Application of circular RNA in diagnosis and treatment of skin squamous cell carcinoma
Patent Information
- Application Number
- CN202511824602.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-01-20
Smart Images

Figure CN121362835A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of biological medicine, and particularly relates to application of circular RNA in diagnosis and treatment of cutaneous squamous cell carcinoma. BACKGROUND
[0002] As the second most common skin malignancy in the world, the annual incidence of cutaneous squamous cell carcinoma (cSCC) shows an upward trend of 7%-10%. The current clinical diagnosis and treatment system relies on two major technical pillars. Histopathological biopsy is the gold standard method, which needs surgical operation to cut the lesion tissue for HE staining and microscopic examination, but has many defects. The invasive operation leads to the risk of bleeding and infection, and the early micro-lesion miss rate is high, and the tumor dynamic evolution cannot be monitored in real time. Imaging technology includes high-frequency ultrasound and dermatoscope, however, this detection technology has insufficient recognition ability for deep invasive lesions. Molecular diagnosis is a new emerging diagnostic technology in recent years, and the current molecular diagnostic markers include miRNA, such as miR-21 and miR-205, but miRNA is easily degraded by RNAase in the circulatory system, and the detection repeatability is poor; linear RNA, such as TP53 gene mutation detection and long-chain non-coding RNA MALAT1, but the linear RNA structure is unstable, and the false negative rate of plasma samples is high.
[0003] The prior art has the following disadvantages: (1) The traditional marker detection has low sensitivity, the AUC of miRNA and linear RNA is generally <0.75, leading to a high early patient miss diagnosis rate and missing the best intervention window. (2) The sample is highly invasive, and must rely on tissue biopsy to obtain sufficient RNA, the patient compliance is poor, and postoperative dynamic monitoring cannot be performed. (3) The detection stability is insufficient, the circulating miRNA is affected by hemolysis and storage temperature, and it is difficult to popularize in primary hospitals.
[0004] Therefore, there is an urgent need for a method and marker for diagnosing cutaneous squamous cell carcinoma with high accuracy, stability, high sensitivity and non-invasiveness. SUMMARY
[0005] The application aims to solve the above technical problems, and provides a marker for diagnosing cutaneous squamous cell carcinoma with high accuracy, stability, high sensitivity and non-invasiveness.
[0006] To achieve the above application purposes, the application provides the following technical solutions. In a first aspect, the application provides application of circular RNA in diagnosis and treatment of cutaneous squamous cell carcinoma, wherein the circular RNA is hsa_circ_PHC3.
[0007] The application also provides application of a circular RNA in preparation of a product for diagnosing and / or treating skin squamous cell carcinoma, wherein the circular RNA is hsa_circ_PHC3.
[0008] In a second aspect, the application provides application of a reagent for detecting a level of hsa_circ_PHC3 in preparation of a skin squamous cell carcinoma diagnosis kit.
[0009] Preferably, the reagent for detecting a level of hsa_circ_PHC3 is a nucleic acid amplification primer and / or a probe.
[0010] Preferably, the reagent for detecting a level of hsa_circ_PHC3 is an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2, and a probe with a nucleotide sequence as shown in SEQ ID NO: 3.
[0011] In a third aspect, the application provides a primer-probe combination for detecting a level of hsa_circ_PHC3, comprising: an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2, and a probe with a nucleotide sequence as shown in SEQ ID NO: 3.
[0012] In a fourth aspect, the application provides a kit comprising the primer-probe combination described in the application.
[0013] Compared with the prior art, the technical scheme of the application has many advantages, has obvious advantages in diagnosis, is non-invasive, can detect plasma samples, realizes non-invasive dynamic monitoring, tracks recurrence risk every month after surgery, has high sensitivity, significantly improves early cancer detection rate by 25% (T1 tumor missed detection rate is reduced from 35% to 12%), has high specificity of 93%, is significantly better than existing markers, avoids cross-reaction with inflammatory diseases, false positive rate is reduced to about 7%, reduces over-treatment, circRNA has high RNase and circRNase resistance, samples can be transported at room temperature, and is suitable for remote medical scenarios; the detection limit is as low as 1x10 3 copies / μL, and is suitable for detecting <0.5mm 3 micro-metastases. In addition, the application also has obvious advantages in industrialization, the production process of the kit is simple, the room temperature stability is high, the room temperature storage can be more than 6 months, which is suitable for primary medical scenarios, so that the storage period is more than 18 months, in addition, the diagnosis cost is saved, compared with the high cost of tissue biopsy, only plasma detection is required, and the primary coverage is effectively improved. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 Dilution factor is shown.
[0015] Figure 2 Amplification curve is shown.
[0016] Figure 3 Expression of hsa_circ_PHC3 parent gene PHC3 is down-regulated in cSCC is shown. DETAILED DESCRIPTION
[0017] The technical solutions of the present application are further described below in conjunction with the drawings and specific examples.
[0018] If not specifically stated, the instruments or reagents used in the examples are conventional instruments or reagents in the art, which are conventional products available on the market. If not specifically stated, the specific experimental operations involved in the text are understood or known by those skilled in the art according to their mastery of common knowledge or conventional technical means, and will not be described one by one.
[0019] 1. Marker screening experiment (circRNA sequencing analysis, preliminary screening) (1) Sample preparation: 30 pairs of cSCC tissue and paracancer normal tissue samples (confirmed by pathology) were collected, frozen in liquid nitrogen and stored at -80℃; (2) Total RNA was extracted by TRIzol method, purity was detected by Nanodrop (OD260 / 280 = 1.8-2.0), and RIN value was verified by Agilent 2100 Bioanalyzer ≥7.0; (3) Arraystar Human circRNA V3.0 chip was used, covering 13617 circRNAs; (4) Sample RNA was digested by Rnase R (1U enzyme / μg RNA, 37℃ incubation for 30 min) to remove linear RNA; (5) RNA fragmentation: Mg 2+ buffer (94℃, 8min) to fragment to 200-300nt; (6) Single-strand cDNA synthesis: random hexamer primer (5'-NNNNNN-3') and Superscript IV reverse transcriptase were added for single-strand cDNA synthesis (50℃, 15min); (7) Double-strand synthesis: dUTP method to construct strand-specific library: dATP / dCTP / dGTP / dUTP + DNA polymerase I (16℃, 60min); (8) Adapter ligation: cDNA end sequence was completed by End Repair Mix (20℃, 30min), and Klenowexo- Add dA (37°C, 30 min); (9) USER enzyme digestion: Illumina Truseq adapter, 15-fold molar excess of adapter, 20°C, 15 min; (10) PCR amplification: Phusion High-Fidelity polymerase (98°C 30 s, 12-15 cycles; 72°C 5 min); (11) Fragment distribution detection: Agilent 2100 Bioanalyzer main peak 280 ± 20 bp; (12) Library quantification: Qubit dsDNA HS Assay kit, use qPCR to quantify individual libraries (Kapa library quantification kit), concentration ≥ 2 nM, CV < 5%; (13) Cluster generation: cBot (Illumina), cluster density 120-140 K / mm 2 ; (14) Sequencing mode: Illumina NovaSeq 6000; PE150 double-end sequencing: Q30 ≥ 85%; Data volume: ≥ 80M reads per sample; (15) Raw data quality control: FastQC; Sequence alignment STAR / BWA and circRNA detection algorithm: CIRCexplorer2, find_circ; (16) circRNA annotation database: circBase / circBank / MiOncoCirc; (17) Differential expression analysis: DESeq2 / edgeR (conditions: |log2FC| > 1 & FDR < 0.05); (18) Screening of differential circRNA (i.e., hsa_circ_PHC3).
[0020] Figure 3 It is shown that the expression of hsa_circ_PHC3 parent gene PHC3 is down-regulated in cSCC. It can be seen that the expression difference of hsa_circ_PHC3 in cancer tissue and normal skin tissue makes it have the potential to become a new type of molecular diagnostic marker. By detecting the expression level of PHC3 in biopsy tissue, it may help to assist in the diagnosis of cSCC.
[0021] 2. Design of diagnostic kit Detection and fixation are performed using probe-based PCR, and a detection kit is developed.
[0022] (1) Sample processing Tissue: ground in liquid nitrogen, extracted by TRIzol method.
[0023] Plasma: 200 μL was taken, and RNA was purified by miRNeasy Serum Kit (Qiagen), incubated at 37℃ for 30 min to eliminate gDNA interference.
[0024] RNA quality control: OD260 / 280 = 1.8~2.0; RIN≥7.0 (tissue), no RIN value is required for plasma.
[0025] (2) cDNA synthesis
[0026] (3) Design and synthesis of specific primers containing cross-splice sites: hsa_circ_PHC3 (derived from parent gene: chr3: 169863211-169867032 5'pad=0 3'pad=0 strand=+) The full exon sequence of the parent gene is:
[0027] The specific primer sequence for amplifying hsa_circ_PHC3 is as follows: forward primer: 5'-GGTAATACTGCCGCTGGTAGA -3' reverse primer: 5'- GCTGTACAGTCTGACATTCCTGT-3' product length 150bp, including primer length.
[0028] The product sequence is as follows: GGTAATACTGCCGCTGGTAGAACTGGAAGCCTGGGAACGGCTTATTAACTGTGCAGGTGTAGGAGAAGTGGAGAGGTTGATCTGAGTAGCTGCAGACTGACAGGAAGATGACGATGACGAGACAACAGGAATGTCAGACTGTACAGC The sequence of the probe is as follows: 5'-**FAM**-GGAGAGGTTGAT (T→L) C (C→L) TGAGTAGCTGCAGA -**MGB**-3 The sequence spans the splice site; L represents a locked nucleotide modification (Locked Nucleic Acid), which aims to increase nuclease resistance and improve the binding efficiency of the target mRNA.
[0029] The specific primer sequence of linear RNA (PHC3 mRNA) is as follows: Forward primer: 5'-ATGCCGAGTTCCTGGTGAAT-3' (within exon 7) Reverse primer: 5'-TGGTGCCATCTTGTTGTTCC-3' (within exon 8) The specific primer sequence of the internal reference gene GAPDH is as follows: Forward primer: 5'-GGAGCGAGATCCCTCCAAAAT-3' Reverse primer: 5'-GGCTGTTGTCATACTTCTCATGG-3' The qRT-PCR amplification system is as follows:
[0030] The typical qRT-PCR reaction system after optimization is as follows:
[0031] The qRT-PCR amplification program is as follows:
[0032] (4) Fluorescence threshold (Threshold) setting: Instrument automatically calculates (e.g. ABI QuantStudio: Baseline 3-15 cycles, Threshold = 10 x background standard deviation).
[0033] (5) Ct value recording: Ct value of each sample needs to meet: Ct of internal reference gene < 28 (otherwise, sample degradation); Complex hole requirement: standard deviation of Ct value ≤ 0.5.
[0034] (6) Inhibitor tolerance test: Add heparin (0.5 IU / mL) to healthy plasma: Ct value offset ≤ 1.0; Hemoglobin (2 mg / mL): Ct value offset ≤ 1.5.
[0035] (7) Data analysis Standard curve preparation Standard preparation: Clone hsa_circ_PHC3 sequence (SEQ ID NO: 4) into pCR2.1 vector, transcribe in vitro to generate circRNA mimic (T7 RNA polymerase), gradient dilution: 10 7 → 10 0 copies / μL. Dilution multiples are shown as Figure 1 indicated.
[0036] Standard curve equation is as follows: Ct = -3.32 x log10 (copy number) + 36.18 (R 2 ≥ 0.99) Sample copy number calculation is as follows: copies / μL = 10^[(Ct - intercept) / slope] (8) Detection kit components Detection kit components are shown in Table 1 below.
[0037] Table 1. Detection kit components
[0038] 3. Clinical verification Sample processing: collect 1 mL of plasma from skin squamous cell carcinoma patients (confirmed by pathology, without receiving radiotherapy and chemotherapy), extract total RNA (TRIzol method).
[0039] qRT-PCR detection: the above-mentioned optimized typical qRT-PCR reaction system (20 μL) contains 2x UDG enzyme mix, primer, probe and detection sample; reaction condition: 95℃ 2 min; 95℃ 15 sec, 60℃ 30 sec, 40 cycles.
[0040] Result interpretation: if the ΔCt value (target gene Ct value-GAPDH Ct value) is > 3.0, it is determined to be positive.
[0041] Clinical sample verification experiment Based on the verification of 200 clinical plasma samples of skin squamous cell carcinoma patients, the AUC of the kit of the application is 0.89, the sensitivity is 82% (average), the specificity is 93% (average), and the minimum detection limit is 1x10 3 copies / μL, suitable for detecting <0.5mm 3 micro metastases. Compared with existing markers, cross-reaction with inflammatory diseases is avoided, the false positive rate is reduced to about 7%, and over-treatment is reduced, indicating that the diagnostic marker hsa_circ_PHC3 has high accuracy and clinical application value in identifying skin squamous cell carcinoma.
[0042] The plasma samples of skin squamous cell carcinoma patients at different disease stages were detected, and the positive rates of the early cancer group and the non-early cancer group are shown in Table 2.
[0043] Table 2. Comparison of positive rates of early cancer group and non-early cancer group
[0044] Note: "early cancer group" refers to early micro-infiltration cSCC (carcinoma in situ); "non-early cancer group" refers to high-risk invasive cSCC.
[0045] As shown in Table 2, the detection rate of early cancer is significantly improved, and the detection positive rate of the early cSCC group is significantly higher than that of the high-risk invasive cSCC group, which has important clinical application potential for early diagnosis and screening of cSCC.
[0046] The kit of the application has simple production process and high room temperature stability, and can be stored at room temperature for more than 6 months.
[0047] The amplification curve is shown in Figure 2 .
[0048] The Ct value of the hsa_circ_PHC3 standard is shown in Table 3 below.
[0049] Table 3. Ct value of hsa_circ_PHC3 standard
[0050] The standard curve is calculated as follows:
[0051] The above description is only the preferred embodiment of the present application, and does not limit the present application in any form. Any simple modification, equivalent change and modification of the above embodiment according to the technical essence of the present application, without departing from the technical solution of the present application, still belongs to the scope of the technical solution of the present application.
Claims
1. Use of a circular RNA, which is hsa_circ_PHC3, in the preparation of a product for diagnosing and / or treating squamous cell carcinoma of the skin.
2. Use of a reagent for detecting the level of hsa_circ_PHC3 in the preparation of a diagnostic kit for squamous cell carcinoma of the skin.
3. Use according to claim 2, characterized in that, The reagent for detecting the level of hsa_circ_PHC3 is a nucleic acid amplification primer and / or probe.
4. Use according to claim 2, characterized in that, The reagent for detecting the level of hsa_circ_PHC3 is the following primer and probe: an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2, and a probe with a nucleotide sequence as shown in SEQ ID NO:
3.
5. A primer probe combination for detecting the level of hsa_circ_PHC3, comprising: The reagent for detecting the level of hsa_circ_PHC3 is the following primer and probe: an upstream primer with a nucleotide sequence as shown in SEQ ID NO: 1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: 2, and a probe with a nucleotide sequence as shown in SEQ ID NO:
3.
6. A kit comprising the primer probe combination of claim 5.