Method for auxiliary detection of pig backfat thickness and special primer pair thereof

Abstract

The invention discloses a method for assisting detection of pig backfat thickness and a special primer pair thereof, and relates to the technical field of biology. A primer pair of the DNA fragment of the A polymorphic site; the SSC is 10 g. 20549610 Ggt, and the SSC is 10 g. The A polymorphic site is the 20549610th nucleotide site Ggt from the 5'terminal on a chromosome 10 of a reference sequence of an international porcine genome 11.1 version (Sscrofa11.1 Primary Assessment), and the A polymorphic site is the 20549610th nucleotide site Ggt from the 5 'terminal on the chromosome 10 of the reference sequence of the Sscrofa11.1 Primary Assessment; a mutation. According to the method for assisting in detecting the pig backfat thickness and the special primer pair thereof, a sequencing method is used for detecting SSC10g. 20549610 Ggt; according to the method, the genotype of a pig individual is judged according to the basic group at the A polymorphic site, so that the backfat thickness character of the pig is selected, the average backfat thickness of the pig can be reduced by about 3.37 mm, and the pig with better production performance is obtained; according to the method provided by the invention, the pigs to be selected can be screened in an early stage, and the problem of long time for selecting excellent breeding pigs in actual production is effectively solved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a method for assisting in detecting the back fat thickness of pigs and a special primer pair thereof. BACKGROUND

[0002] The back fat thickness trait of pigs has an impact on growth rate and carcass lean rate. Excessive deposition of back fat not only affects the growth rate of pigs, reduces the carcass lean rate, but also leads to waste of feed. Back fat thickness is an important indicator for evaluating carcass lean rate, which is strongly negatively correlated with lean rate. Because of its high heritability and ease of determination, it is often used as an indirect trait for lean pig genetic improvement.

[0003] The back fat thickness trait of pigs is closely related to the nutritional level and feeding management, but the genetic factor plays an essential role. The essence of the trait affected by breed is also genetic. Identifying and in-depth studying the causal mutation of the back fat thickness trait has important theoretical significance and application value for developing precise molecular breeding of the trait in actual production. SUMMARY

[0004] The purpose of the present application is to provide a method for assisting in detecting the back fat thickness of pigs and a special primer pair thereof to solve the problems raised in the background.

[0005] To achieve the above purpose, the present application provides the following technical solution: a special primer pair is a primer pair for amplifying a DNA fragment containing the SSC10g.20549610 G>A polymorphic site. The SSC10g.20549610 G>A polymorphic site is a G>A mutation at the 20549610th nucleotide site from the 5' end on chromosome 10 of the international pig genome 11.1 version (Sscrofa11.1 Primary Assembly) reference sequence.

[0006] Further, the primer pair consists of a DNA molecule shown in SEQ ID No. 1 and a DNA molecule shown in SEQ ID No. 2.

[0007] A method for assisting in detecting the back fat thickness of pigs, which applies the special primer pair, and the operation method is as follows: the back fat thickness of pigs with homozygous GG genotype or the back fat thickness of pigs with heterozygous GA genotype is less than the back fat thickness of pigs with homozygous AA genotype. The pigs with homozygous GG genotype are pigs with G as the base of the SSC10g.20549610 G>A polymorphic site. The pigs with heterozygous GA genotype are pigs with G and A as the base of the SSC10g.20549610 G>A polymorphic site. The homozygous AA genotype pig is a pig with A at the SSC10g.20549610 G>A polymorphic site; The SSC10g.20549610 G>A polymorphic site is a base at position 20549610 of chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly).

[0008] Further, the homozygous GG genotype, heterozygous GA genotype or homozygous AA genotype is determined as follows: using the pig genomic DNA as a template, using the primer pair of claim 1 or 2 as primers for PCR amplification to obtain a PCR amplification product, if the pig genomic (Sscrofa11.1 Primary Assembly) at position 20549610 of chromosome 10 contains G, the genotype of the pig is homozygous GG genotype, if the base is G and A, the genotype of the pig is heterozygous GA genotype, if the base is A, the genotype of the pig is homozygous AA genotype.

[0009] Further, when the primer is the primer pair of claim 2, the base at position 20549610 of chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly) is located at the 448th position from the 5' end of the PCR amplification product.

[0010] Further, the application is applied to pig breeding.

[0011] Further, the pig is Qinglian black pig.

[0012] The application provides a method for assisting in detecting the back fat thickness of a pig and a special primer pair thereof, and has the following beneficial effects: The application uses sequencing to detect the base at the SSC10g.20549610 G>A polymorphic site, to determine the genotype of the pig individual, so as to select the back fat thickness of the pig, so that the average back fat thickness of the pig is reduced by about 3.37 mm, and a pig with better production performance is obtained; the method provided by the application can be used for early screening of a pig to be selected, effectively solves the problem of long time for selecting a superior breeding pig in actual production, reduces the breeding cost, effectively reduces or increases the back fat thickness of the pig in actual production, the method has high accuracy, low detection cost, and can realize automatic detection, and has high practical application value in pig breeding. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 It is a sequencing result diagram of the sequence near the SSC10g.20549610 G>A site of the application. DETAILED DESCRIPTION

[0014] The embodiments of the present invention will be described in further detail below with reference to the accompanying drawings and examples. The following examples are for illustrative purposes only and should not be construed as limiting the scope of the invention.

[0015] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0016] This invention uses Qinglian Black Pig ( Sus scrofa The breed of pig was purchased from Zhejiang Qinglian Food Co., Ltd.

[0017] The PCR amplification sequences in the following examples all refer to the pig genome (Sscrofa11.1 Primary Assembly) sequence.

[0018] Example 1: Determining the thickness of pig backfat I. Determination of the G>A polymorphic site in SSC10g.20549610 (a) Using two Qinglian black pigs as experimental materials, genomic DNA was extracted from their ear margin tissues.

[0019] (II) Primer Design and Synthesis Based on the international pig genome version 11.1 reference sequence (http: / / asia.ensembl.org / Sus_scrofa / Info / Index), the following primers were designed and synthesized: U (upstream primer): 5'– GAAGCAGGAGTTGAGGCA -3' (SEQ ID No. 1); D (downstream primer): 5'–ACTTCTGTCAAATGTTCCCTGC–3' (SEQ ID No. 2).

[0020] (III) PCR amplification Using the genomic DNA of Qinglian black pig obtained in step (1) as a template, PCR amplification was performed with U and D as primers to obtain PCR amplification products, which were named product 1 and product 2, respectively.

[0021] PCR amplification system: 200 ng genomic DNA, 5 µL 10× PCR amplification buffer, dNTPs final concentration of 10 mM, 50 ng each of forward and reverse primers, 0.75 U Taq DNA polymerase, Mg 2＋ 2.5 mmol / L, add ddH2O to bring the system to 50 µL.

[0022] PCR amplification procedure: 95℃ pre-denaturation 5 min; 95℃ denaturation 20 s, 60.5℃ annealing 30 s, 72℃ extension 30 s, 35 cycles in total; finally 72℃ extension 10 min.

[0023] (IV) Sequencing and sequence analysis The product 1 and the product 2 were sequenced to obtain the sequence of the product 1 (as shown in SEQ ID No. 3) and the sequence of the product 2 (as shown in SEQ ID No. 4). There is only one base difference between SEQ ID No. 3 and SEQ ID No. 4, which is the 448th base from the 5' end in SEQ ID No. 3 and SEQ ID No. 4, which is G or A, as shown by the arrow in Figure 1 , which is the 20549610th site on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly), so the site is named SSC10g.20549610G>A.

[0024] The individual in which the base at the 20549610th site on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly) (or the base at the 448th site from the 5' end of the PCR amplification product obtained in step (III)) is G is a homozygous individual, and the genotype of the individual is named homozygous GG genotype. The individual in which the base at the 20549610th site on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly) (or the base at the 448th site from the 5' end of the PCR amplification product obtained in step (III)) is A is a homozygous individual, and the genotype of the individual is named homozygous AA genotype. The individual in which the base at the 20549610th site on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly) (or the base at the 448th site from the 5' end of the PCR amplification product obtained in step (III)) is G and A is a heterozygous individual, and the genotype of the individual is named heterozygous GA genotype.

[0025] II. Association analysis of SSC10g.20549610G>A polymorphism site and backfat thickness of pigs To determine whether the SSC10g.20549610G>A polymorphism site is related to the backfat thickness of pigs, 304 healthy Qinglian black pigs were used as experimental materials, and the following tests were performed: (1) Extract the genomic DNA of the ear tissue of each pig, and perform PCR amplification according to the method of step (III) in step (I), respectively, to obtain each PCR amplification product, and determine whether the genotype of each pig is homozygous GG, heterozygous GA or homozygous AA according to the method of step (IV) in step (I).

[0026] (ii) The backfat thickness of the pigs at the weight of about 90 kg was determined and recorded.

[0027] The results are shown in Table 1.

[0028] Table 1 shows that the backfat thickness of the pigs with homozygous GG genotype or the pigs with heterozygous GA genotype is less than that of the pigs with homozygous AA genotype.

[0029] (iii) The SSC10g.20549610G>A site of the pig and the backfat thickness of the pig were analyzed by the least square method.

[0030] The model used is as follows: Y = W + G + e Wherein, Y is the measured trait; W is the initial weight covariate; G is the genotype effect; and e is the random error.

[0031] The results are shown in Table 1.

[0032] Table 1 shows that the backfat thickness of the pigs with homozygous GG genotype or the pigs with heterozygous GA genotype is less than that of the pigs with homozygous AA genotype.

[0033] Table 1 shows that the backfat thickness of the pigs with homozygous GG genotype or the pigs with heterozygous GA genotype is less than that of the pigs with homozygous AA genotype. The backfat of the pigs with homozygous AA genotype is about 3.37 mm thicker than that of the pigs with homozygous GG genotype (P<0.05).

[0034] Therefore, in the actual pig breeding, the pigs with homozygous GG genotype are preferably selected for breeding to obtain pigs with thinner backfat.

[0035] The embodiments of the present application are given for the purpose of illustration and description, and are not intended to be exhaustive or to limit the application to the disclosed form. Many modifications and variations will be apparent to those of ordinary skill in the art. Embodiments were chosen and described in order to best explain the principles of the application and its practical application, and to enable others skilled in the art to understand the application for various embodiments with various modifications as are suited to the particular use contemplated.

Claims

1. A pair of dedicated primers, characterized in that, The primer pair for amplifying the DNA fragment containing the SSC10g.20549610 G>A polymorphic site; The SSC10g.20549610 G>A polymorphic site is a G>A mutation at the 20549610th nucleotide site from the 5' end on chromosome 10 of the international pig genome 11.1 version (Sscrofa11.1 Primary Assembly) reference sequence.

2. The pair of primers according to claim 1, wherein The primer pair consists of the DNA molecule shown in SEQ ID No. 1 and the DNA molecule shown in SEQ ID No.

2.

3. A method for assisting in the detection of backfat thickness in swine using a pair of specific primers according to claim 2, wherein The operation method is as follows: the backfat thickness of pigs with homozygous GG genotype or the backfat thickness of pigs with heterozygous GA genotype is less than the backfat thickness of pigs with homozygous AA genotype; The pig with homozygous GG genotype is a pig with G at the SSC10g.20549610 G>A polymorphic site; The pig with heterozygous GA genotype is a pig with G and A at the SSC10g.20549610 G>A polymorphic site; The pig with homozygous AA genotype is a pig with A at the SSC10g.20549610 G>A polymorphic site; The SSC10g.20549610 G>A polymorphic site is the 20549610th base on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly).

4. The method of claim 3, wherein the method further comprises, The determination method of the homozygous GG genotype, the heterozygous GA genotype or the homozygous AA genotype is as follows: using the genomic DNA of the pig as a template and the primer pair of claim 1 or 2 as primers for PCR amplification to obtain a PCR amplification product, if the 20549610th base on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly) contained in the PCR amplification product is G, then the genotype of the pig is homozygous GG genotype, if the base at this position is G and A, then the genotype of the pig is heterozygous GA genotype, and if the base at this position is A, then the genotype of the pig is homozygous AA genotype.

5. The method of claim 4, wherein the method further comprises the step of: When the primer is the primer pair of claim 2, the 20549610th base on chromosome 10 of the pig genome (Sscrofa11.1 Primary Assembly) is located at the 448th position from the 5' end of the PCR amplification product.

6. The method of claim 5, wherein, Applied to the breeding of pigs.

7. The method of claim 6, wherein the method further comprises, The pig is Qinglian black pig.

Images