DCAPS molecular marker for identifying soybean glutamic acid content character and application of dCAPS molecular marker

Abstract

The invention provides a qGlu16-C142T SNP (Single Nucleotide Polymorphism) site related to the content of soybean glutamic acid, which is positioned at 35995252bp of a physical position of a No.16 chromosome of a soybean genome and corresponds to a 142-site basic group from the 5'tail end of a nucleotide sequence shown in SEQ ID NO: 1; the locus comprises two allele types: C type and T type. The invention also develops a dCAPS molecular marker based on the SNP site, and provides a method for identifying or assisting in identifying the genotype of the SNP site of the soybean to be detected. Finally, experimental verification is carried out through soybean materials, and it is found that the content of glutamic acid in to-be-detected soybeans with the genotype being C is higher than or candidate higher than the content of glutamic acid in to-be-detected soybeans with the genotype being T. The dCAPS molecular marker disclosed by the invention has important significance on screening out soybean varieties with relatively high glutamic acid content.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular marker breeding, and particularly relates to a dCAPS molecular marker for identifying the glutamic acid content trait of soybean and application thereof. BACKGROUND

[0002] Glutamic acid, as a core nutrient and quality index with a high content in soybean seeds, is of great significance. It is not only a natural umami substance in food processing, which can significantly improve the flavor intensity of soy products such as tofu and soybean paste, but also an important nutritional fortifying component of infant formula and nutritional supplements for the elderly. In the feed field, it can optimize the amino acid balance of livestock feed, promote the development of the intestinal tract and protein absorption of livestock, and reduce the amount of artificial glutamic acid additives to reduce breeding costs. At the same time, as a key intermediate product of plant nitrogen metabolism, it can also improve the nitrogen utilization efficiency of soybeans, help yield formation, and enhance the stability of plants to adversity, thus enabling soybeans to improve their value in food, feed and agricultural production. However, the glutamic acid content of existing soybean cultivars varies significantly, and most varieties cannot meet the precise needs of high-value industries for high-quality raw materials. Therefore, the directional breeding of high-glutamic acid soybean varieties through genetic improvement has become a key direction for promoting the upgrading of the soybean industry.

[0003] Traditional soybean glutamic acid content improvement relies on hybrid breeding technology. However, due to the synergistic regulation of glutamic acid content by multiple genes and environmental factors, phenotype screening is easily disturbed by the environment, making it difficult to accurately distinguish between genetic differences and phenotype changes caused by environmental fluctuations during breeding. With the development of molecular breeding technology, genome-wide association analysis (GWAS) has become a key means for mining glutamic acid-related genetic markers. However, the number of SNP sites related to glutamic acid discovered is extremely small, making it difficult to comprehensively cover the genetic regulatory network related to glutamic acid synthesis and nitrogen metabolism. The adaptability of some sites is limited, and the reported sites are mostly based on the identification of vegetable soybean germplasm. The adaptability of different purpose varieties such as oil soybean and feed soybean, and different ecotype germplasm such as northeast spring soybean and huanghuaihai summer soybean has not been verified. At the same time, a small number of high-explanation sites lack cross-environment stability verification, and their association performance under different soil fertility and nitrogen levels is not clear, which limits their wide application in molecular breeding. These problems make it difficult for current molecular marker-assisted breeding technology to be efficiently applied to the breeding of high-glutamic acid soybean varieties, and it still relies on traditional phenotype screening, resulting in high breeding cycle and cost.

[0004] Therefore, mining a new SNP site related to glutamic acid content with high phenotype explanation rate and strong environmental stability, and which can be widely adapted to multiple purposes and multiple ecological regions of soybean germplasm, becomes the key to break the shackles of current molecular breeding technology in the directional improvement of soybean glutamic acid. This breakthrough not only provides core technical support for the precise directional improvement of soybean quality, but also effectively strengthens the core competitiveness of the soybean industry, and has profound theoretical guiding significance and significant industrial application value for promoting the theoretical innovation and industrial application upgrading of soybean breeding. SUMMARY

[0005] The technical problem to be solved by the present application is to provide a qGlu16-C142T SNP site related to soybean glutamic acid content and applications thereof.

[0006] To solve the above technical problems, the technical solutions adopted by the present application are as follows.

[0007] A SNP site related to soybean glutamic acid content, the SNP site is located at 35995252 bp of the physical position of chromosome 16 of soybean genome, named qGlu16-C142T SNP site, the site contains two types of alleles: C type and T type, and soybeans with different genotypes have different glutamic acid contents.

[0008] On the other hand, the present application also comprises a composition for detecting the polymorphism or genotype of the above-mentioned SNP site, which is A1), A2) or A3) as follows:

[0009] A1) The composition contains a PCR primer combination for amplifying a DNA fragment of soybean genome;

[0010] A2) The composition is a PCR reagent containing the PCR primer combination;

[0011] A3) A kit containing the PCR primer combination of A1) or the PCR reagent of A2).

[0012] As a preferred technical solution of the present application, the PCR primer combination comprises a forward primer F shown in SEQ ID NO: 2 and a reverse primer R shown in SEQ ID NO: 3.

[0013] As a preferred technical solution of the present application, the PCR reagent or kit at least comprises an AluI restriction endonuclease component.

[0014] On the other hand, the present application also comprises the application of any one of the above-mentioned compositions, and the application is any of the following:

[0015] B1) Application in identifying or assisting in identifying soybean glutamic acid content;

[0016] B2) use in preparing a product for identifying or assisting in identifying the glutamic acid content of soybean;

[0017] B3) use in screening or assisting in screening soybean varieties with high glutamic acid content;

[0018] B4) use in preparing a product for screening or assisting in screening soybean varieties with high glutamic acid content;

[0019] B5) use in soybean breeding and / or assisted breeding;

[0020] B6) use in preparing a product for soybean breeding and / or assisted breeding.

[0021] In another aspect, the present application also comprises a product prepared based on the above-mentioned uses, which is any one of the following:

[0022] C1) a product for detecting the polymorphism or genotype of the above-mentioned qGlu16-C142T SNP site in soybean;

[0023] C2) a product for identifying or assisting in identifying the glutamic acid content of soybean;

[0024] C3) a product for soybean breeding and / or assisted breeding.

[0025] In another aspect, the present application also comprises a method for detecting the genotype of the above-mentioned qGlu16-C142T SNP site in the genome of soybean, characterized in that it comprises the following (1) or (2):

[0026] (1) direct sequencing;

[0027] (2) PCR amplification with the above-mentioned composition, and identification of the amplification product by enzyme digestion, determination of the genotype based on the electrophoretic band pattern of the enzyme digestion product.

[0028] As a preferred technical solution of the present application, the above-mentioned method (2) is specifically as follows: PCR amplification of the soybean genomic DNA to be tested with the above-mentioned composition to obtain a PCR amplification product; the obtained PCR amplification product is digested with AluI to obtain an enzyme digestion product; if the PCR product cannot be cut into a B band pattern with a band size of 690 bp, then the soybean to be tested has a T genotype at the site; if the PCR product can be cut into an A band pattern, forming two products of 141 bp and 549 bp after cutting, then the soybean to be tested has a C genotype at the site.

[0029] In another aspect, the present application also comprises a method for detecting or assisting in detecting the glutamic acid content of soybean, using the above method for detecting the genotype of the qGlu16-C142T SNP site in the genome of soybean, determining the genotype of the qGlu16-C142T SNP site of the soybean to be tested, and determining the specific trait of the soybean in terms of glutamic acid content based on the genotype; the glutamic acid content is: the soybean with genotype C is greater than or candidate is greater than the soybean with genotype T.

[0030] In the last aspect, the present application also comprises a method for breeding soybean, first detecting the polymorphism of the above SNP in the genome of soybean, and selecting soybean with homozygous C at the SNP site in the genome of soybean as the parent for breeding.

[0031] The beneficial effects produced by the above technical solutions are that the present application provides a dCAPS molecular marker for identifying the glutamic acid content of soybean and its application. The molecular marker can identify or assist in identifying the glutamic acid content of soybean by detecting the genotype of the qGlu16-C142T SNP site in the genome of the soybean to be tested, which helps to select soybean plants with high glutamic acid content. The qGlu16-C142T SNP site contains two types of alleles: C type and T type, and is located at position 35995252bp of chromosome 16, corresponding to the 142th base of the nucleotide sequence shown in SEQ ID NO: 1 from the 5' end. The dCAPS molecular marker can be used for assisted breeding of soybean, accelerating the screening and breeding process of soybean with high glutamic acid content, and accurately screening single plants with high glutamic acid genotype in soybean breeding, thereby optimizing the genotype composition of the breeding population and improving the nutritional quality of soybean seeds.

[0032] The present application also provides a composition and / or kit for detecting the qGlu16-C142T SNP site. By detecting the genotype of the qGlu16-C142T SNP site, the screening and typing of the soybean material to be tested can be quickly realized, and soybean varieties with high glutamic acid content can be selected. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 Figure 1 is a schematic diagram of the glutamic acid content of parent seeds.

[0034] Figure 2 Figure 3 is a schematic diagram of a high-density genetic linkage map.

[0035] Figure 3 Figure 5 is a schematic diagram of the distribution of QTL sites of glutamic acid content.

[0036] Figure 4 Figure 7 is a schematic diagram of the application effect detection of the dCAPS molecular marker. DETAILED DESCRIPTION

[0037] The following examples illustrate the present application. The various starting materials and equipment used in the present application are all conventional commercially available products and can be directly obtained by market purchase. The materials, reagents and the like used in the following examples can be obtained from commercial channels unless otherwise specified. It should be understood that when used in the present application and the appended claims, the term "comprising" indicates the presence of the described features, integers, steps, operations, elements, and / or components, but does not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" used in the present application and the appended claims means any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0038] As used in the present application and the appended claims, the term "if" can be interpreted as "when" or "upon" or "in response to a determination" or "in response to detecting" depending on the context. Similarly, the phrases "if it is determined" or "if [a described condition or event] is detected" can be interpreted depending on the context to mean "upon determining" or "in response to determining" or "upon detecting [a described condition or event]" or "in response to detecting [a described condition or event]." Additionally, in the description of the application and the appended claims, the terms "first," "second," "third," etc. are used merely as labels, and are not intended to impose or imply a relative importance or order of magnitude. The description of "one embodiment" or "some embodiments" or the like in the present application means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the present application. Thus, the appearance of the phrases "in one embodiment" or "in some embodiments" or "in other embodiments" or "in yet some embodiments" or the like in various places in the specification is not necessarily all referring to the same embodiment, unless otherwise be specifically noted. The terms "comprise," "include," "have," and their conjugates mean "including but not limited to," unless otherwise specifically noted.

[0039] Example 1, Discovery of a soybean glutamic acid content-related qGlu16-C142T SNP site

[0040] 1. Preparation of experimental materials

[0041] Using Nannong 26 and Williams82, provided by the Soybean Center of Nanjing Agricultural University, as parents, an F6 recombinant inbred line (RIL) population containing 131 families was constructed through single-seed propagation. Nannong 26 is a high-protein variety with a black seed coat, with a protein content of 47% as determined by the Grain Quality Testing Center of the Ministry of Agriculture and Rural Affairs of the People's Republic of China. Williams82 is a low-protein public genome reference germplasm introduced from the United States, with a laboratory protein content of approximately 41%. In November 2023, this RIL population and the parental materials were sown at three breeding experimental sites in Sanya (E1), Lingshui (E2), and Yacheng (E3). Each family was planted in three-row plots with a row length of 2m, a row spacing of 0.5m, and a plant spacing of 0.1m. During the growing season, diseased seedlings, weak seedlings, and other abnormal plants were removed. After natural maturity, the plants were harvested in mixed plots, dried, and then plump and uniform grains were selected for later use.

[0042] 2. Methods for determining soybean glutamic acid content, statistical analysis, and visualization of data.

[0043] Subsequently, characteristic spectra of the tested seeds under three environments were obtained using a Bruker MATRIX-I near-infrared analyzer. The spectra were then fitted using the instrument's built-in protein and amino acid models to predict glutamate content. Each plot of sample was measured individually in triplicate, and the average value was used as the final percentage content data. Differences in glutamate content among parents were analyzed using GraphPad Prism 5 software, and bar charts were generated. Genetic analysis of glutamate traits under multiple environments was performed using built-in formulas in Excel software. The generalized heritability was calculated using R language, with the following formula: h 2 b =σ 2 g / (σ 2 g +σ 2 ge / n+σ 2 ε / nr)), where h 2 b Represents the generalized heritability, σ 2 g σ represents the variance of genotypes. 2 ε σ represents the variance of the error. 2 ge The variance of the interaction between genotype and environment is represented by , where n represents the number of environments and r represents the number of replicates per environment. The Pearson function from the psych package in R is used to calculate the correlation coefficients between different traits.

[0044] 3. Genotyping analysis of soybean RIL populations

[0045] Through molecular experiments and bioinformatics analysis, high-quality genotype data of soybean parents and F6 RIL population were obtained, genetic map was constructed and QTL loci controlling glutamic acid content were located, which provided core support for subsequent functional gene mining and molecular marker-assisted breeding.

[0046] After collecting the young leaves of parents and 131 F6 RIL families, extracting DNA and quantitative testing, breaking into 350 bp fragments for library construction, obtaining Clean data through high-throughput sequencing; comparing the data with the soybean reference genome, screening high-confidence SNPs and Indels and counting typing; grouping according to the physical location of the markers, using Join Map 3.0 to construct the genetic map, and finally completing QTL positioning by the complete interval mapping method of QTL Ici Mapping V4.1.

[0047] The glutamic acid related quality traits of two parents Williams82 and Nannong26 were detected. The results showed that the glutamic acid content of Nannong26 was significantly higher than that of Williams82, and the difference between parents was significant, indicating that the RIL population was suitable for QTL positioning analysis, as shown in Figure 1 .

[0048] Genetic variation analysis of soybean RIL population glutamic acid traits found that the glutamic acid phenotype data of both parents fell within the range of the two extremes of the population phenotype values, and showed continuous distribution characteristics, with a genetic variation coefficient of 5.23%. The glutamic acid trait showed significant heterosis, reflecting the clear differentiation of the two parents in genetic basis. From the skewness and kurtosis statistical parameters, the absolute values of this trait index were at a low level, and the phenotype distribution pattern was highly consistent with the normal distribution characteristics, which confirmed that the glutamic acid trait was a quantitative trait. The heritability results showed that the heritability of soybean glutamic acid trait was at a high level (the specific value was 0.958), which meant that the soybean glutamic acid trait was mainly controlled by genes, and the interference effect of environmental factors was relatively limited. This characteristic fully explained that the RIL population constructed in this study had good conditions for subsequent QTL positioning analysis. As shown in Table 1.

[0049] Table 1 Genetic variation analysis of RIL population

[0050]

[0051] 4, High-density genetic map construction and QTL positioning of glutamic acid content related traits

[0052] To aid in subsequent QTL mapping analysis, high-throughput resequencing was performed on a RIL population containing two parents and 131 recombinant inbred families. Polymorphic SNPs were screened and integrated into 4286 effective polymorphic bin markers, which were then divided into 20 linkage groups based on chromosomal physical location to construct a high-density genetic linkage map. Figure 2 As shown in the image, this map has high resolution and no obvious gaps, which can meet the requirements for subsequent QTL localization.

[0053] QTL mapping results showed that 9 potential QTL sites for the glutamate trait were detected in 3 environments, distributed across 5 chromosomes, such as... Figure 3 As shown in Table 2, chromosomes 4 and 16 have a relatively large number of potential QTLs associated with the glutamate trait, while the other chromosomes have only one potential QTL, indicating that these loci contain pleiotropic or environmentally stable QTLs. Furthermore, based on the LOD significance threshold of 3.37 returned from 1000 permutation tests across the entire genome and the physical and genetic distances between different QTL loci, a pooled screening was performed, resulting in two highly reliable QTL loci associated with glutamate, as shown in Table 2. In addition, qGlu_16 can be stably detected in three environments, indicating that this locus has significant breeding value.

[0054] Table 2 QTL mapping analysis of glutamate content

[0055]

[0056] Note: Positive '&' indicates an additive effect derived from Nanjing Agricultural University 26, negative '&' indicates an additive effect derived from Williams 82. E1, Sanya; E2, Lingshui; E3, Yacheng.

[0057] 5. Screening for SNPs related to soybean glutamic acid content

[0058] Based on the parental resequencing results, high-quality SNP variant sites were screened within or near the candidate physical region of the QTL site qGlu_16. These sites were required to have a sequencing depth greater than 5, a sequencing quality greater than 10, and be homozygous. A single SNP site associated with soybean glutamate content was detected at chromosome 16 at base 35,995,252, named qGlu16-C142T SNP site. This site exhibits two genotypes in the natural soybean population: C and T.

[0059] Refer to the sequence information shown in SEQ ID NO: 1:

[0060] TTGTCTCCACATAATTAATTAATTATTGAATTATATTATCTACAGAATATTTTTTTAATCTTTTTTTTAGAATATATATTCTATGTTTATCATATTACTCATTTTATTTCACACTTTTTTCTTTTTTAATTGTAAAAAAAGYTATGTATAAGTTTTGTATAATTTTTATTTTTAACTGCTTCAATTAAGGCTTTTTGGCTCTTATTAATTTGGTGAGATTTTGATGTATCTTTAGAAGCCTCCATTTTTTAGATTGAATATGAGATTATTTTTTAATTTAAAATTTAGTCACATTTAAATTTTTTTTACCTCTTCCCAAAGAAGTGCTGTATAATTAATAATTCTCATTAGCAGTTAAGTGTGAGTGACTGCTGAATCAAAGGTTAACCAAGGTAGCAGGGATAAATGAAAATATATTTTTTTAATTCTCTTGATTTAGAATAACAGGGACCAGTTACATTTTTTGGCAGGACCTTATTTAATTTATCTTTATTCAAAAATCTGAGTTTAATCCTTGATCTTTTTTTTCTTCTTATTTTTAATTCGGTTCTTTTTAGTCTATTTTGGTGAATGTATCTTTGTCTGTCAGAAATTATTTTGTTGACCATCATCACTAAAACCAATATGTTGATAAAAAAATATTAAAACAAAAATATATATAAACAATGAAGTTGAGAAAAGAGATAAG

[0061] (SEQ ID NO: 1; wherein Y at position 142 is C or T).

[0062] Example 2, Development of a dCAPS molecular marker to identify the qGlu16-C142T SNP locus genotype

[0063] According to the physical position of qGlu16-C142T SNP site, sequences of 30 bp upstream and downstream were extracted on the genome, and dCAPS molecular markers were designed according to the sequences using the online website "dCAPS Finder". If the SNP variation cannot cause variation of the enzyme cutting site, a single nucleotide mismatch is introduced near the SNP position, so that the restriction endonuclease AluI produces a recognition site in one of the sequences amplified with one parent as a template in the amplified PCR product. The following primer sequences were obtained through the above marker development:

[0064] Forward primer F: TTGTCTCCACATAATTAATTAA (SEQ ID NO: 2)

[0065] Reverse primer R: CTCTTATCTCTTTTCTCAACTTCATT (SEQ ID NO: 3)

[0066] Endonuclease AluI: AGCT

[0067] Example 3, Method for detecting genotype of soybean qGlu16-C142T SNP site

[0068] Genomic DNA of the soybean to be tested was extracted, and the extracted DNA was subjected to PCR amplification using the primers F and R in Example 2 to obtain a PCR amplification product. The PCR reaction system was 25 μL, and the components and amounts were as follows: 2.5 μL of 10×Ex Tag HS buffer, 2.0 μL of 0.2 mM dNTP, 1.0 μL of template DNA, 0.5 μL of upstream primer F (concentration of 10 μM), 0.5 μL of downstream primer R (concentration of 10 μM), 0.2 μL of Ex Taq HS enzyme, and the rest was supplemented with 18.3 μL of ddH2O. The PCR reaction conditions were as follows: 95°C for 2 min; then 30 cycles of 95°C for 30 s, 53°C for 30 s, and 72°C for 30 s; after the cycles, 72°C for 10 min; finally, the amplified product was stored at 16°C.

[0069] The PCR amplification product is digested with restriction enzyme Alul to obtain the digestion product; the digestion product is detected by 1% agarose gel electrophoresis, and the product with a single band is further subjected to enzyme digestion detection. The total system of the restriction enzyme digestion reaction used is 25 μL, and the components and amounts are as follows: 2.5 μL of 10x NEB buffer, 1.0 μL of restriction enzyme, 10 μL of PCR amplification product, and the rest is supplemented with 11.5 μL of ddH2O. The enzyme is digested at the working temperature for 30 min, and then the digestion product is detected in 1% agarose gel electrophoresis, and the result is observed in the gel imaging system. The different genotypes of the qGlu16-C142T SNP site are judged according to the fragment size of the digestion product:

[0070] If the PCR product cannot be cut by Alul endonuclease into a B band type with a band size of 690 bp, then the soybean to be tested has a genotype of T type at the site; if the PCR product can be cut into an A band type, two products of 141 bp and 549 bp are formed after cutting, then the soybean to be tested has a genotype of C type at the site. The A and B band types after enzyme digestion can be clearly distinguished on 1% agarose gel.

[0071] Among them, for any material, if only A band type or B band type is amplified, it indicates that the qGlu16-C142T SNP site in the soybean material is of a homozygous type. If A type and B type are amplified at the same time, it indicates that the soybean material is still in a heterozygous state at the qGlu16-C142T SNP site, and the offspring will separate at this site after selfing.

[0072] Example 4, application of dCAPS molecular marker in identifying soybean glutamic acid trait

[0073] 1. Selection of test materials and determination of qGlu16-C142T SNP site genotype

[0074] Nannong 26 is used as a high glutamic acid parent donor material, and Wan Dou 37 and Wan Dou 38 are used as low glutamic acid content receptor parent materials. The genome DNA digestion product of Nannong 26 is of A band type, i.e., the qGlu16-C142T SNP site genotype is of C type, by the method of detecting the qGlu16-C142T SNP site genotype of soybean in Example 3. The genome DNA digestion products of Wan Dou 37 and Wan Dou 38 are of B band type, i.e., the qGlu16-C142T SNP site genotype is of T type. The qGlu16-C142T SNP site genotypes of different donor materials are shown in Table 4.

[0075] 2. Phenotypic determination of glutamic acid content of soybean materials

[0076] The soybean of different test materials was naturally air-dried to a moisture content of less than 7%, and mature and full soybean seeds without damage and mildew were selected as the determination samples, which were placed at an ambient temperature of about 25°C for more than 48 hours. The near-infrared instrument was used to determine the spectrum of the samples, and the corresponding glutamic acid content value was obtained. The glutamic acid content of Nannong 26 was 9.36 g / 100g, and the glutamic acid contents of Wandou 37 and Wandou 38 were 8.10 g / 100g and 8.43 g / 100g, respectively. The results showed that the glutamic acid content of Nannong 26 was 15.58% and 11.01% higher than that of Wandou 37 and Wandou 38, respectively, indicating that the donor parent and the receptor parent were significantly different in glutamic acid content, and were suitable for molecular marker application effect example verification. The glutamic acid contents of different parent materials are shown in Table 3.

[0077] Table 3 Glutamic acid content and qGlu16-C142T SNP genotype of three parent materials

[0078]

[0079] 3. Breeding population construction and material planting

[0080] Taking soybean variety Nannong 26 as the female parent, two hybrid combinations were prepared with Wandou 37 and Wandou 38, respectively. The hybridization operation was completed by using conventional sexual hybridization technology. In the F2 separation generation of hybrids, 150-200 single plants with healthy growth were selected and reserved for each hybrid combination, and then single-seed transmission method was used for continuous selfing until F4 generation was bred.

[0081] The tender leaves of each F4 single plant were collected for genotype identification to determine the genetic background information of each plant. After completing the genotype detection, the F4 single plants were harvested and the seeds were saved. In mid-June of the next year, all F4 family seeds were planted in a 1m x 3 row plot in Longkang test base, and the unified field management standard was implemented. In October of the same year, after the soybeans were mature, the seeds were collected according to the plot and row, and the seeds of each family were collected separately.

[0082] To ensure the reliability of the phenotype data, 3 repetitions were taken for each family. In the seed treatment stage, abnormal seeds such as developmental deformity and shriveled seeds were removed, and then the near-infrared spectrum analyzer was used to determine the glutamic acid content in the seeds. The average value of the determination results of 3 repetitions was finally calculated as the final phenotype data of the glutamic acid content of the family. After the above screening and identification, 100 breeding families with stable genetics and reliable phenotype data were reserved for each of the two hybrid combinations, which were used for subsequent genetic analysis work.

[0083] 4. Molecular marker screening and phenotype analysis

[0084] The DNA of the above-mentioned 200 selected families was subjected to genotype identification by the method for detecting the genotype of soybean qGlu16-C142T SNP site in Example 3. As a result, 48 families of A band type and 70 families of B band type were detected in the two populations, and the remaining families were heterozygous band type or band missing type. Since the heterozygous band type will separate in the later stage, it was removed. The glutamic acid of the 118 single plants with clear band type was determined, and the results showed that the average values of glutamic acid content of the A band type (qGlu16-C142T SNP site genotype was C type) and B band type (qGlu16-C142T SNP site genotype was T type) groups were 8.770 g / 100 g and 8.463 g / 100 g, respectively, and the standard deviations were 0.499 g / 100 g and 0.347 g / 100 g, respectively. In the A band type group, the highest glutamic acid content was 9.780 g / 100 g, and the lowest was 7.959 g / 100 g. In the B band type group, the highest glutamic acid content was 9.216 g / 100 g, and the lowest was 7.776 g / 100 g. The absolute values of skewness and kurtosis of the two groups were less than 1, indicating that the phenotypes of the two groups were in accordance with the normal distribution characteristics. After Student's T-test, the glutamic acid content of the A band type and B band type groups was significantly different, and the glutamic acid content of the A band type group was better than that of the B band type. The average glutamic acid content was significantly improved by 3.63% by using molecular markers for directional selection. The results showed that the molecular marker can be used for genetic breeding improvement to increase the glutamic acid content of soybean. As shown in Table 4, Figure 4

[0085] Table 4 Variation analysis of glutamic acid content of different genotype populations

[0086]

[0087] Note: The genotype of qGlu16-C142T SNP site of A band type is C type, and the genotype of qGlu16-C142T SNP site of B band type is T type.

[0088] In summary, the glutamic acid content of soybean with qGlu16-C142T SNP site genotype C is greater than or candidate greater than that of soybean with genotype T. The above dCAPS molecular marker can quickly and effectively identify the glutamic acid content trait of soybean.

[0089] ​The above-described embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application, and should be included in the protection scope of the present application.

Claims

1. A SNP site associated with soybean glutamic acid content, characterized in that: The SNP site is located at 35,995,252 bp on chromosome 16 of the soybean genome and is named qGlu16-C142T SNP site. This site contains two allele types: C type and T type. Different genotypes of soybeans have different glutamic acid contents.

2. The composition for detecting the site polymorphism or genotype of claim 1, characterized in that: (A1), (A2), or (A3) as follows: A1) The composition contains a PCR primer set for amplifying soybean genomic DNA fragments; A2) The composition is a PCR reagent containing the PCR primer combination; A3) A kit containing the PCR primer combination described in A1) or the PCR reagent described in A2).

3. The composition according to claim 2, characterized in that: The PCR primer combination includes the front primer F shown in SEQ ID NO: 2 and the back primer R shown in SEQ ID NO:

3.

4. The composition according to claim 3, characterized in that: The PCR reagent or kit contains at least an AluI restriction endonuclease component.

5. The use of the composition according to any one of claims 2-4, characterized in that: The application is any one of the following: B1) Application in identifying or assisting in the identification of soybean glutamic acid content; B2) Application in the preparation of products for identification or auxiliary identification of soybean glutamic acid content; B3) Application in screening or assisting in the screening of soybean varieties with high glutamic acid content; B4) Application in the preparation of products for screening or assisting in the screening of soybean varieties with high glutamic acid content; B5) Applications in soybean breeding and / or assisted breeding; B6) Application in the preparation of products for soybean breeding and / or assisted breeding.

6. The product, characterized in that: The product prepared based on the application described in claim 5 is any one of the following: C1) Products that detect the qGlu16-C142T SNP polymorphism or genotype of soybeans as described in claim 1; C2) Products used for identifying or assisting in the identification of soybean glutamic acid content; C3) Products used for soybean breeding and / or assisted breeding.

7. A method for detecting the genotype of the qGlu16-C142T SNP site as described in claim 1 in the soybean genome, characterized in that, Including the following (1) or (2): (1) Direct sequencing; (2) Perform PCR amplification using the composition described in claim 2, 3 or 4, identify the amplification product by enzyme digestion, and determine the genotype based on the electrophoretic banding of the enzyme digestion product.

8. The method according to claim 7, characterized in that: Specifically, (2) involves: performing PCR amplification on the soybean genomic DNA to be tested using the composition described in claim 2, 3, or 4 to obtain PCR amplification products; and digesting the obtained PCR amplification products with AluI enzyme to obtain digestion products. If the PCR product cannot be cleaved into a B-band pattern and the band size is 690 bp, then the soybean being tested has a T-type genotype at the specified locus. If the PCR product can be cut into A-band, and after cutting, two products of 141bp and 549bp are formed, then the soybean being tested has the C-type genotype at the locus.

9. A method for detecting or assisting in the detection of glutamic acid content in soybeans, characterized in that: Using the method described in claim 7 or 8 for detecting the genotype of the qGlu16-C142T SNP site in the soybean genome, the genotype of the qGlu16-C142TSNP site in the soybean to be tested is determined, and the specific trait of soybean in terms of glutamic acid content is determined based on the genotype; the glutamic acid content is: soybeans with genotype C are greater than or candidate greater than soybeans with genotype T.

10. A method for soybean breeding, characterized in that: First, the polymorphism of the SNP described in claim 1 in the soybean genome was detected, and soybeans with the SNP site C homozygous in the soybean genome were selected as parents for breeding.

Images