Application of PPAR pathway regulator in preparation of nasopharynx cancer radiotherapy sensitizer

Abstract

The invention relates to the technical field of biological medicines, and particularly discloses application of a PPAR pathway regulator in preparation of a nasopharyngeal carcinoma radiotherapy sensitizer. In-vitro experiments prove that after the expression of the MAP2K7 gene in nasopharynx cancer cells is silenced by utilizing shRNA, the sensitivity of the cancer cells to radioactive rays can be remarkably enhanced. Mechanism research is carried out by using a transcriptome sequencing technology, it is found that MAP2K7 silently up-regulates the activity of a PPAR pathway, that is, MAP2K7 influences the radiotherapy sensitivity by regulating a PPAR signal pathway, and the activity of the PPAR pathway is in positive correlation with the radiotherapy sensitivity of nasopharyngeal carcinoma. The invention provides a new therapeutic target and a solution for nasopharyngeal carcinoma radiotherapy resistance, and lays a theoretical basis and an experimental basis for developing a novel radiotherapy sensitizer based on an MAP2K7-PPAR pathway.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of PPAR pathway modulators in the preparation of radiosensitizers for nasopharyngeal carcinoma. Background Technology

[0002] Nasopharyngeal carcinoma is a highly geographically localized malignant tumor. Due to the difficulty of early diagnosis, most patients are diagnosed at an advanced stage. Although radical treatment regimens centered on intensity-modulated radiotherapy (IMRT) can achieve good local control, the intrinsic radioresistance of tumor cells and the severe toxicity of concurrent chemoradiotherapy remain key challenges leading to treatment failure, local recurrence, and decreased quality of life for patients. Therefore, developing novel radiosensitizers that can precisely target the drug resistance mechanisms of nasopharyngeal carcinoma while possessing both high efficacy and low toxicity is of crucial clinical significance for overcoming current treatment bottlenecks and improving patient survival benefits. Currently, radiosensitizers exist, but their mechanisms of action are concentrated on known DNA damage repair or oncogene signaling pathways.

[0003] For example, Chinese patent CN108559744A (published on September 21, 2018) discloses the application of a reagent that interferes with the expression of the long non-coding RNA PVT1 in the preparation of a radiosensitizer for nasopharyngeal carcinoma. This was demonstrated by testing the nasopharyngeal carcinoma cell lines CNE2 and 5... After introducing a PVT1-targeting interference vector (siPVT1) into 8F cells to inhibit PVT1 expression, the cells were irradiated with radiation at doses of 0, 2, 4, 6, and 8 Gy, respectively. The cells were then cultured for 12 days. Colony formation assays showed that, compared to the negative control (NC, cells transfected with the scramble interference vector), inhibiting PVT1 expression significantly reduced CNE2 and 5% CVE-2 levels. The significantly reduced number of colonies formed by 8F cells indicates that the cells are more sensitive to radiotherapy, suggesting that reagents that interfere with the expression of long non-coding RNA PVT1 can be used to prepare radiosensitizers for nasopharyngeal carcinoma.

[0004] For example, Chinese invention patent CN111617251A (published on September 4, 2020) discloses the application of MDM4 inhibitors as drugs for treating nasopharyngeal carcinoma. MDM4 inhibitors can address the low sensitivity of nasopharyngeal carcinoma cells to radiation therapy by inhibiting the key radiation-sensitive factor MDM4. Radiotherapy is the main treatment for nasopharyngeal carcinoma, but if nasopharyngeal carcinoma cells develop radioresistance—that is, tumor cells continue to grow at the original radiotherapy dose and frequency without being inhibited—radiotherapy becomes ineffective, leading to rapid disease progression and even death. This approach discovers and utilizes the key mechanism of MDM4 activation causing radioresistance in nasopharyngeal carcinoma, restoring the sensitivity of nasopharyngeal carcinoma to radiotherapy by using MDM4 inhibition. This approach can be applied in the practical operation of drug preparation and research for treating nasopharyngeal carcinoma.

[0005] To overcome the limitations of existing nasopharyngeal carcinoma radiosensitization strategies, such as high toxicity and poor targeting, this invention proposes for the first time to use the MAP2K7 gene as a new target and to prepare highly efficient and low-toxic nasopharyngeal carcinoma radiosensitization agents by regulating the PPAR pathway. Summary of the Invention

[0006] To address the aforementioned issues, this invention provides the application of PPAR pathway modulators in the preparation of radiosensitizers for nasopharyngeal carcinoma, offering a new strategy for preparing highly effective and low-toxicity radiosensitizers for nasopharyngeal carcinoma.

[0007] This application provides a PPAR pathway modulator for modulating the radiosensitivity of nasopharyngeal carcinoma cells.

[0008] Furthermore, the activity of the PPAR pathway is positively correlated with the radiosensitivity of nasopharyngeal carcinoma.

[0009] Furthermore, the PPAR pathway regulator includes shMAP2K7; the shMAP2K7 is used to silence the MAP2K7 gene.

[0010] Furthermore, the MAP2K7 gene downregulates PPAR pathway activity.

[0011] Furthermore, the gene MAP2K7 was discovered through an ensemble machine learning approach. Eight machine learning algorithms (RSF, Enet, Boruta, Xgboost, SVM-REF, Lasso, CoxBoost, and StepCox) were used to screen key genes for model inclusion. The gene frequency, survival analysis data in the nasopharyngeal carcinoma dataset, and expression differences in nasopharyngeal carcinoma tissues / adjacent tissues were comprehensively considered to identify MAP2K7 as a key gene for radiosensitivity in nasopharyngeal carcinoma.

[0012] Furthermore, the preparation method of shMAP2K7 is as follows: Based on the mRNA sequence of MAP2K7, three shRNA sequences and one nonsense control shRNA sequence were designed and synthesized, and ligated into the pLVX-mcherry-Puro empty vector.

[0013] Furthermore, the DNA coding sequences of the three shRNA sequences are shown below (5' to 3'): sh1:gatcgGAGCATTGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCAATGCTCTTTTTT; sh2:gatcgGCTACCAGGCAGAAATCAACGCTCGAGCGTTGATTTCTGCCTGGTAGCTTTTTT; sh3: gatcgGGAAGAGACCAAAGTATAACTCGAGTTATACTTTGGTCTCTTCCTTTTTT.

[0014] Furthermore, the PPAR pathway regulator also includes one of Rosiglitazone (CAS No.:122320-73-4) and T0070907 (CAS No.:313516-66-4).

[0015] Furthermore, T0070907 inhibits the activity of the PPAR pathway; Rosiglitazone upregulates the activity of the PPAR pathway.

[0016] Furthermore, the PPAR pathway modulator is used in the preparation of radiosensitizers for nasopharyngeal carcinoma.

[0017] Furthermore, the relationship between MAP2K7 gene expression level and patient survival was analyzed using Kaplan-Meier curves.

[0018] Furthermore, the proliferation differences of nasopharyngeal carcinoma cell lines in the MAP2K7 silencing group and the control group under different radiotherapy doses (0 Gy, 2 Gy, 4 Gy, 8 Gy, 16 Gy) were detected by the CCK8 method, the difference in radiotherapy IC50 dose of nasopharyngeal carcinoma cells between the MAP2K7 silencing group and the control group was calculated, and the relationship between MAP2K7 gene expression and radiosensitivity of nasopharyngeal carcinoma cells was evaluated.

[0019] Furthermore, a prognostic assessment model for nasopharyngeal carcinoma was constructed using a combination of Lasso regression and stepwise Cox regression.

[0020] Compared with existing technologies, the advantages and effects of this application are as follows: 1. This application proposes and validates that MAP2K7 is a key gene regulating radiosensitivity in nasopharyngeal carcinoma, and reveals that it regulates radiosensitivity in nasopharyngeal carcinoma by mediating the downstream pathway PPAR. This differs from known targets and mechanisms of action in existing technologies, providing a novel approach and drug target for overcoming radioresistance.

[0021] 2. This application targets MAP2K7 by gene silencing, which can specifically enhance the sensitivity of tumor cells to radiation without relying on broad-spectrum cytotoxic drugs. This avoids the shortcomings of traditional chemotherapy drugs that cause acute toxicity due to lack of selectivity. It is expected to significantly reduce the toxicity of treatment while achieving high-efficiency sensitization and improving the quality of life of patients.

[0022] 3. The prognostic model constructed using the technical solution of this application can not only accurately predict the patient's prognosis, but also assess the responsiveness to immunotherapy. Compared with published models, the best model provided by this application has better predictive performance.

[0023] The above description is only an overview of the technical solution of this application. In order to better understand the technical means of this application and implement it in accordance with the contents of the specification, and to make the above and other objects, features and advantages of this application more obvious and understandable, the preferred embodiments of this application are described in detail below with reference to the accompanying drawings.

[0024] The above and other objects, advantages and features of this application will become more apparent to those skilled in the art from the following detailed description of specific embodiments in conjunction with the accompanying drawings. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. In all drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.

[0026] in: Figure 1 To select radiosensitive core genes for nasopharyngeal carcinoma (NPC), the following data are presented: A) Risk forest plot of the top 10 most frequent key genes in the training set; B) Venn diagram showing the intersection of the top 10 core genes, prognostic model genes, and NPC survival-related genes; C) Difference in MAP2K7 expression between high-risk and low-risk patients in the NPC validation set; D) Difference in hazard scores between high-expression and low-expression MAP2K7 patients in the NPC validation set; E) Difference in MAP2K7 expression between metastatic and non-metastatic NPC tissues in GEO data; and F) MAP2K7 survival analysis in the NPC validation set. Figure 2 This study analyzed the association between MAP2K7 and radiosensitivity in nasopharyngeal carcinoma. A represents the MAP2K7 gene expression level detected by qPCR in commonly used nasopharyngeal carcinoma cell lines; B represents the effect of qPCR on silencing MAP2K7 gene expression in 5-8F cells. Figure 3 This study compares the gradient radiotherapy response of MAP2K7 silencing cells and control cells, where NC represents the control group and SH represents the silencing group. Figure 4To investigate how MAP2K7 silencing enhances DNA damage and affects gene expression in nasopharyngeal carcinoma cells, the following data were analyzed: A) Immunofluorescence assay showed the difference in expression of the radiotherapy-damaged protein γ-H2AX between the MAP2K7-silenced group and the control group; B) qPCR assay showed the gene expression level in the control group cells; and C) qPCR assay showed the gene expression level in the MAP2K7-silenced group cells. Figure 5 Volcano plot analysis for differentially expressed genes; Figure 6 Enrichment analysis of genes related to DNA damage repair and the PPAR pathway was performed. In this analysis, A represents the expression trend of DNA damage-related genes in transcriptome sequencing data; B represents the enrichment trend of the DNA double-strand break pathway; and C represents the enrichment trend of the PPAR pathway. Figure 7 To illustrate the expression trends of key genes in the MAP2K7-regulated PPAR pathway, A shows the expression trends of key PPAR genes and downstream elements; B is a heatmap showing the expression trends of genes in the PPAR pathway. Figure 8 To investigate the regulation of radiosensitivity of nasopharyngeal carcinoma cells by the PPAR pathway, A represents the effect of the PPAR pathway inhibitor T0070907 on key genes in the pathway; B represents the effect of the PPAR pathway agonist Rosiglitazone on key genes in the pathway; and C represents the effect of PPAR pathway inhibitors / agonists on the radiosensitivity of nasopharyngeal carcinoma cells. Figure 9 c-idex index for all prognostic models; Figure 10 AUC index and ROC curve (1 year and 3 years) for the optimal model. Figure 11 Survival analysis based on hazard score grouping according to the optimal model; Figure 12 The comparison is between the performance of the best model and the published model. A is the comparison of the c-idex index of the best model and the published model; B is the comparison of the 1-year AUC index of the best model and the published model; C is the comparison of the 3-year AUC index of the best model and the published model. Figure 13 A heatmap showing the results of the Xcell algorithm; Figure 14 Scoring of some immune cells and immune function in HNSCC patients; Figure 15 Scoring of some immune cells and immune function in NPC patients; Figure 16For treatment response prediction, A represents the prediction performance of immunotherapy in the training set; B represents the prediction performance of immunotherapy across all datasets; C represents the prediction performance of treatment response across all datasets; and D represents the AUC curve of cancercalss in treatment response prediction. Detailed Implementation

[0027] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. In the following description, specific details such as specific configurations and components are provided merely to help fully understand the embodiments of this application. Therefore, those skilled in the art should understand that various changes and modifications can be made to the embodiments described herein without departing from the scope and spirit of this application. In addition, for clarity and brevity, descriptions of known functions and structures are omitted in the embodiments.

[0028] It should be understood that the phrase "an embodiment" or "this embodiment" throughout the specification means that a specific feature, structure, or characteristic related to the embodiment is included in at least one embodiment of this application. Therefore, "an embodiment" or "this embodiment" appearing throughout the specification does not necessarily refer to the same embodiment. Furthermore, these specific features, structures, or characteristics can be combined in any suitable manner in one or more embodiments.

[0029] Furthermore, reference numerals and / or letters may be repeated in different examples within this application. Such repetition is for the purpose of simplification and clarity and does not in itself indicate a relationship between the various embodiments and / or settings discussed.

[0030] In this article, the term "and / or" is merely a description of the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can mean: A exists alone, B exists alone, and A and B exist simultaneously. The term " / and" describes another type of relationship between related objects, indicating that two relationships can exist. For example, A / and B can mean: A exists alone, and A and B exist alone. In addition, the character " / " in this article generally indicates that the related objects before and after it have an "or" relationship.

[0031] In this article, the term "at least one" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, "at least one of A and B" can mean: A exists alone, A and B exist simultaneously, or B exists alone.

[0032] It should also be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion.

[0033] This application introduces a complete research system from target discovery and mechanism analysis to clinical prediction models through the following examples. Examples 1-3 introduce the function and mechanism of MAP2K7 as a core regulatory gene for radiosensitivity of nasopharyngeal carcinoma, and Examples 4-5 introduce the application and prediction effect of a prognostic model. The following provides a detailed description of each example.

[0034] Example 1 This example demonstrates the selection and validation of core genes for radiosensitivity in nasopharyngeal carcinoma. Please refer to the appendix. Figure 1 .

[0035] Gene expression and clinical information of head and neck squamous cell carcinoma (HNSCC) were downloaded from the TCGA database as a training set, and gene expression and clinical information of nasopharyngeal carcinoma and oral squamous cell carcinoma (OSCC) were downloaded from the GEO database as a validation set. Eight machine learning methods (RSF, Enet, Boruta, Xgboost, SVM-REF, Lasso, CoxBoost, and StepCox) were used to screen for radiosensitive genes. The expression differences, prognostic significance, and frequency distribution of candidate genes in nasopharyngeal carcinoma tissues / adjacent tissues were analyzed. Finally, MAP2K7 was identified as a key radiosensitive regulatory gene for nasopharyngeal carcinoma.

[0036] Using the NPC validation set, we found higher MAP2K7 expression levels in high-risk patients, and the hazard scores of patients with high MAP2K7 expression were significantly higher than those in low-risk patients. Sequencing samples of nasopharyngeal carcinoma (NPC) tissues related to radiosensitivity were selected from the GEO dataset to examine the difference in MAP2K7 gene expression between radiosensitive and radioinsensitive NPC tissues. We found that higher MAP2K7 expression levels were associated with lower survival. Furthermore, gene expression analysis in metastatic and non-metastatic NPC patients revealed higher MAP2K7 expression levels in the metastatic NPC group. Therefore, we speculate that MAP2K7 may contribute to poor tumor prognosis by enhancing radioresistance in NPC cells and promoting metastasis.

[0037] Example 2 Based on Example 1, this example is for the functional verification of the MAP2K7 gene and its association analysis with the radiosensitivity of nasopharyngeal carcinoma. Please refer to the appendix. Figure 2-4 .

[0038] In three common nasopharyngeal carcinoma cell lines—5-8F, HK-1, and C666-1—the expression of the MAP2K7 gene was detected, and the 5-8F cells with the highest expression level were selected for subsequent functional validation.

[0039] The expression of the MAP2K7 gene in 5-8F cells was silenced using a lentiviral shRNA tool, as detailed below: Step S1: There are three shRNA sequences, and their DNA coding sequences are shown in the table below (5' to 3'): sh1:gatcgGAGCATTGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCAATGCTCTTTTTT; sh2:gatcgGCTACCAGGCAGAAATCAACGCTCGAGCGTTGATTTCTGCCTGGTAGCTTTTTT; sh3:gatcgGGAAGAGACCAAAGTATAACTCGAGTTATACTTTGGTCTCTTCCTTTTTT; Step S2: Use qPCR to verify the silencing efficiency of the three shRNAs, and select the SH-3 cell line with the best silencing effect for subsequent experiments.

[0040] Furthermore, MAP2K7 silenced cells and control cells were treated with gradient dose radiotherapy, and cell proliferation activity was detected by CCK-8 assay and IC50 value was calculated. Furthermore, real-time quantitative primers for detecting MAP2K7 gene expression levels were designed, and immunofluorescence technology was used to assess the radiotherapy damage to nasopharyngeal carcinoma cells. The target area to be detected is: GACCTGGATGTGGTGCTGAAGAGCCACGACTGCCCCTACATCGTGCAGTGCTTTGGGACGTTCATCACCAACACGGACGTCTTCATCGCCATGGAGCTCATGGGCACCTGCGCTGAGAAGCTCAAGA. The sequence of the upstream primer is: GACCTGGATGTGGTGCTGAAGA; The sequence of the upstream primer is: TCTTGAGCTTCTCAGCGCAGGT.

[0041] Furthermore, by detecting the expression level of the DNA damage marker γ-H2AX using immunofluorescence technology, it was found that the expression level of the DNA damage gene GADD45A was more upregulated in the MAP2K7 silencing group cells at a 2Gy radiotherapy dose.

[0042] Furthermore, qPCR was used to detect the expression of key genes in radiotherapy-related pathways and DNA damage pathways in MAP2K7-silenced cells and control cells under 2Gy radiotherapy. Both groups of cells showed changes in PPAR pathway genes after radiotherapy. The expression of the DNA damage gene GADD45A was more upregulated in the MAP2K7-silenced group. Therefore, silencing MAP2K7 expression can enhance the radiotherapy damage effect.

[0043] The technical effects achieved in this embodiment are as follows: The results of this embodiment show that the expression level of the MAP2K7 gene is positively correlated with the radiotherapy tolerance of nasopharyngeal carcinoma. Silencing this gene can significantly improve radiosensitivity, providing a reliable experimental basis and theoretical foundation for developing radiosensitizers for nasopharyngeal carcinoma targeting MAP2K7.

[0044] Example 3 Based on Examples 1-2, this example studies the mechanism by which MAP2K7 affects the radiosensitivity of nasopharyngeal carcinoma by regulating the PPAR pathway. Please refer to the appendix. Figure 5-7 .

[0045] To investigate the mechanism by which the MAP2K7 gene regulates radiosensitivity, this embodiment performed transcriptome sequencing analysis on cells in the MAP2K7 silencing group and the control group. The specific steps are as follows: Step S1, Sample preparation: Expand the culture of nasopharyngeal carcinoma cell lines in the MAP2K7 gene silencing group and the control group. Remove the culture medium during the logarithmic proliferation phase, wash gently with PBS, extract RNA using the Trizol method, purify mRNA after detecting RNA quality by agarose gel electrophoresis, amplify the library, and sequence it using Illumina Novaseq X Plus. Step S2, Sequencing Data Processing: Perform FASTP processing on the data to remove low-quality sequence information; use bowtie2 to perform ribosomal RNA comparison and retain mRNA sequences; use HISAT2 for reference sequence comparison and use Stringtie for transcript reconstruction to standardize gene expression levels; Step S3, Transcriptome Data Analysis: Principal component analysis (PCA) was used to analyze the clustering of samples, and correlation analysis was used to assess the reproducibility between samples. EdgeR was used to screen for differentially expressed genes, and volcano plots and cluster heatmaps were used to display differentially expressed genes. GO database, KEGG database and GSEA were used to analyze the enrichment pathways of differentially expressed genes.

[0046] Furthermore, volcano plot analysis of differentially expressed genes revealed that the control group cells had a significant advantage in the expression of DNA repair-related genes, while the MAP2K7 silencing group cells showed a significant enrichment of PPAR pathway-related genes.

[0047] Further pathway enrichment analysis showed that genes related to the DNA double-strand damage repair pathway were more enriched in the control group cells, while genes related to the PPAR signaling pathway were significantly enriched in the MAP2K7 silencing group cells. For example, the expression levels of PPARA, PPARD, PPARG and their downstream elements RXRA, RXRD and RXRG were significantly upregulated in the MAP2K7 silencing group cells, indicating that MAP2K7 may affect radiosensitivity by downregulating the PPAR pathway.

[0048] The technical effects achieved in this embodiment are as follows: This embodiment reveals the mechanism by which MAP2K7 enhances radiotherapy resistance in nasopharyngeal carcinoma by downregulating PPAR pathway activity through transcriptome sequencing analysis; it demonstrates that PPAR pathway activity is positively correlated with the radiosensitivity of nasopharyngeal carcinoma cells, providing a molecular basis for the development of novel radiosensitizers targeting this pathway.

[0049] Example 4 Based on Examples 1-3, this example further confirms the relationship between PPAR pathway activity and radiosensitivity of nasopharyngeal carcinoma cells. Please refer to the appendix. Figure 8 .

[0050] The role of the PPAR pathway in radiosensitivity was investigated using the PPAR pathway agonist Rosiglitazone (CAS No.:122320-73-4) and the inhibitor T0070907 (CAS No.:313516-66-4).

[0051] Furthermore, the initial stock solution concentration of T0070907 is 100 mM. The specific preparation method is as follows: 100 mg of solid T0070907 powder is dissolved in 3600 μL of newly opened dimethyl sulfoxide (DMSO) solvent. After vortexing, it is sterilized by filtration through a 0.22 microporous membrane and stored at -80°C. Before use, it should be thawed naturally at room temperature and diluted to the specified concentration using cell culture medium. The initial stock solution concentration of Rosiglitazone is 100 mM. The specific preparation method is as follows: 100 mg of solid Rosiglitazone powder is dissolved in 2798 μL of newly opened dimethyl sulfoxide (DMSO) solvent. After vortexing, it is sterilized by filtration through a 0.22 microporous membrane and stored at -80°C. Before use, it should be thawed naturally at room temperature and diluted to the specified concentration using cell culture medium.

[0052] The results showed that 50 μM T0070907 effectively inhibited PPAR pathway activity, particularly the expression of key genes PPAR-A and PPAR-G, while 40 μM Rosiglitazone significantly upregulated PPAR pathway activity, especially the expression of key gene PPAR-A. Functional experiments demonstrated that at a radiotherapy dose of 4 Gy, treatment with the PPAR pathway inhibitor T0070907 increased cell viability from 0.38 to 0.55, while the agonist Rosiglitazone further decreased cell viability from 0.38 to 0.29, proving a positive correlation between PPAR pathway activity and the radiosensitivity of nasopharyngeal carcinoma cells.

[0053] Example 5 This example describes the construction of a nasopharyngeal carcinoma survival prognostic model based on radiosensitivity genes. Please refer to [link to relevant documentation]. Figure 9-12 .

[0054] The construction method includes the following steps: Step S1: Using gene expression and survival data of head and neck squamous cell carcinoma (HNSCC) from TCGA as the training set, and gene expression and survival data of nasopharyngeal carcinoma (NPC) and oral squamous cell carcinoma (OSCC) from GEO as the validation set, and using 394 codes from the tumor radiosensitivity regulator database as key variables, a variety of machine learning algorithms, including RSF, Enet, StepCox, CoxBoost, plsRcox, superpc, GBM, survivorsvm, Ridge, and Lasso, were systematically evaluated and compared. Step S2: Through comparison, Lasso was ultimately chosen for variable selection, and stepwise Cox regression was used to construct the final prognostic model, achieving the best prognostic simulation results: the consistency index (C-index) in the training set (HNSCC) and the two validation sets (NPC, OSCC) reached 0.71, 0.74, and 0.65, respectively; in the time-dependent ROC analysis, the AUC values ​​for predicting 1-year survival were 0.74, 0.86, and 0.70, respectively, and the AUC values ​​for predicting 3-year survival were 0.78, 0.71, and 0.70, respectively. Step S3: Comparison with published models: By comparing the c-index parameter and 1-year / 3-year AUC parameter of published models, it was found that this model has better predictive performance than published survival prognosis models. Step S4: Select genes to be included in the prognostic model, analyze the survival curve of each gene in each dataset separately, and evaluate the correlation between model genes and patient survival.

[0055] The results achieved in this embodiment are as follows: The model constructed in this embodiment ranks first in all three datasets, indicating that the prognostic model is significantly better than the existing technology in terms of prediction accuracy and robustness, and has outstanding clinical translational value and application prospects.

[0056] Example 6 This embodiment is based on Embodiment 4. This embodiment is based on the prognostic model for the analysis of immune infiltration characteristics and the prediction of immunotherapy response. Please refer to the appendix. Figure 13-16 .

[0057] The prognostic model constructed according to the aforementioned embodiments calculates the risk score for each patient, and the patient cohort is divided into low-risk and high-risk groups proportionally.

[0058] Furthermore, multiple immune infiltration analysis algorithms, including quantTIseq, TIMER, CIBERSORT, CIBERSORT-ABS, MCP-counter, xCell, EPIC, ABIS, ConsensusTME, and ESTIMATE, were used to systematically evaluate the differences in immune cell composition in tumor tissues between the two groups of patients. Taking the xCell algorithm as an example, significant differences were found in multiple immune cell populations between high-risk and low-risk groups in each dataset. In the HNSCC dataset, the infiltration levels of multiple populations related to T cell immune function, including CD4+ naive T cells, CD4+ effector T cells, CD8+ T cells, and CD8+ effector T cells, were significantly lower in the high-risk group than in the low-risk group. Simultaneously, the immune infiltration score and immune microenvironment score were also significantly lower in the high-risk group, suggesting a significant state of immunosuppression in this group. This trend of immunosuppression was further confirmed in the NPC validation set.

[0059] Furthermore, we used various binary classification analysis methods (nb, svmRadialWeights, rf, kknn, adaboost, LogitBoost, cancerclass) to analyze the accuracy (AUC and ROC) of patient risk scores and immunotherapy efficacy, and evaluated the feasibility of using a drug resistance gene-based prognostic model for the efficacy of immunotherapy in nasopharyngeal carcinoma.

[0060] Furthermore, a treatment response prediction model was constructed using seven different algorithms for supplementary analysis. The results showed that the cancerclass model achieved the best prediction performance in both the training and validation sets, with corresponding AUC values ​​of 0.836 and 0.629, respectively. This indicates that radiotherapy-sensitive genes have strong predictive value for both predicting responses to conventional treatments and those to immunotherapy.

[0061] The effects achieved in this embodiment are as follows: This embodiment integrates a prognostic model and, through multidimensional immune analysis, reveals the link between risk score and tumor immune microenvironment, and achieves accurate prediction of treatment response.

[0062] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any equivalent substitutions, structural improvements, adjustments to the functional implementation methods, as well as reasonable adjustments to parameters, module integrations, or step sequences based on the concept of the present invention, made within the spirit and principles set forth in the present invention, should be included within the scope of protection of the present invention.

Claims

1. A PPAR pathway modulator, characterized in that, The PPAR pathway regulator includes shMAP2K7; shMAP2K7 is used to silence the MAP2K7 gene.

2. The PPAR pathway modulator according to claim 1, characterized in that, The MAP2K7 gene downregulates PPAR pathway activity.

3. A PPAR pathway modulator according to claim 1 or 2, characterized in that, The preparation method of shMAP2K7 is as follows: Based on the mRNA sequence of MAP2K7, three shRNA sequences and one nonsense control shRNA sequence were designed and synthesized, and ligated into the pLVX-mcherry-Puro empty vector.

4. A PPAR pathway modulator according to claim 3, characterized in that, The 5' to 3' DNA coding sequences of the three shRNA sequences are shown below: sh1:gatcgGAGCATTGAGATTGACCAGAACTCGAGTTCTGGTCAATCTCAATGCTCTTTTTT; sh2:gatcgGCTACCAGGCAGAAATCAACGCTCGAGCGTTGATTTCTGCCTGGTAGCTTTTTT; sh3: gatcgGGAAGAGACCAAAGTATAACTCGAGTTATACTTTGGTCTCTTCCTTTTTT.

5. A PPAR pathway modulator according to claim 1, characterized in that, The PPAR pathway modulators also include one of Rosiglitazone and T0070907.

6. The PPAR pathway modulator according to claim 5, characterized in that, The T0070907 inhibits the activity of the PPAR pathway; the Rosiglitazone upregulates the activity of the PPAR pathway.

7. The use of the PPAR pathway modulator according to any one of claims 1-6 in the preparation of a radiosensitizer for nasopharyngeal carcinoma, characterized in that, The PPAR pathway modulator regulates the radiosensitivity of nasopharyngeal carcinoma cells; the radiosensitivity of nasopharyngeal carcinoma cells is positively correlated with PPAR pathway activity.

8. The application according to claim 7, characterized in that, The proliferation differences of nasopharyngeal carcinoma cell lines in the MAP2K7 silencing group and the control group under different radiotherapy doses of 0 Gy, 2 Gy, 4 Gy, 8 Gy and 16 Gy were detected by the CCK8 method. The difference in radiotherapy IC50 dose between the MAP2K7 silencing group and the control group was calculated to evaluate the relationship between MAP2K7 gene expression and radiosensitivity of nasopharyngeal carcinoma cells.

9. The application according to claim 7, characterized in that, A prognostic assessment model for nasopharyngeal carcinoma was constructed using a combination of Lasso regression and stepwise Cox regression.

Images