Compositions and methods for diagnosis and treatment of lymphatic system disorders

Abstract

Compositions and methods for the diagnosis and treatment of lymphatic disorders are disclosed.

Description

[0001] This application is a divisional application of the application patent application with the application date of September 9, 2019, the application number of 201980073395.9, and the invention name of “Compositions and methods for diagnosis and treatment of lymphatic system disorders”.

[0002] This application claims priority to U.S. Provisional Application No. 62 / 728,444, filed September 7, 2018, the entire contents of which are incorporated herein by reference as if fully set forth. TECHNICAL FIELD

[0003] The present invention relates to the fields of genetics, personalized medicine, and lymphatic system malformations. More specifically, the present invention provides new genetic targets and therapeutic treatment regimens for ameliorating symptoms associated with lymphangiomatosis and other generalized lymphatic anomalies (GLA). BACKGROUND

[0004] Throughout this specification, several publications and patents are referenced by author and year and are incorporated herein by reference in their entirety as if fully set forth. The references are listed in a numbered list in the order of their appearance in the specification.

[0005] The lymphatic system plays a critical role in maintaining fluid circulation, protecting the body from disease, and absorbing dietary fat in the small intestine (1). Complex lymphatic anomalies are characterized by abnormal formation and organization of lymphatic vessels with excessive growth. Patients often present with overlapping symptoms that can lead to severe pulmonary disease (2, 3). Examples of lymphatic anomalies include generalized lymphatic anomaly (GLA), lymphangiectasia, and chyloperitoneum (pericardial, pleural, or peritoneal). Due to significant diagnostic challenges, inconsistencies in classification and nomenclature have hindered research on complex lymphatic anomalies (3-6). Despite little understanding of the molecular genetic etiology of complex lymphatic anomalies, congenital lymphatic system malformations appear to have a related underlying genetic etiology (7-9). Indeed, germline and somatic mutations have been identified in genes that converge on the PI3K / mTOR and Ras / MAPK pathways (1, 8).

[0006] Dysruption or aberration of the PI3K / mTOR and Ras / MAPK signaling pathways has been shown to impair normal expansion and remodeling during maturation of the lymphatic network, where such dysruption is associated with lymphatic disease. Acquisition of AKT1 and PIK3CA functional mutations, leading to elevated mammalian targets of rapamycin complex 1 (mTORCl) activity, was identified in patients with lymphatic malformations, including partial syndromes such as Proteus syndrome (OMIM 176920), CLOVES syndrome (OMIM 612918), and Klippel-Trenaunay-Weber syndrome (OMIM 149000) (9-11). Mutations in KRAS, HRAS, RAF1, PTPN11, SOS1, and RASA1, which lead to dysregulation of RAS pathway activity, resulted in lymphedema or lymphangiectasia in the following syndromes: Noonan syndrome (OMIM 163950), Costello syndrome (OMIM 218040), cardio-facio-cutaneous syndrome (OMIM 115150), and capillary malformation-arteriovenous malformation (CM-AVM) syndrome (OMIM 608354) (12-17).

[0007] Despite these understandings, there is a lack of genetic biomarkers for identifying patients with lymphatic disorders and lymphatic vessel abnormalities, such as lymphangiomatosis / lymphangiectasia (LAM), generalized lymphatic anomaly (GLA), and chylocele, and a lack of therapeutic agents that target genetic markers associated with these disorders. SUMMARY

[0008] Accordingly, in one embodiment of the application, a method for diagnosing a lymphatic vessel abnormality in a human patient is provided. An exemplary method comprises: obtaining a biological sample comprising nucleic acid from the patient; analyzing the nucleic acid to determine: i) whether a single nucleotide variation (SNV) is present in one or more of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, CBL, and ARAF, or ii) whether a SNV in linkage disequilibrium with a SNV in one or more of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, CBL, and ARAF is present; and diagnosing the patient as having a lymphatic vessel abnormality if a SNV of i) or ii) is present. In another aspect, a method for diagnosing a lymphatic vessel abnormality in a human patient entails obtaining genotypic sequence information from the human patient, determining from the sequence information: i) whether a single nucleotide variation (SNV) is present in one or more of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, CBL, and ARAF, or ii) whether a SNV in linkage disequilibrium with a SNV in one or more of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, CBL, and ARAF is present; and diagnosing the patient as having a lymphatic vessel abnormality if a SNV of i) or ii) is present.

[0009] The present application also provides a method for treating a lymphatic vessel abnormality in a human patient. An exemplary method comprises: obtaining a biological sample comprising nucleic acid from the patient; analyzing the nucleic acid to determine i) whether a single nucleotide variant (SNV) is present in one or more of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, and CBL or ii) whether a SNV in linkage disequilibrium with a SNV in one or more of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, and CBL is present; and administering to the patient identified as having one or more SNVs of i) or ii) one or more agents suitable for treating the lymphatic vessel abnormality, thereby treating the lymphatic vessel abnormality. In alternative embodiments of the method, genotype information is obtained from the patient and analyzed to determine: i) whether a single nucleotide variant (SNV) is present in one or more of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, and CBL or ii) whether a SNV in linkage disequilibrium with a SNV in one or more of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, and CBL is present; and administering to the patient identified as having one or more SNVs of i) or ii) one or more agents suitable for treating the lymphatic vessel abnormality, thereby treating the lymphatic vessel abnormality. In alternative embodiments of the method, genotype information is obtained from the patient.

[0010] In certain embodiments, the lymphatic vessel abnormality is characterized by abnormal formation and / or overgrowth of lymphatic vessels. In other embodiments, the lymphatic vessel abnormality is lymphangioleiomyomatosis (LAM). In another embodiment, the lymphatic vessel abnormality is generalized lymphatic anomaly (GLA). The lymphatic vessel abnormality is characterized by chyloperitoneum, including pericardial, pleural or peritoneal effusion.

[0011] The diagnostic method can further comprise generating a report identifying the SNV upon detection in the biological sample. The therapeutic method described above can further comprise generating a report identifying a recommended treatment for the lymphatic vessel abnormality based on the SNV identified in the method.

[0012] In some embodiments, the agent administered to the SNV-positive subject is 1) a MEK / ERK inhibitor; 2) an agent / inhibitor listed in Tables 1 and 2; 3) a combination of a MEK / ERK inhibitor and one or more agents / inhibitors listed in Tables 1 and 2; and / or 4) a combination of 1) an mTOR inhibitor and / or a PIK3K inhibitor; and 2) one or more MEK / ERK inhibitors. In yet another embodiment, the diagnostic methods described herein can further comprise administering to the diagnosed patient an effective amount of one or more agents suitable for treating the lymphatic vessel abnormality.

[0013] In certain embodiments of the treatment methods, the agent administered (e.g., to a patient harboring one or more SNVs associated with a lymphatic vessel abnormality) is selected from one or more MEK / ERK inhibitors, and combinations of one or more of any of the inhibitors. In some embodiments, the agent administered is a MEK / ERK inhibitor. In some embodiments, the agent administered is one or more agents listed in Tables 1 and 2. In some embodiments, the agent administered is a MEK / ERK inhibitor and one or more agents listed in Tables 1 and 2. In some embodiments, the agent administered is a combination of 1) an mTOR inhibitor and / or a PIK3K inhibitor; and 2) one or more MEK / ERK inhibitors. In some embodiments, when the agent is an mTor inhibitor, rapamycin and / or BEZ-235 (dactolisib) is administered. In certain embodiments, the one or more mTOR inhibitors, one or more PIK3K inhibitors, and / or one or more MEK / ERK inhibitors have an IC50 of less than 100 μΜ, less than 10 μΜ, less than 1 μΜ, less than 100 nM, less than 10 nM, less than 1 nM.

[0014] In some embodiments, the patient does not have an SNV in PTPN11. In some embodiments, the patient does not have an SNV in BRAF. In some embodiments, the patient does not have an SNV in KRAS. In some embodiments, the patient does not have an SNV in SOS1. In some embodiments, the patient does not have an SNV in ITGA9.

[0015] In some embodiments, combinations of agents listed in Tables 1 and 2 are used. These combinations include, but are not limited to, a) Ridaforolimus and Trametinib; b) Ridaforolimus and Selumetinib or Cobimetinib; c) BEZ235 and Selumetinib; d) Omipalisib and Selumetinib or Trametinib; e) Everolimus and Trametinib or Selumetinib; f) Sirolimus, Ridaforolimus and Selumetinib; g) Sirolimus, Ridaforolimus and Trametinib; h) Torkinib and Trametinib; i) BEZ235, Torkinib and Trametinib; and j) Sirolimus and Gedatolisib and Trametinib. In other embodiments, the treatment further comprises administration of systemic chemotherapy, interferon alpha, radiation therapy and / or surgery.

[0016] In some embodiments, the SNV is selected from the group consisting of c.1504T>G:pS502A, c.1510A>G:pM504V and / or c.1507G>C:pG503R in the PTPN11 gene, c.35G>A:pG12D in KRAS, c.1403T>C:pF468S in the BRAF gene, c.2536G>A:pE846K in the SOS1 gene, and a complex mutation comprising c.1236+4A>G and c.289T>G:p.C97G in the ITGA9 gene, wherein "c." designates coding DNA sequence and "p." designates protein sequence.

[0017] In some embodiments, the diagnostic method comprises detecting one or more of the above SNVs. In some embodiments, the diagnostic method further comprises administering to the subject one or more agents known to treat lymphatic vessel abnormalities. In some embodiments, the agent is a MEK / ERK inhibitor. In some embodiments, the agent administered is one or more of the agents listed in Tables 1 and 2. In some embodiments, the agent administered is a MEK / ERK inhibitor in combination with one or more of the agents listed in Tables 1 and 2. In some embodiments, the agent administered is a combination of 1) an mTOR inhibitor and / or a PIK3K inhibitor; and 2) one or more MEK / ERK inhibitors. The administration of the agent(s) improves one or more lymphatic structures, reduces chylous pleural effusion, improves respiratory function, allows for a gradual reduction in concomitant medication, and / or increases survival rate.

[0018] In some embodiments, the diagnostic method comprises detecting one or more of c.1504T>G:pS502A, c.1510A>G:pM504V, and / or c.1507G>C:pG503R in the PTPN11 gene, and administering at least one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, the agent is selected from Tables 1-2, thereby improving one or more lymphatic structures, reducing chylothorax, improving respiratory function, allowing for tapering of concomitant medications, or increasing survival rate.

[0019] In some embodiments, the diagnostic method comprises detecting c.1403T>C:pF468S in the BRAF gene. In some embodiments, the diagnostic method further comprises treating the patient with one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, the agent is selected from Tables 1-2, thereby improving one or more lymphatic structures, reducing chylothorax, improving respiratory function, allowing for tapering of concomitant medications, or increasing survival rate.

[0020] In some embodiments, the diagnostic method comprises detecting c.35G>A:pG12D in KRAS, and administering one or more mTor inhibitors and one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, at least one agent is selected from Tables 1-2 for administration, thereby improving one or more lymphatic structures, reducing chylothorax, improving respiratory function, allowing for tapering of concomitant medications, or increasing survival rate.

[0021] In some embodiments, the diagnostic method comprises detecting c.2536G>A:pE846K in the SOS1 gene. In some embodiments, the diagnostic method further comprises treating the patient with one or more MEK / ERK inhibitors, alone or in combination. In other embodiments, the agent is selected from Tables 1-2, thereby improving one or more lymphatic structures, reducing chylothorax, improving respiratory function, allowing for tapering of concomitant medications, or increasing survival rate.

[0022] In some embodiments, the diagnostic method comprises detecting c.1236+4A>G and / or c.289T>G:p.C97G in the ITGA9 gene, and administering one or more MEK / ERK inhibitors, alone or in combination. In some embodiments, at least one agent of Tables 1-2 is administered, thereby improving one or more lymphatic structures, reducing chylothorax, improving respiratory function, allowing for tapering of concomitant medications, or increasing survival rate.

[0023] Suitable ERK / MEK inhibitors for treatment include, but are not limited to, selumetinib (AZD6244), PD0325901, trametinib (GSK1120212), PD184352 (CI-1040), pimasertib (AS-703026), TAK-733, AZD8330, binimetinib (MEK162, ARRY-162, ARRY-438162), SL-327, refametinib (RDEA119, Bay 86-9766), and cobimetinib (GDC-0973, RG7420).

[0024] In some embodiments, the step of analyzing the nucleic acid to determine the presence of a single nucleotide variant (SNV) in one or more of c.1504T>G:pS502A, c.1510A>G:pM504V, and / or c.1507G>C:pG503R in the PTPN11 gene, c.35G>A:pG12D in the KRAS, c.1403T>C:pF468S in the BRAF gene, c.2536G>A:pE846K in the SOS1 gene, and a complex mutation comprising c.1236+4A>G and c.289T>G:p.C97G in the ITGA9 gene further comprises the step of analyzing the polynucleotide sample to determine the presence of the SNV by performing a process selected from the group consisting of detection of specific hybridization, measurement of allele size, restriction fragment length polymorphism analysis, allele-specific hybridization analysis, single base primer extension reaction, and sequencing of amplified polynucleotides.

[0025] In some embodiments, the biological sample comprises DNA.

[0026] In some embodiments, the biological sample comprises RNA.

[0027] In some embodiments, the nucleic acid comprising the SNV is obtained from an isolated cell of a human patient.

[0028] In some embodiments, an isolated vector encodes a nucleic acid with a SNV, wherein the SNV is selected from the group consisting of: c.1504T>G:pS502A, c.1510A>G:pM504V, and / or c.1507G>C:pG503R in the PTPN11 gene, c.35G>A:pG12D in the KRAS, c.1403T>C:pF468S in the BRAF gene, c.2536G>A:pE846K in the SOS1 gene, and a complex mutation comprising c.1236+4A>G and c.289T>G:p.C97G in the ITGA9 gene.

[0029] In some embodiments, the host cell comprises an isolated vector encoding a nucleic acid with a SNV. In some embodiments, the transgenic animal comprises the host cell. In some embodiments, the transgenic animal is a mouse or a zebrafish.

[0030] In some embodiments, the method of screening for the effect of an agent comprises contacting a host cell or a transgenic animal with one or more of the inhibitors described herein, or encompassing the agents of Tables 1-2, either alone or in combination. In some embodiments, the effect of the agent being screened for is caudal rescue or branching rescue in zebrafish.

[0031] In some embodiments, the method for identifying an agent that alters cell signaling comprises: providing a cell expressing at least one nucleic acid comprising at least one SNV as described above, providing a cell expressing a homologous wild-type sequence lacking the SNV; contacting both populations of cells with a test agent; and analyzing whether the agent alters cell signaling in the cell having the nucleic acid comprising the SNV (relative to the cell lacking the SNV). BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 Figure 4a - Overexpression of BRAF and PTPN11 mutants in the Ea.hy926 cell line activates ERK signaling.

[0033] Figure 2 Figure 4b - MEK inhibitors reduce activation / phosphorylation of ERK in cells overexpressing BRAF WT and F486S mutants.

[0034] Figure 3 Figure 4c - MEK inhibitors reduce activation / phosphorylation of ERK in cells overexpressing PTPN11 mutants.

[0035] Figures 4A-4B Figure 4d - MEK inhibitors reduce activation / phosphorylation of ERK in cells overexpressing PTPN11 mutants.

[0036] Figures 5A-5B Figure 4e - MEK inhibitors reduce activation / phosphorylation of ERK in cells overexpressing PTPN11 mutants. Figure 5A Figure 4f - MEK inhibitors reduce activation / phosphorylation of ERK in cells overexpressing PTPN11 mutants. Figure 5B

[0037] ​Figure 6 Effect of PD0325901 on HDLECs expressing ARAF mutant S214P. PD0325901 rescues the ARAF-S214P-induced cell morphological differences as shown by reduced pERK levels at the cell membrane and increased VE-cadherin accumulation. Green color indicates HA staining, which marks ARAF-expressing cells; red color indicates VE-cadherin staining.

[0038] Figure 7 Effect of CI1040 on HDLECs expressing ARAF mutant S214P. CI1040 rescues the ARAF-S214P-induced cell morphological differences as shown by reduced pERK levels at the cell membrane and increased VE-cadherin accumulation. Green color indicates HA staining, which marks ARAF-expressing cells; red color indicates VE-cadherin staining.

[0039] Figure 8 Effect of Pimasertib on HDLECs expressing ARAF mutant S214P. Pimasertib rescues the ARAF-S214P-induced cell morphological differences as shown by reduced pERK levels at the cell membrane and increased VE-cadherin accumulation. Green color indicates HA staining, which marks ARAF-expressing cells; red color indicates VE-cadherin staining.

[0040] Figure 9 Effect of TAK-733 on HDLECs expressing ARAF mutant S214P. TAK-733 rescues the ARAF-S214P-induced cell morphological differences as shown by reduced pERK levels at the cell membrane and increased VE-cadherin accumulation. Green color indicates HA staining, which marks ARAF-expressing cells; red color indicates VE-cadherin staining.

[0041] Figure 10 Effect of AZD8330 on HDLECs expressing ARAF mutant S214P. AZD8330 rescues the ARAF-S214P-induced cell morphological differences as shown by reduced pERK levels at the cell membrane and increased VE-cadherin accumulation. Green color indicates HA staining, which marks ARAF-expressing cells; red color indicates VE-cadherin staining.

[0042] Figure 11 Effect of Refametinib on HDLECs expressing ARAF mutant S214P. Refametinib rescues the ARAF-S214P-induced cell morphological differences as shown by reduced pERK levels at the cell membrane and increased VE-cadherin accumulation. Green color indicates HA staining, which marks ARAF-expressing cells; red color indicates VE-cadherin staining.

[0043] Figure 12 Effect of Ulixertinib on HDLECs expressing the ARAF mutant S214P. Ulixertinib rescued the ARAF-S214P-induced cell morphological differences as shown by decreased phosphorylation levels of the ERK substrate RSK3 at the cell membrane and increased VE-cadherin accumulation. Green indicates HA staining, which marks cells expressing ARAF; red indicates VE-cadherin staining; white indicates DAPI staining of the nuclei.

[0044] Figure 13 Effect of Ulixertinib on HDLECs expressing the BRAF mutant F486S. Ulixertinib rescued the BRAF-F486S-induced cell morphological differences as shown by increased VE-cadherin accumulation at the cell membrane. Green indicates HA staining, which marks cells expressing BRAF; red indicates VE-cadherin staining; white indicates DAPI staining of the nuclei.

[0045] Figure 14 Effect of Trametinib on HDLECs expressing the BRAF mutant F486S. Trametinib rescued the BRAF-F486S-induced cell morphological differences as shown by decreased phosphorylation levels of ERK at the cell membrane and increased VE-cadherin accumulation. Green indicates HA staining, which marks cells expressing BRAF; red indicates VE-cadherin staining; white indicates DAPI staining of the nuclei.

[0046] Figure 15 Effect of Trametinib on HDLECs expressing the RAF1 mutant T145P. Trametinib rescued the RAF1-T145P-induced cell morphological differences as shown by decreased phosphorylation levels of ERK at the cell membrane and increased VE-cadherin accumulation.

[0047] Figure 16 Effect of Ulixertinib and Trametinib on HDLECs expressing the KRAS mutant G12D. Ulixertinib and Trametinib rescued the KRAS-G12D-induced cell morphological differences as shown by decreased phosphorylation levels of ERK at the cell membrane and increased VE-cadherin accumulation.

[0048] Figure 17 Weak activation of p-ERK induced by RIT1 mutation.

[0049] Figure 18Three-dimensional spheroid sprouting assay showed increased sprouting activity in HDLECs expressing three different EPHB4 mutations compared to EPHB4-WT as measured by length of bottom sprouts. Both rapamycin and OSI-027 rescued the increased sprouting induced by the mutant L778_G779insLMGS.

[0050] Figure 19 Treatment with MEK inhibitor and BEZ235 significantly improved the edema caused by KRAS mutant G12D.

[0051] Figure 20 Mosaic expression of PTPN11 S502A or G503R mutations resulted in a mild lymphatic abnormality phenotype.

[0052] Figure 21 CRISPR knockout of the target on rasa1a and rasa1b around residue 749 resulted in large edema formation in zebrafish, single targeting (rasa1a or rasa1b) or ATG targeting did not result in any phenotype.

[0053] Figures 22A-22G Clinical picture and molecular analysis of a lymphedema proband. Figure 22A ) Coronal slice of a T2-weighted non-contrast lymphangiogram showing a large pericardial effusion (arrow). Figure 22B ) Maximum intensity projection of a dynamic contrast-enhanced magnetic resonance lymphangiogram in a healthy control showing normal TD moving to the left azygos vein. Figure 22C ) Maximum intensity projection of a dynamic contrast-enhanced magnetic resonance lymphangiogram in P1 showing an enlarged lumbar lymphatic network with retrograde portal flow (arrow) and an enlarged and tortuous TD (arrow) moving to the left azygos vein and also providing retrograde perfusion to the mediastinum and pericardium (box). Figure 22D ) Contrast lymphangiogram of the boxed area in c showing an enlarged and tortuous distal TD with retrograde flow towards the mediastinum, pericardium and lung through the enlarged lymphatic network originating from the distal TD (arrow). Figure 22E ) Coronal maximum intensity projection of the pelvis and genitalia showing multiple enlarged ducts originating from the bilateral inguinal lymph nodes (arrows) and providing retrograde flow to the penis and scrotum (arrows). Figure 22F ) Pedigree and genotype of the recurrent mutation (c.640T>C (p.S214P) in ARAF) identified in an unrelated relative. Figure 22G ) Schematic topology of the ARAF protein with the position of the p.S214P mutation in CR2 indicated by an asterisk. The Ser 214 residue is highly conserved across vertebrate species and all RAF isoforms.

[0054] Figures 23A-23J ARAF-S214P mutation increases ERK1 / 2 activity in HDLECs, enhances lymphangiogenic capacity, and alters actin cytoskeleton and VE-cadherin connections, and causes thoracic duct (TD) dilation in zebrafish, which can be reversed by cobimetinib. Figure 23A ARAF mutant transfection in HEK293T cells impaired binding to 14-3-3 proteins and increased p-ERK. Right panel shows normalized 14-3-3 / FLAG ratios, showing reduced co-immunoprecipitation of 14-3-3 proteins in mutants. Data shown as mean ± s.e.m. of three independent experiments. Two-tailed unpaired t-test (degrees of freedom (df) 4), ****P = 8.6 x 10 -6 Images were cropped for better presentation. Figure 23B ARAF mutant transfection in HEK293T cells induced increased p-ERK1 / 2 expression compared to cells expressing WT (**P = 0.0026; two-tailed unpaired t-test; df = 8). ARAT-S214P did not change phosphorylation of AKT, p70S6K, mTOR and p38. Normalized ratios are shown by the right boxplot (min to max values, showing all points), where the central line represents the median, the box range represents the interquartile range, while the whiskers represent the minimum to maximum data range. Six independent experiments were performed. Images were cropped for better presentation. Figure 23C Primary HDLECs transduced with ARAF-WT or ARAF-S214P were cultured under increasing concentrations of trametinib. Results from three independently transduced cells were quantified and plotted on a scatter plot, where each individual value is superimposed as a point. Data shown as mean ± s.e.m. of three independent experiments (error bars). Transduction of ARAF-S214P significantly increased p-ERK levels (*P = 0.03; two-tailed unpaired t-test, df 4). Trametinib treatment caused a significant decrease in p-ERK (*P = 0.02 for 100 nM trametinib treatment and 300 nM trametinib treatment; *P = 0.01 for 1000 nM trametinib treatment and 3000 nM trametinib treatment; two-tailed unpaired t-test, df 4); NS, not significant. Images were cropped for better presentation. Figure 23D) Three-dimensional lymphoblastoid spheroid sprouting assay showed that the sprouting activity of HDLECs expressing ARAF-S214P was increased compared to ARAF-WT as measured by the number of sprouts at the bottom (***P = 0.0002) and the length of sprouts (***P = 0.0005). Two-tailed unpaired t-test, df 22. Spheroids were also cultured under increasing concentrations of trametinib, which significantly reduced the number of sprouts at concentrations of 30 nM (****P = 4.68 x 10 -5 ; df = 25), 100 nM (***P = 9.5 x 10 -4 ; df = 25), and 300 nM (***P = 4.4 x 10 -4 ; df = 24) and the length of sprouts at 30 nM (***P = 1.8 x 10 -4 ; df = 25), 100 nM (**P = 0.001; df = 23), and 300 nM (***P = 3.2 x 10 -4 ; df = 24). Two-tailed unpaired t-test. Three experiments using independently transduced HDLECs were quantified and the points of all three experiments (15 points per condition) (3 to 6 spheroids per experiment) were plotted on staggered boxplots, where the center line represents the median, the box range represents the interquartile range, and the whiskers represent the minimum to maximum data range. Figure 23E ) ARAF mutants affect VE-cadherin localization (****P = 1.88 x 10 -26 ), while treatment with trametinib led to an increased cell surface localization of VE-cadherin (****P = 1.63 x 10 -19 ). Red arrows indicate staining referred to as plasma membrane staining, while yellow arrows indicate intracellular staining. Three experiments using independently transduced HDLECs were quantified for intracellular and plasma membrane staining and the points of all three experiments (75 points per condition) (min to max) were plotted on left boxplots, where the center line represents the median, the box range represents the interquartile range, and the whiskers represent the minimum to maximum data range. Two-tailed unpaired t-test, df 148; NS, not significant. The maximum length and width of cells from Figure 23E experiments were measured and the aspect ratio was calculated and plotted on right boxplots (min to max; bottom right), where the center line represents the median, the box range represents the interquartile range, and the whiskers represent the minimum to maximum data range. ARAF-S214P expression led to a significant increase in the aspect ratio (****P = 9.57 x 10-15), while treatment with trametinib normalized the ratio (****P = 7.51 x 10-17 ; two-tailed unpaired t-test, df 148; NS, not significant). Figure 23F ) MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay showed that ARAF-S214P did not cause an increase in proliferation of transduced HDLECs. Metabolic activity was measured at two wavelengths (550 and 700 nm). Contents of triplicate wells (n = 3 independent wells) were collected at the indicated times as described in the Methods. The trend line connects the mean of each transducer at each time point, and these points show the measured values of all data points. This experiment represents the results of two independent retroviral transductions. Figures 23G-23I ) Top: overview of the fish lymphatic system; white boxes indicate the areas investigated in Figures 23G-23I , showing overlays of confocal scans (maximum intensity projection). TD and posterior cardinal vein (PCV) are labeled in green (tg(mrc1a:EGFP)), and TD in Figure 23G – Figure 23I are outlined with dashed lines. ARAF transgene (mrc1a:araf) cells are labeled in red (green + red -> yellow). Figure 23G ) ARAF-S214P expression caused severe dilation of TD. Figure 23H ) Expression of ARAF-WT (red) had no effect on the morphology of TD and PCV (both green). Figure 23I ) Cobimetinib (1 uM) partially reversed the dilation induced by the mutation. Three independent experiments were repeated, and in Figures 23G-23I , similar findings were made. Figure 23J ), phenotypes were classified against the portion of the body that was dilated with and without cobimetinib treatment: normal, moderate dilation (TD has expanded but can be separated from the PCV), and severe dilation (TD overlaps with the PCV). Cobimetinib treatment significantly reduced severe dilation (****P = 1.33 x 10 -5 ; one-tailed unpaired t-test; blue histogram) and rescued to normal morphology (***P = 0.00051; one-tailed unpaired t-test; green histogram). A total of 40 larvae and 120 body portions were analyzed across three independent experiments. Data are shown as mean ± s.e.m. of three independent experiments. Untreated dot images are available as source data.

[0055] Figures 24A-24F : Lung function tests and clinical images of proband before and after MEK inhibitor treatment. Figure 24ALung function test results before and after MEK inhibitor treatment. Note that all lung volume measurements showed significant improvement, with the predicted value of FEV1 increasing from 23% to 42%, TLC from 29% to 56%, and the predicted value of maximal inspiratory pressure (MIP) from 71% to 115% (marked in red). FVC, forced vital capacity; FEF25-75, moderate forced expiratory flow rate; RV, residual volume; RV / TLC, RV to TLC ratio; DLCO [Hb], pulmonary carbon monoxide diffusion capacity corrected for hemoglobin; DLCO / VA, DLCO divided by alveolar volume (VA); MEP, maximal expiratory pressure; O2 Sat, oxygen saturation. Figure 24B The coronal maximum intensity projection of T2-weighted noncontrast lymphangiography images before (left) and 12 months after (right) the start of MEK inhibitor therapy confirms extensive dilation and almost complete absorption of beaded subcutaneous lymphatic vessels. Figure 24C The coronal maximum intensity projection of the contrast lymphangiography of the pelvis and chest before treatment (left) confirmed the sparse central lymphatic vessels, the lack of central lymphatic flow above the diaphragm, and the extensive dilation and beaded bilateral subcutaneous ducts moving along the abdominal wall. Twelve months after the start of treatment (right), the dilated subcutaneous ducts were absorbed, forming a new, more normal-looking lymphatic network that extended along the abdominal wall into the chest. Figure 24D The coronal maximum intensity projection of the contrasting lymphangiography images of the pelvis and thigh before treatment (left) also confirmed the sparse ducts and extensive dilation and beading of lymphatic vessels in the thigh. After treatment (right), the abnormally dilated ducts were absorbed again, and a new and more normal-looking lymphatic network was formed. Figure 24E Chest X-rays taken before treatment (left) and 12 months after treatment (right) show a reduction in effusion and a significant improvement in vital capacity. Figure 24F The patient's growth chart (left). Trametinib treatment began before age 13 (*), and improvements in lymphedema and clinical condition were observed approximately 3–6 months after treatment initiation. The upper right image shows a photograph of the patient's lower extremities after the compression stockings were removed at peak body weight. The lower right image shows the corresponding photograph of the lower extremities. Detailed Implementation

[0056] The Ras / mitogen-activated protein kinase (MAPK) pathway plays a crucial role in cell proliferation, migration, differentiation, and apoptosis, all of which are essential for normal development. Central conducting lymphatic anomaly (CCLA) is a complex lymphatic anomaly characterized by dilated lymphatic channels, impaired lymphatic channel motility, and distal obstruction affecting lymphatic drainage. First described by Trenor III and Chaudry and Clemens et al., CCLA was classified by the International Society for Vascular Anomalies (ISSVA) in 2015 as a channel-type lymphatic malformation that exhibits a clear pattern of overlap with its clinically symptomatic diagnosis, generalized lymphatic anomaly (GLA), including but not limited to chylothorax, chyloperitoneum, lymphatic leakage or backflow, and extremity swelling. We recently discovered that acquisition of a functional mutation in ARAF is causative of lymphatic anomalies, including LAM, GLA, and CCLA. Here, we describe acquisition of functional mutations in KRAS, BIRAF, and PNPN11 as pathogenic variants for lymphatic anomalies, including LAM, GLA, and CCLA. Additional mutations in SOS1, ITAG9, RASA1, RAF1, RIT1, PIEZO1, EPHB4, NF1, CBL, and ARAF are also described that contribute to the pathogenesis of this disorder.

[0057] Lymphatic anomalies are rare, devastating diseases of which the etiology is mostly unknown, and treatment depends on the patient’s presentation. Identifying the causative genes will allow the development of affordable therapies that are in line with precision medicine implementation.

[0058] In Example II, we characterize a recurrent, gain-of-function ARAF mutation (c.640T>C: p.S214P) in a 12-year-old boy with advanced lymphatic disease that was unresponsive to conventional sirolimus therapy and in another unrelated adult patient. The mutation results in loss of a conserved phosphorylation site. Cells transduced with ARAF-S214P exhibit elevated ERK1 / 2 activity, enhanced lymphangiogenic capacity, and disassembly of the actin cytoskeleton and VE-cadherin junctions, which are rescuable using the MEK inhibitor trametinib. The functional relevance of the mutation is also verified by recapitulating the lymphatic phenotype in a zebrafish model, where the abnormal phenotype is rescued using the MEK inhibitor. Subsequent treatment of the proband with the MEK inhibitor results in significant clinical improvement, with remodeling of the patient’s lymphatic system, resolution of lymphedema, significant improvement in pulmonary function tests, cessation of supplemental oxygen requirement, and near-normal daily activities. Our results provide a representative proof of how knowledge of genetic classification and mechanistic understanding can guide biology-based medical treatment, which in our view is life-saving.

[0059] Reference will now be made in detail to certain embodiments of the application, examples of which are illustrated in the accompanying drawings. While the application will be described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the application to those embodiments. On the contrary, the application is intended to cover all alternatives, modifications, and equivalents, which can be included within the scope of the application as defined by the appended claims.

[0060] Before the present teachings are described in detail, it is to be understood that the disclosure is not limited to specific components or process steps, as such can vary. It should be noted that, as used in this specification and the appended claims, the singular form "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a conjugate" includes a plurality of conjugates, reference to "a cell" includes reference to a plurality of cells, and so forth.

[0061] It is to be understood that the temperatures, concentrations, times, and the like, discussed in the present disclosure are preceded by an implicit "about", such that slight and insubstantial deviations are within the scope of the present teachings herein. Also, the use of "comprise", "comprises", "comprising", "contain", "contains", "containing", "include", "includes", and "including" should be understood in the non-limiting sense that they are used as equivalents of the wording "consist of. It is to be understood that both the foregoing general description and the detailed description are exemplary and explanatory only and are not restrictive of the present teachings.

[0062] Unless specifically indicated otherwise, the description herein stating an embodiment "comprises" various components will also be taken to mean that the embodiment "consists" or "consists essentially of the components; the description herein stating an embodiment "consists of various components will also be taken to mean that the embodiment "comprises" or "consists essentially of the components; and the description herein stating an embodiment "consists essentially of various components will also be taken to mean that the embodiment "consists of or "comprises" the components (such interchangeability does not apply to the use of these terms in the claims).

[0063] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. Any document incorporated by reference herein is in its entirety and for the purpose of describing the term in question. Although the present teachings are described in conjunction with various embodiments, no limitation with respect to the present teachings is intended. Rather, the teachings intended to cover all alternatives, modifications, and equivalents.

[0064] Further, a compound "selected from the group consisting of" means one or more compounds in the following list, including mixtures (i.e., combinations) of two or more said compounds. According to the present application, an isolated or biologically pure molecule is a compound that has been separated from the bulk of other molecules in its natural source. As such, "isolated" and "biologically pure" do not necessarily reflect the extent to which a compound has been purified to homogeneity. An isolated compound of the present application can be obtained from its natural source, produced using laboratory synthetic techniques, or produced by any such chemical synthetic route.

[0065] "Lymphatic vessel abnormality" refers to a disease or condition characterized by abnormal formation and tissue overgrowth of lymphatic vessels. Non-limiting examples of lymphatic vessel abnormalities include "lymphangiomatosis" or "lymphedema" (collectively referred to herein as LAM), lymphangioma, generalized lymphatic anomaly (GLA) and chylocele, extensive lymphangioma, systemic cystic angiomatosis, multiple lymphatic malformations, extensive lymphatic malformation, CCLA, diffuse lymphatic malformation, Kaposi type LAM and Gorham-Stout disease (GSD), a rare lymphatic vessel-derived vascular disorder characterized by progressive osteolysis.

[0066] Clinically, lymphangiomas are classified into several types. Among them are (1) Simplex, which consists of thin-walled lymphatic vessels of capillary size. This type usually affects the skin (localized lymphangioma); (2) Cystic lymphangioma (or cystic hygroma): ranging in size from a few millimeters to several centimeters, visible at a young age, usually in the neck or axilla; (3) Cavernosum: this type consists of dilated lymphatic vessels, usually with a fibrous outer membrane layer. This is the type that usually affects organs in the chest, abdomen, and bones. Each of these lymphangiomas is included in the present application.

[0067] "Single nucleotide variant (SNV)" refers to a position in genomic DNA where there is a single base different from the usual base at that position. SNVs are similar to SNPs, except that SNPs usually refer to SNVs that occur at a certain frequency (e.g., occur in more than a certain percentage of the population), while SNVs do not provide frequency information. There are millions of SNVs that have been catalogued in the human genome. Some SNVs cause disease, while other SNVs are normal variations in the genome.

[0068] "Lymphatic vessel abnormality-associated SNV or -specific marker" is an SNV associated with an increased risk of developing a lymphatic vessel abnormality that is not found in patients without such a disease. Such a marker can include, but is not limited to, a nucleic acid, a protein encoded therefrom, or other small molecules.

[0069] As used herein, the term "genetic alteration" refers to a change from a wild-type or reference sequence of one or more nucleic acid molecules. Genetic alterations include, but are not limited to, SNVs and SNPs, copy number variations (CNVs), base pair substitutions, additions, and deletions of at least one nucleotide of a nucleic acid molecule of a known sequence.

[0070] "Linkage" describes the tendency of genes, alleles, loci, or genetic markers to be inherited together due to their location on the same chromosome and is measured by the percent recombination (also called recombination rate, or theta) between two genes, alleles, loci, or genetic markers. The closer two loci are physically on a chromosome, the lower the recombination rate. Typically, when testing for linkage of a polymorphic site in a disease-causing gene to a disease, the recombination rate will be zero, indicating that the disease and the disease-causing gene are always inherited together. In rare cases, when a gene spans a large portion of the genome, it is possible to observe recombination between a polymorphic site on one end of the gene and a disease-causing mutation on the other end. However, if the disease-causing mutation is the polymorphism being tested for linkage to the disease, no recombination will be observed.

[0071] "Centimorgan" is a unit of genetic distance, representing the linkage between two genetic markers, alleles, genes, or loci, which corresponds to a 1% probability of recombination between the two markers or loci for any meiotic event.

[0072] "Linkage disequilibrium" or "allele association" refers to the frequency with which a particular allele, locus, gene, or genetic marker is preferentially associated with a particular allele, locus, gene, or genetic marker at a nearby chromosomal location, higher than any particular allele frequency that would be expected by chance in the population.

[0073] As used herein, the term "solid substrate" refers to any form, such as a bead, a microparticle, a microarray, the surface of a microtiter well or test tube, a dipstick, or a filter. The material of the substrate can be polystyrene, cellulose, latex, nitrocellulose, nylon, polyacrylamide, dextran, or agarose. The solid substrate can comprise nucleic acids immobilized thereon such that they cannot be removed from the substrate in solution.

[0074] As used herein, "target nucleic acid" refers to a previously defined region of a nucleic acid present in a complex mixture of nucleic acids, wherein the defined wild-type region contains at least one known nucleotide variation, which can or can not be associated with lymphatic vessel abnormality. The nucleic acid molecule can be isolated from a natural source by cDNA cloning or subtractive hybridization or manually synthesized. The nucleic acid molecule can be artificially synthesized by the triester method of synthesis or by using an automated DNA synthesizer.

[0075] With respect to nucleic acids used in the present application, the term "isolated nucleic acid" when applied to DNA refers to a DNA molecule that is separated from the sequences immediately contiguous (in the 5' and 3' directions) with the naturally occurring genome of the organism from which it originated. For example, an "isolated nucleic acid" can comprise a DNA molecule that is inserted into a vector (such as a plasmid or viral vector) or that is integrated into the genomic DNA of a prokaryote or eukaryote. An "isolated nucleic acid molecule" can also comprise a cDNA molecule. An isolated nucleic acid molecule that is inserted into a vector is sometimes also referred to herein as a recombinant nucleic acid molecule.

[0076] With respect to RNA molecules, the term "isolated nucleic acid" refers primarily to an RNA molecule that is encoded by an isolated DNA molecule as defined above. Alternatively, the term can refer to an RNA molecule that is sufficiently separated from the RNA molecules with which it is associated in its natural state (i.e., in a cell or tissue) such that it exists in "substantially pure" form.

[0077] The term "enriched" with respect to nucleic acids means that the proportion of a particular DNA or RNA sequence in the total DNA or RNA in a cell or solution of interest is significantly higher (2-5 fold) than the proportion of that sequence in a normal cell or in the cell from which the sequence was extracted. This can be due to a preferential reduction in the amount of other DNA or RNA present, or to a preferential increase in the amount of the particular DNA or RNA sequence, or to a combination of both. However, it should be noted that "enriched" does not mean that no other DNA or RNA sequences are present, but only that the relative amount of the sequence of interest has been significantly increased.

[0078] For certain purposes, it is also advantageous for nucleotide sequences to be in purified form. The term "purified" with respect to nucleic acids does not require absolute purity (e.g., a homogenous preparation); rather, it indicates that the sequence is relatively purer than the sequence in its natural environment.

[0079] The term "complementary" describes two nucleotides that can form a variety of favorable interactions with each other. For example, adenine is complementary to thymine because they can form two hydrogen bonds. Similarly, guanine and cytosine are complementary because they can form three hydrogen bonds. Thus, if a nucleic acid sequence comprises the following base sequence: thymine, adenine, guanine, and cytosine, the "complement" of that nucleic acid molecule is a molecule comprising adenine in place of thymine, thymine in place of adenine, cytosine in place of guanine, and guanine in place of cytosine. Because the complement can comprise a nucleic acid sequence that forms optimal interactions with the parent nucleic acid molecule, such a complement can bind to its parent molecule with high affinity.

[0080] With respect to single-stranded nucleic acids, particularly oligonucleotides, the term "specifically hybridizes" refers to the association between two single-stranded nucleotide molecules of sufficient complementary sequence to allow such hybridization under predetermined conditions commonly used in the art (sometimes referred to as "substantially complementary"). Specifically, the term refers to the hybridization of an oligonucleotide to a substantially complementary sequence contained within a single-stranded DNA or RNA molecule of the present application, substantially to the exclusion of hybridization to non-complementary sequences of single-stranded nucleic acids. For example, specific hybridization can refer to a sequence that hybridizes to any lymphatic vessel abnormality specific marker nucleic acid but not to other nucleotides. Such markers include, for example, the lymphatic vessel abnormality specific markers set forth in the tables contained herein. Suitable conditions that enable specific hybridization of single-stranded nucleic acid molecules of different complementarity are well known in the art.

[0081] For example, a general formula is shown below for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules having a particular sequence homology (Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory (1989):

[0082] T m = 81.5 °C + 16.6 Log [Na+] + 0.41 (% G+C) - 0.63 (% formamide) - 600 / bp in duplex

[0083] As an illustration of the above formula, using [Na+] = [0.368] and 50% formamide, a GC content of 42%, an average probe size of 200 bases, T m = 57 °C. For each 1% decrease in homology, the T m of a DNA duplex will decrease by 1-1.5 °C. Thus, using a hybridization temperature of 42 ° C, targets having greater than about 75% sequence identity will be observed. The stringency of hybridization and washing should be selected to be more stringent than the T mabout 12-20°C. In certain aspects, moderately stringent hybridization conditions are defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS, and 100 μg / ml denatured salmon sperm DNA at 42°C, and washing in 2X SSC and 0.5% SDS at 55°C for 15 minutes. Highly stringent hybridization conditions are defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS, and 100 μg / ml denatured salmon sperm DNA at 42°C, and washing in 1X SSC and 0.5% SDS at 65°C for 15 minutes. Very highly stringent hybridization conditions are defined as hybridization in 6X SSC, 5X Denhardt's solution, 0.5% SDS, and 100 μg / ml denatured salmon sperm DNA at 42°C, and washing in 0.1X SSC and 0.5% SDS at 65°C for 15 minutes.

[0084] As used herein, the term "oligonucleotide" is defined as a nucleic acid molecule consisting of two or more, preferably three or more, ribonucleotides or deoxyribonucleotides. The exact size of the oligonucleotide will depend on a variety of factors as well as the particular application and use of the oligonucleotide. Oligonucleotides, including probes and primers, can be any length from 3 nucleotides to the full length of the nucleic acid molecule, and expressly includes every possible number of contiguous nucleic acids from 3 nucleotides to the full length of the polynucleotide. Preferably, the oligonucleotide is at least about 10 nucleotides in length, more preferably at least 15 nucleotides in length, and more preferably at least about 20 nucleotides in length.

[0085] As used herein, the term "probe" refers to an oligonucleotide, polynucleotide, or nucleic acid, RNA or DNA, whether naturally occurring or synthetically produced, which is capable of annealing or specifically hybridizing to a nucleic acid having a sequence complementary to the probe. The probe can be single-stranded or double-stranded. The exact length of the probe will depend on many factors, including temperature, source of the probe, and method of use. For example, for diagnostic applications, the oligonucleotide probe (in some cases, the nucleic acid associated with a given rs number is associated with a single nucleotide polymorphism available in the dbSNP database) typically comprises 15-25, 15-35, 20-50, or 100 or more nucleotides, although it can comprise fewer nucleotides, provided that the site of the SNV is included in the probe. The probes herein are selected to be complementary to different strands of a particular target nucleic acid sequence. This means that the probes must be sufficiently complementary so as to be able to "specifically hybridize" or anneal to their respective target strands under a predetermined set of conditions. Therefore, the probe sequence does not have to reflect the exact complementary sequence of the target. For example, a non-complementary nucleotide sequence can be attached to the 5' or 3' end of the probe, the remainder of the probe sequence being complementary to the target strand. Alternatively, non-complementary bases or longer sequences can be interspersed into the probe, provided that the probe sequence has sufficient complementarity to the sequence of the target nucleic acid to specifically anneal thereto.

[0086] As used herein, the term "primer" refers to an oligonucleotide, which can be RNA or DNA, which can be single-stranded or double-stranded, which can be derived from a biological system, produced by restriction enzyme digestion, or synthetically produced, which is capable of functionally serving as an initiator of template-dependent nucleic acid synthesis when placed in the appropriate environment. The primer can be extended at its 3' end by the addition of nucleotides (by the action of a polymerase or similar activity) when provided with a suitable nucleic acid template, suitable nucleotide triphosphate precursors, a polymerase, suitable cofactors, and conditions such as appropriate temperature and pH, to produce a primer extension product. The length of the primer can vary depending on the particular conditions and application requirements. For example, in diagnostic applications, the oligonucleotide primer is typically 15-25, 15-40, 20-50, etc., or more nucleotides in length. The primer must have sufficient complementarity to the desired template to initiate synthesis of the desired extension product, that is, be able to anneal to the desired template strand in a manner sufficient to provide an appropriately juxtaposed 3' hydroxyl portion of the primer for initiation of synthesis by a polymerase or similar enzyme. It is not required that the primer sequence represent the exact complement of the desired template. For example, a non-complementary nucleotide sequence can be attached to the 5' end of the otherwise complementary primer. Alternatively, non-complementary bases can be interspersed into the oligonucleotide primer sequence, provided that the primer sequence has sufficient complementarity to the sequence of the desired template strand to functionally provide a template-primer complex for synthesis of the extension product.

[0087] Polymerase chain reaction (PCR) has been described in U.S. Patents 4,683,195, 4,800,195, and 4,965,188, the disclosures of which are incorporated herein by reference in their entirety.

[0088] "siRNA" refers to a molecule involved in the process of RNA interference that participates in sequence-specific post-transcriptional gene silencing or gene knockdown by providing small interfering RNA (siRNA) having homology to the sequence of the target gene. Small interfering RNA (siRNA) can be synthesized in vitro or produced by ribonuclease III cleavage from longer dsRNAs, and is a mediator of sequence-specific mRNA degradation. Preferably, siRNAs of the present application are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and conventional DNA / RNA synthesizers. The siRNAs can be synthesized as two separate complementary RNA molecules or as a single RNA molecule having two complementary regions. Commercial suppliers of synthetic RNA molecules or reagents include Applied Biosystems (Foster City, CA, USA), Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, Ill., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA), and Cruachem (Glasgow, UK). For example, specific siRNA constructs for inhibiting lymphangiomatosis mRNA can be between 15-35 nucleotides in length, more typically, they can be about 21 nucleotides in length.

[0089] The term "vector" relates to a single- or double-stranded circular nucleic acid molecule that can be infected, transfected or transformed into a cell and replicate independently or within the host cell genome. Circular double-stranded nucleic acid molecules can be cleaved, thereby linearizing upon treatment with a restriction enzyme. The knowledge of the vector, the kind of restriction enzyme and the nucleotide sequence targeted by the restriction enzyme is readily available to the person skilled in the art and includes any replicon (e.g. plasmid, cosmid, bacmid, bacteriophage or virus) onto which another genetic sequence or element (DNA or RNA) can be ligated, thereby replicating the ligated sequence or element. The nucleic acid molecule of the present application can be inserted into a vector by cleaving the vector with a restriction enzyme and ligating the two fragments together. When cloning genetic regions comprising repeats or deletions, the person skilled in the art is well aware that flanking sequences of appropriate length (e.g. between 50-100 or more nucleotides) upstream and downstream of the affected region will be employed in the cloning process. Such vectors will have utility, for example, in cell lines for studying the effects of such alterations on the encoded protein.

[0090] The person skilled in the art can use a number of techniques to facilitate the transformation, transfection or transduction of the expression construct into a prokaryotic or eukaryotic organism. The terms "transformation", "transfection" and "transduction" refer to the process of inserting nucleic acids and / or expression constructs into a cell or host organism. These processes involve a variety of techniques, such as treating cells with high concentrations of salt, electric fields or detergents, making the outer membrane or wall of the host cell permeable to the nucleic acid molecule of interest, microinjection, PEG fusion, etc.

[0091] The term "promoter element" describes a nucleotide sequence incorporated into a vector that, once in the appropriate cell, can facilitate the binding of transcription factors and / or polymerases and the subsequent transcription of a portion of the vector DNA into mRNA. In one embodiment, the promoter element of the present application is upstream of the 5' end of the lymphatic vessel abnormality specific marker nucleic acid molecule, such that the latter is transcribed into mRNA. The mRNA is then translated into a polypeptide by the host cell machinery. The promoter element can drive constitutive or inducible expression of the coding region of interest.

[0092] The person skilled in the art will recognize that the nucleic acid vector can comprise nucleic acid elements other than the promoter element and the nucleic acid encoding the lymphatic vessel abnormality specific marker. These other nucleic acid elements include, but are not limited to, origins of replication, ribosome binding sites, nucleic acid sequences encoding drug resistance enzymes or amino acid metabolism enzymes, and nucleic acid sequences encoding secretion signals, localization signals, or signals useful for the purification of the polypeptide.

[0093] A "replicon" is any genetic element, such as a plasmid, cosmid, bacmid, plasmid, bacteriophage or virus, that is capable of replication, primarily under its own control. Replicons can be RNA or DNA, and can be single- or double-stranded.

[0094] An "expression operon" refers to a nucleic acid fragment that can have transcriptional and translational control sequences, such as promoters, enhancers, translational initiation signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate expression of a polypeptide coding sequence in a host cell or organism.

[0095] As used herein, the term "reporter," "reporter system," "reporter gene," or "reporter gene product" shall mean an operable genetic system in which a nucleic acid comprises a gene that encodes a product that, when expressed, produces a reporter signal that is readily measurable (e.g., by bioassay, immunoassay, radioimmunoassay, or by colorimetric, fluorescent, chemiluminescent, or other means). The nucleic acid can be RNA or DNA, linear or circular, single- or double-stranded, antisense or sense polarity, and operably linked to the necessary control elements to express the reporter gene product. The control elements required will vary depending on the nature of the reporter system and whether the reporter gene is in DNA or RNA form, but can include, without limitation, elements such as promoters, enhancers, translational control sequences, poly A addition signals, transcriptional termination signals, and the like.

[0096] The introduced nucleic acid can or can not integrate (covalently link) into the nucleic acid of the recipient cell or organism. For example, in bacteria, yeast, plants, and mammalian cells, the introduced nucleic acid can remain as an episomal element or independent replicon, such as a plasmid. Alternatively, the introduced nucleic acid can integrate into the nucleic acid of the recipient cell or organism and be stably maintained in that cell or organism, and further passed on or inherited by progeny cells or organisms of the recipient cell or organism. Finally, the introduced nucleic acid can only be present transiently in the recipient cell or host organism.

[0097] The term "selectable marker gene" refers to a gene that, when expressed, confers a selectable phenotype (e.g., antibiotic resistance) on a transformed cell.

[0098] The term "operably linked" means that the regulatory sequences necessary for expression of a coding sequence are placed in the DNA molecule in proper positions relative to the coding sequence so as to effect expression of the coding sequence. This definition sometimes applies to the arrangement of transcriptional units and other transcription control elements (e.g., enhancers) in expression vectors.

[0099] The term "recombinant organism" or "transgenic organism" refers to an organism having a new combination of genes or nucleic acid molecules. The new combination of genes or nucleic acid molecules can be introduced into the organism using a variety of nucleic acid manipulation techniques available to one of skill in the art. The term "organism" relates to anything that is alive consisting of at least one cell. An organism can be as simple as a eukaryotic cell or as complex as a mammal. Thus, the phrase "recombinant organism" encompasses recombinant cells as well as eukaryotic and prokaryotic organisms. Exemplary transgenic organisms include zebrafish or mice.

[0100] The term "isolated protein" or "purified protein" is used herein at times. This term refers primarily to a protein produced by expression of an isolated nucleic acid molecule of the application. Alternatively, the term can refer to a protein sufficiently separated from other proteins with which it is naturally associated such that the protein exists in "substantially pure" form. "Isolated" does not exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the basic activity, and which can be present, for example, due to incomplete purification, addition of stabilizers or admixture into, for example, an immunogenic or pharmaceutically acceptable formulation.

[0101] A "specific binding pair" comprises a specific binding member (sbm) and a binding partner (bp) which have a specific specificity for each other and which bind to each other preferentially over other molecules under normal conditions. Examples of specific binding pairs are antigens and antibodies, ligands and receptors, and complementary nucleotide sequences. The skilled person knows many other examples. Furthermore, the term "specific binding pair" also applies to cases where one or both of the specific binding member and the binding partner comprise a moiety of a macromolecule. In embodiments where the specific binding pair comprises nucleic acid sequences, they will have a length that hybridizes to each other under the conditions of the assay, preferably more than 10 nucleotides long, more preferably more than 15 or 20 nucleotides long.

[0102] A "sample" or "patient sample" or "biological sample" generally refers to a sample that can be tested for a particular molecule, preferably a lymphatic abnormality specific marker molecule, such as the markers shown in the table below. The sample can include, but is not limited to, cells, body fluids including blood, serum, plasma, urine, lymphatic fluid, saliva, tears, pleural fluid, and the like.

[0103] "Genotypic sequence information" generally refers to any information relating to the DNA or RNA sequence of a subject. Genotypic sequence information includes whole genome, whole exome sequencing, exome sequencing, or targeted sequencing of regions of interest within the genome of a subject. Genotypic sequence information can also include the generation of data regarding the presence or absence of a particular SNV, for example, SNVs found herein to be associated with lymphatic vessel abnormalities. Additionally, genotypic sequence information would include the use of probes to detect the presence and / or expression of one or more SNVs associated with lymphatic vessel abnormalities. Examples of how probes can be used to obtain genotypic sequence information include, but are not limited to: (1) in situ hybridization; (2) southern hybridization (3) northern hybridization; (4) various amplification reactions, such as polymerase chain reaction (PCR).

[0104] The terms "agent" and "test compound" are used interchangeably herein to refer to a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract from a biological material such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues. Biological macromolecules include siRNA, shRNA, antisense oligonucleotides, peptides, peptide / DNA complexes, and any nucleic acid-based molecule capable of modulating the activity of an SNV-containing nucleic acid or encoded protein described herein. Exemplary agents include, but are not limited to, at least one MEK inhibitor. Other agents also include those listed in Tables 1-2. The potential biological activity of an agent is assessed by inclusion in the screening assays described below.

[0105] As used herein, "treatment" covers any administration or application of a therapeutic agent to a mammal (including humans) for the purpose of affecting a disease, including inhibiting the disease or progression of the disease, inhibiting or slowing the disease or its progression, arresting its development, partially or completely relieving symptoms, preventing the disease from occurring, or preventing recurrence of symptoms of the disease. Exemplary treatments include administration of an effective dose of at least one MEK inhibitor and / or at least one of the agents listed in Tables 1-2.

[0106] The terms "inhibition" or "inhibit" refer to the reduction or cessation of any event (e.g., protein ligand binding), or the reduction or cessation of any phenotypic characteristic, or the reduction or cessation of the incidence, degree, or likelihood of the characteristic. "Reduction" or "inhibition" refers to a decrease, decrease, or prevention of activity, function, and / or amount as compared to a reference. Complete inhibition or decrease is not required. For example, in certain embodiments, "decrease" or "inhibit" refers to the ability to cause an overall reduction of 20% or more. In another embodiment, "decrease" or "inhibit" refers to the ability to cause an overall reduction of 50% or more. In another embodiment, "decrease" or "inhibit" refers to the ability to cause an overall reduction of 75%, 85%, 90%, 95%, or more.

[0107] The term "inhibitor" refers to an agent that slows or stops a particular chemical reaction, signal transduction pathway, or other process, or reduces the activity of a particular reactant, catalyst, or enzyme.

[0108] The terms "patient" and "subject" are used interchangeably and refer to a mammal, including a human.

[0109] The term "MEK" refers to the MAPK / ERK pathway (also known as the Ras-Raf-MEK-ERK pathway), which comprises a series of proteins in a cell that relay signals from receptors on the cell surface to DNA in the nucleus. The signal begins when a signaling molecule binds to a receptor on the cell surface, and ends when the DNA in the nucleus expresses a protein and produces some change in the cell, such as cell division. The pathway includes many proteins, including MAPKs (mitogen-activated protein kinases, originally called ERKs, extracellular signal-regulated kinases), which communicate by adding phosphate groups on neighboring proteins, acting as "on" or "off switches.

[0110] The term "MEK inhibitor" or "MEK / ERK inhibitor" refers to an agent that inhibits mitogen-activated protein kinases MEK1, MEK2, and / or ERK. They can be used to affect the MAPK / ERK pathway, which is often overactive in certain cancers. The term "cellular signal transduction" will include mTOR signal transduction as well as any other signal transduction pathway process that controls cell homeostasis or activity.

[0111] Diagnosing a patient with lymphatic vessel abnormalities

[0112] In some embodiments, after obtaining genotype sequence information from a biological sample obtained from a patient, the patient is diagnosed with a lymphatic vessel abnormality based on the presence of SNVs. In some embodiments, the patient is diagnosed with a lymphatic vessel abnormality based on the presence of one or more SNVs detected in a gene selected from PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZO1, EPHB4, NF1, ARAF, and CBL, or the presence of SNVs detected in linkage disequilibrium with SNVs in a gene selected from PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZO1, EPHB4, NF1, ARAF, and CBL, which are associated with lymphatic vessel abnormalities. In some embodiments, the one or more SNVs are c.1504T>G:pS502A, c.1510A>G:pM504V, and / or c.1507G>C:pG503R in the PTPN11 gene, c.35G>A:pG12D in KRAS, c.1403T>C:pF468S in the BRAF gene, c.2536G>A:pE846K in the SOS1 gene, and a complex mutation comprising c.1236+4A>G and c.289T>G:p.C97G in the ITGA9 gene, or any of the mutations listed in Table 3.

[0113] In some embodiments, a report confirming the presence of SNVs in a particular subject can be generated from the experimental data. In some embodiments, a report recommending a treatment for a lymphatic vessel abnormality can be generated based on data about SNVs confirmed using the genotype sequence information.

[0114] In some embodiments, after obtaining genotype sequence information from a biological sample obtained from a patient, a diagnosis based on detecting the presence of one or more SNVs in a gene selected from the group consisting of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, ARAF, and CBL, or detecting the presence of a SNV in linkage disequilibrium with a SNV in a gene selected from the group consisting of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, ARAF, and CBL, can guide the selection of a treatment for the patient. In some embodiments, after obtaining genotype sequence information from a biological sample obtained from a patient, a diagnosis based on detecting the presence of one or more SNVs in a gene selected from the group consisting of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, ARAF, and CBL, or detecting the presence of a SNV in linkage disequilibrium with a SNV in a gene selected from the group consisting of PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZ01, EPHB4, NF1, ARAF, and CBL, does not guide or influence the selection of a treatment for the patient.

[0115] In some embodiments, the diagnosis of a lymphatic vessel abnormality is made based on clinical presentation, scan results, and / or family history alone. In some embodiments, the diagnosis of a lymphatic vessel abnormality is made without the need to test for genetic sequence information. In some embodiments, the diagnosis of a lymphatic vessel abnormality is made based on clinical presentation and genetic sequence information.

[0116] The SNVs associated with lymphatic vessel abnormalities disclosed in the present application can be used in a variety of ways to diagnose a lymphatic vessel abnormality.

[0117] For example, a nucleic acid comprising a SNV associated with a lymphatic vessel abnormality can be used as a probe to detect the presence and / or expression of a lymphatic vessel abnormality specific marker. Methods by which a marker nucleic acid associated with a lymphatic vessel abnormality can be used as a probe for such assays include, but are not limited to: (1) in situ hybridization; (2) Southern hybridization; (3) northern hybridization; (4) various amplification reactions, such as polymerase chain reaction (PCR).

[0118] In addition, assays for detecting a SNV associated with a lymphatic vessel abnormality or a protein encoded thereby can be performed on any type of biological sample, including but not limited to a bodily fluid (including blood, urine, serum, gastric lavage), any type of cell (e.g., brain cell, white blood cell, monocyte), or body tissue.

[0119] Nucleic acids comprising SNVs associated with lymphatic vessel abnormalities, vectors expressing the same, marker proteins comprising SNVs associated with lymphatic vessel abnormalities, and anti-lymphatic vessel abnormality specific marker antibodies can be used to detect SNVs associated with lymphatic vessel abnormalities in tissue, cells or body fluids in vivo, and to alter marker protein expression comprising SNVs associated with lymphatic vessel abnormalities to detect and diagnose lymphatic vessel abnormalities.

[0120] Methods of detecting and / or diagnosing lymphatic vessel abnormalities based on SNVs associated with lymphatic vessel abnormalities are included. The methods can include detecting SNVs associated with lymphatic vessel abnormalities, nucleic acids comprising SNVs associated with lymphatic vessel abnormalities in a sample will first be amplified (e.g., using PCR) to increase the number of templates compared to other sequences present in the sample. This allows for detection of target sequences with high sensitivity if they are present in the sample. This initial step can be avoided by using highly sensitive array technologies that are becoming more important in the field.

[0121] Alternatively, new detection technologies can overcome this limitation and enable analysis of small samples containing as little as 1 μg of total RNA. Using resonance light scattering (RLS) technology, multiple reads can detect small amounts of mRNA using biotin-labeled hybridization targets and anti-biotin antibodies compared to traditional fluorescent technologies. Another alternative to PCR amplification involves planar waveguide technology (PWG) to increase signal-to-noise ratio and reduce background interference. Both technologies are commercially available from Qiagen Inc. (USA).

[0122] Accordingly, any of the foregoing technologies can be used to detect or quantify SNV marker expression associated with lymphatic vessel abnormalities, and thus to diagnose lymphatic vessel abnormalities or the risk of developing the same.

[0123] Treating patients with lymphatic vessel abnormalities

[0124] Elucidating the role of SNVs associated with lymphatic vessel abnormalities described herein in modulating the lymphatic vessel abnormality phenotype facilitates repurposing of existing therapies, and the development of new therapies that can be used to treat lymphatic vessel abnormalities. In some embodiments, the present application includes administering one or more mTOR inhibitors, one or more PIK3K inhibitors, and / or one or more MEK inhibitors (e.g., one or more agents in Tables 1-2) to a patient having a lymphatic vessel abnormality.

[0125] In some embodiments, the patient to be treated having a lymphatic abnormality has been diagnosed based on symptoms and positive family history of a lymphatic abnormality. In some embodiments, a variety of scanning techniques, such as plain film radiography, bone scan, computed tomography, magnetic resonance imaging, and lymphoscintigraphy are used in conjunction with clinical presentation to diagnose a lymphatic abnormality. In some embodiments, a biopsy is performed to diagnose a lymphatic abnormality. In some embodiments, a lymphatic abnormality is diagnosed based on overgrowth of lymphatic vessels. In some embodiments, a lymphatic abnormality is diagnosed based on abnormal formation of lymphatic vessels. In some embodiments, a lymphatic abnormality is diagnosed based on chylous effusions, including pericardial, pleural, or peritoneal effusions.

[0126] In some embodiments, the patient to be treated having a lymphatic abnormality has been diagnosed according to the diagnostic methods described herein.

[0127] In some embodiments, one or more MEK inhibitors (e.g., one or more agents of Tables 1-2; Example II) can be used in the preparation of a medicament to treat a lymphatic abnormality. The one or more agents can be formulated with a pharmaceutically acceptable excipient, carrier, buffer, stabilizer, or other materials well known in the art. Such materials should be nontoxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material can depend on the route of administration, e.g., oral, intravenous, dermal or subcutaneous, nasal, nebulized, intramuscular, and intraperitoneal routes. In vitro systems or transgenic organisms comprising a lymphatic abnormality-associated mutation can be used to select particular agents for use in treating humans.

[0128] Agents that can be used in the treatment include, but are not limited to, the agents of Tables 1 and 2. Both Tables 1 and 2 list certain agents, and the fact that they are not listed in both tables should not be given any significance.

[0129] Table 1

[0130]

[0131]

[0132]

[0133]

[0134]

[0135] Table 2 provides agents that can be used alone or in combination with any of the agents in Table 1 or Table 2 to treat a lymphatic abnormality.

[0136] Table 2

[0137]

[0138]

[0139] Structure of ISO-27 (Mateo et al. (2016) Br. J. Cancer 114(8):889-96

[0140] For the treatment of an individual having a lymphatic vessel abnormality, or to reduce the signs or symptoms of the disease, a suitable agent targeting a gene disclosed herein can be administered in combination in order to provide a therapeutic benefit to the patient. Such agents should be administered in an effective dose.

[0141] Once the genetic alteration is confirmed, a therapy can be designed to modulate the biological pathways and signal transduction pathways affected by the altered gene. For example, where inhibition of the MAPK (MEK1 / MEK2) and ERK pathways is desired, a MEK inhibitor can be used alone or in combination with other MEK / ERK inhibitors. In certain embodiments, the treatment requires administration of an agent listed in Table 1 or 2, such as an mTOR inhibitor, with a PIK3K inhibitor. In other embodiments, an mTOR inhibitor and a MEK / ERK inhibitor are combined to provide a therapeutic benefit to the patient. In another approach, a PIK3K and a MEK / ERK inhibitor are combined to ameliorate the symptoms of the disease. For the acquisition of a specific ARAF functional mutation described herein, an effective therapy includes administration of a MEK / ERK inhibitor. The combination therapies described above can act in an additive manner. In other embodiments, the agents combined act synergistically to reduce the symptoms.

[0142] First, a biological sample and / or genotyping information can be obtained from the patient. The genetic information gathered from the nucleic acids present in the sample is then assessed, for example, for the presence of SNVs associated with a lymphatic vessel abnormality. The presence of these mutations indicative of the risk or presence of a lymphatic vessel abnormality, and the simultaneous confirmation of the affected gene, provides the clinician with guidance as to which therapeutic agents are appropriate. One or more total therapeutic doses (when two or more targets are to be modulated) can be administered to the subject in a single dose, or a fractionated treatment regimen can be used, in which multiple / separate doses are administered over a longer period of time, for example, allowing for daily doses to be administered over the course of a day, or doses to be administered over a longer period of time, over the time period required. The skilled artisan will know that the amount of lymphatic vessel abnormality agent required to obtain an effective dose in a subject depends on many factors, including the age, weight, and general health of the subject, as well as the route of administration and the number of treatments to be administered. In view of these factors, the skilled artisan will adjust the particular dose to obtain an effective dose for the treatment of an individual having a lymphatic vessel abnormality.

[0143] The effective dosage of a lymphatic vessel abnormality treatment agent will depend on the mode of administration and the body weight of the individual treated. The dosages described herein are generally for an average human adult, but can be adjusted for children. The dosages are generally from about 0.001 mg to about 1000 mg.

[0144] The administration of a lymphatic vessel abnormality treatment agent is particularly useful in individuals with lymphatic vessel abnormalities, particularly in those with more severe forms of the disease, when administered in combination with, for example, conventional drugs used to treat such diseases. The skilled artisan will administer a lymphatic vessel abnormality treatment agent alone or in combination, and monitor the effectiveness of such treatment using routine methods, e.g., pulmonary, intestinal, thyroid, or inflammatory function assays, radiological or immunological tests, or, where indicated, histopathological methods. Other agents used to treat lymphatic vessel abnormalities include systemic chemotherapy, alpha interferon therapy, radiation therapy, or surgery to alleviate the symptoms of the disease.

[0145] The administration of the pharmaceutical formulation is preferably an "effective amount" that is sufficient to show an benefit to the individual. The amount prevents, alleviates, slows, or otherwise reduces the severity of the lymphatic vessel abnormality symptoms in the patient. Treatment of a patient with a lymphatic vessel abnormality with an effective amount of a MEK inhibitor and / or an agent of Table 1-2 can improve lymphatic structure, reduce chylothorax, improve respiratory function, reduce morbidity associated with the medication, or increase survival rate.

[0146] The pharmaceutical formulation can be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suitable for administration of a pharmaceutical formulation to a patient. Each dosage should contain a quantity of active ingredient calculated to produce the desired effect in association with the selected pharmaceutical carrier. Procedures for determining appropriate dosage unit are well known to those skilled in the art.

[0147] Dosage units can be proportionally increased or decreased based on the body weight of the patient. As is known in the art, the appropriate concentration for alleviating a particular pathological condition can be determined by dose concentration curve calculations.

[0148] Pharmaceutical compositions useful in the methods of the present application can be administered systemically in the form of parenteral, oral solid and liquid preparations, or can be administered subcutaneously, intradermally, intramuscularly, sublingually, topically, otic (OTIC), buccal, conjunctival, cutaneous, dental, transdermally, intra-cervical, sinus or tracheal, enterally, epidurally, transmucosally, interstitially, intraperitoneally, intra-arterially, intra-articularly, intra-biliary, intra-bronchially, intra-capsularly, intra-cardiacally, intra-corneally, intra-dermally, intra-lymphatically, intra-pericardially, intra-peritoneally, intranasally, transdermally, respiratory, ocular, suppository, aerosol, topically, or other known routes of administration. In addition to agents useful in the treatment of lymphatic vessel abnormalities, the pharmaceutical compositions can also include pharmaceutically acceptable carriers and other known ingredients that enhance and facilitate drug administration. Thus, such compositions can optionally include other components, such as adjuvants, such as aqueous suspensions of aluminum and magnesium hydroxides, and / or other pharmaceutically acceptable carriers, such as saline. Other possible formulations, such as nanoparticles, liposomes, resealed erythrocytes, and immune-based systems, can also be used to deliver / administer appropriate agents to patients in accordance with the methods of the present application. The use of nanoparticles to deliver such agents, as well as cell membrane-permeable peptide carriers that can be used, are described in Crombez et al., Biochemical Society Transactions v35:p44 (2007).

[0149] Upon successful detection or quantification of SNV marker expression associated with a lymphatic vessel abnormality and thus diagnosis of a lymphatic vessel abnormality or risk of developing a lymphatic vessel abnormality, administration of an agent useful in the treatment of a lymphatic vessel abnormality can be completed. Detection or quantification of SNV marker expression associated with a lymphatic vessel abnormality can guide the selection of a particular drug for treatment. Detection or quantification of SNV marker expression associated with a lymphatic vessel abnormality can indicate that a particular treatment is not appropriate for a given subject.

[0150] In other embodiments, treatment of a lymphatic vessel abnormality can be performed based on a clinical diagnosis of the disease, and treatment can be initiated without detecting or quantifying genetic sequence information. In other embodiments, treatment of a lymphatic vessel abnormality can be performed based on a clinical diagnosis of the disease, and treatment can be initiated without detecting or quantifying SNV marker expression associated with a lymphatic vessel abnormality.

[0151] In other embodiments, treatment of a lymphatic vessel abnormality can be performed based on a clinical diagnosis of the disease, and treatment can be initiated when SNV marker expression associated with a lymphatic vessel abnormality is not different from a control.

[0152] In some embodiments, the treatment is administered in a patient having no SNV in PTPN11, KRAS, BRAF, SOS1, ITGA9, RASA1, RAF1, RIT1, PEIZO1, EPHB4, NF1, ARAF, and CBL.

[0153] In some embodiments, the inhibitor is a MEK1 / 2 inhibitor, which inhibits mitogen-activated protein kinase MEK1 and / or MEK2. They can be used to affect the MAPK / ERK pathway, which is often overactive in certain cancers and other disorders.

[0154] In some embodiments, the co-administered agent is rapamycin or BEZ-235 (dactolisib). Rapamycin, an mTOR inhibitor, is also known as sirolimus. BEZ-235, also known as dactolisib or NVP-BEZ235, is a compound with known activity against pi 10, PI3K, and mTOR.

[0155] In some embodiments, the agent administered in the method of treatment is selected from the group consisting of: rapamycin (sirolimus), everolimus (RAD001), AZD8055, Temsirolimus (CCI-779, NSC 683864), KU-0063794, MHY1485, BEZ235 (NVP-BEZ235, Dactolisib), PI-103, Torkinib (PP242), tacrolimus (FK506), Deforolimus (MK-8669), INK 128 (MLN0128), Voxtalisib (SAR245409, XL765), Torin 1, Omipalisib (GSK2126458, GSK458), OSI-027, PF-04691502, Apitolisib (GDC-0980, RG7422), GSK1059615, Gedatolisib (PF-05212384, PKI-587), WYE-354, AZD2014, Torin 2, WYE-125132 (WYE-132), PP121, WYE-687, CH5132799, WAY-600, ETP-46464, GDC-0349, XL388, zotarolimus (ABT-578), tacrolimus (FK506), BGT226 (NVP-BGT226), Palomid 529 (P529), and Rheinacetic acid.

[0156] In some embodiments, the agent to be administered is a MEK inhibitor selected from the group consisting of selumetinib (AZD6244), PD0325901, trametinib (GSK1120212), PD184352 (CI-1040), Pimasertib (AS-703026), TAK-733, AZD8330, binimetinib (MEK162, ARRY-162, ARRY-438162), SL-327, Refametinib (RDEA119, Bay 86-9766), and cobimetinib (GDC-0973, RG7420).

[0157] Combinations of the above agents can also be used in the treatment methods described herein to treat lymphatic vessel abnormalities. In some embodiments, the following combinations can act in an additive or synergistic manner to treat lymphatic vessel abnormalities (including GLA and LAM). In certain embodiments, the combination for administration is selected from the group consisting of 1) Deforolimus and trametinib; 2) Deforolimus and selumetinib or cobimetinib; 3) BEZ235 and selumetinib; 4) Omipalisib and selumetinib or trametinib; 5) Everolimus and trametinib or selumetinib; 6) Sirolimus, Deforolimus and selumetinib; 7) Sirolimus, Deforolimus and trametinib; 8) Torkinib and trametinib; 9) BEZ235, Torkinib and trametinib; and 10) Sirolimus and Gedatolisib and trametinib.

[0158] In some embodiments, the treatment with an agent listed herein is used in combination with one or more of systemic chemotherapy, interferon alpha, radiation therapy, and / or surgery.

[0159] Methods of identifying other useful therapeutic agents

[0160] Since the SNVs identified herein have been associated with the etiology of lymphatic vessel abnormalities, methods of identifying agents that modulate the activity of the genes and their encoded products comprising such SNVs should result in the production of effective therapeutic agents for the treatment of this condition.

[0161] The chromosomal regions described herein contain protein coding regions that provide suitable targets for the rational design of therapeutic agents that modulate their activity. Small peptide molecules corresponding to these regions can be used to facilitate the design of therapeutic agents that can effectively modulate the activity of the encoded proteins.

[0162] Molecular modeling should help identify specific organic molecules with the ability to bind to the active site of a protein encoded by a SNV-containing nucleic acid based on the conformation or key amino acid residues required for function. Combinatorial chemistry methods will be used to identify molecules with the greatest activity, and then iterations of these molecules will be developed for further screening cycles. In certain embodiments, candidate drugs can be screened from large libraries of synthetic or natural compounds. One example is the FDA-approved library of compounds for human use. Additionally, libraries of compounds are commercially available from a number of companies, including but not limited to Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, NJ), Microsource (New Milford, CT), Aldrich (Milwaukee, WI), AKos Consulting and Solutions GmbH (Basel, Scotland), Ambinter (Paris, France), Asinex (Moscow, Russia), Aurora (Graz, Australia), BioFocus DPI, Switzerland, Bionet (Camelford, UK), ChemBridge, (San Diego, CA), ChemDiv, (San Diego, CA), Chemical Block Lt, (Moscow, Russia), ChemStar (Moscow, Russia), Exclusive Chemistry, Ltd (Obninsk, Russia), Enamine (Kyiv, Ukraine), Evotec (Hamburg, Germany), Indofine (Sparks, NJ), Interbioscreen (Moscow, Russia), Interchim (Montlucon, France), Life Chemicals, Inc. (Orange, CT), Microchemistry Ltd. (Moscow, Russia), Otava, (Toronto, ON), PharmEx Ltd. (Moscow, Russia), Princeton Biomolecular (Monmouth Junction, NJ), Scientific Exchange (Center Ossipee, NH), Specs (Delft, Netherlands), TimTec (Newark, DE), Toronto Research Corp. (North York ON), UkrOrgSynthesis (Kyiv, Ukraine), Vitas-M, (Moscow, Russia), Zelinsky Institute, (Moscow, Russia), and Bicoll (Shanghai, China).

[0163] Libraries of natural compounds in the form of bacterial, fungal, plant, and animal extracts are commercially available or can be readily prepared by methods well known in the art. It is contemplated that compounds isolated from natural sources (e.g., animal, bacterial, fungal, plant sources (including leaves and barks)) as well as marine samples can be assayed as candidates to detect the presence of potentially useful pharmaceutical agents. It will be appreciated that the pharmaceutical agents to be screened can also be derived or synthesized from chemical compositions or artificial compounds. Several commercial libraries can be used in the screening.

[0164] The polypeptides or fragments used in the drug screening assays can be free in solution, immobilized on a solid support, or within a cell. One drug screening method utilizes eukaryotic or prokaryotic host cells that are stably transformed with recombinant polynucleotides expressing the polypeptides or fragments, preferably in a competitive binding assay. Such cells, in viable or fixed form, can be used in standard binding assays. For example, the formation of a complex between the polypeptide or fragment and a test agent can be determined, or the extent to which the formation of a complex between the polypeptide or fragment and a known substrate is interfered with by a test agent can be examined.

[0165] Another technique for drug screening involves the use of host eukaryotic cell lines, cells (e.g., endothelial cells), or intact animal models (e.g., transgenic mice or zebrafish) that have a nonfunctional or altered lymphatic vessel abnormality-associated gene. In some cases, the transgenic organism comprises cells having a mutation in the PTPN11 gene of c.1504T>G:pS502A, c.1510A>G:pM504V, and / or c.1507G>C:pG503R, c.35G>A:pG12D in KRAS, c.1403T>C:pF468S in BRAF gene, c.2536G>A:pE846Kin in SOS1 gene, and a compound mutation comprising c.1236+4A>G and c.289T>G:p.C97G in ITGA9 gene or one or more mutations shown in Table 3. These host cell lines, cells, or transgenic animals are deficient at the polypeptide level. The host cell line or cell is grown in the presence of a pharmaceutical compound. For example, in a zebrafish model, rescue of tail blood vessels and / or D / V vascular structures can be assessed. Additionally, induction of phosphorylation by mTOR in the host cell line can be assessed.

[0166] An exemplary method for drug screening is a method for identifying agents that alter cell signaling, e.g., the agents listed in Tables 1-2. The method would include providing a cell expressing at least one nucleic acid comprising at least one SNV associated with lymphatic vessel abnormalities; providing a cell expressing a homologous wild-type sequence corresponding to the SNV associated with lymphatic vessel abnormalities; contacting the cell expressing at least one SNV associated with lymphatic vessel abnormalities and the cell expressing the homologous wild-type sequence with a test agent; and analyzing whether the agent alters cell signaling.

[0167] Host cells expressing SNVs associated with lymphatic vessel abnormalities or functional fragments thereof of the application provide a system in which potential compounds or agents are screened for their ability to modulate lymphatic vessel abnormality development. Thus, in one embodiment, nucleic acid molecules of the application can be used to generate recombinant cell lines for use in assays to identify agents that modulate abnormal MAPK signaling associated with lymphatic vessel abnormalities and abnormal vascularization. Methods of screening for compounds that are capable of modulating the function of a protein encoded by a SNV-containing nucleic acid are also provided herein.

[0168] Another method entails the use of phage display libraries, engineered to express polypeptide fragments encoded by SNV-containing nucleic acids on the phage surface. Such libraries are then subjected to multiple rounds of contact with a combination chemical library under conditions in which binding affinity between the expressed peptides and components of the chemical library can be detected. U.S. Patents 6,057,098 and 5,965,456 provide methods and apparatuses for conducting such assays.

[0169] In another embodiment, the availability of altered nucleic acids associated with lymphatic abnormality enables the production of a laboratory mouse strain carrying the altered nucleic acids of the application. These altered nucleic acids associated with lymphatic abnormality can be c.1504T>G:pS502A, c.1510A>G:pM504V and / or c.1507G>C:pG503R in the PTPN11 gene, c.35G>A:pG12D in KRAS, c.1403T>C:pF468S in the BRAF gene, c.2536G>A:pE846K in the SOS1 gene, and a complex mutation comprising c.1236+4A>G and c.289T>G:p.C97G in the ITGA9 gene, or any other mutation shown in Table 3. Transgenic mice expressing the mutations associated with lymphatic abnormality of the application provide a model system in which the role of the protein encoded by the mutated nucleic acid in the occurrence and progression of lymphatic abnormality can be examined. Methods for introducing transgenes in laboratory mice are known to those skilled in the art. Three common methods include: 1. integration of a retroviral vector encoding the exogenous gene of interest into an early embryo; 2. injection of DNA into the pronucleus of a newly fertilized egg; and 3. integration of genetically manipulated embryonic stem cells into an early embryo. The production of the above transgenic mice will facilitate the molecular dissection of the role of the target protein in various processes associated with the lymphatic abnormality phenotype. Such mice provide in vivo screening tools to study putative therapeutic drugs in an entire animal model and are encompassed by the present application.

[0170] The term "animal" as used herein includes all vertebrates, including humans. It also includes individual animals at various stages of development, including embryonic and fetal stages. A "transgenic animal" refers to any animal that contains one or more cells with genetic information that has been altered or received directly or indirectly by deliberate genetic manipulation at the subcellular level (for example, by targeted recombination, microinjection, or infection with a recombinant virus). The term "transgenic animal" is not intended to encompass a classical cross or in vitro fertilization, but rather an animal in which one or more of the cells has been altered or received a recombinant DNA molecule. The molecule can be specifically targeted to a particular genetic locus, randomly integrated into the chromosome, or it can be extrachromosomally replicated DNA. The term "germline transgenic animal" refers to a transgenic animal in which a genetic alteration or genetic information has been introduced into the germline, thereby conferring the ability to pass the genetic information to offspring. If these offspring in fact possess some or all of this alteration or genetic information, they are also transgenic animals.

[0171] The change in genetic information can be foreign to the animal species to which the recipient belongs, or foreign only to the particular individual recipient, or can be genetic information already possessed by the recipient. In the last case, the changed or introduced gene can express differently than the native gene. Such changed or foreign genetic information will include the introduction of a changed nucleotide sequence associated with lymphatic vessel abnormality.

[0172] DNA used to alter a target gene can be obtained by a variety of techniques, including but not limited to isolation from a genomic source, preparation of cDNA from an isolated mRNA template, direct synthesis, or combinations thereof.

[0173] One type of target cell for transgene introduction is an embryonic stem cell (ES). ES cells can be obtained from pre-implantation embryos cultured in vitro (Evans et al., (1981) Nature 292: 154-156; Bradley et al., (1984) Nature 309:255-258; Gossler et al., (1986) Proc. Natl. Acad. Sci. 83:9065-9069). Transgenes can be introduced efficiently into ES cells by standard techniques (e.g., DNA transfection) or by retrovirus-mediated transduction. Thereafter, the resulting transformed ES cells can be combined with blastocysts from a non-human animal. Thereafter, the introduced ES cells colonize the embryo and contribute to the germline of the resulting chimeric animal.

[0174] One method of determining the contribution of individual genes and their expression products is to use isolated, mutant-containing genes associated with lymphatic vessel abnormality as an insertional cassette to selectively inactivate wild-type genes in pluripotent ES cells (e.g., those described above), and then generate transgenic mice. The use of gene-targeted ES cells in the production of gene-targeted transgenic mice is described and reviewed elsewhere (Frohman et al., (1989) Cell 56: 145-147; Bradley et al., (1992) Bio / Technology 10:534-539).

[0175] By using targeted homologous recombination to insert specific changes into a chromosomal allele, techniques can be used to inactivate or alter any genetic region to a desired mutation. However, the initial report of homologous plasmid-chromosome recombination was detected at a frequency of only between 10 -6 and 10 -3 times that of homologous extrachromosomal recombination, which occurs at near 100% frequency. Non-homologous plasmid-chromosome interactions occur at a level 10 5 -10 2 times more frequently than homologous inserts.

[0176] To overcome the low proportion of targeted recombination in murine ES cells, various strategies have been developed to detect or select rare homologous recombinants. One method of detecting homologous alteration events is to screen the pool of transformed cells for homologous insertions by polymerase chain reaction (PCR) and then screen individual clones. Alternatively, a positive genetic selection method has been developed in which a marker gene is constructed that is only active when a homologous insertion has occurred, so that these recombinants can be directly selected. One of the most powerful methods developed for selecting homologous recombinants is the positive-negative selection (PNS) method developed for genes for which there is no direct selection alteration. The PNS method is more effective for targeting genes that are not highly expressed because the marker gene has its own promoter. Non-homologous recombinants are selected by using the herpes simplex virus thymidine kinase (HSV-TK) gene and non-homologous recombinants are selected using an effective herpes drug, such as gancyclovir (GANC) or (1-(2-deoxy-2-fluoro-B-D arabinofuranosyl)-5-iodouracil (FIAU). By this counter-selection, the number of homologous recombinants in the surviving transformants can be increased. With the mutated lymphatic-vascular abnormality-associated nucleic acid as the targeting insertion cassette, a method of detecting successful insertion is provided, for example, by obtaining immunoreactivity with an antibody having immunological specificity for a polypeptide encoded by the EPHB4 nucleic acid, thus facilitating screening / selecting ES cells having the desired genotype.

[0177] As used herein, a knock-in animal is an animal in which, for example, an endogenous murine gene has been replaced by a human lymphatic-vascular abnormality-associated gene of the present application. Such a knock-in animal provides an ideal model system for studying the development of lymphatic-vascular abnormalities.

[0178] As used herein, a vector can be used to target expression of a mutated lymphatic-vascular abnormality-associated nucleic acid, fragment thereof, or lymphatic-vascular abnormality-associated fusion protein in a "tissue-specific manner" or "cell type-specific manner," wherein the nucleic acid sequence encoding all or a portion of the lymphatic-vascular abnormality-associated nucleic acid is operably linked to regulatory sequences (e.g., promoters and / or enhancers) that direct expression of the encoded protein in a particular tissue or cell type. Such regulatory elements can be advantageously used in both in vitro and in vivo applications. Promoters that direct tissue-specific proteins are well known in the art and are described herein. Alternatively, the transgene can be under the control of an inducible promoter that can act in a tissue-specific or "systemic" manner.

[0179] The nucleic acid sequences encoding the mutant associated with lymphatic vessel abnormality of the present application can be operably linked to a variety of different promoter sequences for expression in transgenic animals. Such promoters include, but are not limited to, a prion gene promoter, such as a hamster or mouse Thy-1 promoter for expression of a transgene in a desired cell type; a PGK promoter; or a CMV promoter.

[0180] Also provided herein are methods of using the transgenic mice of the present application. For example, the transgenic mice into which a nucleic acid comprising a nucleic acid associated with a mutant lymphatic vessel abnormality or a protein encoded thereby has been introduced can be used to develop screening methods to screen for therapeutic agents to identify those capable of modulating the occurrence of a lymphatic vessel abnormality.

[0181] Detection products and kits

[0182] Compositions or products useful for detecting a lymphatic vessel abnormality SNV are encompassed. For example, a nucleic acid comprising a SNV associated with a lymphatic vessel abnormality, a vector expressing the same, a marker protein comprising a SNV associated with a lymphatic vessel abnormality, and an antibody to a lymphatic vessel abnormality specific marker are products capable of detecting a SNV of c.1504T>G:pS502A, c.1510A>G:pM504V, and / or c.1507G>C:pG503R in the PTPN11 gene, c.35G>A:pG12D in KRAS, c.1403T>C:pF468S in the BRAF gene, c.2536G>A:pE846K in the SOS1 gene, and a complex mutation comprising c.1236+4A>G and c.289T>G:p.C97G in the ITGA9 gene. Also included are nucleic acid probes of sufficient length and character to detect a SNV of c.1504T>G:pS502A, c.1510A>G:pM504V, and / or c.1507G>C:pG503R in the PTPN11 gene, c.35G>A:pG12D in KRAS, c.1403T>C:pF468S in the BRAF gene, c.2536G>A:pE846K in the SOS1 gene, and a complex mutation comprising c.1236+4A>G and c.289T>G:p.C97G in the ITGA9 gene. The detection products can be labeled so that they can be detected.

[0183] Any product that can be used to detect SNVs associated with lymphatic vessel abnormalities can be incorporated into the kit. Any product that can be used to treat lymphatic vessel abnormalities can be incorporated into the kit. Kits comprising such detection and treatment products are included. The kits can comprise one or more of the following: a lymphatic vessel abnormality-associated SNV-specific marker polynucleotide or one or more such markers immobilized on a solid support, a gene chip, an oligonucleotide, a polypeptide, a peptide, an antibody, a label, a marker, a reporter, a pharmaceutically acceptable carrier, a physiologically acceptable carrier, instructions for use, a container, an administration vessel, a test substrate, or any combination thereof.

[0184] The following examples are provided to illustrate certain embodiments of the present application. They are not intended to limit the application in any way.

[0185] Example I

[0186] As described for other lymphatic malformations, CCLAs are the result of errors in congenital lymphatic development. To determine the genetic basis of CCLAs, we performed whole-exome sequencing on DNA samples from 7 patients, all of whom had malformative lymphatic vessels imaged by dynamic contrast magnetic resonance lymphangiography (DCMRL), a new advanced imaging technique that better diagnosed this group of patients. We examined five patients for missense, nonsense, splice-altering, and coding indel mutations that could explain these phenotypes. Results were filtered to exclude synonymous variants, variants with minor allele frequencies (MAF) greater than 0.5%, and variants previously identified in controls through our in-house exome variant database. Relevant candidates have been recommended for manual curation. As a result, we identified one somatic mutation and five de novo missense mutations in four different genes (PTPN11, KRAS, BRAF, and SOS1), all of which involved the Ras / MAPK signaling pathway (Table 3). Additionally, two heterozygous variants were found in a patient with primary lymphedema and retrograde lymph flow, c.1236+4A>G and c.289T>G:p.C97G in ITGA9. ITGA9 encodes integrin alpha-9, a cell surface glycoprotein that mediates cell-cell adhesion and cell-matrix interactions. Integrin alpha-9 binds VEGF-C, and inactivation of Itga9 caused chylothorax and disrupted lymphatic valve formation in mice.

[0187] The sequence of each of these proteins can be found in the NCBI database and is listed below.

[0188] a) c.1504T>G:pS502A in PTPN11;

[0189] S502 present in NCBI Reference Sequence NP_002825.3

[0190] b) c.1510A>G:pM504V in PTPN11 ;

[0191] M504 present in NCBI Reference Sequence NP_002825.3

[0192] c) c.1507G>C:pG503R in PTPN11 ;

[0193] G503 present in NCBI Reference Sequence NP_002825.3

[0194] d) c.35G>A:pG12D in KRAS;

[0195] G12 present in NCBI Reference Sequence NP_203524.1.

[0196] e) c.1403T>C:pF468S in BRAF;

[0197] F468 present in NCBI Reference Sequence NP_004324.2

[0198] f) c.2536G>A:pE846K in SOS1 ;

[0199] E846 present in NCBI Reference Sequence NP_005624.2

[0200] g) c.1236+4A>G and c.289T>G:p.C97G in ITGA9;

[0201] pC97 present in NCBI Reference Sequence NP_002198.2.

[0202] * Variant is 4 bp from exon-intron junction and present in intron

[0203] Table 3. Mutations in genes that cause lymphoid disorders

[0204]

[0205]

[0206]

[0207] NM_002834.3:381-2162 Homo sapiens protein tyrosine phosphatase, non-receptor type 11 (PTPN11), transcript variant 1, mRNA

[0208]

[0209] NM_004985.4:193-759 Homo sapiens KRAS oncogene, GTPase (KRAS), transcript variant b, mRNA

[0210] ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAATTATGTAA (SEQ ID NO: 2)

[0211] NM_004333.4:62-2362 Homo sapiens B-Raf proto-oncogene, serine / threonine kinase (BRAF), mRNA

[0212]

[0213] NM_005633.3:42-4043 Homo sapiens SOS Ras / Rac guanine nucleotide exchange factor 1 (SOS1), mRNA

[0214]

[0215] NM_002207.2: 54-3161 Homo sapiens integrin subunit alpha 9 (ITGA9), mRNA

[0216]

[0217] NM_002890.2 4402 bp mRNA Homo sapiens RAS p21 protein activator 1 (RASA1), transcript variant 1

[0218] 1 cgtaacccag gcagctgggg agcctgggct gtggccctag gagggggcgc ggcggcgggc

[0219] 61 tctctccttt tgttgttgtt tcctcagcct ggggagctga aggggagacg cgtctgggtg

[0220] 121 gggctgctcg gagcccgggc ctggtggccc ctggggctcc cgggcgggca gggtagggca

[0221] 181 gagtagagcg ggcttcaaca tgatggcggc cgaggccggc agtgaggagg gcggcccggt

[0222] 241 aacagccgga gctggaggag gcggcgcggc agcgggctcc agtgcctatc ccgcagtgtg

[0223] 301 tcgggtgaag atacccgcgg ccctgcctgt ggcagccgcc ccctatcctg ggctggtgga

[0224] 361 gaccggagtg gctggaactc tgggtggcgg agccgctttg gggtcagagt tcctaggagc

[0225] 421 cgggtctgtg gcaggggcac tggggggagc tggactgaca gggggaggta ctgctgctgg

[0226] 481 cgtagctggt gctgctgctg gcgtggccgg tgctgctgtt gctggaccta gtggagacat

[0227] 541 ggctctcacc aaactgccca cttcgttgct tgctgagact ctcgggccag gcggcggttt

[0228] 601 tccccctctg ccccctcccc cttacctgcc ccctttgggg gcgggcctcg ggacagtgga

[0229] 661 cgaaggtgac tctctggatg gaccagaata cgaggaggaa gaggtggcca taccgttgac

[0230] 721 cgctcctcca actaaccagt ggtatcacgg aaaacttgac agaacgatag cagaagaacg

[0231] 781 cctcaggcag gcagggaagt ctggcagtta tcttataaga gagagtgatc ggaggccagg

[0232] 841 gtcctttgta ctttcatttc ttagccagat gaatgttgtc aaccatttta ggattattgc

[0233] 901 tatgtgtgga gattactaca ttggtggaag acgtttttct tcactgtcag acctaatagg

[0234] 961 ttattacagt catgtttctt gtttgcttaa aggagaaaaa ttactttacc cagttgcacc

[0235] 1021 accagagcca gtagaagata gaaggcgtgt acgagctatt ctaccttacacaaaagtacc

[0236] 1081 agacactgat gaaataagtt tcttaaaagg agatatgttc attgttcataatgaattaga

[0237] 1141 agatggatgg atgtgggtta caaatttaag aacagatgaa caaggccttattgttgaaga

[0238] 1201 cctagtagaa gaggtgggcc gggaagaaga tccacatgaa ggaaaaatatggttccatgg

[0239] 1261 gaagatttcc aaacaggaag cttataattt actaatgaca gttggtcaagtctgcagttt

[0240] 1321 tcttgtgagg ccctcagata atactcctgg cgattattca ctttatttccggaccaatga

[0241] 1381 aaatattcag cgatttaaaa tatgtccaac gccaaacaat cagtttatgatgggaggccg

[0242] 1441 gtattataac agcattgggg acatcataga tcactatcga aaagaacagattgttgaagg

[0243] 1501 atattatctt aaggaacctg taccaatgca ggatcaagaa caagtactcaatgacacagt

[0244] 1561 ggatggcaag gaaatctata ataccatccg tcgtaaaaca aaggatgccttttataaaaa

[0245] 1621 cattgttaag aaaggttatc ttctgaaaaa gggcaaagga aaacgttggaaaaatttata

[0246] 1681 ttttatctta gagggtagtg atgcccaact tatttatttt gaaagcgaaaaacgagctac

[0247] 1741 caaaccaaaa ggattaatag atctcagtgt atgttctgtc tatgtcgttcatgatagtct

[0248] 1801 ctttggcagg ccaaactgtt ttcagatagt agttcagcac tttagtgaagaacattacat

[0249] 1861 cttttacttt gcaggagaaa ctccagaaca agcagaggat tggatgaaaggtctgcaggc

[0250] 1921 attttgcaat ttacggaaaa gtagtccagg gacatccaat aaacgccttcgtcaggtcag

[0251] 1981 cagccttgtt ttacatattg aagaagccca taaactccca gtaaaacattttactaatcc

[0252] 2041 atattgtaac atctacctga atagtgtcca agtagcaaaa actcatgcaagggaagggca

[0253] 2101 aaacccagta tggtcagaag agtttgtctt tgatgatctt cctcctgacatcaatagatt

[0254] 2161 tgaaataact cttagtaata aaacaaagaa aagcaaagat cctgatatcttatttatgcg

[0255] 2221 ctgccagttg agccgattac agaaagggca tgccacagat gaatggtttctgctcagctc

[0256] 2281 ccatatacca ttaaaaggta ttgaaccagg gtccctgcgt gttcgagcacgatactctat

[0257] 2341 ggaaaaaatc atgccagaag aagagtacag tgaatttaaa gagcttatac tgcaaaagga

[0258] 2401 acttcatgta gtctatgctt tatcacatgt atgtggacaa gaccgaacactactggccag

[0259] 2461 catcctactg aggatttttc ttcacgaaaa gcttgaatcg ttgttgttat gcacactaaa

[0260] 2521 tgacagagaa ataagcatgg aagatgaagc cactacccta tttcgagccacaacacttgc

[0261] 2581 aagcaccttg atggagcagt atatgaaagc cactgctaca cagtttgttcatcatgcttt

[0262] 2641 gaaagactct attttaaaga taatggaaag caagcagtct tgtgagttaagtccatcaaa

[0263] 2701 gttagaaaaa aatgaagatg tgaacactaa tttaacacac ctattgaacatactttcaga

[0264] 2761 gcttgtggag aaaatattca tggcttcaga aatacttcca ccgacattgagatatattta

[0265] 2821 tgggtgttta cagaaatctg ttcagcataa gtggcctaca aataccaccatgagaacaag

[0266] 2881 agttgttagt ggttttgttt ttcttcgact catctgtcct gccatcctgaatccacggat

[0267] 2941 gttcaatatc atctcagatt ctccatctcc tattgctgca agaacactgatattagtggc

[0268] 3001 taaatctgtg cagaacttag caaatcttgt ggaatttgga gctaaggagccctacatgga

[0269] 3061 aggtgtcaat ccattcatca aaagcaacaa acatcgtatg atcatgtttttagatgaact

[0270] 3121 tgggaatgta cctgaacttc cggacactac agagcattct agaacggacctgtcccgtga

[0271] 3181 tttagcagca ttgcatgaga tttgcgtggc tcattcagat gaacttcgaacgctcagtaa

[0272] 3241 tgagcgtggt gcacagcagc acgtattgaa aaagcttctg gctataacagaactgcttca

[0273] 3301 acaaaaacaa aaccagtata caaaaaccaa tgatgtcagg tagcagccttcgccccagtg

[0274] 3361 ttctgcatgg attcagcatg tccaacatgg taattcactt cagtttaatgtctcctttgc

[0275] 3421 tcttgccaaa aaatagcaca cttttccaca ttccagtgat gtgtgagctatgcaaacaaa

[0276] 3481 atccaagatt ctgctggtga ataactatgc cagcaacctt gtaagctatctgtgcaggat

[0277] 3541 atttgcacta tttccacatg gaatcaatct ttaacaacct ctgagccttg gtgtacagac

[0278] 3601 cacctttcac aaaacgaaat gctatgactg tatcttgata tctcgaactt tcaaaatata

[0279] 3661 ttttcagtac acccagttgc caaagttttg ctgtctctta gagaaagaactatgaaatca

[0280] 3721 actgacaaga aacacattct tattgacaat tgtgtataac tggattgcag actgttctta

[0281] 3781 ctgtaactac ttcctgatta ggaatatgac catttgactg ttcaatgatt atttgtattt

[0282] 3841 acagtttcca gagtttgtca ttataatagg aacaatcttt gctgtatact tttaaaaaat

[0283] 3901 actctgctat ttctcttgct ggaactgttg aaagaaaata tatagaatg atctattgctc

[0284] 3961 atcagcttta ttttttaaac atacgactta ttttgttgaa attgtcaaag actgtattta

[0285] 4021 gatctcataa tgctttgtta aatgtttaca agtaaatagt ttgaattcag taaatattat

[0286] 4081 tggttgttgt attgatcaat gcatgttacc cattcaacca ttttatagactaccaatttc

[0287] 4141 ttttatgtta actagaatgc ttttgttaaa agttatttgt tcattatttg tgctacccct

[0288] 4201 ttgattatgc agacaacctc atcagctgcc taacttatcc atctttgaac ttctgactac

[0289] 4261 ttgttgtatc tgctggatat ttagttcaac tgtatagttt tatttacttc tgtatgtgta

[0290] 4321 tttttgtgaa gtattcacaa aggttaagtt aaaataaaac caagggatat ct tgcataat

[0291] 4381 tgattaaaaa aaaaaaaaaa aa (SEQ ID NO: 6)

[0292] NM_002880.2 3291 bp mRNA Homo sapiens Raf-1 proto-oncogene, serine / threonine kinase (RAF1), transcript variant 2, mRNA.

[0293] 1 agaatcggag agccggtggc gtcgcaggtc gggaggacga gcaccgagtc gagggctcgc

[0294] 61 tcgtctgggc cgcccgagag tcttaatcgc gggcgcttgg gccgccatct tagatggcgg

[0295] 121 gagtaagagg aaaacgattg tgaggcggga acggctttct gctgcctttt ttgggccccg

[0296] 181 aaaagggtca gctggccggg ctttggggcg cgtgccctga ggcgcggagc gcgtttgcta

[0297] 241 cgatgcgggg gctgctcggg gctccgtccc ctgggctggg gacgcgccga atgtgaccgc

[0298] 301 ctcccgctcc ctcacccgcc gcggggagga ggagcgggcg agaagctgcc gccgaacgac

[0299] 361 aggacgttgg ggcggcctgg ctccctcagg tttaagaatt gtttaagctg catcaatgga

[0300] 421 gcacatacag ggagcttgga agacgatcag caatggtttt ggattcaaag atgccgtgtt

[0301] 481 tgatggctcc agctgcatct ctcctacaat agttcagcag tttggctatc agcgccgggc

[0302] 541 atcagatgat ggcaaactca cagatccttc taagacaagc aacactatcc gtgttttctt

[0303] 601 gccgaacaag caaagaacag tggtcaatgt gcgaaatgga atgagcttgc atgactgcct

[0304] 661 tatgaaagca ctcaaggtga ggggcctgca accagagtgc tgtgcagtgt tcagacttct

[0305] 721 ccacgaacac aaaggtaaaa aagcacgctt agattggaat actgatgctg cgtctttgat

[0306] 781 tggagaagaa cttcaagtag atttcctgga tcatgttccc ctcacaacac acaactttgc

[0307] 841 tcggaagacg ttcctgaagc ttgccttctg tgacatctgt cagaaattcc tgctcaatgg

[0308] 901 atttcgatgt cagacttgtg gctacaaatt tcatgagcac tgtagcacca aagtacctac

[0309] 961 tatgtgtgtg gactggagta acatcagaca actcttattg tttccaaatt ccactattgg

[0310] 1021 tgatagtgga gtcccagcac taccttcttt gactatgcgt cgtatgcgagagtctgtttc

[0311] 1081 caggatgcct gttagttctc agcacagata ttctacacct cacgccttcacctttaacac

[0312] 1141 ctccagtccc tcatctgaag gttccctctc ccagaggcag aggtcgacatccacacctaa

[0313] 1201 tgtccacatg gtcagcacca ccctgcctgt ggacagcagg atgattgaggatgcaattcg

[0314] 1261 aagtcacagc gaatcagcct caccttcagc cctgtccagt agccccaacaatctgagccc

[0315] 1321 aacaggctgg tcacagccga aaacccccgt gccagcacaa agagagcgggcaccagtatc

[0316] 1381 tgggacccag gagaaaaaca aaattaggcc tcgtggacag agagattcaagctattattg

[0317] 1441 ggaaatagaa gccagtgaag tgatgctgtc cactcggatt gggtcaggctcttttggaac

[0318] 1501 tgtttataag ggtaaatggc acggagatgt tgcagtaaag atcctaaaggttgtcgaccc

[0319] 1561 aaccccagag caattccagg ccttcaggaa tgaggtggct gttctgcgcaaaacacggca

[0320] 1621 tgtgaacatt ctgcttttca tggggtacat gacaaaggac aacctggcaattgtgaccca

[0321] 1681 gtggtgcgag ggcagcagcc tctacaaaca cctgcatgtc caggagaccaagtttcagat

[0322] 1741 gttccagcta attgacattg cccggcagac ggctcaggga atggactatttgcatgcaaa

[0323] 1801 gaacatcatc catagagaca tgaaatccaa caatatattt ctccatgaaggcttaacagt

[0324] 1861 gaaaattgga gattttggtt tggcaacagt aaagtcacgc tggagtggttctcagcaggt

[0325] 1921 tgaacaacct actggctctg tcctctggat ggccccagag gtgatccgaatgcaggataa

[0326] 1981 caacccattc agtttccagt cggatgtcta ctcctatggc atcgtattgtatgaactgat

[0327] 2041 gacgggggag cttccttatt ctcacatcaa caaccgagat cagatcatcttcatggtggg

[0328] 2101 ccgaggatat gcctccccag atcttagtaa gctatataag aactgccccaaagcaatgaa

[0329] 2161 gaggctggta gctgactgtg tgaagaaagt aaaggaagag aggcctctttttccccagat

[0330] 2221 cctgtcttcc attgagctgc tccaacactc tctaccgaag atcaaccggagcgcttccga

[0331] 2281 gccatccttg catcgggcag cccacactga ggatatcaat gcttgcacgctgaccacgtc

[0332] 2341 cccgaggctg cctgtcttct agttgacttt gcacctgtct tcaggctgccaggggaggag

[0333] 2401 gagaagccag caggcaccac ttttctgctc cctttctcca gaggcagaacacatgttttc

[0334] 2461 agagaagctg ctgctaagga ccttctagac tgctcacagg gccttaacttcatgttgcct

[0335] 2521 tcttttctat ccctttgggc cctgggagaa ggaagccatt tgcagtgctggtgtgtcctg

[0336] 2581 ctccctcccc acattcccca tgctcaaggc ccagccttct gtagatgcgcaagtggatgt

[0337] 2641 tgatggtagt aaaaagca ggggcccagc cccagctgtt ggctacatgagtatttagag

[0338] 2701 gaagtaaggt agcaggcagt ccagccctga tgtggagaca catgggattttggaaatcag

[0339] 2761 cttctggagg aatgcatgtc acaggcggga ctttcttcag agagtggtgcagcgccagac

[0340] 2821 attttgcaca taaggcacca aacagcccag gactgccgag actctggccgcccgaaggag

[0341] 2881 cctgctttgg tactatggaa cttttcttag gggacacgtc ctcctttcacagcttctaag

[0342] 2941 gtgtccagtg cattgggatg gttttccagg caaggcactc ggccaatccgcatctcagcc

[0343] 3001 ctctcaggga gcagtcttcc atcatgctga attttgtctt ccaggagctgcccctatggg

[0344] 3061 gcggggccgc agggccagcc ttgtttctct aacaaacaaa caaacaaacagccttgtttc

[0345] 3121 tctagtcaca tcatgtgtat acaaggaagc caggaataca ggttttctlg atgatttggg

[0346] 3181 ttttaatttt gtttttattg cacctgacaa aatacagtta tctgatggtccctcaattat

[0347] 3241 gttattttaa taaaataaat taaatttagg tgtaaaaaaa aaaaaaaaaa a SEQ ID NO: 7)

[0348] NM_001142864 7833 bp mRNA Homo sapiens piezotonic mechanoreceptive ion channel component 1 (PIEZO1), mRNA.

[0349] 1 atggagccgc acgtgctcgg cgcggtcctg tactggctgc tgctgccctg cgcgctgctg

[0350] 61 gctgcctgcc tgctccgctt cagcggactc tcgctggtct acctgctctt cctgctgctg

[0351] 121 ctgccctggt tccccggccc cacccgatgc ggcctccaag gtcacacagg ccgcctcctg

[0352] 181 cgggcattgc tgggcctcag cctgctcttc ctggtggccc atctcgccct ccagatctgc

[0353] 241 ctgcatattg tgccccgcct ggaccagctc ctgggaccca gctgcagccg ctgggagacc

[0354] 301 ctctcgcgac acataggggt cacaaggctg gacctgaagg acatccccaa cgccatccgg

[0355] 361 ctggtggccc ctgacctggg catcttggtg gtctcctctg tctgcctcgg catctgcggg

[0356] 421 cgccttgcaa ggaacacccg gcagagccca catccacggg agctggatga tgatgagagg

[0357] 481 gatgtggatg ccagcccgac ggcagggctg caggaagcag caacgctggc ccctacacgg

[0358] 541 aggtcacggc tggccgctcg tttccgagtc acggcccact ggctgctggt ggcggctggg

[0359] 601 cgggtcctgg ccgtaacact gcttgcactg gcaggcatcg cccacccctc ggccctctcc

[0360] 661 agtgtctacc tgctgctctt cctggccctc tgcacctggt gggcctgcca ctttcccatc

[0361] 721 agcactcggg gcttcagcag actctgcgtc gcggtggggt gcttcggcgc cggccatctc

[0362] 781 atctgcctct actgctacca gatgcccttg gcacaggctc tgctcccgcc tgccggcatc

[0363] 841 tgggctaggg tgctgggtct caaggacttc gtgggtccca ccaactgctc cagcccccac

[0364] 901 gcgctggtcc tcaacaccgg cctggactgg cctgtgtatg ccagccccgg cgtcctcctg

[0365] 961 ctgctgtgct acgccacggc ctctctgcgc aagctccgcg cgtaccgccc ctccggccag

[0366] 1021 aggaaggagg cggcaaaggg gtatgaggct cgggagctgg agctagcagagctggaccag

[0367] 1081 tggccccagg aacgggagtc tgaccagcac gtggtgccca cagcacccgacaccgaggct

[0368] 1141 gataactgca tcgtgcacga gctgaccggc cagagctccg tcctgcggcggcctgtgcgg

[0369] 1201 cccaagcggg ctgagcccag ggaggcgtct ccgctccaca gcctgggccacctcatcatg

[0370] 1261 gaccagagct atgtgtgcgc gctcattgcc atgatggtat ggagcatcacctaccacagc

[0371] 1321 tggctgacct tcgtactgct gctctgggcc tgcctcatct ggacggtgcgcagccgccac

[0372] 1381 caactggcca tgctgtgctc gccctgcatc ctgctgtatg ggatgacgctgtgctgccta

[0373] 1441 cgctacgtgt gggccatgga cctgcgccct gagctgccca ccaccctgggccccgtcagc

[0374] 1501 ctgcgccagc tggggctgga gcacacccgc tacccctgtc tggaccttggtgccatgttg

[0375] 1561 ctctacaccc tgaccttctg gctcctgctg cgccagtttg tgaaagagaagctgctgaag

[0376] 1621 tgggcagagt ctccagctgc gctgacggag gtcaccgtgg cagacacagagcccacgcgg

[0377] 1681 acgcagacgc tgttgcagag cctgggggag ctggtgaagg gcgtgtacgccaagtactgg

[0378] 1741 atctatgtgt gtgctggcat gttcatcgtg gtcagcttcg ccggccgcct cgtggtctac

[0379] 1801 aagattgtct acatgttcct ttcctgctc tgcctcaccc tcttccaggt ctactacagc

[0380] 1861 ctgtggcgga agctgctcaa ggccttctgg tggctcgtgg tggcctacacc atgctggtc

[0381] 1921 ctcatcgccg tctacacctt ccagttccag gacttccctg cctactggcg caacctcact

[0382] 1981 ggcttcaccg acgagcagct gggggacctg ggcctggagc agttcagcgt gtccgagctc

[0383] 2041 ttctccagca tcctggtgcc cggcttcttc ctcctggcct gcatcctgcag ctgcactac

[0384] 2101 ttccacaggc ccttcatgca gctcaccgac atggagcacg tgtccctgcct ggcacgcgc

[0385] 2161 ctcccgcgct gggctcacag gcaggatgca gtgagtggga ccccactgct gcgggaggag

[0386] 2221 cagcaggagc atcagcagca gcagcaggag gaggaggagg aggaggaggactccagggac

[0387] 2281 gaggggctgg gcgtggccac tccccaccag gccacgcagg tgcctgaaggg gcagccaag

[0388] 2341 tggggcctgg tggctgagcg gctgctggag ctggcagccg gcttctcggacgtcctctca

[0389] 2401 cgcgtgcagg tgttcctgcg gcggctgctg gagcttcacg ttttcaagctggtggccctg

[0390] 2461 tacaccgtct gggtggccct gaaggaggtg tcggtgatga acctgctgctggtggtgctg

[0391] 2521 tgggccttcg ccctgcccta cccacgcttc cggcccatgg cctcctgcctgtccaccgtg

[0392] 2581 tggacctgcg tcatcatcgt gtgtaagatg ctgtaccagc tcaaggttgtcaacccccag

[0393] 2641 gagtattcca gcaactgcac cgagcccttc cccaacagca ccaacttgctgcccacggag

[0394] 2701 atcagccagt ccctgctgta ccgggggccc gtggaccctg ccaactggtttggggtgcgg

[0395] 2761 aaagggttcc ccaacctggg ctacatccag aaccacctgc aagtgctgctgctgctggta

[0396] 2821 ttcgaggcca tcgtgtaccg gcgccaggag cactaccgcc ggcagcaccagctggccccg

[0397] 2881 ctgcctgccc aggccgtgtt tgccagcggc acccgccagc agctggaccaggatctgctc

[0398] 2941 ggctgcctca agtacttcat caacttcttc ttctacaaat tcgggctggagatctgcttc

[0399] 3001 ctgatggccg tgaacgtgat cgggcagcgc atgaactttc tggtgaccctgcacggttgc

[0400] 3061 tggctggtgg ccatcctcac ccgcaggcac cgccaggcca ttgcccgcctctggcccaac

[0401] 3121 tactgcctct tcctggcgct gttcctgctg taccagtacc tgctgtgcctggggatgccc

[0402] 3181 ccggccctgt gcattgatta tccctggcgc tggagccggg ccgtccccatgaactccgca

[0403] 3241 ctcatcaagt ggctgtacct gcctgatttc ttccgggccc ccaactccaccaacctcatc

[0404] 3301 agcgactttc tcctgctgct gtgcgcctcc cagcagtggc aggtgttctcagctgagcgc

[0405] 3361 acagaggagt ggcagcgcat ggctggcgtc aacaccgacc gcctggagccgctgcggggg

[0406] 3421 gagcccaacc ccgtgcccaa ctttatccac tgcaggtcct accttgacatgctgaaggtg

[0407] 3481 gccgtcttcc gatacctgtt ctggctggtg ctggtggtgg tgtttgtcacgggggccacc

[0408] 3541 cgcatcagca tcttcgggct gggctacctg ctggcctgct tctacctgctgctcttcggc

[0409] 3601 acggccctgc tgcagaggga cacacgggcc cgcctcgtgc tgtgggactgcctcattctg

[0410] 3661 tacaacgtca ccgtcatcat ctccaagaac atgctgtcgc tcctggcctgcgtcttcgtg

[0411] 3721 gagcagatgc agaccggctt ctgctgggtc atccagctct tcagccttgtatgcaccgtc

[0412] 3781 aagggctact atgaccccaa ggagatgatg gacagagacc aggactgcctgctgcctgtg

[0413] 3841 gaggaggctg gcatcatctg ggacagcgtc tgcttcttct tcctgctgctgcagcgccgc

[0414] 3901 gtcttcctta gccattacta cctgcacgtc agggccgacc tccaggccaccgccctgcta

[0415] 3961 gcctccaggg gcttcgccct ctacaacgct gccaacctca agagcattgactttcaccgc

[0416] 4021 aggatagagg agaagtccct ggcccagctg aaaagacaga tggagcgtatccgtgccaag

[0417] 4081 caggagaagc acaggcaggg ccgggtggac cgcagtcgcc cccaggacaccctgggcccc

[0418] 4141 aaggaccccg gcctggagcc agggcccgac agtccagggg gctcctccccgccacggagg

[0419] 4201 cagtggtggc ggccctggct ggaccacgcc acagtcatcc actccggggactacttcctg

[0420] 4261 tttgagtccg acagtgagga agaggaggag gctgttcctg aagacccgaggccgtcggca

[0421] 4321 cagagtgcct tccagctggc gtaccaggca tgggtgacca acgcccaggcggtgctgagg

[0422] 4381 cggcggcagc aggagcagga gcaggcaagg caggaacagg caggacagctacccacagga

[0423] 4441 ggtggtccca gccaggaggt ggagccagca gagggccccg aggaggcagcggcaggccgg

[0424] 4501 agccatgtgg tgcagagggt gctgagcacg gcgcagttcc tgtggatgctggggcaggcg

[0425] 4561 ctagtggatg agctgacacg ctggctgcag gagttcaccc ggcaccacggcaccatgagc

[0426] 4621 gacgtgctgc gggcagagcg ctacctcctc acacaggagc tcctgcagggcggcgaagtg

[0427] 4681 cacaggggcg tgctggatca gctgtacaca agccaggccg aggccacgctgccaggcccc

[0428] 4741 accgaggccc ccaatgcccc aagcaccgtg tccagtgggc tgggcgcggaggagccactc

[0429] 4801 agcagcatga cagacgacat gggcagcccc ctgagcaccg gctaccacacgcgcagtggc

[0430] 4861 agtgaggagg cagtcaccga ccccggggag cgtgaggctg gtgcctctctgtaccaggga

[0431] 4921 ctgatgcgga cggccagcga gctgctcctg gacaggcgcc tgcgcatcccagagctggag

[0432] 4981 gaggcagagc tgtttgcgga ggggcagggc cgggcgctgc ggctgctgcgggccgtgtac

[0433] 5041 cagtgtgtgg ccgcccactc ggagctgctc tgctacttca tcatcatcctcaaccacatg

[0434] 5101 gtcacggcct ccgccggctc gctggtgctg cccgtgctcg tcttcctgtgggccatgctg

[0435] 5161 tcgatcccga ggcccagcaa gcgcttctgg atgacggcca tcgtcttcaccgagatcgcg

[0436] 5221 gtggtcgtca agtacctgtt ccagtttggg ttcttcccct ggaacagccacgtggtgctg

[0437] 5281 cggcgctacg agaacaagcc ctacttcccg ccccgcatcc tgggcctggagaagactgac

[0438] 5341 ggctacatca agtacgacct ggtgcagctc atggcccttt tcttccaccgctcccagctg

[0439] 5401 ctgtgctatg gcctctggga ccatgaggag gactcaccat ccaaggagcatgacaagagc

[0440] 5461 ggcgaggagg agcagggagc cgaggagggg ccaggggtgc ctgcggccaccaccgaagac

[0441] 5521 cacattcagg tggaagccag ggtcggaccc acggacggga ccccagaaccccaagtggag

[0442] 5581 ctcaggcccc gtgatacgag gcgcatcagt ctacgtttta gaagaaggaagaaggagggc

[0443] 5641 ccagcacgga aaggagcggc agccatcgaa gctgaggaca gggaggaagaagagggggag

[0444] 5701 gaagagaaag aggcccccac ggggagagag aagaggccaa gccgctctggaggaagagta

[0445] 5761 agggcggccg ggcggcggct gcagggcttc tgcctgtccc tggcccagggcacatatcgg

[0446] 5821 ccgctacggc gcttcttcca cgacatcctg cacaccaagt accgcgcagccaccgacgtc

[0447] 5881 tatgccctca tgttcctggc tgatgttgtc gacttcatca tcatcatttttggcttctgg

[0448] 5941 gcctttggga agcactcggc ggccacagac atcacgtcct ccctatcagacgaccaggta

[0449] 6001 cccgaggctt tcctggtcat gctgctgatc cagttcagta ccatggtggttgaccgcgcc

[0450] 6061 ctctacctgc gcaagaccgt gctgggcaag ctggccttcc aggtggcgctggtgctggcc

[0451] 6121 atccacctat ggatgttctt catcctgccc gccgtcactg agaggatgttcaaccagaat

[0452] 6181 gtggtggccc agctctggta cttcgtgaag tgcatctact tcgccctgtccgcctaccag

[0453] 6241 atccgctgcg gctaccccac ccgcatcctc ggcaacttcc tcaccaagaagtacaatcat

[0454] 6301 ctcaacctct tcctcttcca ggggttccgg ctggtgccgt tcctggtggagctgcgggca

[0455] 6361 gtgatggact gggtgtggac ggacaccacg ctgtccctgt ccagctggatgtgtgtggag

[0456] 6421 gacatctatg ccaacatctt catcatcaaa tgcagccgag agacagagaagaaatacccg

[0457] 6481 cagcccaaag ggcagaagaa gaagaagatc gtcaagtacg gcatgggtggcctcatcatc

[0458] 6541 ctcttcctca tcgccatcat ctggttccca ctgctcttca tgtcgctggt gcgctccgtg

[0459] 6601 gttggggttg tcaaccagcc catcgatgtc accgtcaccc tgaagctggg cggctatgag

[0460] 6661 ccgctgttca ccatgagcgc ccagcagccg tccatcatcc ccttcacggc caggcctat

[0461] 6721 gaggagctgt cccggcagtt tgacccccag ccgctggcca tgcagttcat cagccagtac

[0462] 6781 agccctgagg acatcgtcac ggcgcagatt gagggcagct ccggggcgct gtggcgcatc

[0463] 6841 agtcccccca gccgtgccca gatgaagcgg gagctctaca acggcacggc cgacatcacc

[0464] 6901 ctgcgcttca cctggaactt ccagagggac ctggcgaagg gaggcactgt ggagtatgcc

[0465] 6961 aacgagaagc acatgctggc cctggccccc aacagcactg cacggcggcag ctggccagc

[0466] 7021 ctgctcgagg gcacctcgga ccagtctgtg gtcatcccta atctcttccc caagtacatc

[0467] 7081 cgtgccccca acgggcccga agccaaccct gtgaagcagc tgcagcccaatgaggaggcc

[0468] 7141 gactacctcg gcgtgcgtat ccagctgcgg agggagcagg gtgcgggggccaccggcttc

[0469] 7201 ctcgaatggt gggtcatcga gctgcaggag tgccggaccg actgcaacctgctgcccatg

[0470] 7261 gtcattttca gtgacaaggt cagcccaccg agcctcggct tcctggctggctacggcatc

[0471] 7321 atggggctgt acgtgtccat cgtgctggtc atcggcaagt tcgtgcgcggattcttcagc

[0472] 7381 gagatctcgc actccattat gttcgaggag ctgccgtgcg tggaccgcatcctcaagctc

[0473] 7441 tgccaggaca tcttcctggt gcgggagact cgggagctgg agctggaggaggagttgtac

[0474] 7501 gccaagctca tcttcctcta ccgctcaccg gagaccatga tcaagtggactcgtgagaag

[0475] 7561 gagtaggagc tgctgctggc gcccgagagg gaaggagccg gcctgctgggcagcgtggcc

[0476] 7621 acaaggggcg gcactcctca ggccggggga gccactgccc cgtccaaggccgccagctgt

[0477] 7681 gatgcatcct cccggcctgc ctgagccctg atgctgctgt cagagaaggacactgcgtcc

[0478] 7741 ccacggcctg cgtggcgctg ccgtccccca cgtgtactgt agagttttttttttaattaa

[0479] 7801 aaaatgtttt atttatacaa atggacaatc aga (SEQ ID NO: 8)

[0480] NM_004444 4369 bp mRNA Homo sapiens EPH receptor B4 (EPHB4), mRNA.

[0481] 1 ttccagcgca gctcagcccc tgcccggccc ggcccgcccg gctccgcgcc gcagtctccc

[0482] 61 tccctcccgc tccgtccccg ctcgggctcc caccatcccc gcccgcgagg agagcactcg

[0483] 121 gcccggcggc gcgagcagag ccactccagg gaggggggga gaccgcgagc ggccggctca

[0484] 181 gcccccgcca cccggggcgg gaccccgagg ccccggaggg accccaactc cagccacgtc

[0485] 241 ttgctgcgcg cccgcccggc gcggccactg ccagcacgct ccgggcccgc cgcccgcgcg

[0486] 301 cgcggcacag acgcggggcc acacttggcg ccgccgcccg gtgccccgca cgctcgcatg

[0487] 361 ggcccgcgct gagggccccg acgaggagtc ccgcgcggag tatcggcgtc cacccgccca

[0488] 421 gggagagtca gacctggggg ggcgagggcc ccccaaactc agttcggatc ctacccgagt

[0489] 481 gaggcggcgc catggagctc cgggtgctgc tctgctgggc ttcgttggcc gcagctttgg

[0490] 541 aagagaccct gctgaacaca aaattggaaa ctgctgatct gaagtgggtg acattccctc

[0491] 601 aggtggacgg gcagtgggag gaactgagcg gcctggatga ggaacagcac agcgtgcgca

[0492] 661 cctacgaagt gtgtgacgtg cagcgtgccc cgggccaggc ccactggctt cgcacaggtt

[0493] 721 gggtcccacg gcggggcgcc gtccacgtgt acgccacgct gcgcttcacc atgctcgagt

[0494] 781 gcctgtccct gcctcgggct gggcgctcct gcaaggagac cttcaccgtc ttctactatg

[0495] 841 agagcgatgc ggacacggcc acggccctca cgccagcctg gatggagaac ccctacatca

[0496] 901 aggtggacac ggtggccgcg gagcatctca cccggaagcg ccctggggcc gaggccaccg

[0497] 961 ggaaggtgaa tgtcaagacg ctgcgtctgg gaccgctcag caaggctggc ttctacctgg

[0498] 1021 ccttccagga ccagggtgcc tgcatggccc tgctatccct gcacctcttctacaaaaagt

[0499] 1081 gcgcccagct gactgtgaac ctgactcgat tcccggagac tgtgcctcgggagctggttg

[0500] 1141 tgcccgtggc cggtagctgc gtggtggatg ccgtccccgc ccctggccccagccccagcc

[0501] 1201 tctactgccg tgaggatggc cagtgggccg aacagccggt cacgggctgcagctgtgctc

[0502] 1261 cggggttcga ggcagctgag gggaacacca agtgccgagc ctgtgcccagggcaccttca

[0503] 1321 agcccctgtc aggagaaggg tcctgccagc catgcccagc caatagccactctaacacca

[0504] 1381 ttggatcagc cgtctgccag tgccgcgtcg ggtacttccg ggcacgcacagacccccggg

[0505] 1441 gtgcaccctg caccacccct ccttcggctc cgcggagcgt ggtttcccgcctgaacggct

[0506] 1501 cctccctgca cctggaatgg agtgcccccc tggagtctgg tggccgagaggacctcacct

[0507] 1561 acgccctccg ctgccgggag tgccgacccg gaggctcctg tgcgccctgcgggggagacc

[0508] 1621 tgacttttga ccccggcccc cgggacctgg tggagccctg ggtggtggttcgagggctac

[0509] 1681 gtcctgactt cacctatacc tttgaggtca ctgcattgaa cggggtatcctccttagcca

[0510] 1741 cggggcccgt cccatttgag cctgtcaatg tcaccactga ccgagaggtacctcctgcag

[0511] 1801 tgtctgacat ccgggtgacg cggtcctcac ccagcagctt gagcctggcctgggctgttc

[0512] 1861 cccgggcacc cagtggggct gtgctggact acgaggtcaa ataccatgagaagggcgccg

[0513] 1921 agggtcccag cagcgtgcgg ttcctgaaga cgtcagaaaa ccgggcagagctgcgggggc

[0514] 1981 tgaagcgggg agccagctac ctggtgcagg tacgggcgcg ctctgaggccggctacgggc

[0515] 2041 ccttcggcca ggaacatcac agccagaccc aactggatga gagcgagggctggcgggagc

[0516] 2101 agctggccct gattgcgggc acggcagtcg tgggtgtggt cctggtcctggtggtcattg

[0517] 2161 tggtcgcagt tctctgcctc aggaagcaga gcaatgggag agaagcagaatattcggaca

[0518] 2221 aacacggaca gtatctcatc ggacatggta ctaaggtcta catcgaccccttcacttatg

[0519] 2281 aagaccctaa tgaggctgtg agggaatttg caaaagagat cgatgtctcctacgtcaaga

[0520] 2341 ttgaagaggt gattggtgca ggtgagtttg gcgaggtgtg ccgggggcggctcaaggccc

[0521] 2401 cagggaagaa ggagagctgt gtggcaatca agaccctgaa gggtggctacacggagcggc

[0522] 2461 agcggcgtga gtttctgagc gaggcctcca tcatgggcca gttcgagcaccccaatatca

[0523] 2521 tccgcctgga gggcgtggtc accaacagca tgcccgtcat gattctcacagagttcatgg

[0524] 2581 agaacggcgc cctggactcc ttcctgcggc taaacgacgg acagttcacagtcatccagc

[0525] 2641 tcgtgggcat gctgcggggc atcgcctcgg gcatgcggta ccttgccgagatgagctacg

[0526] 2701 tccaccgaga cctggctgct cgcaacatcc tagtcaacag caacctcgtctgcaaagtgt

[0527] 2761 ctgactttgg cctttcccga ttcctggagg agaactcttc cgatcccacctacacgagct

[0528] 2821 ccctgggagg aaagattccc atccgatgga ctgccccgga ggccattgccttccggaagt

[0529] 2881 tcacttccgc cagtgatgcc tggagttacg ggattgtgat gtgggaggtgatgtcatttg

[0530] 2941 gggagaggcc gtactgggac atgagcaatc aggacgtgat caatgccattgaacaggact

[0531] 3001 accggctgcc cccgccccca gactgtccca cctccctcca ccagctcatgctggactgtt

[0532] 3061 ggcagaaaga ccggaatgcc cggccccgct tcccccaggt ggtcagcgccctggacaaga

[0533] 3121 tgatccggaa ccccgccagc ctcaaaatcg tggcccggga gaatggcggggcctcacacc

[0534] 3181 ctctcctgga ccagcggcag cctcactact cagcttttgg ctctgtgggcgagtggcttc

[0535] 3241 gggccatcaa aatgggaaga tacgaagaaa gtttcgcagc cgctggctttggctccttcg

[0536] 3301 agctggtcag ccagatctct gctgaggacc tgctccgaat cggagtcactctggcgggac

[0537] 3361 accagaagaa aatcttggcc agtgtccagc acatgaagtc ccaggccaagccgggaaccc

[0538] 3421 cgggtgggac aggaggaccg gccccgcagt actgacctgc aggaactccccaccccaggg

[0539] 3481 acaccgcctc cccattttcc ggggcagagt ggggactcac agaggcccccagccctgtgc

[0540] 3541 cccgctggat tgcactttga gcccgtgggg tgaggagttg gcaatttggagagacaggat

[0541] 3601 ttgggggttc tgccataata ggaggggaaa atcacccccc agccacctcggggaactcca

[0542] 3661 gaccaagggt gagggcgcct ttccctcagg actgggtgtg accagaggaaaaggaagtgc

[0543] 3721 ccaacatctc ccagcctccc caggtgcccc cctcaccttg atgggtgcgttcccgcagac

[0544] 3781 caaagagagt gtgactccct tgccagctcc agagtggggg ggctgtcccagggggcaaga

[0545] 3841 aggggtgtca gggcccagtg acaaaatcat tggggtttgt agtcccaacttgctgctgtc

[0546] 3901 accaccaaac tcaatcattt ttttcccttg taaatgcccc tcccccagctgctgccttca

[0547] 3961 tattgaaggt ttttgagttt tgtttttggt cttaattttt ctccccgttccctttttgtt

[0548] 4021 tcttcgtttt gtttttctac cgtccttgtc ataactttgt gttggagggaacctgtttca

[0549] 4081 ctatggcctc ctttgcccaa gttgaaacag gggcccatca tcatgtctgt ttccagaaca

[0550] 4141 gtgccttggt catcccacat ccccggaccc cgcctgggac ccccaagctg tgctatga

[0551] 4201 aggggtgtgg ggtgaggtag tgaaaagggc ggtagttggt ggtggaaccc agaaacggac

[0552] 4261 gccggtgctt ggaggggttc ttaaattata tttaaaaaag taactttttg tataaataaa

[0553] 4321 agaaaatggg acgtgtccca gctccagggg taaaaaaaaa aaaaaaaaa (SEQ ID NO: 9)

[0554] NM_000267 12381 bp mRNA Homo sapiens neurofibromin 1 (NF1), transcript variant 2, mRNA.

[0555] 1 aatctctagc tcgctcgcgc tccctctccc cgggccgtgg aaaggatccc acttccggtg

[0556] 61 gggtgtcatg gcggcgtctc ggactgtgat ggctgtgggg agacggcgct agtggggaga

[0557] 121 gcgaccaaga ggccccctcc cctccccggg tccccttccc ctatccccct ccccccagcc

[0558] 181 tccttgccaa cgcccccttt ccctctcccc ctcccgctcg gcgctgaccc cccatcccca

[0559] 241 cccccgtggg aacactggga gcctgcactc cacagaccct ctccttgcct cttccctcac

[0560] 301 ctcagcctcc gctccccgcc ctcttcccgg cccagggcgc cggcccaccc ttccctccgc

[0561] 361 cgccccccgg ccgcggggag gacatggccg cgcacaggcc ggtggaatgg gtccaggccg

[0562] 421 tggtcagccg cttcgacgag cagcttccaa taaaaacagg acagcagaac acacatacca

[0563] 481 aagtcagtac tgagcacaac aaggaatgtc taatcaatat ttccaaatac aagttttctt

[0564] 541 tggttataag cggcctcact actattttaa agaatgttaa caatatgaga atatttggag

[0565] 601 aagctgctga aaaaaattta tatctctctc agttgattat attggataca ctggaaaaat

[0566] 661 gtcttgctgg gcaaccaaag gacacaatga gattagatga aacgatgctg gtcaaacagt

[0567] 721 tgctgccaga aatctgccat tttcttcaca cctgtcgtga aggaaaccag catgcagctg

[0568] 781 aacttcggaa ttctgcctct ggggttttat tttctctcag ctgcaacaac ttcaatgcag

[0569] 841 tctttagtcg catttctacc aggttacagg aattaactgt ttgttcagaa gacaatgttg

[0570] 901 atgttcatga tatagaattg ttacagtata tcaatgtgga ttgtgcaaaa ttaaaacgac

[0571] 961 tcctgaagga aacagcattt aaatttaaag ccctaaagaa ggttgcgcag ttagcagtta

[0572] 1021 taaatagcct ggaaaaggca ttttggaact gggtagaaaa ttatccagatgaatttacaa

[0573] 1081 aactgtacca gatcccacag actgatatgg ctgaatgtgc agaaaagctatttgacttgg

[0574] 1141 tggatggttt tgctgaaagc accaaacgta aagcagcagt ttggccactacaaatcattc

[0575] 1201 tccttatctt gtgtccagaa ataatccagg atatatccaa agacgtggttgatgaaaaca

[0576] 1261 acatgaataa gaagttattt ctggacagtc tacgaaaagc tcttgctggccatggaggaa

[0577] 1321 gtaggcagct gacagaaagt gctgcaattg cctgtgtcaa actgtgtaaagcaagtactt

[0578] 1381 acatcaattg ggaagataac tctgtcattt tcctacttgt tcagtccatggtggttgatc

[0579] 1441 ttaagaacct gctttttaat ccaagtaagc cattctcaag aggcagtcagcctgcagatg

[0580] 1501 tggatctaat gattgactgc cttgtttctt gctttcgtat aagccctcacaacaaccaac

[0581] 1561 actttaagat ctgcctggct cagaattcac cttctacatt tcactatgtgctggtaaatt

[0582] 1621 cactccatcg aatcatcacc aattccgcat tggattggtg gcctaagattgatgctgtgt

[0583] 1681 attgtcactc ggttgaactt cgaaatatgt ttggtgaaac acttcataaagcagtgcaag

[0584] 1741 gttgtggagc acacccagca atacgaatgg caccgagtct tacatttaaagaaaaagtaa

[0585] 1801 caagccttaa atttaaagaa aaacctacag acctggagac aagaagctataagtatcttc

[0586] 1861 tcttgtccat ggtgaaacta attcatgcag atccaaagct cttgctttgtaatccaagaa

[0587] 1921 aacaggggcc cgaaacccaa ggcagtacag cagaattaat tacagggctcgtccaactgg

[0588] 1981 tccctcagtc acacatgcca gagattgctc aggaagcaat ggaggctctgctggttcttc

[0589] 2041 atcagttaga tagcattgat ttgtggaatc ctgatgctcc tgtagaaacattttgggaga

[0590] 2101 ttagctcaca aatgcttttt tacatctgca agaaattaac tagtcatcaaatgcttagta

[0591] 2161 gcacagaaat tctcaagtgg ttgcgggaaa tattgatctg caggaataaatttcttctta

[0592] 2221 aaaataagca ggcagataga agttcctgtc actttctcct tttttacggggtaggatgtg

[0593] 2281 atattccttc tagtggaaat accagtcaaa tgtccatgga tcatgaagaattactacgta

[0594] 2341 ctcctggagc ctctctccgg aagggaaaag ggaactcctc tatggatagtgcagcaggat

[0595] 2401 gcagcggaac ccccccgatt tgccgacaag cccagaccaa actagaagtggccctgtaca

[0596] 2461 tgtttctgtg gaaccctgac actgaagctg ttctggttgc catgtcctgtttccgccacc

[0597] 2521 tctgtgagga agcagatatc cggtgtgggg tggatgaagt gtcagtgcataacctcttgc

[0598] 2581 ccaactataa cacattcatg gagtttgcct ctgtcagcaa tatgatgtcaacaggaagag

[0599] 2641 cagcacttca gaaaagagtg atggcactgc tgaggcgcat tgagcatcccactgcaggaa

[0600] 2701 acactgaggc ttgggaagat acacatgcaa aatgggaaca agcaacaaag ctaatcctta

[0601] 2761 actatccaaa agccaaaatg gaagatggcc aggctgctga aagccttcacaagaccattg

[0602] 2821 ttaagaggcg aatgtcccat gtgagtggag gaggatccat agatttgtctgacacagact

[0603] 2881 ccctacagga atggatcaac atgactggct tcctttgtgc ccttgggggagtgtgcctcc

[0604] 2941 agcagagaag caattctggc ctggcaacct atagcccacc catgggtccagtcagtgaac

[0605] 3001 gtaagggttc tatgatttca gtgatgtctt cagagggaaa cgcagatacacctgtcagca

[0606] 3061 aatttatgga tcggctgttg tccttaatgg tgtgtaacca tgagaaagtgggacttcaaa

[0607] 3121 tacggaccaa tgttaaggat ctggtgggtc tagaattgag tcctgctctgtatccaatgc

[0608] 3181 tatttaacaa attgaagaat accatcagca agttttttga ctcccaaggacaggttttat

[0609] 3241 tgactgatac caatactcaa tttgtagaac aaaccatagc tataatgaagaacttgctag

[0610] 3301 ataatcatac tgaaggcagc tctgaacatc tagggcaagc tagcattgaaacaatgatgt

[0611] 3361 taaatctggt caggtatgtt cgtgtgcttg ggaatatggt ccatgcaattcaaataaaaa

[0612] 3421 cgaaactgtg tcaattagtt gaagtaatga tggcaaggag agatgacctctcattttgcc

[0613] 3481 aagagatgaa atttaggaat aagatggtag aatacctgac agactgggttatgggaacat

[0614] 3541 caaaccaagc agcagatgat gatgtaaaat gtcttacaag agatttggaccaggcaagca

[0615] 3601 tggaagcagt agtttcactt ctagctggtc tccctctgca gcctgaagaaggagatggtg

[0616] 3661 tggaattgat ggaagccaaa tcacagttat ttcttaaata cttcacattatttatgaacc

[0617] 3721 ttttgaatga ctgcagtgaa gttgaagatg aaagtgcgca aacaggtggcaggaaacgtg

[0618] 3781 gcatgtctcg gaggctggca tcactgaggc actgtacggt ccttgcaatgtcaaacttac

[0619] 3841 tcaatgccaa cgtagacagt ggtctcatgc actccatagg cttaggttaccacaaggatc

[0620] 3901 tccagacaag agctacattt atggaagttc tgacaaaaat ccttcaacaaggcacagaat

[0621] 3961 ttgacacact tgcagaaaca gtattggctg atcggtttga gagattggtggaactggtca

[0622] 4021 caatgatggg tgatcaagga gaactcccta tagcgatggc tctggccaatgtggttcctt

[0623] 4081 gttctcagtg ggatgaacta gctcgagttc tggttactct gtttgattctcggcatttac

[0624] 4141 tctaccaact gctctggaac atgttttcta aagaagtaga attggcagactccatgcaga

[0625] 4201 ctctcttccg aggcaacagc ttggccagta aaataatgac attctgtttcaaggtatatg

[0626] 4261 gtgctaccta tctacaaaaa ctcctggatc ctttattacg aattgtgatcacatcctctg

[0627] 4321 attggcaaca tgttagcttt gaagtggatc ctaccaggtt agaaccatcagagagccttg

[0628] 4381 aggaaaacca gcggaacctc cttcagatga ctgaaaagtt cttccatgccatcatcagtt

[0629] 4441 cctcctcaga attcccccct caacttcgaa gtgtgtgcca ctgtttataccaggtggtta

[0630] 4501 gccagcgttt ccctcagaac agcatcggtg cagtaggaag tgccatgttcctcagattta

[0631] 4561 tcaatcctgc cattgtctca ccgtatgaag cagggatttt agataaaaagccaccaccta

[0632] 4621 gaatcgaaag gggcttgaag ttaatgtcaa agatacttca gagtattgccaatcatgttc

[0633] 4681 tcttcacaaa agaagaacat atgcggcctt tcaatgattt tgtgaaaagcaactttgatg

[0634] 4741 cagcacgcag gtttttcctt gatatagcat ctgattgtcc tacaagtgatgcagtaaatc

[0635] 4801 atagtctttc cttcataagt gacggcaatg tgcttgcttt acatcgtctactctggaaca

[0636] 4861 atcaggagaa aattgggcag tatctttcca gcaacaggga tcataaagctgttggaagac

[0637] 4921 gaccttttga taagatggca acacttcttg catacctggg tcctccagagcacaaacctg

[0638] 4981 tggcagatac acactggtcc agccttaacc ttaccagttc aaagtttgaggaatttatga

[0639] 5041 ctaggcatca ggtacatgaa aaagaagaat tcaaggcttt gaaaacgttaagtattttct

[0640] 5101 accaagctgg gacttccaaa gctgggaatc ctatttttta ttatgttgcacggaggttca

[0641] 5161 aaactggtca aatcaatggt gatttgctga tataccatgt cttactgactttaaagccat

[0642] 5221 attatgcaaa gccatatgaa attgtagtgg accttaccca taccgggcctagcaatcgct

[0643] 5281 ttaaaacaga ctttctctct aagtggtttg ttgtttttcc tggctttgcttacgacaacg

[0644] 5341 tctccgcagt ctatatctat aactgtaact cctgggtcag ggagtacaccaagtatcatg

[0645] 5401 agcggctgct gactggcctc aaaggtagca aaaggcttgt tttcatagactgtcctggga

[0646] 5461 aactggctga gcacatagag catgaacaac agaaactacc tgctgccaccttggctttag

[0647] 5521 aagaggacct gaaggtattc cacaatgctc tcaagctagc tcacaaagacaccaaagttt

[0648] 5581 ctattaaagt tggttctact gctgtccaag taacttcagc agagcgaacaaaagtcctag

[0649] 5641 ggcaatcagt ctttctaaat gacatttatt atgcttcgga aattgaagaaatctgcctag

[0650] 5701 tagatgagaa ccagttcacc ttaaccattg caaaccaggg cacgccgctcaccttcatgc

[0651] 5761 accaggagtg tgaagccatt gtccagtcta tcattcatat ccggacccgctgggaactgt

[0652] 5821 cacagcccga ctctatcccc caacacacca agattcggcc aaaagatgtccctgggacac

[0653] 5881 tgctcaatat cgcattactt aatttaggca gttctgaccc gagtttacggtcagctgcct

[0654] 5941 ataatcttct gtgtgcctta acttgtacct ttaatttaaa aatcgagggccagttactag

[0655] 6001 agacatcagg tttatgtatc cctgccaaca acaccctctt tattgtctctattagtaaga

[0656] 6061 cactggcagc caatgagcca cacctcacgt tagaattttt ggaagagtgtatttctggat

[0657] 6121 ttagcaaatc tagtattgaa ttgaaacacc tttgtttgga atacatgactccatggctgt

[0658] 6181 caaatctagt tcgtttttgc aagcataatg atgatgccaa acgacaaagagttactgcta

[0659] 6241 ttcttgacaa gctgataaca atgaccatca atgaaaaaca gatgtacccatctattcaag

[0660] 6301 caaaaatatg gggaagcctt gggcagatta cagatctgct tgatgttgtactagacagtt

[0661] 6361 tcatcaaaac cagtgcaaca ggtggcttgg gatcaataaa agctgaggtgatggcagata

[0662] 6421 ctgctgtagc tttggcttct ggaaatgtga aattggtttc aagcaaggttattggaagga

[0663] 6481 tgtgcaaaat aattgacaag acatgcttat ctccaactcc tactttagaacaacatctta

[0664] 6541 tgtgggatga tattgctatt ttagcacgct acatgctgat gctgtccttcaacaattccc

[0665] 6601 ttgatgtggc agctcatctt ccctacctct tccacgttgt tactttcttagtagccacag

[0666] 6661 gtccgctctc ccttagagct tccacacatg gactggtcat taatatcattcactctctgt

[0667] 6721 gtacttgttc acagcttcat tttagtgaag agaccaagca agttttgagactcagtctga

[0668] 6781 cagagttctc attacccaaa ttttacttgc tgtttggcat tagcaaagtcaagtcagctg

[0669] 6841 ctgtcattgc cttccgttcc agttaccggg acaggtcatt ctctcctggctcctatgaga

[0670] 6901 gagagacttt tgctttgaca tccttggaaa cagtcacaga agctttgttggagatcatgg

[0671] 6961 aggcatgcat gagagatatt ccaacgtgca agtggctgga ccagtggacagaactagctc

[0672] 7021 aaagatttgc attccaatat aatccatccc tgcaaccaag agctcttgttgtctttgggt

[0673] 7081 gtattagcaa acgagtgtct catgggcaga taaagcagat aatccgtattcttagcaagg

[0674] 7141 cacttgagag ttgcttaaaa ggacctgaca cttacaacag tcaagttctgatagaagcta

[0675] 7201 cagtaatagc actaaccaaa ttacagccac ttcttaataa ggactcgcctctgcacaaag

[0676] 7261 ccctcttttg ggtagctgtg gctgtgctgc agcttgatga ggtcaacttgtattcagcag

[0677] 7321 gtaccgcact tcttgaacaa aacctgcata ctttagatag tctccgtatattcaatgaca

[0678] 7381 agagtccaga ggaagtattt atggcaatcc ggaatcctct ggagtggcactgcaagcaaa

[0679] 7441 tggatcattt tgttggactc aatttcaact ctaactttaa ctttgcattggttggacacc

[0680] 7501 ttttaaaagg gtacaggcat ccttcacctg ctattgttgc aagaacagtcagaattttac

[0681] 7561 atacactact aactctggtt aacaaacaca gaaattgtga caaatttgaagtgaatacac

[0682] 7621 agagcgtggc ctacttagca gctttactta cagtgtctga agaagttcgaagtcgctgca

[0683] 7681 gcctaaaaca tagaaagtca cttcttctta ctgatatttc aatggaaaatgttcctatgg

[0684] 7741 atacatatcc cattcatcat ggtgaccctt cctataggac actaaaggagactcagccat

[0685] 7801 ggtcctctcc caaaggttct gaaggatacc ttgcagccac ctatccaactgtcggccaga

[0686] 7861 ccagtccccg agccaggaaa tccatgagcc tggacatggg gcaaccttctcaggccaaca

[0687] 7921 ctaagaagtt gcttggaaca aggaaaagtt ttgatcactt gatatcagacacaaaggctc

[0688] 7981 ctaaaaggca agaaatggaa tcagggatca caacaccccc caaaatgaggagagtagcag

[0689] 8041 aaactgatta tgaaatggaa actcagagga tttcctcatc acaacagcacccacatttac

[0690] 8101 gtaaagtttc agtgtctgaa tcaaatgttc tcttggatga agaagtactt actgatccga

[0691] 8161 agatccaggc gctgcttctt actgttctag ctacactggt aaaatatacc acagatgagt

[0692] 8221 ttgatcaacg aattctttat gaatacttag cagaggccag tgttgtgttt cccaaagtct

[0693] 8281 ttcctgttgt gcataatttg ttggactcta agatcaacac cctgttatca ttgtgccaag

[0694] 8341 atccaaattt gttaaatcca atccatggaa ttgtgcagag tgtggtgtac catgaagaat

[0695] 8401 ccccaccaca ataccaaaca tcttacctgc aaagttttgg ttttaatggc ttgtggcggt

[0696] 8461 ttgcaggacc gttttcaaag caaacacaaa ttccagacta tgctgagctt attgttaagt

[0697] 8521 ttcttgatgc cttgattgac acgtacctgc ctggaattga tgaagaaacc agtgaagaat

[0698] 8581 ccctcctgac tcccacatct ccttaccctc ctgcactgca gagccagctt agtatcactg

[0699] 8641 ccaaccttaa cctttctaat tccatgacct cacttgcaac ttcccagcat tccccaggaa

[0700] 8701 tcgacaagga gaacgttgaa ctctccccta ccactggcca ctgtaacagtggacgaactc

[0701] 8761 gccacggatc cgcaagccaa gtgcagaagc aaagaagcgc tggcagtttcaaacgtaata

[0702] 8821 gcattaagaa gatcgtgtga agcttgcttg ctttcttttt taaaatcaacttaacatggg

[0703] 8881 ctcttcacta gtgacccctt ccctgtcctt gccctttccc cccatgttgtaatgctgcac

[0704] 8941 ttcctgtttt ataatgaacc catccggttt gccatgttgc cagatgatcaactcttcgaa

[0705] 9001 gccttgccta aatttaatgc tgccttttct ttaacttttt ttcttctacttttggcgtgt

[0706] 9061 atctggtata tgtaagtgtt cagaacaact gcaaagaaag tgggaggtcaggaaactttt

[0707] 9121 aactgagaaa tctcaattgt aagagaggat gaattcttga atactgctactactggccag

[0708] 9181 tgatgaaagc catttgcaca gagctctgcc ttctgtggtt ttcccttcttcatcctacag

[0709] 9241 agtaaagtgt tagtcctatt tatacatttt tcaagataca agtttatgagagaaatagta

[0710] 9301 ttataacccc agtatgttta atcttttagc tgtggacttt ttttttaaccgtacaaaact

[0711] 9361 gaaagaacca tagaggtcaa gcctcagtga cttgacacca taaagccacagacaaggtac

[0712] 9421 ttggggggga gggcagggaa atttcatatt ttatagtgga ttcttaagaaatactaacac

[0713] 9481 ttgagtatta gcaataatta caggaaaata agtgcgacca catatatcttaacattactg

[0714] 9541 aattaaaact atggcttcta agtccttatc caaactcagt catccaaactagtttatttt

[0715] 9601 tttctccagt tgattatctt ttaattttta attttgctaa aggtggtttttttgtgtttt

[0716] 9661 gttttttgta aaccaaaact atactaagta tagtaattat atatatatatatattttttc

[0717] 9721 ccctccccct cttctttcct aactaattct gagcagggta atcagtgaacaaagtgttga

[0718] 9781 aaattgttcc cagaaggtaa ttttcataga tgtttgcatt agctccatagcaaaatggaa

[0719] 9841 tggtacgtga catttagggt agctgatatt tttattttgt taaataatttccaagaatag

[0720] 9901 agtatggtgt atattataaa tttctttgat aagatgtatt ttgaatgtcttttaatcttc

[0721] 9961 ctcctcctct ccaaaaaaat cagaaacctc tttaagaaaa catgtaggttatatatgcta

[0722] 10021 gaattgcatt taatcactgt gaaaagactg gtcagcctgc attagtatgacagtaggggg

[0723] 10081 gctgttagaa ttgctgctat actggtggta tggattatca tggcattggaattttcatag

[0724] 10141 taatgcagat ccaatttctt tgtggtacct gcagtttaca aaataatttgacttcagtga

[0725] 10201 gcatattggt atctggatgt tccaatttag aactaaacca tatttattacaaaaagatat

[0726] 10261 taatccctct actcccaggt tccctttata tgttaagata taatggctttgaggggggaa

[0727] 10321 aaaataaacc taggggagag gggagtttcc tgtagtgctg tttcattagaggatttcagt

[0728] 10381 aaattaaatt ccacagctaa ttcaataaat aatggtacat ttaagtgttctgattttaat

[0729] 10441 aatatatttc acatttatcc acacagtaac aatgtaatat gttaatgtaaataaaattgg

[0730] 10501 ttttgatact cagaaataac aagaatttaa ttttttaaat ttgtttacag tcctgggaaa

[0731] 10561 agtaagaatt atttgccaaa ataagaggaa agaaaacctt agtattatta atgagtttac

[0732] 10621 catagaattg ttggaaatac tgaagacagg tgcaatttac taaacttttg tttaaact

[0733] 10681 attgtagagg ctgcattaga agaaaatgtt tataatgaca gagcaactat gactatataa

[0734] 10741 aaaagctgaa attagaactg tgtttagaaa tagatcagta acccagtgcc aaggatgcca

[0735] 10801 agctgccacc atggtcttgg ctctcccaca acccagtgtt tctggggtaa gtttcacagt

[0736] 10861 ttctaggccc tggaatagca ggcagtgtaa gcctttgata actttagttc gatgtttttc

[0737] 10921 ttgtttttgt ttgttggttt ggtgcatatg atagtgggtg ttatgctatt ttgctcttcc

[0738] 10981 catcaaaata aagaaacttc cagaggttta ctgttaaaaa tactgatatt tccataaacg

[0739] 11041 ggtttaccaa gggtgtagta tttcataccg cctgaaatga tcagcattgg cacaaatcaa

[0740] 11101 aattcagccg cctttgaaat gcaaaaatac ctttgactag taagtacatc ctaggagttt

[0741] 11161 gaaaacttaa ctaaggttta aaatttacct tgtttaaaga acttctgact tttgaggaaa

[0742] 11221 atctagcttt ccaagtaact aaaatgtaca tgagataaac ctctcaccac tatgtgtccc

[0743] 11281 ttgagaaatg caacactttt ttagtcttca tacttgtaat ctataaaaga aattctgaag

[0744] 11341 tttagaccaa gttgcccatt tctgcgtaat tgacataagt tctgttaaaa atattataag

[0745] 11401 taattcgttt cggtttgtag atgtttcccc tgacttgtta aagaggaaac caggaactca

[0746] 11461 gtcatgtttt tgtcctggat aatctacctg ttatgccagt actcccatcc gaggggcatg

[0747] 11521 cccttagttg cccagatgga gatgcagttc agtagatttg gggcaaagtg gctacagctc

[0748] 11581 tgtcttccat tcactcaaca cctgttcatg actgagccag gtgcccaggac acatcctaa

[0749] 11641 acagtcagct tctatcctgt gtcctagttg gggagacaga gtgccagcca caaccctcc

[0750] 11701 caggtttgta ggttttaggg gttttcagtt ttgtttgggt tttttgttttttgtttttgt

[0751] 11761 ttctacatcc ttccccgact cccaggcata atgaggcatg tcttactcaatgttatgcaa

[0752] 11821 tggatttagg caaaaattca ttcttagtgt cagccacaca attttttttaatgcagtata

[0753] 11881 ttcacctgta aatagtttgt gtaaaatttg acaaaaaaag tatatttactatactgtaaa

[0754] 11941 tatatgtgat gatatattgt attattttgc ttttttgtaa agcagttagttgctgcacat

[0755] 12001 ggataacaac aaaaatttga ttattctcgt gttagtattg ttaacttctttttgcgactg

[0756] 12061 cgttacatca tttaaagaaa atgctgtgta ttgtaaactt aaattgtatatgataactta

[0757] 12121 ctgtcctttc catccgggcc taaactttgg cagttccttt gtctacaaccttgttaatac

[0758] 12181 tgtaaacagt tgtacgccag caggaaaaat actgcccaac agacaaaatcgatcattgta

[0759] 12241 ggggaaaatc atagaaatcc atttcagatc tttattgttc ctcaccccattttcctcctt

[0760] 12301 gtgtatgtac ttcccccacc cccctttttt taagtaaaat gtaaattcaat ctgctctaa

[0761] 12361 gaaaaaaaaa aaaaaaaaaa a (SEQ ID NO: 10)

[0762] NM_005188 11241 bp mRNA Homo sapiens Cbl proto-oncogene (CBL), mRNA.

[0763] 1 tccgcccgga tagccggcgg cggcggcggc ggcggcggcg gcggcggccg ggagaggccc

[0764] 61 ctccttcacg ccctgcttct ctccctcgct cgcagtcgag ccgagccggc ggacccgcct

[0765] 121 gggctccgac cctgcccagg ccatggccgg caacgtgaag aagagctctg gggccggggg

[0766] 181 cggcagcggc tccgggggct cgggttcggg tggcctgatt gggctcatga aggacgcctt

[0767] 241 ccagccgcac caccaccacc accaccacct cagcccccac ccgccgggga cggtggacaa

[0768] 301 gaagatggtg gagaagtgct ggaagctcat ggacaaggtg gtgcggttgt gtcagaaccc

[0769] 361 aaagctggcg ctaaagaata gcccacctta tatcttagac ctgctaccag atacctacca

[0770] 421 gcatctccgt actatcttgt caagatatga ggggaagatg gagacacttg gagaaaatga

[0771] 481 gtattttagg gtgtttatgg agaatttgat gaagaaaact aagcaaacca taagcctctt

[0772] 541 caaggaggga aaagaaagaa tgtatgagga gaattctcag cctaggcgaa acctaaccaa

[0773] 601 actgtccctc atcttcagcc acatgctggc agaactaaaa ggaatctttc caagtggact

[0774] 661 ctttcaggga gacacatttc ggattactaa agcagatgct gcggaatttt ggagaaaagc

[0775] 721 ttttggggaa aagacaatag tcccttggaa gagctttcga caggctctac atgaagtgca

[0776] 781 tcccatcagt tctgggctgg aggccatggc tctgaaatcc actattgatc tgacctgcaa

[0777] 841 tgattatatt tcggtttttg aatttgacat ctttacccga ctctttcagc cctggtcctc

[0778] 901 tttgctcagg aattggaaca gccttgctgt aactcatcct ggctacatgg cttttttgac

[0779] 961 gtatgacgaa gtgaaagctc ggctccagaa attcattcac aaacctggca gttatatctt

[0780] 1021 ccggctgagc tgtactcgtc tgggtcagtg ggctattggg tatgttactgctgatgggaa

[0781] 1081 cattctccag acaatccctc acaataaacc tctcttccaa gcactgattg atggcttcag

[0782] 1141 ggaaggcttc tatttgtttc ctgatggacg aaatcagaat cctgatctgactggcttatg

[0783] 1201 tgaaccaact ccccaagacc atatcaaagt gacccaggaa caatatgaattatactgtga

[0784] 1261 gatgggctcc acattccaac tatgtaaaat atgtgctgaa aatgataaggatgtaaagat

[0785] 1321 tgagccctgt ggacacctca tgtgcacatc ctgtcttaca tcctggcaggaatcagaagg

[0786] 1381 tcagggctgt cctttctgcc gatgtgaaat taaaggtact gaacccatcgtggtagatcc

[0787] 1441 gtttgatcct agagggagtg gcagcctgtt gaggcaagga gcagagggagctccctcccc

[0788] 1501 aaattatgat gatgatgatg atgaacgagc tgatgatact ctcttcatgatgaaggaatt

[0789] 1561 ggctggtgcc aaggtggaac ggccgccttc tccattctcc atggccccacaagcttccct

[0790] 1621 tcccccggtg ccaccacgac ttgaccttct gccgcagcga gtatgtgttccctcaagtgc

[0791] 1681 ttctgctctt ggaactgctt ctaaggctgc ttctggctcc cttcataaagacaaaccatt

[0792] 1741 gccagtacct cccacacttc gagatcttcc accaccaccg cctccagaccggccatattc

[0793] 1801 tgttggagca gaatcccgac ctcaaagacg ccccttgcct tgtacaccaggcgactgtcc

[0794] 1861 ctccagagac aaactgcccc ctgtcccctc tagccgcctt ggagactcatggctgccccg

[0795] 1921 gccaatcccc aaagtaccag tatctgcccc aagttccagt gatccctggacaggaagaga

[0796] 1981 attaaccaac cggcactcac ttccattttc attgccctca caaatggagcccagaccaga

[0797] 2041 tgtgcctagg ctcggaagca cgttcagtct ggatacctcc atgagtatgaatagcagccc

[0798] 2101 attagtaggt ccagagtgtg accaccccaa aatcaaacct tcctcatctgccaatgccat

[0799] 2161 ttattctctg gctgccagac ctcttcctgt gccaaaactg ccacctggggagcaatgtga

[0800] 2221 gggtgaagag gacacagagt acatgactcc ctcttccagg cctctacggcctttggatac

[0801] 2281 atcccagagt tcacgagcat gtgattgcga ccagcagatt gatagctgtacgtatgaagc

[0802] 2341 aatgtataat attcagtccc aggcgccatc tatcaccgag agcagcacctttggtgaagg

[0803] 2401 gaatttggcc gcagcccatg ccaacactgg tcccgaggag tcagaaaatgaggatgatgg

[0804] 2461 gtatgatgtc ccaaagccac ctgtgccggc cgtgctggcc cgccgaactctctcagatat

[0805] 2521 ctctaatgcc agctcctcct ttggctggtt gtctctggat ggtgatcctacaacaaatgt

[0806] 2581 cactgaaggt tcccaagttc ccgagaggcc tccaaaacca ttcccgcggagaatcaactc

[0807] 2641 tgaacggaaa gctggcagct gtcagcaagg tagtggtcct gccgcctctgctgccaccgc

[0808] 2701 ctcacctcag ctctccagtg agatcgagaa cctcatgagt caggggtactcctaccagga

[0809] 2761 catccagaaa gctttggtca ttgcccagaa caacatcgag atggccaaaaacatcctccg

[0810] 2821 ggaatttgtt tccatttctt ctcctgccca tgtagctacc tagcacaccatctccctgct

[0811] 2881 gcaggtttag aggaccagtg agttgggagt tattactcaa gtggcacctagaagggcagg

[0812] 2941 agttcctttg gtgacttcac agtgaagtct tgccctctct gtgggatatcacatcagtgg

[0813] 3001 ttccaagatt tcaaagtggt gaaatgaaaa tggagcagct agtatgttttattattttat

[0814] 3061 gggtcttgag tgcatttgaa ggtgtccttc agttcccacg tagagagagtgtggattata

[0815] 3121 ttacatgata acctacctgg ggaacagtcc agaaagctat agaacaagtattttgctgga

[0816] 3181 aatcctaatt gaggacttaa gacttcctgg gttaaggatg tggccgtgtgtgtgtgtgtc

[0817] 3241 tgcctgtggt tgtatgtgtc cttgtgatta taagattaac ctgctgtgtgtgttaattcc

[0818] 3301 aggcagggaa ttagcacaaa aggtttagga aggaatcttt ttttaaagacttccatctac

[0819] 3361 tgtggtatta tacccaagcc tagtgtgtat tacaacttca acactcccctttggcttata

[0820] 3421 ttaccatgtg catagctaaa gtcttctatt tttagaacac cttctgtctgttctttcccc

[0821] 3481 atcaactcct tcctcatcct tcttggtgtt ctgtcatggg ccatgggcttgctatggcca

[0822] 3541 gccttactga ggccaagcag cttatgggat gttctttatt gtgtgtgatggtattggttt

[0823] 3601 gtttggtaga taagtgggag gaaaagtact gttgctacac tattataggcatgtttgata

[0824] 3661 ctagcagcta acactggtca ctccaaagca ctgtttctat aggaacattgaagctattaa

[0825] 3721 gatgttttga ttatcctaat tacataatga ccgatttgag atagaggcctttaaatacat

[0826] 3781 tccatgccct ccccagaaaa tagtctgtgg gagtcagttg ccttggtgccaggtatgtgt

[0827] 3841 tctgatgtag gtcatgagtc tttctactta atgggaaggg aagaacatttgtttccagga

[0828] 3901 tgactttctg gccagaatac cggaaagctt ttaggaagct tcgttcacatgctatttaaa

[0829] 3961 tgcacaaaat agacagtaag gatttatctg ttcagttttt cttcccagtgaattaatttc

[0830] 4021 agcttatatg ggtgtcttca tttgaacatg aggaatatta ggttatattttcagcagtgg

[0831] 4081 ttttttcctt tgccctttaa ggagtgggga taatgtccac ggtggcccag cctcttgctg

[0832] 4141 atggcacctt ccctgcattg ctgcctcccg atgatgtggt tcttttctlt gtgcctgtggc

[0833] 4201 tttgggaatg taacatctct ttcctccttt ccttcccttt tcctcttcacctgaggtcct

[0834] 4261 aaatactctc tgtaattact gtgttcttca cggtaattag acatcattcagtgaataaat

[0835] 4321 tactgtagtc aaagacagta tgggctggca gtttgtgtaa ttgcaagttcataaagagaa

[0836] 4381 ttgagggtcc agttgggaga actattagtc agttctttta tatgctgataaatgatccct

[0837] 4441 cgagttcagt tagtattctg tccagagtgt ttagctcact ttcttagcagtgtgtaagct

[0838] 4501 ttctccatgt cagaagcaag cctgctcttt gataaatctg tcttcctgaaaatctaaatc

[0839] 4561 atgcttttgt ctttagatct acacagaaat gaccctcctt ggatcagttttctttccagt

[0840] 4621 ctaatcatct ttggaactaa aacttgttct aactcgtctc ttggcattcagctactccta

[0841] 4681 gatcttttgg ttttatcccc tggcctcaga gccatttata ttcccagagta ggcagtaca

[0842] 4741 ggatctcgtg ttgatttgct gtggttaccc agtgtcttct ctacatggca taagcggca

[0843] 4801 aagcccacca ttaggtgagg cggtcccgag ttgaggtaga gtggggcagaggaagatggc

[0844] 4861 agtgaatatc aaacagtaga ccgccatcaa cttctaacag ccagtacacacactgtttca

[0845] 4921 ttttgaggta acgttcagtt ttgcattttg tttaaatatt gaaggcctagacaaagaact

[0846] 4981 agaaaaaaaa aagcagtttc caggcccatc catattgtaa tttttctttatctgcagata

[0847] 5041 ttgcctgtag tctaaagatc tctttggaag acaaagcatt ggctatatatcttttgcctt

[0848] 5101 ttccatgcat ctaaatcttc tctggagatt atctccctac tgtgtaggttaagggcagtc

[0849] 5161 tcgacttttc cttttttgag tcctgtgtgg ctctttgaat cagcgtgaaactgaggctcc

[0850] 5221 agctccctgt gttgtgtgtg tgtgccatcc atgggcttgg gtgtcagtttgtcacaggta

[0851] 5281 tctgccagca ttcaaggttt tggatcattt catgaggatc tttcctttgactgggtgctg

[0852] 5341 tgaggacaca cctgggtctg tgcctgagat tgccaggcaa gattaaggaaagttttcatg

[0853] 5401 tggcttttgt tttgaggtta ttctcaaaac cttaatttct tatattttctgttgactaag

[0854] 5461 gcaccagtaa cccattcttc accctccatt tgtatggcaa tttaaaagtctttggctttg

[0855] 5521 ctctgaattt aattaaaact gccttttatg aacagacttc gagttttgccattttgggca

[0856] 5581 agcccttccg cttgtccctt cctagtggct aataaagtaa aaaaacccacactactttgt

[0857] 5641 tctctttttc tcatattcat tgggctgttg tattcagcca gtctcatgctttccctgggt

[0858] 5701 cttcacggat tgctttccaa gctgccttgt tgcggggttg ctgcagagcagcaactggac

[0859] 5761 ctttccagct gtcgccatgt tccttccact aaagtagagg gttcttaaaatggaaaaacc

[0860] 5821 tgtgggctct tcatatacct ccctttagtt aagtaataga ccaggcagcttctcatctca

[0861] 5881 gcatttacct gttaatattt ttgtgaatag tgctctctac ctgtgggtgg ccgttctctt

[0862] 5941 ccacttgctc gtctcccccc agccccattc tgcataatct accattcttctcctctcttt

[0863] 6001 ctcttcttat acagaccctc attactgggg cccaagatgt gggatactactgttagtatt

[0864] 6061 atttaactat tttgtagatt taaaagattt ctggttaagg gaggtgggggt cactgttca

[0865] 6121 tcactcttaa aatatgtgtt ttctctatag aaaagtaaaa tgtgtttatg gtcccaaaca

[0866] 6181 gtcaactcac aaatttttat aacaaaattt ccttgtaaaa actagggacc atctatatat

[0867] 6241 tccctttaag atctagttct ttttgtaggt gttcagcaat ggtgataaag cagaatattc

[0868] 6301 tcctacctca cgtcattaaa gtcagaagat tatagacctt ctcaaactataagtccctct

[0869] 6361 tcttgccgtt ggcctttctg actctggaat gaccactgtt cattgaaaaatagttttctg

[0870] 6421 actattggtc tggctctaac agtttgtttg ttcatccagc aaatgtttat gagtgatgac

[0871] 6481 catgtgccag aaatgtcagg tatgtgtcct tcccttggcg ccacatagtagtttactaat

[0872] 6541 gtttggggga ttgtacttgg actgtcatag cctctgcgtt tgaccttaaaatagctcttc

[0873] 6601 ccagtaagat tgtgcaattt ttattcacag ctcttccatg tagacttacctttcctcata

[0874] 6661 gagctatcct ggttaataac aggccaagat tctcccatta tcccctgttgtctcctgtag

[0875] 6721 ctttgataat gcctgggaga ttccttggtg taagtgtcat ggataccgactgtttttatg

[0876] 6781 ttggaatttg ttccaacata attagaatct gtttggtgag ttgaaaggtaagttggctca

[0877] 6841 gagttgcaca gtagggcatt aaatgtttaa gcaaagcatc tgcccacactcccctttcca

[0878] 6901 atctagtgcc ttccttgaac tttttcctga gctgctacgt ccctaatcccccttgttggg

[0879] 6961 aggattttcg tatcaccctt atgggacctg tcaccatgtc ctgtactatttggaattggt

[0880] 7021 tttccagtct ttcaacaacc gttgtggcta actatgtttt agaagggctggaggtgtggg

[0881] 7081 ccctgtcttc gggtctcagg acccaaagat cctttagtca gttgttgggtcttccaagag

[0882] 7141 ccagacatta atacagattg aactccatca gtcccctaat tgtcagcctttacctccctc

[0883] 7201 ccagagcaag gagtttaggg attctaaagc ttagtgtcca cacatcattctaccagacct

[0884] 7261 tagagcttta gaagctcaat ctaaaatact gtaactcagc ataaactattactatcactc

[0885] 7321 ctttgaactc agtctccatg agcagtgttt tgttggaaat acatagaacggcttaatgcc

[0886] 7381 tagagggtgg tggatagtga aggacggtca aggttatatt tttgactgcttagggattct

[0887] 7441 ttggatccaa gaaacagaaa tgttcaagcg gaataaagga gggagtggagttgtggtaag

[0888] 7501 gatgcagggt atttcgcaga acccaggacg ggaagtgcct ttggttcttgggtggagctg

[0889] 7561 gaactgcaga gctttgcacc tagtcctttc tcccgcttca cagtctgcttatggtatatg

[0890] 7621 tggcccccaa ataggcactc tagtcctcaa gtctacacca ccttccaactctggggatca

[0891] 7681 ccatgaacaa attctcaatt tcccatactt aatttttttt ttttttgagatggagtctcg

[0892] 7741 ctgtgtcgcc caggctggag tgcagtggtg cagtctcaac tcaccacaacctctgcctcc

[0893] 7801 caggttcaag cagttctctg cctcaacctc ccgagtagct gggattacaggcgcctgcca

[0894] 7861 ccatgcccag ctaatgttca tatttttagt agagacaggg tttcaccgtcttggctaggc

[0895] 7921 tggtcttgaa ctcctgaccc tcatgatcca cccacctcgg cctcccaaagtgctaagatt

[0896] 7981 acaggcgtga gccaccgcgc ccggcccata cttcgtattc ttaaaaaaaactacactcag

[0897] 8041 cccagcacat tgatcaagta tctatctctg agcagttggc cttgccagggagagcagaga

[0898] 8101 tgtggcaggc tccttcagct ggagacaggg agcttctcag agaagtgagcagagactcca

[0899] 8161 cagacaccct aaaaaggctt ctactcaaga agtaaagcca ctactcctgcctttttgctt

[0900] 8221 agtggacagg aaggcacagg agtttgtctg ggacatcata gaaattcttaggtttaactt

[0901] 8281 aattctggtc attgtcttct ttatttcctg tttttcttcc ctttgtcagt ctcgcatcc

[0902] 8341 aagatttctt ccctccctct tgtgggccag cctgtcctgt tccagagctagcctgttcct

[0903] 8401 gggtagcctt ccttagcctc cattcagcct caggtctttt gccttcttccgtgtttattt

[0904] 8461 agagagcaga atctaataac gggttccact gtagccacta tccatggacttctgggtcct

[0905] 8521 cttcaggttt gagtgcttga aaatgttcat tctctgggct tgtggcctgt ctccccact

[0906] 8581 ctcctcctca ccctctcgct ccttcctgtg tgagggccgc tctgcagtaatgttctcagg

[0907] 8641 caagccttcc taggcacctc agaaactact ttgccagagc cagtaagaatatataatatt

[0908] 8701 ggagcagttg ccaggataga aattaaatat agattccagt ttaggatagagtttttaccg

[0909] 8761 agagctcttt agacagtata cctgtgtctt ctctggcaat tgctttcattttagtcctat

[0910] 8821 ataaaagctt tccttttctg ttttttttta aaactatgct tttgcttgcctaaatctttt

[0911] 8881 gatcttatat ttctctcatc tcagagcctg tcctgagttg taaggtatttcatactgcct

[0912] 8941 tacttaaaag ttttttaaac tactagagtc atttgataca cacagaagtt acctaataat

[0913] 9001 ccaaagatgt ccatcaaggg aggaagggtg ggtcatcaga ctttgcctttgatgttgtag

[0914] 9061 actaggctcc tgagttaagc agcagaggga cagcagtgcc atgtgccttcactgtgtccc

[0915] 9121 aggaaatctg ggttggttcc agtgggaaat accagtattt cttggttctggaaagtagca

[0916] 9181 aaagagtagg agatggggaa atagggatgg ggagagcaag ccccgcatgtccatggcgag

[0917] 9241 tcaggtgggg agcacgggtg gaagggccgg ctgttgacag acagactaagctgtgtggtg

[0918] 9301 ctcttgccgc cccttcctgg gtacagagct tgagaaaaat gcagccgaccactccctgtg

[0919] 9361 tttgtacaga gcaaagccca aaagccaacc tcagatctcc tgatttggcagctgaagaaa

[0920] 9421 tcagcagagt cctgattgcc tgattcagtc ccaaaaatga atgtcaggccccgccccctc

[0921] 9481 cccaccaaca ttgcctctcc tacattctcc ttctgcccct aaatcagacaggaggccaga

[0922] 9541 gaggagtatt gctcaatgcg tgctatgtgc aactcctcag gccttgtgccacctccatgc

[0923] 9601 tgagccctga agcagggtgt cctgggtgcc tgtgtgtcag ctccctcctctctacctacc

[0924] 9661 tctgaccttc ttgtgggtga gggtggccat gcttatggcc atcttaaaactggagaggca

[0925] 9721 gagaactact tatgagtctg tagaccacgt gttgtcttcc atggcctgtttctcctgctg

[0926] 9781 tctgggtgag tgagcctgca acgcaatgcc catgagagta aatgcctcctgacctaccct

[0927] 9841 gctcagcact gttctagtgt cttggccttg aaagaaaagc ctgacttcctgctgacacat

[0928] 9901 gtggtagggg catggcagct atgaggcacc tcctacgtct gttttctggctgtggtgact

[0929] 9961 tgggattttt aaccttatat atctttttcc tttactcaaa acaaaacaatttttagcaca

[0930] 10021 ctgaaaaaaa aaaaaagcca aatgttttgt gcctttctaa ggcagcactgtatcccaggc

[0931] 10081 tgcattttag gacttaatat ggaaatacca gagtctgagc tcctctaccttgagtttcat

[0932] 10141 tagtccttag tgtctaggag acaggaaaga atgctctctg tgactggagaggtgacatgc

[0933] 10201 aggtgcagtg tgtctggagt ccctttcccc tgctgtgaga cttcagtggaggagagaagc

[0934] 10261 attgtaccct gggatcattt ggttggttcc aatcacaagc ttagttatcaggttgcatgc

[0935] 10321 cttgtctcct gcaaaagaca gaatgtttca caattcccag gtaaactctggaccattcca

[0936] 10381 agtgtcctag ccttctgatg acattaatta cctagttgtg tcgaggagtataggatggac

[0937] 10441 tctcctgaga aggggaggtt ggtggctttg tcttttcttt ttgctggatcctgaactggt

[0938] 10501 ctagacctcc tgcccccacc ccccagcccc catcagatgt ggctggcctttcatttgaag

[0939] 10561 gcttcagact taaagcatta agcagctagt gccctctgca gggcctggtttccccaggga

[0940] 10621 agggcagcaa ggaacatggg accagaagcc tgtcctcagt aatgtgactatagtgagctt

[0941] 10681 tagcaaaagt ttttctatat aatgacatct tacttatctt ttaccctttcctcagttttc

[0942] 10741 ccctgccttt aactaataaa gaattgggag acagaaattt taaagtcctccttattcaag

[0943] 10801 attttgaaat tcttagcctg ggagtgctgg agagaacctg atgctttctccagaatgaag

[0944] 10861 agtcccaatt tgtatatcag tgttaagaag aaaacaaaac aaacacataggtgagatttt

[0945] 10921 cgtggactat tttaaaaatg tgtcattaat ataaaaaatt tatattagcagtatttaatc

[0946] 10981 attctcacct gtaaagaata agaaaaacag aaggtaaata ttcttacagagaatagcaga

[0947] 11041 gctttaagat tcattttcat tttaagtcca ttttattttg ccagtgtattaatgtttaga

[0948] 11101 agtctgtttt actaatgtta tttattaatt ttttttcatt tccatacacagttagttaac

[0949] 11161 taaagagctt tttcaagcac ccatgtctgt aaaaaaatat ttttaaataaagtttctttt

[0950] 11221 gttgtagcag aaaaaaaaaa a

[0951] RASopathies are a group of genetically heterogeneous disorders including, but not limited to, Noonan Syndrome (NS), Cardiofaciocutaneous Syndrome (CFC), Neurofibromatosis type 1 (NF1), Noonan Syndrome with Multiple Lentigines (NSML), Costello Syndrome (CS), and Legius Syndrome, which have mutations in the Ras / MAPK pathway involving PTPN11, SOS1, RAF1, KRAS, HRAS, MAP2K1, MAP2K2, NRAS, CBL, SHOC2, BRAF, RIT1, A2ML1, SPRED1, and NF1. Lymphatic defects in NS have been described in a subset of NS patients, but vary in severity, location, and time of onset. In a review of the literature, we identified a total of 52 prenatal and postnatal patients who presented with clinical features of Noonan or Noonan-like syndrome and lymphatic defects, including pleural effusion, pericardial effusion, chylothorax, hydrops, lymphangiectasia, and lymphedema. We identified mutations in PTPN11 that could explain their disease. Therapeutic intervention in the ras / MAPK ERK pathway should therefore reverse the disease phenotype in these patients, similar to what we have shown previously for ARAF mutations. Thus, the finding that our patients with central conducting lymphatic anomalies have germline or somatic mutations in the Ras / MAPK pathway is novel and identifies new targets for therapeutic agent development. Cell and model data supporting these RAS / MAPK pathway are described below.

[0952] Cell models were developed to study the effects of potential ERK activating mutations. We have reverse transcribed and expressed wild type and mutant proteins in the cell line Ea.hy926. The Ea.hy926 cell line is a fusion of human umbilical vein endothelial cells with a melanoma cell line. It is immortalized and retains some characteristics of endothelial cells. We have successfully used this cell line to demonstrate the cellular consequences of ARAF gene mutations that result in some form of central conducting lymphatic anomaly. We have also shown the reversal of the effects of mutant ARAF in the same cell line using trametinib, a MEK inhibitor.

[0953] Figure 1 The levels of activated ERK in EA.hy926 cells expressing WT or mutant BRAF or PTPN11 proteins are shown. When normalized to protein loading, the amount of phosphorylated ERK contained in cells expressing mutant BRAF was more than 5-fold that of cells expressing wild type BRAF in this experiment. As observed previously with ARAF, mutant BRAF was more highly expressed than WT.

[0954] In Figure 2In cells expressing the F486S BRAF mutant, a change in cell morphology can be observed. As revealed by phalloidin staining, filamentous actin is present throughout the cell body of cells expressing wild-type BRAF. However, actin is largely restricted to the periphery of cells expressing the BRAF mutant. This behavior is consistent with previous observations for cells expressing ARAF mutants. VE-cadherin staining is predominantly intracellular in cells expressing WT or mutant BRAF. Our previous results with ARAF suggested that even expression of WT BRAF induces ERK activation in the Ea.hy926 cell line. Although WT BRAF does not significantly alter cell morphology, this results in internalized VE-cadherin. Figure 3 The effects of ERK activation on VE-cadherin localization and cell morphology are highlighted. Treatment of cells expressing WT or mutant BRAF results in a significant increase in cell surface staining of VE-cadherin and increased filamentous actin in the cell body. The morphological differences between cells expressing WT versus mutant are less apparent in this experiment, which can represent variability from experiment to experiment, or is due to the increased incubation time and cell density in this experiment, compared to the previous experiment. No change in cell morphology and distribution of VE-cadherin was observed in cells expressing PTPN11 mutants. Figure 2

[0955] To identify inhibitors with higher therapeutic efficacy, we treated cells expressing WT and mutant BRAF or PTPN11 with a variety of MEK inhibitors. See Figures 4 and 5. We used trametinib as a point of comparison, and have established a titration curve for PD0352971, Pimasertib, and Refametinib. As expected, each inhibitor was able to reduce pERK levels in cells in a dose-dependent manner. Note that in this set of experiments, the mutants of PTPN11 do not appear to activate ERK above the levels shown with WT PTPN11. Although the specific fold-increase varies from gel to gel, BRAF F486S consistently induces ERK activation above the WT level.

[0956] Zebrafish model of lymphatic vessel disease

[0957] ​Gateway system (Invitrogen, Kwan 2007, Villefranc 2007 17937395, 17948311) was used to assemble the clones in vectors with flanking Tol2 transposase sites for integration into the genome (Kawakami 1999, 10564832). Approximately 10 pl of 25 ng / ul Tol2 mRNA and vector DNA were injected into the first cell of freshly fertilized eggs. Constructs were injected into mrc1a:GFP expressing casper fish to visualize lymphatic vessels. Confocal scanning was performed using a Zeiss LSM710 confocal microscope and Zen software. Confocal z-stacks of images were overlaid using the maximum intensity projection function of Zeiss Zen software. Images were edited in imageJ (Fiji) {Schindelin 2012} and Powerpoint (Microsoft).

[0958] To assess whether the mutant human KRAS G12D could affect zebrafish lymphatic development, we cloned the mutant and WT genes behind the lymph-specific mrc1a promoter (Jung 2017, PMID: 28506987) and linked them to the mCherry fluorophore with a v2a self-cleaving cleavage site (Provost 2007, 17941043). We used flanking Tol2 transposase sites for genomic integration. When phenotypes were analyzed at 7 dpf (days post fertilization), injection of the construct with tol2 mRNA produced small patches of lymphatic cells expressing the transgene and mCherry marker in most injected fish.

[0959] We investigated the phenotype in the main trunk thoracic duct, one of the largest vessels at this stage, which showed the most consistent expression of the transgenic clone. WT KRAS expression did not show an effect on lymphatic development, but KRAS G12D caused thoracic duct expansion and dilation, which appeared to fuse with the abdominal aorta.

[0960] In other studies, we identified additional genes / mutations in the RAS / MAPK pathway that can explain lymphatic abnormalities and provide opportunities for new therapeutic interventions. As shown in Table 3, we identified germline or somatic mutations in RASA1, RAF1, RIT1, NF1, CBL1, and BRAF, all of which are involved in the RAS / MAPK signaling pathway, further supporting the shared genetic etiology between these disease entities and the importance of RAS / MAPK pathway mutations in lymphatic abnormalities. In addition, a homozygous missense variant was found in one patient with lymphedema and a lymphatic transport disorder. Thus, the data we provide show that therapeutic intervention in the linear RAS / MAPK pathway can reverse elevated ERK1 / 2 activity and the lymphatic phenotype caused by mutations in zebrafish, similar to what we have shown previously for ARAF mutations.

[0961] We have developed a cellular model to better understand and investigate the effects of potential ERK-activating mutations by using primary lymphatic endothelial cells instead of established cell lines to capture the mutation characteristics of the disease-relevant cell type. We have reverse transcribed and expressed wild-type and mutant proteins in human dermal lymphatic endothelial cells (HDLECs). We have successfully used these cells to demonstrate the cellular consequences of ARAF gene mutations that result in some form of central conducting lymphatic anomaly. We have also shown that the effects of mutant ARAF can be reversed in the cells using trametinib, a MEK inhibitor, which we recently published in Nature Medicine. In addition, we have tested an additional 7 MEK / ERK inhibitors in this model and shown biochemical and morphological reversal of the effects induced by ARAF mutations that are comparable to trametinib, including PD0325901 (Figure 6), CI1040 / PD184352 (Figure 7), Pimasertib (Figure 8), TAK-733 (Figure 9), AZD8330 (Figure 10), Refametinib (Figure 11), and Ulixertinib (Figure 12).

[0962] Figures 6-11 The effects of each different drug (as indicated in the figure) on HDLECs expressing the ARAF mutation S214P are shown. All of the drugs tested were sufficient to reverse the morphological differences induced by ARAF-S214P, indicating more VE-cadherin accumulation on the cell membrane. Green indicates HA staining, which marks cells expressing ARAF; red indicates VE-cadherin staining.

[0963] Ulixertinib is an orally available potent inhibitor of ERK1 / 2. Previous studies have shown that p-ERK1 / 2 levels are increased in multiple cancer cell lines upon ulixertinib treatment. However, phosphorylation of RSKs (ERK1 / 2 protein substrates) is decreased, which is consistent with sustained ERK1 / 2 inhibition. As shown in the upper panel of Figure 12 , ulixertinib treatment does reduce phosphorylation of the ERK substrate RSK3. In the lower panel, ulixertinib can rescue the loss of VE-cadherin at cell-cell junctions in HDLECs expressing ARAF-S214P and almost completely restores it at a concentration of 300 nM Figure 12 : green indicates HA staining, which marks cells expressing ARAF; red indicates VE-cadherin staining; white indicates DAPI staining of nuclei). Similarly, expression of BRAF-F486S in HDLECs results in a marked lack of VE-cadherin accumulation between neighboring cells Figures 13-14 , which essentially produces a similar phenotype to ARAF mutation. Not surprisingly, ulixertinib Figure 13 ) or trametinib Figure 14 ) treatment can rescue this phenotype, and trametinib Figure 14 , upper panel) can inhibit the elevated ERK phosphorylation. Furthermore, HDLECs expressing RAF1 or KRAS mutations exhibit similar morphological changes and similar p-ERK elevation, which can be normalized by trametinib and ulixertinib Figures 15-16 . On the other hand, RIT1 mutations induce weak activation of p-ERK Figure 17 .

[0964] We utilized a spheroid sprouting assay (3D lymphatic tube formation assay) with HDLECs to gain insight into the effects of mutations on lymphangiogenesis. HDLECs expressing EPHB4-ins, EPHB4-R763Q, or EPHB4-K885 exhibited enhanced lymphatic tube formation capacity compared to HDLECs expressing EPHB4-WT, as measured by sprout length in a three-dimensional lymphatic spheroid sprouting assay in the presence or absence of vascular endothelial growth factor C (VEGFC) with or without Ephrin B2 Figure 18 , upper panel and lower left panel). Both rapamycin and OSI-027, a potent and selective mTORC1 and mTORC2 inhibitor, can rescue the increase in sprouting in mutants Figure 18 , lower right panel).

[0965] In zebrafish models, overexpression of KRAS-G12D mutant (but not wild-type KRAS) in lymphatic vessels resulted in dilated thoracic ducts and overt edema. We further investigated whether either mTOR or MEK / ERK inhibitors could rescue the phenotype. Treatment with MEK inhibitors significantly improved the phenotype, unlike rapamycin, CI 1040, and SL-327, which had no apparent effect. Specifically, treatment with cobimetinib, Pimasertib, TAK-733, AZD8330, and PD0325901 resulted in reduced edema and improved lymphatic branching disorder (Fig. 2A). Figure 19 In addition, treatment with NVP-BEZ235, a dual inhibitor of PI3K and mTOR, showed a significant reduction in edematous larvae ( Figure 19 ).

[0966] We also overexpressed PTPN11 mutations in zebrafish models. Figure 20 Chimeric expression of PTPN11 S502A or G503R mutations was shown to cause a mild lymphatic abnormality phenotype. There was some dilation and misdirection of lymphatic tissue, or fusion of the posterior cardinal vein and thoracic duct.

[0967] There are two RASA1 homologs in zebrafish, rasa1a and rasa1b. We designed gRNAs targeting both rasa1a and rasa1b genes and injected them into Cas9 transgenic embryos, which resulted in the formation of large edema ( Figure 21 ).

[0968] References for Example I

[0969] 1. Alitalo K, Tammela T, Petrova TV 2005 Lymphangiogenesis in development and human disease. Nature 438:946-953

[0970] 2. Trenor CC, 3rd, Chaudry G 2014 Complex lymphatic anomalies. Semin Pediatr Surg 23:186-190

[0971] 3. Levine C 1989 Primary disorders of the lymphatic vessels--a unified concept. J Pediatr Surg 24:233-240

[0972] 4. Wassef M, Blei F, Adams D, Alomari A, Baselga E, Berenstein A, Burrows P, Frieden IJ, Garzon MC, Lopez-Gutierrez JC, Lord DJ, Mitchel S, Powell J, Prendiville J, Vikkula M 2015 Vascular Anomalies Classification: Recommendations From the International Society for the Study of Vascular Anomalies. Pediatrics 136:e203-214

[0973] 5. Hilliard RI, McKendry JB, Phillips MJ 1990 Congenital abnormalities of the lymphatic system: a new clinical classification. Pediatrics 86:988-994

[0974] 6. Smeltzer DM, Stickler GB, Fleming RE 1986 Primary lymphatic dysplasia in children: chylothorax, chylous ascites, and generalized lymphatic dysplasia. Eur J Pediatr 145:286-292

[0975] 7. Faul JL, Berry GJ, Colby TV, Ruoss SJ, Walter MB, Rosen GD, Raffin TA 2000 Thoracic lymphangiomas, lymphangiectasis, lymphangiomatosis, and lymphatic dysplasia syndrome. Am J Respir Crit Care Med 161 :1037-1046

[0976] 8. Brouillard P, Boon L, Vikkula M 2014 Genetics of lymphatic anomalies. J Clin Invest 124:898-904

[0977] 9. Luks VL, Kamitaki N, Vivero MP, Uller W, Rab R, Bovee JV, Rialon KL, Guevara CJ, Alomari AI, Greene AK, Fishman SJ, Kozakewich HP, Maclellan RA, Mulliken JB, Rahbar R, Spencer SA, Trenor CC, 3rd, Upton J, Zurakowski D, Perkins JA, Kirsh A, Bennett JT, Dobyns WB, Kurek KC, Warman ML, McCarroll SA, Murillo R 2015 Lymphatic and other vascular malformative / overgrowth disorders are caused by somatic mutations in PIK3CA. J Pediatr 166:1048-1054e1041-1045

[0978] 10. Kurek KC, Luks VL, Ayturk UM, Alomari AI, Fishman SJ, Spencer SA, Mulliken JB, Bowen ME, Yamamoto GL, Kozakewich HP, Warman ML 2012 Somatic mosaic activating mutations in PIK3CA cause CLOVES syndrome. Am J Hum Genet 90:1108-1115

[0979] 11. Lindhurst MJ, Sapp JC, Teer JK, Johnston JJ, Finn EM, Peters K, Turner J, Cannons JL, Bick D, Blakemore L, Blumhorst C, Brockmann K, Calder P, Cherman N, Deardorff MA, Everman DB, Golas G, Greenstein RM, Kato BM, Keppler-Noreuil KM, Kuznetsov SA, Miyamoto RT, Newman K, Ng D, O'Brien K, Rothenberg S, Schwartzentruber DJ, Singhal V, Tirabosco R, Upton J, Wientroub S, Zackai EH, Hoag K, Whitewood-Neal T, Robey PG, Schwartzberg PL, Darling TN, Tosi LL, Mullikin JC, Biesecker LG 2011 A mosaic activating mutation in AKT1 associated with the Proteus syndrome. N Engl J Med 365:611-619

[0980] 12. Revencu N, Boon LM, Mendola A, Cordisco MR, Dubois J, Clapuyt P, Hammer F, Amor DJ, Irvine AD, Baselga E, Dompmartin A, Syed S, Martin-Santiago A, Ades L, Collins F, Smith J, Sandaradura S, Barrio VR, Burrows PE, Blei F, Cozzolino M, Brunetti-Pierri N, Vicente A, Abramowicz M, Desir J, Vilain C, Chung WK, Wilson A, Gardiner CA, Dwight Y, Lord DJ, Fishman L, Cytrynbaum C, Chamlin S, Ghali F, Gilaberte Y, Joss S, Boente Mdel C, Leaute-Labreze C, Delrue MA, Bayliss S, Martorell L, Gonzalez-Ensenat MA, Mazereeuw-Hautier J, O'Donnell B, Bessis D, Pyeritz RE, Salhi A, Tan OT, Wargon O, Mulliken JB, Vikkula M 2013 RASA1 mutations and associated phenotypes in 68 families with capillary malformation-arteriovenous malformation. Hum Mutat 34:1632-1641

[0981] 13. Burrows PE, Gonzalez-Garay ML, Rasmussen JC, Aldrich MB, Guilliod R, Maus EA, Fife CE, Kwon S, Lapinski PE, King PD, Sevick-Muraca EM 2013 Lymphatic abnormalities are associated with RASA1 gene mutations in mouse and man. Proc Natl Acad Sci U S A 110:8621-8626

[0982] 14. Lo IF, Brewer C, Shannon N, Shorto J, Tang B, Black G, Soo MT, Ng DK, Lam ST, Kerr B 2008 Severe neonatal manifestations of Costello syndrome. J Med Genet 45:167-171

[0983] 15. Fabretto A, Kutsche K, Harmsen MB, Demarini S, Gasparini P, Fertz MC, Zenker M 2010 Two cases of Noonan syndrome with severe respiratory and gastroenteral involvement and the SOS1 mutation F623I. Eur J Med Genet 53:322-324

[0984] 16. Joyce S, Gordon K, Brice G, Ostergaard P, Nagaraja R, Short J, Moore S, Mortimer P, Mansour S 2016 The lymphatic phenotype in Noonan and Cardiofaciocutaneous syndrome. Eur J Hum Genet 24:690-696

[0985] 17. Morcaldi G, Bellini T, Rossi C, Maghnie M, Boccardo F, Bonioli E, Bellini C 2015 Lymphodysplasia and Kras Mutation: A Case Report and Literature Review. Lymphology 48: 121-127

[0986] 18. Makinen T, Adams RH, Bailey J, Lu Q, Ziemiecki A, Alitalo K, Klein R, Wilkinson GA 2005 PDZ interaction site in ephrinB2 is required for the remodeling of lymphatic vasculature. Genes Dev 19:397-410

[0987] 19. Kume T 2010 Specification of arterial, venous, and lymphatic endothelial cells during embryonic development. Histol Histopathol 25:637-646

[0988] 20. Hashimoto T, Tsuneki M, Foster TR, Santana JM, Bai H, Wang M, Hu H, Hanisch JJ, Dardik A 2016 Membrane-mediated regulation of vascular identity. Birth Defects Res C Embryo Today 108:65-84

[0989] 21. Martin-Almedina S, Martinez-Corral I, Holdhus R, Vicente A, Fotiou E, Lin S, Petersen K, Simpson MA, Hoischen A, Gilissen C, Jeffery H, Atton G, Karapouliou C, Brice G, Gordon K, Wiseman JW, Wedin M, Rockson SG, Jeffery S, Mortimer PS, Snyder MP, Berland S, Mansour S, Makinen T, Ostergaard P 2016 EPHB4 kinase-inactivating mutations cause autosomal dominant lymphatic-related hydrops fetalis. J Clin Invest 126:3080-3088

[0990] 22. Kettleborough RN, Busch-Nentwich EM, Harvey SA, Dooley CM, de Bruijn E, van Eeden F, Sealy I, White RJ, Herd C, Nijman IJ, Fenyes F, Mehroke S, Scahill C, Gibbons R, Wali N, Carruthers S, Hall A, Yen J, Cuppen E, Stemple DL 2013 A systematic genome-wide analysis of zebrafish protein-coding gene function. Nature 496:494-497

[0991] 23. Sun S, Chen S, Liu F, Wu H, McHugh J, Bergin IL, Gupta A, Adams D, Guan JL 2015 Constitutive Activation of mTORCl in Endothelial Cells Leads to the Development and Progression of Lymphangiosarcoma through VEGF Autocrine Signaling. Cancer Cell 28:758-772.

[0992] Example II

[0993] ARAF recurrent mutation leads to central conducting lymphatic anomaly treatable by MEK inhibitors

[0994] While recent studies have shown that sirolimus is beneficial in the treatment of generalized lymphatic anomaly (GLA) and central conducting lymphatic anomaly (CCLA)3-5, the lack of clear clinical distinction between these entities hinders the development of innovative therapies due to their rarity and overlapping diagnostic criteria6-9. GLA is defined as a multifocal lymphatic anomaly with multiple regions of micro / macro cystic lymphatic malformations and often involves bone destruction9-11. On the other hand, CCLA describes dysfunction of the thoracic duct (TD) or chyle pool, which leads to retrograde flow of lymph or abnormal lymphatic drainage1,12,13. Both conditions can present with chylothorax, effusions, chyloperitoneum, or lymphedema. The overlap of these apparently distinct diseases suggests that multiple clinical symptoms arise from a common pathway rather than a common gene and implies that the distinction between entities can be artificial. Here, we report the use of whole exome sequencing (WES) to identify a recurrent missense mutation in ARAF that underlies severe late-stage lymphatic disease characterized by complex lymphatic anomalies in two unrelated patients. Our results provide a representative proof of principle that genetic classification provides a method of categorizing complex medical diseases to guide biology-based medical treatments, which in our view is life-saving.

[0995] The following materials and methods are provided to assist in conducting Example II.

[0996] Patients

[0997] After obtaining approval from the institutional review board of Children's Hospital of Philadelphia (CHOP) and informed consent, blood samples were obtained from the proband (P1) and his parents for sequencing analysis. The proband had severe lymphedema in his chest, pericardium, abdomen, lower extremities, and genitalia and was followed and treated at the lymphatic imaging and intervention center at CHOP. An unrelated second adult patient (P2) was recruited through the patient registry of the Lymphangioma Gorham Disease Alliance (LGDA), as were available family members. P1 had no abnormalities in his birth and family history, and his childhood growth and developmental course was normal, except for a capillary malformation on the left side of his abdomen. At age 10 years, he developed swelling of his lower abdomen, thighs, scrotum, and penis. Two months later, he was admitted to a local hospital for shortness of breath and exercise intolerance. Chest X-ray showed cardiomegaly, and echocardiogram showed large pericardial effusion. Pericardiocentesis was performed with drainage of 1 liter of chylous fluid. Despite the institution of total parenteral nutrition, drainage continued, and he was transferred to CHOP for further treatment. At CHOP, his initial evaluation included dynamic contrast-enhanced magnetic resonance lymphangiography, which showed large pericardial effusion and antegrade flow in the dilated lumbar and retroperitoneal network, into dilated and tortuous TDs that moved toward the left-sided azygos vein (Fig. 22a, c, d). Images of an unaffected person are shown in Fig. 22b as a reference. In addition, lymph fluid flowed retrograde into the liver, mesentery, penis, and scrotum and from the distal TDs retrograde into the mediastinum and pericardium (Fig. 22c-e). He underwent stent placement and iodized oil embolization of the distal TDs with the goal of stopping the abnormal mediastinal and pericardial lymph fluid accumulation. He was discharged one month later with stable pericardial effusion, but soon thereafter developed respiratory distress from massive fluid reaccumulation, which increased the need for supplemental oxygen (up to 5 liters through a nasal cannula). He started on sirolimus and was dosed according to a well-tolerated trough level of 2.5 mg per day, which resulted in mid-trough levels of 11.8 (range 6.8-16.2 pg dl1) from May 2016 to November 2016. Over a period of 1.5 years, he experienced multiple percutaneous interventions and surgical lymphatic procedures, including repeated chest tube placement and pleural drainage, multiple percutaneous lymphatic embolizations, two bilateral surgical pleurodeses, surgical lymphatic-venous anastomoses of the thighs, abdomen, and retroperitoneal space, and surgical ligation and inguinal lymphatic embolization of the penis and scrotum due to worsening edema. Despite multiple attempts to control his pericardial effusion, his penile, scrotal, lower extremity, and lower abdominal lymphedema worsened, and his condition continued to deteriorate to the point that palliative care considerations were discussed. The last procedure was performed five months before the use of trametinib, and sirolimus was discontinued.

[0998]

[0999] Patient P2 was an unrelated adult female diagnosed with lymphangiomatosis at age 31. She had extensive symptoms for many years prior to diagnosis, with significant pulmonary involvement requiring multiple pleurocentesis prior to a pleurodesis. She had extensive gastrointestinal involvement requiring a specialized fat-restricted diet and medium-chain triglyceride oil supplementation and intermittent total parenteral nutrition. After the persistent development of unexplained symptoms consistent with lymphangiomatosis affecting her kidneys, liver, spleen, and lungs, she underwent computed tomography and magnetic resonance imaging.

[1000] A liver biopsy confirmed the diagnosis of lymphangiomatosis. She was also treated with albuterol and diuretics and used a motorized scooter for fatigue and difficulty breathing. She never had bone involvement confirmed. As this patient was recruited from the Lymphangiomatosis and Gorham Disease Foundation and was not local, she lost follow-up and was unable to be tested for other therapies as she died from complications related to her underlying lymphatic disease.

[1001] WES and bioinformatics analysis.

[1002] We examined missense, nonsense, splice-altering, and coding indel markers that matched either a dominant or recessive inheritance model in the exome data. Results were filtered to exclude variants with the following factors: synonymous variants; variants in known pseudogenes; variants with a minor allele frequency (MAF) greater than 0.5% in the 1000 Genomes Project or in the 6503 exomes of the National Heart, Lung, and Blood Institute Exome Sequencing Project (ESP6500SI); variants previously identified in controls through our in-house exome variant database. Subsequent gene prioritization was performed by reference to the Online Mendelian Inheritance in Man database on the basis of deleterious predictions and biological relevance.

[1003] Expression and characterization of ARAF mutations in mammalian cell lines.

[1004] HEK293T and HeLa cells were obtained from the American Type Culture Collection and grown in Dulbecco's Modified Eagle Medium (added with 10% fetal bovine serum) at 37°C. Primary human HDLECs were obtained from Promocell and cultured in Endothelial Cell Growth Medium MV 2 (Promocell) according to the manufacturer's instructions. Full-length ARAF cDNA (plasmid number 23725) was amplified from the original vector obtained from Addgene41and cloned as a BamHI / Xhol fragment into a pcDNA3.1 vector containing two copies of a FLAG tag (DYKDDDDK) followed by two STREP tags (WSHPQFEK). The S214P mutation was introduced by site-directed mutagenesis using NEB's Q5 mutagenesis kit following the manufacturer's instructions. Transfections were performed in HEK293T and HeLa according to the manufacturer's protocol using Fugene HD (Promega) with 3 pg of DNA (empty vector, WT ARAF (ARAF-WT) or ARAF mutant (ARAF-S214P)) and 9 pl of transfection reagent. 36-48 hours after transfection, cells were washed twice with ice-cold phosphate-buffered saline (PBS) and lysed on ice using freshly prepared ice-cold cell lysis buffer containing 50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 50 mM beta-glycerophosphate, 10% glycerol (w / v), 1% NP-40 (w / v), 1 mM EDTA, 2 mM NaVO4, and complete EDTA-free protease inhibitor cocktail (Roche Applied Science) (20 pl / milliliter lysis buffer). After clearing the cell lysates by centrifugation, the supernatants were collected for Western blotting or immunoprecipitation using Anti-FLAG M2 affinity gel (catalog number A2220, Sigma) followed by Western blotting.Immunoprecipitates and lysates were run on NuPAGE 4-12% Bis-Tris gels (Thermo Fisher Scientific) and blotted with primary antibodies including: anti-phospho p70S6K-Thr389 (cat# 9205S, Cell Signaling Technology; 1 : 1000), anti-phospho mTOR Ser2448 (cat# 5536P, Cell Signaling Technology; 1 : 1000), anti-FLAG (cat# F3165, Sigma; 1 : 4000), anti-phospho p38 Thr180 / Tyr182 (cat# 4511, Cell Signaling Technology; 1 : 1000), anti-PAN-14-3-3 (cat# sc-629, Santa Cruz Biotechnology; 1 : 500), anti-phospho Akt-Ser473 (cat# 4060, Cell Signaling Technology; 1 : 1000), anti-phospho 44 / 42-(Erk1 / 2)-Thr202 / Tyr204 (cat# 4376, Cell Signaling Technology; 1 : 1000) or anti-beta actin (cat# sc-69879, Santa Cruz Biotechnology; 1 : 1000) antibodies.

[1005] ARAF sequences (from pCDNA3.1-F2S2-ARAF-WT or -S214P constructs as previously described) were cut with BamHI / Xhol and introduced into the Bglll / Xhol sites of a modified version of the pMSCV plasmid containing an amino-terminal FLAG and HA tag. Virus production was performed in HEK293T using Fugene, with 8 pg of total DNA (pMSCV-ARAF-WT or -S214P and envelope and packaging plasmids) and 18 pl of transfection reagent. After 72 hours, the viral supernatant was collected and filtered. Transduction of HDLECs was performed by replacing the cell culture medium with the viral supernatant supplemented with 8 pg ml of polybrene and then filtering through a 0.45 pm filter. Cells were centrifuged at 650 g for 90 minutes and then incubated for 6 hours, at which point the viral supernatant was replaced with standard medium. Transduced HDLECs were incubated for 48 hours before use in experiments. Transduction efficiency observed by HA staining was between 40 and 60%. -1 ARAF sequences (from pCDNA3.1-F2S2-ARAF-WT or -S214P constructs as previously described) were cut with BamHI / Xhol and introduced into the Bglll / Xhol sites of a modified version of the pMSCV plasmid containing an amino-terminal FLAG and HA tag. Virus production was performed in HEK293T using Fugene, with 8 pg of total DNA (pMSCV-ARAF-WT or -S214P and envelope and packaging plasmids) and 18 pl of transfection reagent. After 72 hours, the viral supernatant was collected and filtered. Transduction of HDLECs was performed by replacing the cell culture medium with the viral supernatant supplemented with 8 pg ml of polybrene and then filtering through a 0.45 pm filter. Cells were centrifuged at 650 g for 90 minutes and then incubated for 6 hours, at which point the viral supernatant was replaced with standard medium. Transduced HDLECs were incubated for 48 hours before use in experiments. Transduction efficiency observed by HA staining was between 40 and 60%.

[1006] Immunofluorescence staining and western blotting of HDLECs.

[1007] Round (12 mm) coverslips (VWR) were coated with 0.1% gelatin in water for 10 minutes in a 24-well plate (Corning) and then air-dried for 15 minutes. Transduced HDLECs were plated at a concentration of 100,000 cells per well in 0.5 ml of media in the presence or absence of trametinib for 48 h. Cells were washed in warm, serum-free Dulbecco's Modified Eagle Medium and fixed in 4% paraformaldehyde. Fixed cells were washed twice with PBS and twice with 0.1% BSA in PBS. Cells were permeabilized and blocked by incubation with 10% normal donkey serum (Jackson Immunoresearch) and 0.3% Triton X-100 (Sigma Aldrich) in PBS. VE-cadherin antibody (Thermo Fisher Scientific) was diluted in 0.01% normal donkey serum, 0.1% BSA, and 0.3% Triton X-100 in PBS (final concentration: 2 μg ml -1), and stained for 1 hour. Coverslips were washed twice in 0.1% BSA in PBS. Goat anti-rabbit Alexa 546 (Thermo Fisher Scientific; final concentration: 8 pg ml"1) and Alexa 647 phalloidin (Thermo Fisher Scientific; final concentration: 5 units ml"1) were diluted in 0.01% normal donkey serum, 0.1% BSA and 0.3% Triton X-100 in PBS and stained for 1 hour. Where used, HA tag (6E2) mouse antibody (catalogue number 2367, Cell Signaling Technology) was diluted 1 : 100 in 0.1% BSA and 0.3% Triton X-100 in PBS and then stained for 1 hour. Coverslips were washed twice in 0.1% BSA in PBS and twice in PBS. Coverslips were immersed in water to remove residual salts and mounted on glass slides using Prolong Gold antifade reagent (Thermo Fisher Scientific). Image acquisition was performed on a Leica DM6000 electric upright microscope with a Photometrics HQ2 high resolution monochrome CCD (charge-coupled device) camera using LAS AF software (Leica Microsystems). Z-stacks were acquired at 10x magnification. Images were further processed in the Fiji software package42. Brightness and contrast adjustments were made. The same brightness and contrast settings were applied to all images. Fluorescence values were measured in regions of interest (ROIs) drawn to encompass the whole individual cell or drawn to encompass the whole cell body but not including the cell-cell junctions. From these measurements, the values for the plasma membrane (total cell - intracellular) were derived and the ratio of plasma membrane to intracellular values was derived and plotted. In addition, the length and width of the cells were measured using the line tool and ROI manager. For both analyses, 5 apparently ARAF-expressing cells as determined by HA staining were analysed per x10 field. 5 x10 fields were acquired per experiment per condition. Experiments were performed using a total of 75 cells per condition using cells from 3 independent thawing and transduction of HDLECs. For western blotting of HDLECs with trametinib, 20000 transduced HDLEC cells were plated into a 96 well plate in the presence of increasing amounts of trametinib. Cells were cultured for 24 hours in the presence of drug and then lysed with 40 mM HEPES pH 7.5, 120 mM NaCl, 0.3% CHAPS, 50 mM NaF, 1.5 mM NaVO3 and protease inhibitor cocktail. Lysates were cleared by centrifugation at 20000g for 5 minutes at 4°C. Proteins were separated on 4-12% NuPAGE Bis-Tris gels.Blots were performed using the above antibodies.

[1008] Three-dimensional lymphocyte sprouting assay

[1009] Multicellular spheroids for the lymphocyte sprouting assay were initiated by seeding 7,500 HDLECs expressing ARAF-WT or ARAF-S214P into the wells of a 96-well plate previously coated with 1.5% agarose. Under these conditions, all HDLECs will aggregate into single spheroids within 24 hours. After formation, each spheroid was transferred into a gel solution consisting of the indicated concentration of collagen type I (cat# 354236, Corning; final concentration = 1.5 mg ml-1; pH neutralized with NaOH) and trametinib, which was then allowed to polymerize at 37°C. After solidification, endothelial cell growth medium MV 2 (without VEGFC) containing the appropriate concentration of trametinib was added onto the collagen gel. After 2 days of incubation, embedded spheroids were photographed using an EVOS FL Auto Imaging System (ThermoFisher Scientific) at a z-stack of approximately 8.5 pm steps. The number and length of capillary-like sprouts growing from each spheroid were measured using ImageJ software (https: / / imagej.nih.gov / ij / ).

[1010] MTT proliferation assay with transduced HDLECs.

[1011] Proliferation of transduced HDLECs was measured using the Cell Proliferation Kit I (MTT) from Roche Applied Science. Briefly, on day 2 after retroviral transduction, ARAF-WT- and -S214P-expressing HDLECs were collected, counted and reseeded into flat-bottom 96-well plates in 100 μΐ of medium at a concentration of 10,000 cells per well. At the indicated times after seeding, 10 μΐ of MTT was added to the appropriate wells and incubated at 37°C for 4 hours. A 100-μΐ volume of solubilization reagent was added, followed by overnight incubation at 37°C. Absorbance was measured on a Spectramax i3 multimode plate reader (Molecular Devices) at 550 nm and 700 nm, and A550 nm - A700 nm was calculated. The 4-hour time point after seeding was included as an approximation of the amount of cells loaded into the experiment with minimal proliferation.

[1012] Transgenic expression of human ARAF in zebrafish.

[1013] All procedures using zebrafish were approved by the CHOP Institutional Animal Care and Use Committee (IAC 001154) and were in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Human mutant and WT ARAF cDNAs were cloned into the pDONR221 vector without stop codon; a kozak sequence appropriate for zebrafish (GCAAACATGG) was used43. Expression constructs were assembled using the Tol2 backbone vector set including gateway cloning cassettes44, 45. Constructs were co-injected with Tol2 messenger RNA46.

[1014] ARAF was expressed in blood and lymphatic vessels using the zebrafish mrc1a promoter and visualized by mCherry, which was attached to ARAF via an autocatalytic V2a protein cleavage site. For imaging, larvae were fixed in low-melt agarose and multiple Z images were taken using a x20 lens using a Zeiss LSM710 confocal microscope. Confocal z-stacks of images were overlaid using the maximum intensity projection function of Zeiss Zen software.

[1015] To analyze TD expansion, body sections with transgenic expression in TDs, separated by intersegmental lymphatic vessels, were selected. Morphology was classified as normal (WT), moderately expanded (TDs expanded but separated from PCVs) or severely expanded (TDs and PCVs indistinguishable in Z projections). Images were edited in ImageJ (Fiji). Each experiment was performed 3 times and a total of 40 animals were analyzed.

[1016] Inhibitory drug treatments in zebrafish.

[1017] Drug treatments were performed in 6-well plates with up to 20 larvae per group. Cobimetinib was diluted in embryo medium containing 0.01 M Tris pH 7.2 and 0.1% DMSO. The concentration of cobimetinib used was 1 mM.

[1018] p-ERK antibody staining in zebrafish.

[1019] Fish were injected as described above and larvae with significant WT-type or mutant ARAF / mcherry expression were selected for analysis. Larvae were fixed overnight in 4% paraformaldehyde solution in PBS containing Tween-20 (PBST). Larvae were washed with PBST and incubated in 2% Triton X-100 for 24 hours at 4°C. Larvae were then blocked in 10% bovine serum and stained with phospho-ERK T202 / Y204 antibody (cat# 9101, Cell Signaling Technology, 1 :200) overnight at 4°C, washed with PBST and stained with Alexa Fluor 488 goat anti-rabbit secondary antibody (cat# A11008, ThermoFisher Scientific, 1 :400).

[1020] Statistics.

[1021] For all cell-based assays, significance was assessed by unpaired two-tailed Student’s t-test for comparison of two groups. Statistical analysis was performed using GraphPad Prism 7.0d software. Data are represented as box plots with whiskers from minimum to maximum and centered on the median, or as dot plots with bar graphs representing mean ± s.e.m., as indicated. For all assays performed on HDLECs, except for the proliferation studies for which no statistical analysis was performed, three independent experiments were performed using independent transductions of HDLECs. For the 14-3-3 protein binding assay, three independent experiments were performed using independent transfections of HEK293T cells, while other results for HEK293T cells represent six independent experiments. All zebrafish-related assays were performed in three independent experiments and tested by unpaired one-tailed Student’s t-test for comparison of two groups.

[1022] Results

[1023] The first tier WES analysis for known lymphedema-associated genes, including mutation analysis for AKT1, PIK3CA, KRAS, HRAS, NRAS, BRAF, RAF1, PTPN11, SHOC2, CBL, RIT1 and SOS1, was not revealing. Subsequent gene prioritization revealed a novel X-chromosome ARAF mutation, c.640T>C: p. S214P, in both patients P1, a male, who has CCLA ( Figure 22A, 22C-22E; see "Methods" for detailed clinical description; GenBank Accession NG_016339), patient P2 was a female who was previously diagnosed with lymphangiomatosis. The mutation affects a conserved phosphorylation site, presumably leading to a gain-of-function (GoF) effect, as residue Ser 214 is an orthologous regulatory site in its homologous protein C-RAF (also known as RAF1), which can be inhibited by 14-3-3 proteins. This missense mutation was not present in other exome sequencing data in 1000 Genomes Project, ESP6500SI, ExAC v0.3, gnomAD v2.1, or the 5,000+ samples we have in our internal database. Sanger sequencing of blood DNA from P1 and both parents confirmed that this X-linked ARAF mutation occurred as a somatic heterozygous event, as shown in male patient Figure 22F . Sanger sequencing of the ARAF mutation in P2, her unaffected daughter, and mother confirmed that the mutation was only present in P2 Figure 22F . Sequencing of the father was not possible; however, since her father was not reported to have respiratory symptoms, it is likely that the ARAF mutation was a de novo or somatic mutation in P2. Patient P2 was lost to follow-up, and later we were informed that she subsequently died five years after diagnosis from complications of her lymphatic disease.

[1024] Ser 214 residue, which is one of the 14-3-3 binding sites in conserved region 2 (CR2) in ARAF (14), is highly conserved throughout vertebrate species as well as in RAF proteins, suggesting that it can play an important role in the function of these kinases Figure 22G . Binding of 14-3-3 proteins to phosphorylated Ser 214 of ARAF would prevent activated Ras from recruiting the ARAF protein to the plasma membrane (15). Previous studies have shown that mutation of residue Ser 259, the ARAF-S214 ortholog in C-RAF, impairs 14-3-3 protein binding, which leads to plasma membrane localization and induction of ERK / MEK signaling (16). As shown in Figure 23A , HEK293T cells transfected with ARAF-S214P showed reduced co-immunoprecipitation of 14-3-3 proteins and, in turn, significantly enhanced activation of ERK1 / 2, as measured by increased phosphorylation, compared to HEK293T cells expressing wild-type (WT) ARAF Figure 23A , 23B . ARAF-S214P did not change phosphorylation of AKT, p70S6K, mTOR, and p38, another MAP kinase family Figure 23B). Similar results were obtained in HeLa cells and primary human dermal lymphatic endothelial cells (HDLECs) Figure 23C This apparent over-activation was present even in the absence of cytokines or growth factors.

[1025] HDLECs expressing ARAF-S214P exhibited enhanced lymphangiogenic capacity compared to HDLECs expressing ARAF-WT, as measured by the number of sprouts and sprout length in a three-dimensional lymphospheroid sprouting assay in the absence of vascular endothelial growth factor C (VEGFC) Figure 23D The increase in sprouting in the mutants was rescued by the MEK inhibitor trametinib Figure 23D We then performed morphological analysis of endothelial adherens junctions in primary HDLECs expressing ARAF-S214P. As shown by immunofluorescence microscopy, ARAF-S214P expression caused a substantial lack of VE-cadherin accumulation between neighboring cells, indicating increased internalization of VE-cadherin Figure 23E , yellow arrows). In addition, expression of ARAF-S214P altered the organization of actin, with cells expressing the mutant having less discrete F-actin filaments within the cell body.

[1026] We then examined the ability of MEK1 / 2 inhibitors to reverse these abnormalities. The MEK inhibitor trametinib, at a concentration of 100 nM, rescued the loss of VE-cadherin in the intercellular junctions observed in HDLECs expressing ARAF-S214P, almost completely restoring the cell monolayer integrity and restoring the normal appearance of VE-cadherin at the junctions and actin filaments Figure 23E Although ARAF-S214P clearly activated ERK in HDLECs, and ERK activation is generally associated with cell proliferation, we did not observe any measurable differences in proliferation between HDLECs expressing ARAF-WT- and -S214P in two independent retroviral transductions Figure 23F .

[1027] Analysis of zebrafish lymphatic development was performed in the Tg(mrc1a:egfp)y251 transgenic line 17, in which all lymphatic endothelial cells are marked with EGFP. ARAF expression was targeted to the lymphatics using the mrc1a promoter, and cells expressing ARAF were marked by mCherry expression. ARAF-S214P expression induced lymphatic expansion at different locations, most consistently, we observed expansion of the trunk TD Figure 23G In contrast, expression of ARAF-WT had no effect on lymphatic morphology Figure 23H). Expression of ARAF-S214P induced p-ERK in zebrafish.

[1028] To determine if MEK signaling inhibitors can reverse the abnormality, we treated mrc1a:ARAFs214P larvae with cobimetinib at 3 days post-fertilization (dpf) when lymphoid progenitors sprout TDs (17). We analyzed body segments (somites) with ARAF expression in TDs at 7 dpf and found that duct morphology can be significantly rescued by cobimetinib Figure 23I , 23J ). Meanwhile, we treated WT Tg(mrc1a:egfp)y251 larvae with cobimetinib and found that they tolerated the drug well.

[1029] Given our studies showing that ARAF mutation caused a functional gain-of-function in P1s that were unresponsive to sirolimus and that MEK inhibitors can rescue the lymphoid phenotype in both transduced endothelial cells and transgenic zebrafish models, we sought Institutional Review Board approval to use MEK inhibitor therapy in P1s. Trametinib (Mekinist) is an FDA-approved MEK inhibitor that was used off-label after a comprehensive baseline evaluation in this 12-year-old patient.

[1030] We used a 1 mg d −1 starting dose of trametinib and observed improvements in pulmonary function tests within 2 months of treatment Figure 24A . Furthermore, after three months of treatment, lymphedema and supplemental oxygen requirements were significantly reduced, and he was able to adapt to room air with increased physical activity level, and no adverse events of trametinib were observed. At 12 months of treatment, his pulmonary function tests indicated that his total lung capacity (TLC) was almost doubled, and his forced expiratory volume in 1 s (FEV1) increased from 23% to an estimated 42% Figure 24A ). Electrolytes (low Na and K) normalized and his magnetic resonance imaging scans showed lymphedema and remodeling of his lymphatic system Figures 24B-24F ), a significant recovery of his total lung capacity (TLC) and his forced expiratory volume in 1 s (FEV1) increased from 23% to an estimated 42% Figure 24A ). Electrolytes (low Na and K) normalized and his magnetic resonance imaging scans showed lymphedema and remodeling of his lymphatic system Figures 24B-24F ), a significant recovery of an individual who was frequently hospitalized before starting this gene-directed therapy Figure 24F .

[1031] In summary, we performed WES on two unrelated patients with lymphatic anomalies and identified recurrent, gain-of-function mutations in the ARAF gene, including a 12-year-old male with advanced lymphatic disease who was unresponsive to sunitinib therapy. HDLECs transduced with mutant ARAF exhibited elevated ERK1 / 2 activity, enhanced lymphangiogenic capacity, and disassembly of actin cytoskeleton and VE-cadherin junctions, which could be rescued using the MEK inhibitor trametinib. Sprouting was observed in HDLECs expressing ARAF-S214P in the absence of VEGFC, a potent lymphangiogenic factor (18). No sprouting was observed in cells expressing ARAF-WT under the same conditions. This suggests that ARAF mutants are mimicking the stimulatory actions of VEGFC or inducing expression of VEGFC by HDLECs, which is required for endothelial cell sprouting as seen in many stromal cell types (19-21). We replicated the abnormal lymphatic phenotype caused by GoF mutations in ARAF in a zebrafish model in which treatment with a MEK inhibitor was observed to rescue the phenotype. Remarkably, treatment of the proband with an ARAF mutation using trametinib resulted in significant improvement in the patient's symptoms, remodeling of her dilated and painful lymphatic vessels, resolution of lymphedema, and return to daily activities within 12 months of treatment.

[1032] From ongoing patient recruitment, we investigated additional patients with lymphatic anomalies, including patients with Noonan (or Noonan-related) syndrome, Gorham-Stout disease, kaposiform lymphangiomatosis (KLA), lymphangiectasia, and CCLA. Upon sequencing an additional 43 patients, we identified 7 additional mutations in KRAS, BRAF, RASA1, PTPN11, and SOS1 (Table 3), suggesting that RAS-MAPK signaling is a common pathway leading to the clinical presentation of various lymphatic diseases. Indeed, it is increasingly recognized that the RAS-MAPK pathway plays a critical role in the signaling of lymphangiogenesis (21-23). In a review of the literature, we identified over 50 patients with mutations in KRAS, HRAS, BRAF, RAF1, PTPN11, SHOC2, CBL, RIT1, and SOS1 and presenting with clinical features of Noonan or Noonan-like syndrome with lymphatic defects, including pleural effusion, pericardial effusion, chylothorax, hydrops, lymphangiectasia, and lymphedema (21-23). During the course of our study, a recurrent NRAS variant was implicated in GLA (37) and KLA (38), further supporting the shared genetic etiology between these disease entities and the importance of RAS-MAPK pathway mutations in lymphatic anomalies.

[1033] For decades, it has been recognized that mutations in RASopathies are very common in human cancer. We carefully examined the ARAF mutations we discovered using the cBioPortal (39) database (n = 71,857 subjects, queried on February 6, 2019) and found that 2 patients had the same exact mutation in ARAF. Interestingly, both had a concurrent TP53 mutation, which is thought to be a driver of carcinogenesis. Different mutations at this residue (S214T, S214A, S214Y, S214C, and S214F) were also observed in ten patients with different types of cancer, three of which have been shown to cause elevated MEK / ERK phosphorylation (40). However, nine out of ten patients had concurrent oncogenic mutations in TP53, GNAS, AKT2, APC, EGFR, ATM, CHEK2, KIT, or U2AF1, increasing the likelihood that these oncogenic drivers could cause cancer cells to overproliferate. The proband with the ARAF mutation had dilated lymphatic vessels, but the size of the lesion did not increase over years of follow-up. Thus, these data are consistent with our observation that the ARAF mutation we discovered can not drive increased proliferation of lymphatic endothelial cells in vitro.

[1034] With respect to the prevalence of mutation-positive lymphatic anomalies, the Lymphatic Anomaly Alliance was formed in 11 centers in the United States to facilitate multicenter clinical trials of this group of lymphatic anomalies, including but not limited to GLA, Gorham-Stout disease, CCLA, KLA, Klippel-Trenaunay syndrome, and kaposiform hemangioendothelioma, enrolling over 3000 patients with moderate to severe disease course, with a total of approximately 300 new patients added each year. Based on the current molecular diagnostic rate (20%), we estimate that approximately 20% of them have defects in the RAS-MAPK pathway, suggesting that thousands of patients in the United States can benefit from MEK inhibitor treatment. Thus, our work exemplifies how genetic discoveries can impact disease classification and find new biology and life-saving treatments, as shown here for patients with previously unknown etiology of lymphatic anomalies, a realization of precision medicine.

[1035] References

[1036] 1. Trenor, C. C. 3rd & Chaudry, G. Complex lymphatic anomalies. Semin. Pediatr. Surg. 23, 186-190 (2014).

[1037] 2. Collins, F. S. & Varmus, H. A new initiative on precision medicine. N. Engl. J. Med. 372, 793–795 (2015).

[1038] 3. Adams, D. M. et al. Efficacy and safety of sirolimus in the treatment of complicated vascular anomalies. Pediatrics 137, e20153257 (2016).

[1039] 4. Hammill, A. M. et al. Sirolimus for the treatment of complicated vascular anomalies in children. Pediatr. Blood Cancer 57, 1018–1024 (2011).

[1040] 5. McCormick, A., Rosenberg, S., Trier, K. & Balest, A. A case of a central conducting lymphatic anomaly responsive to sirolimus. Pediatrics 137, e20152694 (2016).

[1041] 6. Hilliard, R. I., McKendry, J. B. & Phillips, M. J. Congenital abnormalities

[1042] of the lymphatic system: a new clinical classification. Pediatrics 86, 988–994 (1990).

[1043] 7. Levine, C. Primary disorders of the lymphatic vessels—a unified concept. J. Pediatr. Surg. 24, 233–240 (1989).

[1044] 8. Smeltzer, D. M., Stickler, G. B. & Fleming, R. E. Primary lymphatic dysplasia in children: chylothorax, chylous ascites, and generalized lymphatic dysplasia. Eur. J. Pediatr. 145, 286-292 (1986).

[1045] 9. Wassef, M. et al. Vascular anomalies classification: recommendations from the International Society for the Study of Vascular Anomalies. Pediatrics 136, e203-e214 (2015).

[1046] 10. Chen, W., Adams, D., Patel, M., Gupta, A. & Dasgupta, R. Generalized lymphatic malformation with chylothorax: long-term management of a highly morbid condition in a pediatric patient. J. Pediatr. Surg. 48, e9-e12 (2013).

[1047] 11. Lala, S. et al. Gorham-Stout disease and generalized lymphatic anomaly— clinical, radiologic, and histologic differentiation. Skeletal Radiol. 42, 917-924 (2013).

[1048] 12. Clemens, R. K., Pfammatter, T., Meier, T. O., Alomari, A. I. & Amann-Vesti, B. R. Combined and complex vascular malformations. Vasa 44, 92-105 (2015).

[1049] 13. Li, D. et al. Pathogenic variant in EPHB4 results in central conducting lymphatic anomaly. Hum. Mol. Genet. 27, 3233-3245 (2018).

[1050] 14. Wellbrock, C., Karasarides, M. & Marais, R. The RAF proteins take centre stage. Nat. Rev. Mol. Cell Biol. 5, 875-885 (2004).

[1051] 15. Lavoie, H. & Therrien, M. Regulation of RAF protein kinases in ERK signalling. Nat. Rev. Mol. Cell Biol. 16, 281-298 (2015).

[1052] 16. Molzan, M. et al. Impaired binding of 14-3-3 to C-RAF in Noonan syndrome suggests new approaches in diseases with increased RAS signaling. Mol. Cell Biol. 30, 4698-4711 (2010).

[1053] 17. Jung, H. M. et al. Development of the larval lymphatic system in zebrafish. Development 144, 2070-2081 (2017).

[1054] 18. Karkkainen, M. J. et al. Vascular endothelial growth factor C is required for sprouting of the first lymphatic vessels from embryonic veins. Nat. Immunol. 5, 74-80 (2004).

[1055] 19. Carmeliet, P. & Jain, R. K. Molecular mechanisms and clinical applications of angiogenesis. Nature 473, 298-307 (2011).

[1056] 20. Karaman, S., Leppanen, V. M. & Alitalo, K. Vascular endothelial growth factor signaling in development and disease. Development 145, dev151019 (2018).

[1057] 21. Potente, M. & Makinen, T. Vascular heterogeneity and specialization in development and disease. Nat. Rev. Mol. Cell Biol. 18, 477-494 (2017).

[1058] 22. Coso, S., Bovay, E. & Petrova, T. V. Pressing the right buttons: signaling in lymphangiogenesis. Blood 123, 2614-2624 (2014).

[1059] 23. Brouillard, P., Boon, L. & Vikkula, M. Genetics of lymphatic anomalies. J. Clin. Invest. 124, 898-904 (2014).

[1060] 24. Bulow, L. et al. Hydrops, fetal pleural effusions and chylothorax in three patients with CBL mutations. Am. J. Med. Genet. A 167A, 394-399 (2015).

[1061] 25. Gargano, G. et al. Hydrops fetalis in a preterm newborn heterozygous for the c.4A>G SHOC2 mutation. Am. J. Med. Genet. A 164A, 1015-1020 (2014).

[1062] 26. Gos, M. et al. Contribution of RIT1 mutations to the pathogenesis of Noonan syndrome: four new cases and further evidence of heterogeneity. Am. J. Med. Genet. A 164A, 2310-2316 (2014).

[1063] 27. Hanson, H. L. et al. Germline CBL mutation associated with a Noonan-like syndrome with primary lymphedema and teratoma associated with acquired uniparental isodisomy of chromosome 11q23. Am. J. Med. Genet. A 164A, 1003-1009 (2014).

[1064] 28. Milosavljevic, D. et al. Two cases of RIT1 associated Noonan syndrome: further delineation of the clinical phenotype and review of the literature. Am. J. Med. Genet. A 170, 1874-1880 (2016).

[1065] 29. Koenighofer, M. et al. Mutations in RIT1 cause Noonan syndrome - additional functional evidence and expanding the clinical phenotype. Clin. Genet. 89, 359-366 (2016).

[1066] 30. Lee, K. A. et al. PTPN11 analysis for the prenatal diagnosis of Noonan syndrome in fetuses with abnormal ultrasound findings. Clin. Genet. 75, 190-194 (2009).

[1067] 31. Croonen, E. A. et al. Prenatal diagnostic testing of the Noonan syndrome genes in fetuses with abnormal ultrasound findings. Eur. J. Hum. Genet. 21, 936-942 (2013).

[1068] 32. Joyce, S. et al. The lymphatic phenotype in Noonan and cardiofaciocutaneous syndrome. Eur. J. Hum. Genet. 24, 690-696 (2016).

[1069] 33. Yaoita, M. et al. Spectrum of mutations and genotype-phenotype analysis in Noonan syndrome patients with RIT1 mutations. Hum. Genet. 135, 209-222 (2016).

[1070] 34. Lo, I. F. et al. Severe neonatal manifestations of Costello syndrome. J. Med. Genet. 45, 167-171 (2008).

[1071] 35. Ebrahimi-Fakhari, D. et al. Congenital chylothorax as the initial presentation of PTPN11-associated Noonan syndrome. J. Pediatr. 185, 248-248.e1 (2017).

[1072] 36. Morcaldi, G. et al. Lymphodysplasia and Kras mutation: a case report and literature review. Lymphology 48, 121-127 (2015).

[1073] 37. Manevitz-Mendelson, E. et al. Somatic NRAS mutation in patient with generalized lymphatic anomaly. Angiogenesis 21, 287-298 (2018).

[1074] 38. Barclay S. F. et al. A somatic activating NRAS variant associated with kaposiform lymphangiomatosis. Genet. Med. https: / / doi.org / 10.1038 / s41436-018-0390-0 (2018).

[1075] 39. Gao, J. et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci. Signal. 6, pl l (2013).

[1076] 40. Imielinski, M. et al. Oncogenic and sorafenib-sensitive ARAF mutations in lung adenocarcinoma. J. Clin. Invest. 124, 1582-1586 (2014).

[1077] While certain preferred embodiments of the present application have been described and specifically exemplified herein, this was for illustrative purposes only and not for the purpose of limiting the scope of the application, which is defined only by the claims set forth below. Various modifications of the application in accordance with the principles of the application can be made by persons skilled in the art without departing from the scope and spirit of the application.

Claims

1. Use of one or more MEK / ERK inhibitors in the manufacture of a medicament for treating a lymphatic vessel abnormality in a subject identified as having one or more SNVs, the lymphatic vessel abnormality selected from the group consisting of generalized lymphatic anomaly (GLA) and lymphangioleiomyomatosis / lymphangiectasia (LAM), the use comprising detecting a nucleic acid comprising a single nucleotide variation (SNV) in a biological sample from the patient, wherein the SNV is selected from the group consisting of: (a) c.1504T>G:pS502A, C1510A>G:pM504V or c.1507G>C:pG503R in PTPN11; (b) c.35G>A:pG12D in KRAS; (c) c.1403T>C:pF468S or c.2128-G>T in BRAF; and (d) c.433A>C:p.T145P in RAF1.

2. The use according to claim 1, wherein the MEK / ERK inhibitor is selected from the group consisting of selumetinib (AZD6244), PD0325901, trametinib (GSK1120212), PD184352 (CI-1040), Pimasertib (AS-703026), TAK-733, AZD8330, binimetinib (MEK162, ARRY-162, ARRY-438162), SL-327, refametinib (RDEA119, Bay 86-9766), cobimetinib (GDC-0973, RG7420) and Ulixertinib.

3. The use according to any one of the preceding claims, wherein the lymphatic vessel abnormality is characterized by abnormal formation of lymphatic vessels and / or tissue overgrowth.

4. The use according to any one of the preceding claims, wherein the lymphatic vessel abnormality is characterized by chyloperitoneum, including pericardial, pleural or peritoneal effusion.

5. The use according to claim 1, further comprising generating a report confirming the SNV following detection in the biological sample.

6. The use according to any one of the preceding claims, further comprising generating a report confirming a suggested medicament for the lymphatic vessel abnormality based on the SNV identified in the method.

7. The use according to any one of the preceding claims, wherein the medicament is a MEK inhibitor selected from pimasertib, refametinib and / or trametinib.

8. The use according to any one of the preceding claims, wherein the patient does not have a SNV in PTPN11.

9. The use according to any one of the preceding claims, wherein the patient does not have a SNV in KRAS.

10. The use according to any one of the preceding claims, wherein the patient does not have a SNV in BRAF.

11. The use according to any one of the preceding claims, wherein the patient does not have a SNV in SOS1. ​ ​ ​ ​ 12. The use according to any one of the preceding claims, wherein the patient does not have a SNV in ITGA9.

13. The use according to any one of the preceding claims, wherein the patient has 2, 3, 4 or 5 of any combination of the following SNVs: (a) c.1504T>G:pS502A, C1510A>G:pM504V and c.1507G>C:pG503R in PTPN11; (b) c.35G>A:pG12D in KRAS; (c) c.1403T>C:pF468S and c.2128-G>T in BRAF; (d) c.2536G>A:pE846K in SOS1; (e) c.475_476del:p.(L159Gfs*20) and c.2246G>C p.R749P in RASA1; (f) c.433A>C:p.T145P in RAF1; (g) c.270G>T:p.M90I in RIT1; (h) c.1034_1043del:p.(L345Pfs*28 in NF1; and (i) c.1096-1G>T and c.2322T>G:p.Y774* in CBL.

14. The use according to any one of the preceding claims, further comprising systemic chemotherapy, interferon alpha, radiotherapy and / or surgery.

15. The use according to any one of the preceding claims, wherein the detecting further comprises analyzing a polynucleotide sample to determine the presence of the SNV by performing a process selected from the group consisting of detection of specific hybridization, measurement of allele size, restriction fragment length polymorphism analysis, allele-specific hybridization analysis, single base primer extension reaction, and sequencing of amplified polynucleotides.

16. The use according to any one of the preceding claims, wherein the biological sample comprises DNA.

17. The use according to any one of the preceding claims, wherein the biological sample comprises RNA.

Images