construction of EcN / kpsE GTG Mutant strain and its production of heparosan
[0113] The construction, fermentation and purification methods are the same as Example 2, except that the primers used in the fusion PCR and all the verification steps are designed for the kpsE gene.
[0114] Results: EcN / kpsE GTG Mutant strain shake flask fermentation OD 600 was 1.65, heparosan production was 0.46 g / L, and the weight average molecular weight (Mw) was 21.1 kDa.
[0115] Example 7: Construction of EcN / kpsD GTG Mutant strain and heparosan production
[0116] The construction, fermentation and purification methods are the same as Example 2, except that the primers used in the fusion PCR and all the verification steps are designed for the kpsD gene.
[0117] Results: EcN / kpsE GTG Mutant strain shake flask fermentation OD 600 was 1.60, heparosan production was 0.43 g / L, and the weight average molecular weight (Mw) was 20.1 kDa.
[0118] Example 8: 5 L fermenter fermentation production of EcN wild type strain
[0119] This example verifies the performance of the wild type strain in large-scale production.
[0120] Fermentation medium two: glucose 20 g / L, KH2PO4 13.5 g / L, (NH4)2HPO4 4 g / L, MgSO4·7H2O 1.4 g / L, citric acid 1.7 g / L, trace element solution 1 mL / L, antifoam agent 0.5 mL / L, VB1 20 mg / L.
[0121] Fermentation process: 1.8 L of fermentation medium two was added to a 5 L fermenter, and after sterilization, 10% seed liquid was inoculated. Control conditions: temperature 37°C, stirring speed 200 rpm, aeration rate 4 L / min, pH 6.75. A fed-batch strategy was used, and glucose was added at a rate of 20 g / h from 4.5-12 h and 40 g / h from 12-20 h. The total fermentation time was 20 h.
[0122] Purification: After the fermentation was completed, the fermentation broth was taken and heparosan precursor purification was performed according to the resin adsorption and elution method described in Example 1.
[0123] Results (see Table 2): EcN wild type fermentation end point OD in 5 L fermenter 600102.2, heparosan production of 7.11 g / L, and molecular weight of 23.5 kDa.
[0124] Table 2 EcN wild type molecular weight .
[0125] Example 9: EcN / kpsM GTG Fermentation production of mutant strains in 5 L tank
[0126] This example verifies the feasibility of kpsM weakening strategy in large-scale production of low molecular weight heparosan.
[0127] Strains: EcN / kpsM constructed in Example 4 GTG Mutant strains.
[0128] Fermentation and purification: fermentation medium, fermentation process control and purification method are exactly the same as Example 8.
[0129] Results (see Table 3): EcN / kpsM GTG End point OD of mutant strains in 5 L tank 600 71.6, heparosan production of 2.21 g / L, and molecular weight further reduced to 4.9 kDa.
[0130] Table 3 EcN / kpsM GTG Molecular weight of mutant strains .
[0131] The present application realizes the regulation of heparosan molecular weight by weakening mutation of ATG to GTG of the start codon of kps gene family members (such as kpsC, kpsS, kpsM, kpsT, kpsE, kpsD, etc.) in EcN, and obtains a series of genetically engineered bacteria capable of producing heparosan with different molecular weights. Through the innovative weakening of the expression of kps genes (such as kpsC, kpsS, kpsM, etc.), the customized production of heparosan molecular weight is successfully realized, which provides a new strategy for the development of heparin drugs.
[0132] Although the present application has been disclosed with the preferred embodiments as above, it is not intended to limit the present application, and anyone skilled in the art can make various modifications and modifications without departing from the spirit and scope of the present application, therefore the protection scope of the present application should be defined by the claims.
[0133] SEQ ID NO. 1 Name: Knockout fragment kpsC GTG -FRT-Kan-FRT GTG ATTGGCATTTACTCGCCTGGCATCTGGCGTATTCCGCATCTGGAGAAATTTCTGGCGCAACCGTGCCA
[0134] SEQ ID NO. 2 Name: Knockdown fragment kpsS GTG -FRT-Kan-FRT GTG CAAGGTAATGCACTAACCGTTTTATTATCCGGTAAAAAATATCTGCTATTGCAGGGGCCAATGGGACC
[0135] SEQ ID NO. 3 Name: Knockdown fragment kpsM GTG -FRT-Kan-FRT GTG GCAAGAAGTGGATTTGAAGTCCAGAAAGTCACCGTAGAGGCATTATTTCTACGAGAAATACGAACACG
[0136] SEQ ID NO. 4 Name: Knockdown fragment kpsT GTG -FRT-Kan-FRT GTG ATTAAGATTGAGAATTTGACGAAGTCATATCGTACGCCAACGGGGCGACACTATGTGTTTAAGGATTTAAAC
[0137] SEQ ID NO. 5 Name: Knockdown fragment kpsE GTG -FRT-Kan-FRT GTG TTGATAAAAGTGAAGTCTGCCGTATCCTGGATGCGTGCTCGTCTGTCTGCCATCTCACTGGCAGATAT
[0138] SEQ ID NO. 6 Name: Knockdown fragment kpsD GTG -FRT-Kan-FRT GTG AAATTATTTAAATCAATTTTACTGATTGCCGCCTGTCACGCGGCGCAGGCCAGCGCGACCATTGATAT
Claims
1. A genetically engineered bacterium for producing heparosan precursor with adjustable molecular weight, characterized in that, is a Escherichia coli Nissle 1917 as a chassis bacteria, by homologous recombination, at least one target gene in the kps gene family of the chassis bacteria is replaced with GTG, wherein the target gene is selected from one or more of kpsC 、 kpsS 、 kpsM 、 kpsT 、 kpsE and kpsD .
2. A method for constructing a genetically engineered bacterium for producing heparin precursor with adjustable molecular weight as described in claim 1, characterized in that, comprising the following steps: Step 1, constructing a knockdown fragment containing a GTG mutation site, the knockdown fragment containing upstream and downstream sequences homologous to the target kps gene locus, and a screening marker gene located therebetween; Step 2, introducing the knockdown fragment into EcN competent cells containing pKD46 plasmid, replacing the start codon ATG of at least one target gene in the kps gene family in the chassis strain with GTG by homologous recombination, to obtain a positive clone with a screening marker; Step 3, eliminating the screening marker in the positive clone obtained in step 2 to obtain a strain without the resistance marker, which is the genetically engineered bacteria.
3. The construction method of claim 1, wherein, The knockdown fragment in step 1 is any one or a combination of the following: (1) a nucleotide sequence as shown in SEQ ID NO. 1 kpsC GTG -FRT-Kan-FRT; (2) a nucleotide sequence as shown in SEQ ID NO. 2 kpsS GTG -FRT-Kan-FRT; (3) a nucleotide sequence represented by SEQ ID NO. 3 kpsM GTG -FRT-Kan-FRT; (4) a nucleotide sequence represented by SEQ ID NO. 4 kpsT GTG -FRT-Kan-FRT; (5) a nucleotide sequence represented by SEQ ID NO. 5 kpsE GTG -FRT-Kan-FRT; (6) a nucleotide sequence represented by SEQ ID NO. 6 kpsD GTG -FRT-Kan-FRT.
4. The construction method according to claim 3, characterized in that, The weight average molecular weight of the heparosan precursor is in the range of 4.9 kDa to 24.5 kDa.
5. Use of the genetically engineered bacteria of claim 1 or obtained by the construction method of any one of claims 2-4 in the fermentation production of heparosan precursor.
6. A process for the fermentative production of heparosan of adjustable molecular weight, characterized in that, comprising: (a) inoculating the genetically engineered bacteria of claim 1 or obtained by the construction method of any one of claims 2-4 into a fermentation medium, after seed culture, and fermenting at 37℃, pH 6.75 for 20-24 h, centrifuging the fermentation product to obtain a supernatant; (b) purifying the supernatant by resin adsorption method to obtain the heparosan precursor.
7. The fermentation production process of claim 6, wherein, The fermentation in step (a) is shake flask fermentation or reactor fermentation, and the shake flask fermentation culture parameters are as follows: 37℃, 250 rpm shaking culture for 24 h; the reactor fermentation uses a fed-batch strategy to supplement glucose to maintain carbon source supply; wherein, the fermentation culture parameters are as follows: temperature 37℃, pH 6.75, stirring speed 200 rpm, aeration rate 4 L / min; the fed-batch strategy is: supplementing glucose at a rate of 20 g / h at 4.5-12 h and 40 g / h at 12-20 h.
8. The fermentation production process of claim 6, wherein, The resin adsorption method in step (b) purifies the fermentation broth supernatant, comprising: diluting the supernatant obtained in step (a) and mixing with macroporous resin for adsorption, washing with NaCl solution, eluting, collecting the eluate and then performing concentration, freeze-drying treatment to obtain heparosan precursor.
9. A heparin precursor, characterized in that, The heparosan precursor is produced by the fermentation production method of any one of claims 6-8, and has a weight average molecular weight in the range of 4.9 kDa-24.5 kDa.
10. Use of the heparosan precursor obtained by the fermentation production method of any one of claims 6-8, or the heparosan precursor of claim 9 in the production of heparin or heparin analogs.