Molecular marker of interferon gene stimulating factor and application of molecular marker

Abstract

The invention discloses a molecular marker of an interferon gene stimulating factor and application of the molecular marker. Specifically, the invention provides a molecular marker related to fish infectious spleen and kidney necrosis disease resistance, the marker is located at the 315th site of an interferon gene stimulating factor (STING) protein coding amino acid sequence, and the polymorphism of the marker comprises lysine (K), threonine (T), glutamine or arginine. It is found that when the molecular marker is an amino acid (such as K or T) which can be ubiquitinated, STING containing the molecular marker can be ubiquitinated by VP012R of ISKNV and cause degradation, so that ISKNV can escape from interferon reaction of a host, and the host is dead; on the contrary, when the site is the amino acid which cannot be ubiquitinated, the host can resist ISKNV infection through interferon reaction, so that disease resistance is shown. The molecular marker provided by the invention can be used as a target spot for screening disease-resistant individuals or breeding new disease-resistant strains.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology, and particularly relates to a molecular marker of interferon gene stimulator and application thereof. BACKGROUND

[0002] Iridovirus is a general term for viruses in the Iridoviridae family of the Pimascovirales order of the Megaviricetes class, and is a large icosahedral virus containing a double-stranded DNA genome. Infectious spleen and kidney necrosis virus (ISKNV) is a representative species of the Megalocytivirus genus in the Iridoviridae family, and is a serious viral pathogen of fish that can cause diseases in about 180 species of freshwater and marine fish, including Siniperca, Epinephelus and Lateolabrax japonicus. Since its discovery, the virus has rapidly become one of the major threats to global aquaculture due to its wide host range, high pathogenicity and lack of effective treatment measures.

[0003] In related technologies, for viral pathogens that lack targeted treatment drugs, breeding of aquaculture varieties with disease resistance is an efficient and effective response, which is extremely critical for reducing economic losses in the aquaculture industry caused by infectious spleen and kidney necrosis virus. Studies have shown that innate immunity is one of the important ways for the body to resist pathogens, and the interferon (IFN) pathway is one of the key pathways against viral pathogens. The stimulator of interferon genes (STING) pathway is a central regulator of cytosolic DNA sensing in vertebrates. After detecting viral DNA, STING is transported from the endoplasmic reticulum to the Golgi apparatus, recruiting TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3) to activate interferon and inflammatory responses. Previous studies have shown that for this important antiviral pathway of the host, many viruses have various immune evasion strategies, including the immune evasion strategy of targeted degradation of STING, which is widely present in many viruses, including ISKNV. However, the degradation pathway and target of ISKNV against host STING are still unclear.

[0004] Therefore, clarifying the key pathway and factors of ISKNV degrading STING can provide a potential target for targeted breeding of disease-resistant strains. SUMMARY

[0005] The present application aims to at least solve one of the technical problems existing in the prior art. To this end, the present application proposes a molecular marker related to fish infectious spleen and kidney necrosis virus resistance.

[0006] The application further provides a molecular marker combination.

[0007] The application further provides a reagent for detecting the molecular marker related to the resistance of fish to infectious spleen and kidney necrosis disease or the molecular marker combination.

[0008] The application further provides a detection kit.

[0009] The application further provides a molecular marker detection device.

[0010] The application further provides related applications of the molecular marker related to the resistance of fish to infectious spleen and kidney necrosis disease or the molecular marker combination as a target.

[0011] The application further provides related applications of the reagent, the detection kit or the molecular marker detection device.

[0012] The application further provides a method for identifying or screening fish susceptible to infectious spleen and kidney necrosis disease.

[0013] In a first aspect of the application, a molecular marker related to the resistance of fish to infectious spleen and kidney necrosis disease is provided, wherein the molecular marker is located at the 315th amino acid of the amino acid sequence of the interferon gene stimulator protein coding, and the polymorphism is lysine, threonine, glutamine or arginine.

[0014] In some embodiments of the application, the amino acid sequence of the interferon gene stimulator protein comprises any one of CRNRYXLILLD, CRNRFXLVLID, CRNRYXLILLN, CRNRYXLVLLN, CRNRYXLVLIK, CRNRYXLILIK, CRNRFXLILLN, CRNRYXLILIN, CRNHYXLILLN or CRNRYXLILLK, wherein X in the amino acid sequence represents the 315th amino acid.

[0015] In some embodiments of the application, when the polymorphism of the molecular marker is lysine and threonine, it is determined that the mortality of the host after being infected with ISKNV is high.

[0016] Preferably, the mortality is ≥80%.

[0017] Preferably, the host includes but is not limited to any one of Siniperca chuatsi, Micropterus salmoides, Lates calcarifer, Plectropomus leopardus, Epinephelus fuscoguttatus, Epinephelus lanceolatus, Epinephelus coioides, Mugil cephalus, Scophthalmus maximus, Paralichthys olivaceus, Seriola dumerili, Larimichthys crocea and Oreochromis niloticus.

[0018] When the polymorphism of the molecular marker is an amino acid that can be ubiquitinated (such as lysine and threonine), the fish STING containing the molecular marker can be ubiquitinated by the VP012R of ISKNV and lead to degradation, which makes ISKNV can escape the interferon response of the host, eventually leading to the death of the host.

[0019] In some embodiments of the present application, when the polymorphism of the molecular marker is glutamine or arginine, it is determined that the mortality of the host after being infected with ISKNV is low;

[0020] Preferably, the mortality is ≤25%;

[0021] Preferably, the host includes but is not limited to any one of Ctenopharyngodon idella, Cyprinus carpio, Carassius auratus, Gasterosteus aculeatus, Xiphophorus hellerii, Xiphophorus maculatus, Poecilia latipinna, Poecilia reticulata and Danio rerio.

[0022] When the polymorphism of the molecular marker is an amino acid that cannot be ubiquitinated (such as arginine and glutamine), the fish STING containing the molecular marker cannot be ubiquitinated by VP012R of ISKNV, and the host can resist ISKNV infection through its own strong interferon response, thereby showing disease resistance.

[0023] The present application finds that when the fish STING has a site homologous to the 315th lysine of Siniperca chuatsi which is an amino acid that cannot be ubiquitinated, the STING cannot be ubiquitinated by VP012R, such as zebrafish STING and crucian carp STING; and when the site homologous to the 315th lysine of Siniperca chuatsi is an amino acid that can be ubiquitinated, the STING can be ubiquitinated by VP012R, thereby leading to degradation, such as large-mouth bass STING. At the same time, when the 315th lysine of Siniperca chuatsi is mutated to another threonine which can also be ubiquitinated, the mutated Siniperca chuatsi STING can also be ubiquitinated by VP012R, thereby leading to degradation. Our research provides new insights for ISKNV to escape the host innate immunity, determines STING as a key protein, and determines the site homologous to the 315th lysine of Siniperca chuatsi as a potential target, which is expected to be used for screening disease-resistant individuals or cultivating new strains with disease resistance.

[0024] In some embodiments of the present application, when the host is Siniperca chuatsi, the interferon gene stimulator encodes an amino acid as shown in NCBI Reference Sequence: XP_044060216.1.

[0025] In a second aspect of the present application, a molecular marker combination is provided, comprising:

[0026] a first molecular marker, the first molecular marker being the molecular marker associated with resistance to fish infectious spleen and kidney necrosis disease according to the first aspect; and

[0027] a second molecular marker, the second molecular marker being located at the 196th amino acid of the interferon gene stimulator, wherein the polymorphism of the second molecular marker is cysteine, threonine, tryptophan or arginine.

[0028] In a third aspect of the present application, a reagent for detecting the molecular marker associated with resistance to fish infectious spleen and kidney necrosis disease according to the first aspect or the molecular marker combination according to the second aspect is provided.

[0029] In some embodiments of the present application, the reagent includes a reagent for detecting a nucleic acid sequence based on PCR amplification, in situ hybridization, gene chip, gene sequencing; and / or a reagent for detecting a protein or polypeptide sequence based on an immune detection method, mass spectrometry, enzymatic hydrolysis, chemical cleavage.

[0030] In a fourth aspect of the present application, a detection kit is provided, comprising the reagent of the third aspect.

[0031] In a fifth aspect of the present application, a molecular marker detection device is provided, comprising:

[0032] an acquisition system for acquiring a sample to be detected;

[0033] a detection system for detecting the sample to be detected using the reagent of the third aspect;

[0034] an analysis system for analyzing and judging the detection result of the detection system;

[0035] a storage system for storing the sample to be detected acquired by the acquisition system, and / or the detection result of the detection system, and / or the analysis and judgment result of the analysis system.

[0036] In some embodiments of the present application, the sample to be detected can be any one or more of a fish tissue sample, a fish cell line sample, and an environmental sample.

[0037] In some embodiments of the present application, when the polymorphism of the molecular marker is lysine and threonine, it is determined that the mortality after infection with ISKNV is high; preferably, the mortality is ≥ 80%.

[0038] In some embodiments of the present application, when the polymorphism of the molecular marker is glutamine or arginine, it is determined that the mortality of the host after infection with ISKNV is low; preferably, the mortality is ≤ 25%.

[0039] In a sixth aspect of the present application, the molecular marker associated with the resistance to infectious spleen and kidney necrosis disease of fish of the first aspect or the combination of molecular markers of the second aspect is used as a target in any one of the following:

[0040] A1) preparing a reagent for predicting or detecting the susceptibility of fish to infectious spleen and kidney necrosis disease;

[0041] A2) preparing a reagent for identifying or breeding fish varieties with low susceptibility to infectious spleen and kidney necrosis disease;

[0042] A3) molecular marker assisted breeding of fish susceptibility to infectious spleen and kidney necrosis disease;

[0043] A4) improvement of fish varieties related to susceptibility to infectious spleen and kidney necrosis disease;

[0044] A5) improvement of germplasm resources of fish.

[0045] In a seventh aspect, the present application provides use of the reagent of the third aspect, the detection kit of the fourth aspect or the molecular marker detection device of the fifth aspect in any one of the following:

[0046] B1) predicting or detecting the susceptibility of fish to infectious spleen and kidney necrosis disease;

[0047] B2) identifying or breeding fish varieties with low susceptibility to infectious spleen and kidney necrosis disease;

[0048] B3) molecular marker assisted breeding of fish susceptibility to infectious spleen and kidney necrosis disease;

[0049] B4) improvement of fish varieties related to susceptibility to infectious spleen and kidney necrosis disease;

[0050] B5) improvement of germplasm resources of fish.

[0051] In the present application, the improvement of fish varieties related to susceptibility to infectious spleen and kidney necrosis disease includes breeding of fish using the aforementioned molecular marker, for example, in the breeding process, offspring are selected to contain individuals with disease-resistant STING genotypes.

[0052] In an eighth aspect, the present application provides a method for identifying or screening the susceptibility of fish to infectious spleen and kidney necrosis disease, comprising: detecting the polymorphism of the sample to be detected using the reagent of the third aspect, and determining the susceptibility of the sample to be detected to infectious spleen and kidney necrosis disease according to the detection result;

[0053] In the present application, the standard for determination is: when the polymorphism of the molecular marker at the 315th amino acid of the interferon gene stimulator protein coding amino acid sequence is lysine or threonine, it is determined as high susceptibility to infectious spleen and kidney necrosis disease, i.e. the mortality rate is ≥ 80%; when the polymorphism of the molecular marker at the 315th amino acid of the interferon gene stimulator protein coding amino acid sequence is arginine or glutamine, it is determined as low susceptibility to infectious spleen and kidney necrosis disease, i.e. the mortality rate is ≤ 25%.

[0054] Other features and advantages of the present application will be illustrated in the following description, and some will become apparent from the description, or will be understood by those skilled in the art through implementation of the present application. BRIEF DESCRIPTION OF DRAWINGS

[0055] The present application will be further described below in conjunction with the drawings and examples, wherein:

[0056] Figure 1Related experimental results of the ISKNV protein VP012R targeting the C-terminal domain of the giant salmon STING through its N segment, wherein: A is the result of detecting the interaction between VP012R and the giant salmon STING by yeast two-hybrid experiment; B and C are the results of detecting the interaction between VP012R and the giant salmon STING by Co-IP after transfecting Flag-scSTING and Myc-ORF012R plasmids into FHM cells; D is a segmented schematic diagram of the giant salmon STING; E is the result of detecting the interaction between VP012R and different segments of the giant salmon STING by Co-IP after transfecting different giant salmon STING segment plasmids and Myc-ORF012R plasmids into FHM cells; F is a segmented schematic diagram of VP012R; G is the result of detecting the interaction between different segments of VP012R and the giant salmon STING by Co-IP after transfecting Flag-scSTING and different VP012R segment plasmids into FHM cells; and H is the result of verifying the interaction between the N segment of VP012R and the C segment of the giant salmon STING by Co-IP after transfecting Flag-scSTING (140-417) and Myc-ORF012R (1-60) plasmids into FHM cells.

[0057] Figure 2 Related experimental results of the ISKNV protein VP012R mediating the ubiquitination and degradation of the giant salmon STING, wherein: A is the result of VP012R degrading the giant salmon STING after transfecting Flag-scSTING and Myc-ORF012R plasmids into MFF-1 cells; B is the result of VP012R degrading the giant salmon STING after transfecting Flag-scSTING and Myc-ORF012R plasmids into FHM cells; C is the result of VP012R degrading the giant salmon STING after transfecting Flag-scSTING and Myc-ORF012R plasmids into FHM cells and using different drugs for treatment; D is the result of VP012R degrading the giant salmon STING after transfecting Flag-scSTING and Myc-ORF012R plasmids into FHM cells and using different concentrations of MG132 for treatment; E is the result of VP012R degrading the giant salmon STING at different time points after transfecting Flag-scSTING and Myc-ORF012R plasmids into FHM cells and using MG132 for treatment; and F is the result of detecting the ubiquitination level of the giant salmon STING after transfecting Flag-scSTING and Myc-ORF012R plasmids into FHM cells.

[0058] Figure 3 Segmented schematic diagram of the giant salmon STING.

[0059] Figure 4Fig. 12 is a degradation result of VP012R on different segments of Megalobrama amblycephala STING and a ubiquitination level of different segments of Megalobrama amblycephala STING after different Megalobrama amblycephala STING segment plasmids and Myc-ORF012R plasmids are transfected into FHM cells, wherein A is a degradation result of VP012R on Megalobrama amblycephala STING (1-140) segment; B is a degradation result of VP012R on Megalobrama amblycephala STING (141-417) segment; C is a degradation result of VP012R on Megalobrama amblycephala STING (1-180) segment; D is a degradation result of VP012R on Megalobrama amblycephala STING (181-417) segment; E is a degradation result of VP012R on Megalobrama amblycephala STING (1-245) segment; F is a degradation result of VP012R on Megalobrama amblycephala STING (217-417) segment; and G is a detection result of ubiquitination levels of different segments of Megalobrama amblycephala STING.

[0060] Figure 5 Fig. 13 is a degradation result of VP012R on different mutants of Megalobrama amblycephala STING and a degradation result of VP012R on different mutants of Megalobrama amblycephala STING, wherein A is a mutant diagram of Megalobrama amblycephala STING; B is a degradation result of VP012R on Megalobrama amblycephala STING-KR mutant; C is a degradation result of VP012R on Megalobrama amblycephala STING-CR mutant; and D is a degradation result of VP012R on Megalobrama amblycephala STING-CKR mutant.

[0061] Figure 6 Fig. 14 is a degradation result of VP012R on different cysteine restoration mutants of Megalobrama amblycephala STING after different Megalobrama amblycephala STING cysteine restoration mutant plasmids and Myc-ORF012R plasmids are transfected into FHM cells, wherein A is a degradation result of VP012R on Megalobrama amblycephala STING-CKR196C mutant; B is a degradation result of VP012R on Megalobrama amblycephala STING-CKR262C mutant; and C is a degradation result of VP012R on Megalobrama amblycephala STING-CKR310C mutant.

[0062] Figure 7 Fig. 15 is a degradation result of VP012R on Megalobrama amblycephala STING-CKR315K mutant after Megalobrama amblycephala STING-CKR315K mutant plasmid and Myc-ORF012R plasmid are transfected into FHM cells.

[0063] Figure 8Degradation results of VP012R on different Mandarin fish STING lysine back-mutant plasmids and Myc-ORF012R plasmids transfected into FHM cells, wherein: A is the degradation result of VP012R on Mandarin fish STING-CKR202K mutant; B is the degradation result of VP012R on Mandarin fish STING-CKR216K mutant; C is the degradation result of VP012R on Mandarin fish STING-CKR246K mutant; D is the degradation result of VP012R on Mandarin fish STING-CKR258K mutant; E is the degradation result of VP012R on Mandarin fish STING-CKR332K mutant; F is the degradation result of VP012R on Mandarin fish STING-CKR343K mutant; G is the degradation result of VP012R on Mandarin fish STING-CKR365K mutant; H is the degradation result of VP012R on Mandarin fish STING-CKR404K mutant; I is the degradation result of VP012R on Mandarin fish STING-CKR416K mutant.

[0064] Figure 9 Degradation results of VP012R on different Mandarin fish STING mutant (mutated to R) and Myc-ORF012R plasmids transfected into FHM cells, wherein: A is the degradation result of VP012R on Mandarin fish STING-C196R mutant; B is the degradation result of VP012R on Mandarin fish STING-K315R mutant; C is the degradation result of VP012R on Mandarin fish STING-C196R / K315R mutant.

[0065] Figure 10 Ubiquitination levels of different Mandarin fish STING mutant plasmids and Myc-ORF012R plasmids transfected into FHM cells, wherein: A is the ubiquitination level detection result of Mandarin fish STING-CKR196C, STING-CKR315K and STING-CKR mutant; B is the ubiquitination level detection result of Mandarin fish STING-C196R, STING-K315R and STING-C196R / K315R mutant.

[0066] Figure 11 Degradation results of VP012R on Mandarin fish STING C196 cysteine and K315 lysine mutant using different drugs after different Mandarin fish STING mutant plasmids and Myc-ORF012R plasmids are transfected into FHM cells.

[0067] Figure 12A phylogenetic tree of STING of fish infected with ISKNV and its related statistical analysis results of the present application, wherein: A is a phylogenetic tree of STING of fish infected with ISKNV; B is a statistical result of mortality of fish infected with ISKNV after being infected with ISKNV; C is a result of amino acid sequence alignment of STING protein of fish infected with ISKNV.

[0068] Figure 13 Laboratory mortality of fish infected with ISKNV after being soaked in ISKNV and degradation results of VP012R on different types of STING, wherein: A is a statistical result of mortality of largemouth bass after being soaked in ISKNV; B is a statistical result of mortality of crucian carp after being soaked in ISKNV; C is a statistical result of mortality of guppy after being soaked in ISKNV; D is a statistical result of mortality of red swordtail after being soaked in ISKNV; E is a degradation result of VP012R on zebrafish STING; F is a degradation result of VP012R on crucian carp STING; G is a degradation result of VP012R on zebrafish STING-G301K mutant; H is a degradation result of VP012R on largemouth bass STING; I is a degradation result of VP012R on largemouth bass STING-CKR-315T mutant. DETAILED DESCRIPTION

[0069] The concept and technical effects of the present application will be described below in conjunction with the embodiments to make the purpose, features and effects of the present application clear, complete and fully understood. Obviously, the described embodiments are only a part of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0070] In the embodiments of the present application, the sources of experimental materials and their related information are as follows:

[0071] Fish: Mandarin fish, largemouth bass, crucian carp, guppy and red swordtail were purchased from a commercial fish farm in Guangdong.

[0072] Cells: MFF-1 cells were cultured in DMEM medium added with 10% fetal bovine serum. FHM cells were cultured in M199 medium added with 10% fetal bovine serum. Both cell lines were cultured at 27°C in an environment containing 5% CO2.

[0073] Virus: ISKNV strain (GenBank: OP896201.1) was isolated from a mandarin fish farm in Foshan, Guangdong, and was preserved in the team of Professor Guo Changjun, School of Life Sciences, Sun Yat-sen University. It was propagated by infecting MFF-1 cells.

[0074] Antibodies: Mouse monoclonal anti-Myc antibody and mouse monoclonal anti-Flag antibody were purchased from Sigma-Aldrich. Rabbit monoclonal anti-HA antibody was purchased from CST. GAPDH antibody was purchased from Abways. HRP-labeled goat anti-mouse IgG (H+L) and HRP-labeled goat anti-rabbit IgG (H+L) were purchased from Promega.

[0075] Reagents: Iodoacetamide (IAA) was purchased from CST. Proteasome inhibitor MG132, CHX and 3-MA were purchased from MedChemExpress. Aureobasidin A (AbA) was purchased from MeilunBio. α-galactosidase (X-α-Gal) was purchased from Coolaber.

[0076] In the embodiments of the present application, all animal experiments were performed in accordance with the Guidelines for the Care and Use of Laboratory Animals of Sun Yat-Sen University (2022032501), ensuring compliance with the ethical regulations for the use of animals.

[0077] Unless otherwise specified in the examples, the routine conditions or the conditions recommended by the manufacturer were used. Unless otherwise specified, the reagents or instruments used were conventional products that can be obtained by commercial purchase.

[0078] Example 1: Study on the interaction between infectious spleen and kidney necrosis virus protein VP012R and Siniperca chuatsi STING

[0079] 1. Yeast two-hybrid experiment:

[0080] To confirm whether the Siniperca chuatsi interferon gene stimulator (STING) is the target of VP012R, the present application verified the interaction between VP012R and Siniperca chuatsi STING protein through yeast two-hybrid experiment. In the yeast two-hybrid experiment, the transmembrane domain may prevent the protein from entering the nucleus of the yeast cell that activates the reporter gene, resulting in false negative results. To avoid this problem, the present experiment constructed a truncated Siniperca chuatsi STING (scSTING-C) lacking the transmembrane domain.

[0081] The amino acid sequence information of scSTING-C is as follows:

[0082] ASIAAFRATHHISSPFCGRGSRKLLILIPLNANISHKLEDEDNNIRFYDNLPNTEIDRAGVRRRVYKHSVYTVLNEHGKAHECVVEYATPLLTLYSMSQESSAGFGEPERRQQVLLFYRTLQDILERSLECRNHYKLILLNDENEDDPHFLSKAILRHLQQQEKEEFYLTPPDDGDGAPVGTNFAKMVDPLVQISSAIDRDWHHPEPMSREPTLMYSLEEPQPLKEPVENTDHYYGKI* (SEQ ID NO. 1). Wherein * refers to a stop codon.

[0083] The nucleotide sequence information corresponding to the above scSTING-C is as follows:

[0084] GCTTCCATCGCAGCATTTCGTGCCACCCATCACATCAGCAGCCCCTTCTGCGGTCGTGGCTCCAGGAAGCTCCTCATCCTCATACCTCTCAATGCCAACATCTCTCACAAGCTGGAGGATGAGGACAACAACATCCGTTTCTATGACAACCTCCCCAACACTGAGATTGACAGGGCAGGAGTCCGGCGGCGGGTCTACAAGCACAGCGTCTACACAGTACTGAACGAGCATGGGAAGGCCCATGAGTGTGTGGTGGAGTATGCAACGCCTCTGCTGACGCTTTACAGCATGTCCCAGGAGAGCAGCGCTGGTTTCGGGGAGCCTGAGCGCAGACAGCAGGTTCTGCTGTTCTACAGGACCCTGCAGGACATACTGGAGCGCTCGCTGGAGTGTCGCAACCACTACAAACTCATCCTGCTCAATGATGAGAATGAAGACGACCCTCACTTCCTGTCCAAGGCCATCCTCAGACACCTGCAGCAGCAGGAGAAAGAGGAGTTCTACCTCACCCCACCTGATGATGGAGATGGTGCGCCTGTTGGCACAAACTTCGCCAAGATGGTGGACCCGTTGGTGCAAATTTCAAGTGCCATAGACAGGGACTGGCACCACCCTGAGCCAATGAGCAGGGAGCCCACGCTCATGTATAGCCTGGAGGAACCTCAGCCTCTAAAGGAACCTGTTGAGAACACCGACCATTATTATGGAAAAATATAA (SEQ ID NO. 2).

[0085] The yeast two-hybrid experiment is performed as follows:

[0086] pGBKT7-scSTING-C and pGADT7-ORF012R are transformed into yeast Y2HGold or Y187 strains, and the proteins are expressed as GAL4 DNA binding domain (BD) or GAL4 activation domain (AD) fusion proteins, respectively. Then, the interaction between VP012R and scSTING-C is identified using the Matchmaker Gold Y2H system according to the manufacturer's instructions.

[0087] The detection results are as follows: Figure 1As shown in A of FIG. 1, yeast two-hybrid experiment proved that VP012R and Megalobrama amblycephala STING-C interact with each other.

[0088] 2. Co-immunoprecipitation experiment:

[0089] This embodiment further verifies the interaction between VP012R and Megalobrama amblycephala STING by co-immunoprecipitation (Co-IP) experiment.

[0090] Firstly, the present application verifies the interaction between VP012R and Megalobrama amblycephala STING by Co-IP experiment, which specifically comprises: after transfecting Flag-scSTING and Myc-ORF012R plasmids into FHM cells, the interaction between VP012R and Megalobrama amblycephala STING is detected by Co-IP. The results are shown in FIG. 1. Figure 1 As shown in B and C of FIG. 1, the complex precipitated by anti-Flag antibody can be recognized by anti-Myc antibody, and the complex precipitated by anti-Myc antibody can be recognized by anti-Flag antibody, which proves that VP012R and Megalobrama amblycephala STING interact with each other.

[0091] The co-immunoprecipitation method is as follows:

[0092] After the cells are cultured to 95-100% density, they are transfected with various plasmid combinations. After 24 hours of transfection, the cells are lysed with lysis buffer and incubated with Protein G Plus-Agarose immunoprecipitation reagent and antibodies at room temperature for 1 hour. The above complex is washed with lysis buffer for three times, centrifuged, resuspended and subjected to Western blot analysis after heating at 100℃ for 10 minutes. Protein bands are detected using High-sig ECL western blotting substrate, and visualized using Amersham ImageQuant 800 system.

[0093] Further, in order to explore the key region mediating the interaction between VP012R-scSTING, the present experiment constructs truncated mutants: scSTING (1-140) (containing N-terminal and transmembrane domain) and scSTING (141-417) (deleting transmembrane domain, containing C-terminal domain), wherein the schematic diagram of the segments of Megalobrama amblycephala STING is shown in D of FIG. 1. Then different Megalobrama amblycephala STING segment plasmids and Myc-ORF012R plasmids are transfected into FHM cells, and the interaction between VP012R and different segments of Megalobrama amblycephala STING is detected by Co-IP. Figure 1

[0094] The results are shown in FIG. 2. Figure 1 ​As shown in F of FIG. 1, when Flag-scSTING (141-417) was transfected, the complex precipitated by the anti-Flag antibody could be recognized by the anti-Myc antibody, proving that there was an interaction between VP012R and the C-terminal domain of the Megalobrama stenosseri STING.

[0095] Furthermore, the present application constructed N-terminal truncated mutants of VP012R: VP012R (1-60) containing the RING domain and VP012R (61-110) lacking the RING domain, wherein the schematic diagram of the VP012R segments is as shown in Figure 1 Then, after the FHM cells were transfected with Flag-scSTING and different VP012R segment plasmids, the interaction of the different VP012R segments with the Megalobrama stenosseri STING was detected by Co-IP. The results are shown in Figure 1 G of FIG. 1, showing that the full-length Megalobrama stenosseri STING could interact with the VP012R (1-60) mutant containing the RING domain after co-transfection.

[0096] In addition, in order to accurately locate the interaction region, the Myc-ORF012R (1-60) plasmid containing the RING domain and the Flag-scSTING (141-417) plasmid containing the C-terminal domain were co-transfected into FHM cells, and then the interaction of VP012R with the C segment of Megalobrama stenosseri STING through its N segment was verified by Co-IP. The results are shown in Figure 1 H of FIG. 1, Co-IP showed that the VP012R (1-60) complex precipitated by the anti-Myc antibody could be recognized by the anti-Flag antibody.

[0097] The above results show that the infectious spleen and kidney necrosis virus protein VP012R can interact with the C-terminal domain of Megalobrama stenosseri STING through its N-terminal RING domain.

[0098] Example 2: ISKNV protein VP012R mediates ubiquitination and degradation of Megalobrama stenosseri STING

[0099] 1. Protein level detection:

[0100] In order to further explore the regulatory effect of VP012R on Megalobrama stenosseri STING, the present embodiment detected the effect of VP012R on Megalobrama stenosseri STING at the protein level. Specifically, it includes:

[0101] After the FFF-1 cells or FHM cells were co-transfected with Flag-scSTING and Myc-ORF012R plasmids, the content of Megalobrama stenosseri STING in the sample was detected by Western blot experiment using Flag antibody to detect the degradation of Megalobrama stenosseri STING by VP012R.

[0102] Western blotting was performed as follows:

[0103] Cells were transfected with various plasmid combinations when they reached 95-100% confluence. 24 hours after transfection, cells were lysed with lysis buffer, centrifuged, resuspended and heated at 100°C for 10 minutes before Western blotting analysis. GAPDH content in samples was detected with GAPDH antibody as internal control. Protein bands were detected using High-sig ECL western blotting substrate and visualized using Amersham ImageQuant 800 system.

[0104] Results showed that Myc-ORF012R transfection enhanced the degradation of mandarin fish STING in MFF-1 cells (A) and FHM cells (B) as the amount of Myc-ORF012R transfection increased. Figure 2 Figure 2 Results showed that Myc-ORF012R transfection enhanced the degradation of mandarin fish STING in MFF-1 cells (A) and FHM cells (B) as the amount of Myc-ORF012R transfection increased.

[0105] 2. Protein degradation pathway exploration:

[0106] There are three main protein degradation pathways in organisms: ubiquitin-proteasome pathway, autophagy pathway and lysosome pathway. To determine the specific pathway of VP012R-mediated degradation of mandarin fish STING, FHM cells co-transfected with Myc-ORF012R and Flag-scSTING were treated with MG132 (proteasome inhibitor), 3-MA (autophagy inhibitor) or NH4Cl (lysosome inhibitor) to block specific degradation pathways. The specific experimental method is as follows:

[0107] Cells were transfected with various plasmid combinations when they reached 95-100% confluence. 24 hours after transfection, cells were treated with MG132 (20 μM), 3-MA (5 mM) or NH4Cl (20 mM), respectively. 12 hours after drug treatment, cells were lysed and Western blotting analysis was performed using the same method as above.

[0108] Results showed that MG132 could inhibit VP012R-mediated degradation of mandarin fish STING, while 3-MA and NH4Cl had no such effect (as shown in C of Figure 2 ). In addition, the level of mandarin fish STING protein in cells was positively correlated with the concentration of MG132 (as shown in D of Figure 2 ). Experiments using 100 μg / mL of CHX (a protein synthesis inhibitor) further confirmed that MG132 could inhibit VP012R-induced degradation of mandarin fish STING protein (as shown in E of Figure 2 ).

[0109] 3. Ubiquitination experiment: ​

[0110] Since proteasome-dependent degradation is usually triggered by ubiquitination modification, and VP012R is an E3 ubiquitin ligase, the present application conducts ubiquitination experiment in the presence of MG132 to verify whether the degradation of Megalobrama amblycephala STING involves ubiquitination. The specific experimental method is as follows:

[0111] After transfecting Flag-scSTING and Myc-ORF012R plasmids into FHM cells, the ubiquitination level of Megalobrama amblycephala STING was detected. Among them, HA-Ubiquitin plasmid (purchased from Wuhan Moli Biological Technology Co., Ltd.) was used to provide HA-tagged ubiquitination modification, and transfection reagent was added according to the manufacturer's instructions. Except as otherwise specified, equal amount of plasmid was transfected in each parallel experiment, and equal amount of transfection reagent was added in the control experiment. According to different experimental requirements, the corresponding label antibody was used to detect the overexpressed protein, the HA antibody was used to detect the ubiquitination level of the protein to be tested in the sample, and the GAPDH antibody was used to detect the GAPDH content in the sample as an internal reference.

[0112] The results are shown in F of Figure 2 , which shows that VP012R significantly enhances the ubiquitination of Megalobrama amblycephala STING.

[0113] 4. Degradation experiment:

[0114] Based on the previously determined interaction region, the present application truncates Megalobrama amblycephala STING into six fragments: N-terminal fragments (1-140, 1-180, 1-245) and C-terminal fragments (141-417, 181-417, 217-417), as shown in Figure 3 After transfecting different Megalobrama amblycephala STING segment plasmids and Myc-ORF012R plasmids into FHM cells, the degradation of VP012R to different segments of Megalobrama amblycephala STING was detected.

[0115] The results of the degradation experiment are shown in A-F of Figure 4 , which shows that VP012R can degrade STING (141-417), STING (181-417), STING (1-245) and STING (217-417), but not STING (1-140) and STING (1-180). These findings indicate that the ubiquitination site of Megalobrama amblycephala STING targeted by VP012R is located within the 181-417 region.

[0116] Further, the ubiquitination experiment of full-length STING, STING (1-180) and STING (181-417) shows that VP012R mediates significant ubiquitination of full-length STING and STING (181-417), but does not mediate ubiquitination of STING (1-180) (as shown in G of Figure 4 ).

[0117] The above results show that the infectious spleen and kidney necrosis virus protein VP012R ubiquitinates the mandarin fish STING in the amino acid region of 181-417.

[0118] Example 3: Screening and verification of ubiquitination sites of mandarin fish STING

[0119] 1. Ubiquitination site mutation experiment:

[0120] The main site of ubiquitination is the lysine residue in the protein, but other amino acids such as cysteine can also be targeted. In order to locate the specific site of mandarin fish STING ubiquitination targeted by VP012R, the present application first replaces all 10 lysines (K) in the STING (181-417) region with arginine (R), as shown in A of Figure 5 . Then after transfecting the mandarin fish STING mutant plasmid and Myc-ORF012R plasmid into FHM cells, the degradation of VP012R to the mandarin fish STING mutant is detected. The co-transfection experiment results with Myc-ORF012R are shown in B of Figure 5 , which shows that the lysine mutant (STING-KR) can still be degraded by VP012R. This indicates that the ubiquitination site targeted by VP012R is not only related to lysine, but also to non-lysine sites (such as cysteine).

[0121] Next, all 3 cysteines (C) in the STING (181-417) region are replaced with arginine (R), as shown in A of Figure 5 . Then after transfecting the mandarin fish STING mutant plasmid and Myc-ORF012R plasmid into FHM cells, the degradation of VP012R to the mandarin fish STING mutant is detected. Co-transfection with Myc-ORF012R shows that the cysteine mutant (STING-CR) can still be degraded by VP012R (as shown in C of Figure 5 ).

[0122] Finally, all K and C residues in the STING (181-417) region are replaced with R to construct the STING-CKR mutant, as shown in A of Figure 5 . Then after transfecting the mandarin fish STING-CKR mutant plasmid and Myc-ORF012R plasmid into FHM cells, the degradation of VP012R to the mandarin fish STING-CKR mutant is detected. The results show that after co-transfection with Myc-ORF012R, VP012R cannot induce the degradation of STING-CKR (as shown in D of Figure 5 ).

[0123] The above results show that the STING of the mandarin fish is ubiquitinated by VP012R at multiple sites, involving at least one lysine residue and one cysteine residue.

[0124] 2. Ubiquitination site revertant mutant experiment:

[0125] Based on the above STING-CKR mutant, the three cysteine (C) sites were restored to cysteine (STING-CKR-196C, STING-CKR-262C, STING-CKR-310C were constructed) respectively, and co-transfection experiments were carried out with Myc-ORF012R respectively, to detect the degradation of VP012R on different STING-CKR revertant mutants of the mandarin fish.

[0126] The results are shown in A-C of Figure 6 , which show that among the three C revertant mutants, only STING-CKR-196C can be degraded by VP012R (as shown in A of Figure 6 ), suggesting that C196 is the ubiquitination site.

[0127] Similarly, the 10 lysine (K) sites were restored to lysine (STING-CKR-315K, etc. were constructed) respectively in the background of STING-CKR, and co-transfection experiments were carried out with Myc-ORF012R respectively, to detect the degradation of VP012R on different STING-CKR revertant mutants of the mandarin fish.

[0128] The results are shown in A-I of Figure 7 and Figure 8 , which show that VP012R only degrades the STING-CKR-315K mutant (as shown in Figure 6 ), confirming that K315 is the ubiquitination site.

[0129] 3. Ubiquitination level detection:

[0130] The results are shown in A and B of Figure 9 , which show that the single mutant STING-C196R and STING-K315R can still be degraded by VP012R (as shown in A and B of Figure 9 ), while the double mutant STING-C196R / K315R is resistant (as shown in C of ).

[0131] Further, after transfecting different plasmids of the mutant of the Megalobrama amblycephala STING and the Myc-ORF012R plasmid into FHM cells, the ubiquitination levels of different mutants of the Megalobrama amblycephala STING were detected. The ubiquitination experiment showed that VP012R induced the highest ubiquitination level on the wild-type Megalobrama amblycephala STING, induced the medium ubiquitination level on the single-site back-mutant STING-CKR-196C and STING-CKR-315K, and induced the lowest ubiquitination level on the multi-site mutant STING-CKR (as shown in A of Figure 10 Similarly, the ubiquitination level induced by VP012R on the wild-type Megalobrama amblycephala STING was higher than that on the single mutant (STING-C196R or STING-K315R), and the level induced on the double mutant STING-C196R / K315R was the lowest (as shown in B of Figure 10 ).

[0132] The above results show that the E3 ligase VP012R inhibits innate immune signaling by ubiquitinating the Megalobrama amblycephala STING at the 196th cysteine (C196) and the 315th lysine (K315) sites.

[0133] Example 4: Study on the influence of K315 on the regulation of host STING activity

[0134] 1. Degradation experiment:

[0135] The above experiment has proved that the Megalobrama amblycephala STING is ubiquitinated at the C196 and K315 sites under the mediation of VP012R. To further study whether the two modification sites are involved in the regulation of the activity of the host STING, the degradation pathways of the wild-type Megalobrama amblycephala STING and its mutants were studied by comparison experiment. The specific experimental method is as follows:

[0136] After transfecting different plasmids of the mutant of the Megalobrama amblycephala STING and the Myc-ORF012R plasmid into FHM cells, different drugs were used for treatment, and it was verified that VP012R degrades the 196th cysteine and the 315th lysine of the Megalobrama amblycephala STING by ubiquitination.

[0137] The results are shown in Figure 11 Unlike the Megalobrama amblycephala STING and the STING-C196R which are easily degraded by proteasomes, the degradation of the K315 mutant and the C196 / K315R double mutant was significantly reduced. In addition, MG132 can effectively inhibit the degradation of the Megalobrama amblycephala STING and the STING-C196R, but has no significant effect on the K315 mutant or the C196 / K315R double mutant. This result shows that the K315 residue of the Megalobrama amblycephala STING is crucial for the host to regulate the function of STING, and it is speculated that the pathogenic spectrum characteristics of ISKNV are related to the sequence characteristics of different species of STING.

[0138] 2. Phylogenetic tree construction analysis:

[0139] In this experiment, all published STING protein amino acid sequences of ISKNV susceptible fish were retrieved for phylogenetic tree construction and homology alignment analysis, and the corresponding species ISKNV mortality rate reported was included. The 29 fish species covered in the analysis covered three representative evolutionary branches of ISKNV susceptible hosts. In the homology alignment, the 315th residue corresponding to the STING of the mandarin fish was defined as the K315 site of other species.

[0140] Among them, the phylogenetic tree analysis method is as follows: for the phylogenetic tree of fish that can naturally infect ISKNV, 11 genes in mitochondria (cytochrome c oxidase subunit 1, cytochrome c oxidase subunit 3, cytochrome b, NADH dehydrogenase subunit 1, NADH dehydrogenase subunit 2, NADH dehydrogenase subunit 3, NADH dehydrogenase subunit 4, NADH dehydrogenase subunit 4L, NADH dehydrogenase subunit 6, ATP synthase Fo subunit 6 and ATP synthase Fo subunit 8) were used to construct. After multiple alignment of protein sequences using L-INS-i algorithm in MAFFT v7.526, phylogenetic tree was constructed in IQ-TREE v3.0.1 using partition model, ModelFinder and UFBoot and parameters "-m MFP+MERGE -B 1000". For the phylogenetic tree of STING of fish that can naturally infect ISKNV, MEGA v12.0.11 was used to align protein sequences by ClustalW, and the phylogenetic tree was constructed using the neighbor-joining method, 1000 bootstrap repeats, Jones-Taylor-Thornton model, gamma distribution (shape parameter = 1.00) and complete deletion.

[0141] The results are shown in Figure 12 , showing that in the K315 site polymorphism, the osteoglossum group is glutamine (Q), the osteichthyes group is arginine (R), and in the osteichthyes group there are various variations, mainly lysine (K), and also arginine (R) and threonine (T), as shown in Figure 12 . It is worth noting that the K315 site variation is related to the difference in ISKNV mortality rate (as shown in Figure 12K315 site is Q). ISKNV infection in the osteichthyan group (K315 site is R) is not lethal. Within the teleosts, there is a differentiation in lethality: in the oviparous lineage, lethality is 25% in the Cyprinodontiformes species (residue R), and 80-100% in the Cichliformes and Mugiliformes species (residue K). In the pelagic fish lineage, the Perciformes lineage and the Scombriformes lineage, most species carry K or T, and ISKNV infection is lethal in 80-100% of the species.

[0142] Based on the above analysis, it can be seen that the amino acid residue at the K315 site is a key factor in determining the lethality of ISKNV infection across species. Specifically, in species with lysine (K) at the K315 site, ISKNV infection leads to high mortality; while in species with arginine (R) at this site, ISKNV infection leads to low mortality or no death.

[0143] 3. Infection experiment:

[0144] To further verify the above conclusion, an infection experiment was carried out. In this experiment, the representative species of K315 site threonine (T) is largemouth bass, and the representative species of K315 site arginine (R) is crucian carp, guppy and red swordtail. The specific experimental method is as follows:

[0145] All fish were raised in a laboratory circulating freshwater system at 27°C, fed twice a day with commercial feed, and acclimated for 2 weeks before the experiment. Before the experiment, healthy fish with normal activity were selected and randomly divided into 3 groups, 20 fish in each group. The fish were soaked in water containing 2x10 8 copies of ISKNV virus per liter for 4 hours, then transferred back to the original feeding environment for 3 weeks of continuous observation and mortality statistics.

[0146] Previous experiments have shown that ISKNV causes 100% mortality in mandarin fish (residue K). Similarly, this experiment further found that ISKNV infection also caused 100% mortality in largemouth bass ( Figure 13 A in the figure). Crucian carp, guppy and red swordtail showed low mortality (<10%), similar to the mortality of zebrafish (residue R) after infection with ISKNV in previous studies ( Figure 13 B-D in the figure).

[0147] Subsequently, this experiment detected the degradation of VP012R to STING in these types of fish. Overexpression of VP012R did not induce degradation of zebrafish or crucian carp (residue R) STING ( Figure 13E and F in FIG. 1). However, after mutating zebrafish STING at position 301 (corresponding to K315 in G. a. domestica) from R to K (constructing drSTING-301K), this mutant could be degraded by VP012R (FIG. 1 Figure 13 G). This explains the reason why ISKNV is less pathogenic in fish with R at K315 site. In addition, fish with T at K315 site (such as Micropterus salmoides) also suffer high mortality rate (>80%) (FIG. 1 Figure 12 B and C in FIG. 1). Co-transfection of Myc-ORF012R with M. salmoides STING (msSTING, residue T) showed that VP012R promoted the degradation of msSTING (FIG. 1 Figure 13 H in FIG. 1).

[0148] Further, the present experiment also constructed a T mutant at position 315 (scSTING-CKR-315T) in scSTING-CKR. And co-transfected with Myc-ORF012R, the results showed that VP012R could promote the degradation of scSTING-CKR-315T (as shown in I in FIG. 1). These findings show that the threonine (T) at position 315 can also be a target for VP012R-mediated degradation, similar to lysine (K). This is consistent with previous studies on ubiquitination of threonine (T). Figure 13

[0149] The above analysis results show that the amino acid residue at K315 site of G. a. domestica STING is a key determinant of the susceptibility of fish to lethal infection of ISKNV.

[0150] In summary, the present application discloses a molecular marker of interferon-stimulating factor and its application. The present application finds that the amino acid residue at K315 site of G. a. domestica STING is a key determinant of the susceptibility of fish to lethal infection of ISKNV. Specifically, in species with lysine (K) or threonine (T) at K315 site, ISKNV infection leads to high mortality rate; while in species with arginine (R) at this site, ISKNV infection leads to low mortality rate or is not lethal. Taking this site as a molecular marker, the susceptibility of fish to infectious spleen and kidney necrosis disease can be effectively detected, and early prediction of the susceptibility of fish to infectious spleen and kidney necrosis disease can be realized. In addition, the molecular marker can also be used for assisted breeding of fish susceptible to infectious spleen and kidney necrosis disease, which has important significance for breeding new strains of fish with low susceptibility to infectious spleen and kidney necrosis disease.

[0151] The above has made a detailed description of the embodiments of the present application, but the present application is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.​

Claims

1. A molecular marker associated with resistance to fish infectious spleen and kidney necrosis disease, characterized in that, The molecular marker is located at the 315th amino acid of the amino acid sequence of the interferon gene stimulator protein coding, and the polymorphism includes lysine, threonine, glutamine or arginine.

2. The molecular marker of claim 1, wherein The amino acid sequence of the interferon gene stimulator protein includes any one of CRNRYXLILLD, CRNRFXLVLID, CRNRYXLILLN, CRNRYXLVLLN, CRNRYXLVLIK, CRNRYXLILIK, CRNRFXLILLN, CRNRYXLILIN, CRNHYXLILLN or CRNRYXLILLK, wherein X in the amino acid sequence represents the 315th amino acid.

3. A combination of molecular markers, characterized in that, Comprise: The first molecular marker is the molecular marker associated with the resistance of fish infectious pancreatic and renal necrosis disease in claim 1 or 2; and the second molecular marker is located at the 196th amino acid of the amino acid sequence of the interferon gene stimulator protein coding, wherein the polymorphism of the second molecular marker is threonine, cysteine, tryptophan or arginine.

4. A reagent for detecting the molecular marker associated with the resistance of fish infectious pancreatic and renal necrosis disease in claim 1 or 2 or the combination of molecular markers in claim 3.

5. The agent of claim 4, wherein The reagent includes a reagent for detecting nucleic acid sequence based on PCR amplification, in situ hybridization, gene chip, gene sequencing; and / or a reagent for detecting protein or polypeptide sequence based on immunodetection method, mass spectrometry, enzymatic hydrolysis, chemical cleavage.

6. A test kit characterized in that, Comprise the reagent in claim 4 or 5.

7. A molecular marker detection device, characterized by, Comprise: An acquisition system for acquiring a sample to be detected; A detection system for detecting the sample to be detected by using the reagent in claim 4 or 5; An analysis system for analyzing and judging the detection result of the detection system; A storage system for storing the sample to be detected acquired by the acquisition system, and / or the detection result of the detection system, and / or the analysis and judgment result of the analysis system.

8. The molecular marker associated with the resistance of fish infectious pancreatic and renal necrosis disease in claim 1 or 2 or the combination of molecular markers in claim 3 as a target point in any one of the following: A1) preparing a reagent for predicting or detecting the susceptibility of fish to infectious pancreatic and renal necrosis disease; A2) preparing a reagent for identifying or breeding fish varieties with low susceptibility to infectious pancreatic and renal necrosis disease; A3) molecular marker assisted breeding of fish infectious pancreatic and renal necrosis disease susceptibility; A4) improvement of fish varieties related to susceptibility to infectious pancreatic and renal necrosis disease; A5) improvement of germplasm resources of fish.

9. The reagent in claim 4 or 5, the detection kit in claim 6 or the molecular marker detection device in claim 7 in any one of the following: B1) predicting or detecting the susceptibility of fish to infectious pancreatic and renal necrosis disease; B2) identifying or breeding fish varieties with low susceptibility to infectious pancreatic and renal necrosis disease; B3) molecular marker assisted breeding of fish infectious pancreatic and renal necrosis disease susceptibility; B4) improvement of fish varieties related to susceptibility to infectious pancreatic and renal necrosis disease; B5) Improvement of germplasm resources of fish.

10. A method for identifying or screening fish for susceptibility to infectious spleen and kidney necrosis disease, characterized in that, The reagent as claimed in claim 4 or 5 is used to detect the polymorphism of the sample to be detected, and the susceptibility of the sample to be detected to infectious pancreatic and renal necrosis disease is determined according to the detection result; The standard of the determination is that when the polymorphism of the molecular marker at the 315th amino acid of the interferon gene stimulator protein coding amino acid sequence is lysine or threonine, it is determined that the susceptibility to infectious pancreatic and renal necrosis disease is high, i.e. the mortality rate is ≥ 80%; when the polymorphism of the molecular marker at the 315th amino acid of the interferon gene stimulator protein coding amino acid sequence is arginine or glutamine, it is determined that the susceptibility to infectious pancreatic and renal necrosis disease is low, i.e. the mortality rate is ≤ 25%.

Images