Chemiluminescent probe for G-quadruplex detection as well as preparation method and application of chemiluminescent probe
By designing small molecule chemiluminescent probes, the problems of low efficiency, high cost and large background interference in existing G-quadruplex detection methods have been solved. This enables high-sensitivity detection and semi-quantitative analysis without the need for an excitation light source, and is suitable for the detection of G-quadruplexes in cells or tissues.
Patent Information
- Application Number
- CN202511501736.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-21
- Publication Date
- 2026-01-23
AI Technical Summary
Existing methods for detecting G-quadruplexes suffer from low cell internalization efficiency, high cost, the need for external light source excitation, and high background interference. Chemiluminescent probes have not been reported for the detection of G-quadruplexes.
A small molecule chemiluminescent probe based on G-quadruplex ligands was designed and synthesized. By introducing a linker chain and a luminescent group, a detection system without an excitation light source was established, and detection was performed by luminescence excited by reactive oxygen species.
It achieves high sensitivity and low background interference detection of G-quadruplexes, enabling visualization and semi-quantitative analysis within cells or tissues, and exhibits low biotoxicity and high specificity.
Smart Images

Figure CN121378293A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of chemical biology technology, in particular to a small molecule chemiluminescent probe based on G-quadruplex ligand design, a preparation method thereof, and application in imaging and screening G-quadruplex ligands in cells or tissues. BACKGROUND
[0002] G-quadruplex (G4) is a higher-order structure formed by single-stranded guanine-rich DNA or RNA sequences, such as telomere 5'-TTAGGG-3' / 5'-UUAGGG-3' repeat sequences and repeat sequences in the gene regulatory region. G-tetrad is the basic building block of G-quadruplex, which is a square planar structure formed by four guanine bases through eight Hoogsteen hydrogen bonds (N1-O6, N2-N7), with O6 atoms pointing to the center of the ring, forming an anionic antiprism bipyramid. Planar G-tetrad can further combine to form an expanded 3D structure, utilizing its large aromatic π plane, and then affecting the final folding topology of G-quadruplex by embedding metal cations of different radii in the central charged cavity, which also strongly affects its stability, such as K + and Na + , which stabilize the G-quadruplex structure by neutralizing the electrostatic repulsion of the C6 oxygen atom. The metal ion stabilization effect is related to the increase of Li + <Na + <K + radius, among which potassium is the best and significantly improves the stability of G-quadruplex. G-quadruplexes can form three different topologies (i.e., parallel, antiparallel, and mixed) in an intra- and inter-strand manner. The thermodynamic stability of G-quadruplexes is determined by its topology, loop size, and loop base composition. More than 375,000 sequences that can form G-quadruplexes have been identified in the human genome. According to the difference in the location of G-quadruplexes, they can be divided into DNA G-quadruplexes and RNA G-quadruplexes. In addition, G-quadruplex structures are found in telomere DNA and RNA, promoter regions, mRNA 5'UTR, and exons, etc. locations, especially in the sequences that can form G-quadruplexes at the end of human telomeres and the promoter regions of oncogenes, such as telomere end repeat sequences, and c-MYC, c-KIT, BCL-2, KRAS, etc. The sequence arrangement and location of G-quadruplexes in these genes are highly conserved in humans. Different types of G-quadruplexes play different functions in vivo, including protecting telomeres and participating in transcription, translation, and splicing, etc.
[0003] G-quadruplexes have been implicated in DNA replication, transcription, and genome maintenance. Through the in-depth study of G-quadruplex-related binding proteins, a comprehensive understanding of the biological processes related to G-quadruplex functions and how G-quadruplexes are involved in cellular regulation can be achieved. In addition, G-quadruplexes also exist in a variety of related viruses and their infected host cells worldwide, including hepatitis C virus (HCV), human immunodeficiency virus (HIV), hepatitis B virus (HBV), Zika virus, and severe acute respiratory syndrome coronavirus (SARS-Co-V). Visualization and accurate detection of G-quadruplex structures and their dynamic changes are essential for understanding their universality and distribution and how they affect biological processes.
[0004] Currently, there are three main strategies for detecting G-quadruplex imaging. First, immunofluorescence assays using highly specific antibodies against G-quadruplex structures, such as BG4 and 1H6, are widely used in G-quadruplex research. However, this method requires cell fixation and has low intracellular efficiency and high cost, which limits its application. Second, fluorescence probes using G4-specific ligand competition experiments. These small molecule probes usually require external light excitation, which causes high background interference. In addition, the sensitivity is relatively low. Third, imaging using G-quadruplex-containing aptamers. Light-emitting RNA aptamers or fluorescent light-emitting aptamers (FLAP, also known as fluorescent aptamers) are a gene-encoded RNA imaging platform. However, imaging in cells is limited due to RNA degradation, competitive folding, thermal instability, and the absence of ion concentrations typically found in cells.
[0005] Chemiluminescent probes are molecules that are promoted to an excited state and emit light through a chemical reaction. This luminescence does not require an external light source, but rather generates light directly through a chemical reaction. Chemiluminescent probes have high sensitivity, low background interference, and are easy to operate, and can be used for qualitative and semi-quantitative detection of substances. To date, there have been no reports of chemiluminescent probes for G-quadruplex detection.
[0006] In order to optimize the limitations of current G-quadruplex detection, the reporter small molecule ligand scaffold is used as a G-quadruplex binding fragment. By further introducing a linking chain and a luminescent group, a small molecule chemiluminescent probe based on G-quadruplex ligands is designed and synthesized. Based on this type of small molecule chemiluminescent probe, a G-quadruplex visualization and semi-quantitative detection system is established. The detection system is simple, does not require an excitation light source, and can be used for in vivo G-quadruplex detection and semi-quantitative analysis in cells or tissues. SUMMARY
[0007] The present application aims to provide a small molecule chemiluminescent probe based on G-quadruplex ligand design and a preparation method and application thereof, so as to solve the problems in the above background art. The probe molecule can be used for G-quadruplex detection and semi-quantitative analysis in cells or tissues.
[0008] To achieve the above-mentioned purpose, the present application provides the following technical solutions. The present application provides a chemiluminescent probe for G-quadruplex detection, which is 3,3'-((4-(4-(2-methyl-3-oxo-3,7-dihydroimidazo[1,2-a]pyrazin-6-yl)benzamido)butyl)amino)-1,10-phenanthroline-2,9-dicarbonyl)bis(nitrogen diazyl))bis(1-methylquinolin-1-ium) iodide, and its structure is shown as formula I: .
[0009] The present application also provides a preparation method of the chemiluminescent probe for G-quadruplex detection, comprising the following steps: (1) Compound 1 is subjected to nucleophilic substitution reaction with N-(tert-butoxycarbonyl)-1,4-butanediamine to obtain compound 2; the reaction uses N-(tert-butoxycarbonyl)-1,4-butanediamine as a reactant and a solvent; ; (2) Compound 2 is subjected to N-methylation reaction with iodomethane to obtain compound 3; the selected organic solvent for the reaction is DMF; ; (3) Compound 3 is subjected to deprotection to obtain compound 4; the selected organic solvent for the reaction is DMF, and the acid is hydroiodic acid; ; (4) 4-tert-butoxycarbonylphenylboronic acid and 2-amino-5-bromopyrazine are used as luminescent group raw materials, and compound 5 is obtained through Suzuki coupling reaction; the selected organic solvent for the reaction is toluene and ethanol, the base is sodium carbonate, and the catalyst is Pd(PPh3)4; ; (5) Compound 5 is subjected to nucleophilic addition reaction with methylglyoxal under acidic conditions, and deprotection is performed to obtain compound 6; the selected organic solvent for the reaction is 1,4-dioxane, and the acid is hydrochloric acid; ; (6) Compound 4 and compound 6 are subjected to condensation reaction to obtain the target probe I; .
[0010] Further, in step (1), the molar ratio of compound 1 to N-(tert-butoxycarbonyl)-1, 4-butanediamine is 1:1.2-1:2, the temperature of the nucleophilic substitution reaction is 110-120℃, and the time is 1-2 hours; in step (2), the molar ratio of compound 2 to methyl iodide is 1:45-1:90, the temperature of the N-methylation reaction is 35-40℃, and the time is 10-12 hours; in step (3), the temperature of the deprotection group is 35-40℃, and the reaction time is 10-12 hours.
[0011] Further, in step (4), the molar ratio of 4-tert-butoxycarbonyl phenyl boronic acid to 2-amino-5-bromopyrazine is 1:1.2-1:2, the temperature of the Suzuki coupling reaction is 80-85℃, and the reaction time is 10-12 hours; in step (5), the molar ratio of compound 5 to methylglyoxal is 1:2-1:6, the temperature of the deprotection group is 75-78℃, and the time of the deprotection group is 4-6 hours.
[0012] Further, in step (6), the molar ratio of compound 4 to compound 6 is 1:1.2-1:2, the temperature of the condensation reaction is 0-4℃, and the time is 1-2 hours.
[0013] Further, in step (6), an organic solvent, a condensing agent, and a base are added in the condensation reaction, the organic solvent is N,N-dimethylformamide or dioxane, the condensing agent is HBTU, EDCI or HATU, PyBOP, and the base is triethylamine or N,N-diisopropyl ethylamine.
[0014] The application also provides an application of the chemiluminescent probe in detecting the G-quadruplex structure, and the chemiluminescent probe can also be applied to semi-quantitative analysis of the G-quadruplex structure, and the relative content of the G-quadruplex can be estimated according to the luminescence intensity.
[0015] The G-quadruplex is a higher-order structure formed by DNA or RNA rich in tandem repeat guanine (G); the G plane is a structural unit of the G-quadruplex, and a square plane is formed by four guanine bases through eight Hoogsteen hydrogen bonds (N1-O6, N2-N7), and two or more G planes form the G-quadruplex structure through π-π stacking and central insertion of metal cations with different radii.
[0016] In some embodiments of the application, the G-quadruplex is related to telomere end protection, DNA replication, transcription, and translation, and can realize effective regulation in the process of cell proliferation, apoptosis and aging, and tumor occurrence and development.
[0017] In some embodiments of the present application, the chemiluminescent probe compound has a rigid planar parent nucleus, side chains containing basic groups, and can be stacked on the G-quadruplex plane and interact with the G-quadruplex among the G-quadruplex structure interaction, and the side chain of the parent nucleus is connected with the active oxygen responsive imidazopyrazinone group.
[0018] In some embodiments of the present application, the chemiluminescent probe compound has high specificity only for G-quadruplex (including DNA G-quadruplex or RNA G-quadruplex), and has weak affinity for other types of nucleic acids (including dsDNA, ssDNA, RNA hairpin).
[0019] In some embodiments of the present application, the qualitative analysis of G-quadruplex is that the G-quadruplex can produce light of a specific wavelength after chemical reaction under active oxygen conditions after combining with the probe compound, and the luminescence intensity is related to the G-quadruplex content and the active oxygen concentration, and the substrate is non-G-quadruplex, which produces little luminescence.
[0020] The present application also provides a chemiluminescent probe as described above in the application of cell luminescence imaging.
[0021] The present application also provides a kit for detecting G-quadruplex, comprising a chemiluminescent probe as shown in formula I, H2O2, FeSO4 and PBS buffer.
[0022] In order to optimize the limitations of the current detection of G-quadruplex, the present application uses a small molecule ligand skeleton as a binding fragment of G-quadruplex, and by further introducing a connecting chain and a luminescent group, a small molecule chemiluminescent probe based on G-quadruplex ligand is designed and synthesized. Based on the small molecule chemiluminescent probe, a G-quadruplex visualization and semi-quantitative detection system is established, which is simple, does not require an excitation light source, and can be used for in vivo G-quadruplex detection and semi-quantitative analysis of cells or tissues.
[0023] Compared with the prior art, the present application has the following advantages: 1、The small molecule chemiluminescent probe of the present application has different luminescence mechanism from fluorescence. This feature enables it to emit light through active oxygen without excitation light, has lower background interference, and improves the accuracy of detection.
[0024] 2、The small molecule chemiluminescent probe of the present application can maintain the luminescence property for nearly 15 minutes.
[0025] 3、The small molecule chemiluminescent probe of the present application has high specificity only for G-quadruplex (including DNA G-quadruplex or RNA G-quadruplex), and has weak affinity for other types of nucleic acids (including dsDNA, ssDNA, RNA hairpin).
[0026] 4、The small molecule chemiluminescent probe has low biological toxicity, has less adverse effects on organisms in actual application, and can ensure safety and reliability of experiments.
[0027] 5、The small molecule chemiluminescent probe can image G-quadruplexes in and outside cells, has no or little luminescent properties for non-G-quadruplexes, and can effectively and accurately image and semi-quantify G-quadruplexes. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 It is a schematic diagram of response ability of the chemiluminescent probe I to different active oxygen; Figure 2 It is a diagram of changes of the chemiluminescent probe I in luminescent intensity with time; Figure 3 It is a schematic diagram of selectivity of the chemiluminescent probe I in different nucleic acid structures; Figure 4 It is a cell toxicity test result diagram of the chemiluminescent probe I; Figure 5 It is a non-denaturing gel electrophoresis luminescence imaging experiment result diagram of the chemiluminescent probe I; Figure 6 It is a chemiluminescence imaging experiment result of the chemiluminescent probe I in normal cells HEK-293T and tumor cells U-2 OS, and the scale is 50 μm. DETAILED DESCRIPTION
[0029] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.
[0030] A chemiluminescent probe for G-quadruplex detection comprises a chemiluminescent probe compound, which generates a luminescent signal after being excited by active oxygen after being combined with a G-quadruplex, and can perform qualitative and semi-quantitative analysis on intracellular G-quadruplexes. The chemiluminescent probe is 3,3'-((4-(4-(2-methyl-3-oxo-3,7-dihydroimidazo[1,2-a]pyrazin-6-yl)benzamido)butyl)amino)-1,10-phenanthroline-2,9-dicarbonyl)bis(nitrogen diyl))bis(1-methylquinolin-1-ium) iodide, and its structure is shown as follows: .
[0031] The preparation process route of the chemiluminescence probe is as follows: (1) Compound 1 and N-(tert-butoxycarbonyl)-1,4-butanediamine undergo nucleophilic substitution reaction to obtain compound 2; ; (2) Compound 2 and iodomethane undergo N-methylation reaction to obtain compound 3; ; (3) Compound 3 is deprotected to obtain compound 4; ; (4) 4-tert-butoxycarbonyl phenylboronic acid and 2-amino-5-bromopyrazine are used as light-emitting group raw materials, and compound 5 is obtained by Suzuki coupling reaction; ; (5) Compound 5 and methylglyoxal undergo nucleophilic addition reaction under acidic conditions, and the deprotection group to obtain compound 6; ; (6) Compound 4 and compound 6 are obtained by condensation reaction to obtain the target probe I; . Example 1
[0032] Preparation of chemiluminescence probe I Step 1: Preparation of intermediate 2 4-chloro-N2, N9 di (quinoline-3-yl) -1, 10-phenanthroline-2, 9-dicarboxamide (20 mg, 0.036 mmol), tert-butyl carbamate (14 mg, 0.072 mmol) were placed in a single-neck flask, heated to 110-120℃ under nitrogen protection for 1-2h. After the reaction was completed, the reaction liquid was quenched with acetonitrile (10 mL), and yellow solid was precipitated and filtered, washed with cold acetonitrile, and dried to obtain yellow solid powder (4-((2, 9-bis (quinoline-3-yl carbamoyl) -1, 10-phenanthroline-4-yl) amino) butyl) tert-butyl carbamate, 10 mg, yield 39.3%.
[0033] Step 2: Preparation of intermediate 3 Intermediate 2 (10 mg, 0.014 mmol), methyl iodide (90 mg, 0.636 mmol) were dissolved in 5 ml DMF, heated to 35-40 °C under nitrogen protection for 10-12 h. After the reaction was completed, the reaction solution was concentrated by vacuum oil pump, then anhydrous ethanol (10 mL) was added, and yellow solid was precipitated and filtered, washed with cold ethanol, and dried to obtain yellow solid powder 3,3'-((4-((((tert-butoxycarbonyl)amino)butyl)amino)-1,10-phenanthroline-2,9-diyl)bis(azanediyl))bis(1-methylquinolin-1-ium) iodide, 6 mg, yield 42.8%.
[0034] Step 3: Preparation of intermediate 4 Intermediate 3 (5 mg, 0.005 mmol), hydroiodic acid (55% w / w, 0.5 ml) were dissolved in 2 ml DMF, heated to 35-40 °C under nitrogen protection for 10-12 h. After the reaction was completed, the reaction solution was concentrated by vacuum oil pump, then anhydrous ethanol (10 mL) was added, and yellow solid was precipitated and filtered, washed with cold ethanol, and dried to obtain yellow solid powder 3,3'-((4-((4-aminobutyl)amino)-1,10-phenanthroline-2,9-diyl)bis(azanediyl))bis(1-methylquinolin-1-ium) iodide, 3 mg, yield 66.8%.
[0035] Step 4: Preparation of intermediate 5 4-tert-butoxycarbonylphenylboronic acid (500 mg, 2.25 mmol), 2-amino-5-bromopyrazine (470 mg, 2.702 mmol), tetrakis(triphenylphosphine)palladium (39 mg, 0.0337 mmol), anhydrous potassium carbonate (477 mg, 4.5 mmol) were dissolved in 20 ml of toluene and 1 ml of ethanol, heated to 80-85 °C under nitrogen protection for 10-12 h. After the reaction was completed, the reaction solution was filtered through diatomite activated carbon, the filtrate was concentrated, extracted with ethyl acetate (10 mL x 3), dried with anhydrous sodium sulfate, concentrated, and separated and purified by column chromatography (petroleum ether: ethyl acetate = 6:1) to obtain light yellow solid tert-butyl 4-(5-aminopyrazin-2-yl)benzoate, 254 mg, yield 41.6%.
[0036] Step 5: Preparation of intermediate 6 Intermediate 5 (50 mg, 0.184 mmol), methylglyoxal (80 mg, 1.106 mmol), hydrochloric acid (12 N, 100 μL) were dissolved in 4 mL of dioxane and heated to 75-78 °C under nitrogen for 4-6 h. After the reaction was completed, the reaction solution was concentrated, dissolved with methanol, and separated and purified by column chromatography (dichloromethane:methanol = 12:1) to obtain 4-(2-methyl-3-oxo-3,7-dihydroimidazo[l,2-a]pyrazin-6-yl)benzoic acid as a brown solid powder, 12 mg, yield 24.2%.
[0037] Step 6: Preparation of chemiluminescent probe I Intermediate 4 (22 mg, 0.037 mmol), intermediate 6 (10 mg, 0.037 mmol), DIPEA (5 mg, 0.04 mmol), PyBOP (26 mg, 0.05 mmol) were dissolved in 10 mL of DMF and reacted at 0-4 °C under nitrogen for 1-2 h in an ice water bath. After the reaction was completed, the reaction solution was concentrated and separated by preparative HPLC (MeOH:H2O = 20%-80%) to obtain 3,3'-(((4-(4-(2-methyl-3-oxo-3,7-dihydroimidazo[l,2-a]pyrazin-6-yl)benzamido)butyl)amino)-l,10-phenanthroline-2,9-dicarbonyl)bis(nitrilediyl))bis(l-methylquinolin-l-ium) iodide as a yellow solid, 2 mg, yield 4.7%. 1 H NMR (600 MHz, DMSO- d6 ) δ 12.18 (s, 2H), 10.29 (d, J = 11.6 Hz, 2H), 9.82(d, J = 11.3 Hz, 2H), 8.86 (d, J = 8.4 Hz, 2H), 8.72 - 8.63 (m, 2H), 8.63 - 8.42 (m, 4H), 8.05 (q, J = 10.7, 8.9 Hz, 3H), 7.88 (s, 3H), 7.70 (s, 1H), 4.72 (s, 6H), 3.60 (s, 2H), 3.46 - 3.35 (m, 2H), 2.27 (s, 2H), 1.90 - 1.84 (m, 2H), 1.80 (q, J = 7.9, 5.9 Hz, 2H). 13 C NMR (151 MHz, DMSO- d6) δ 165.90, 164.07,163.45, 162.71, 148.39, 145.96, 139.21, 135.82, 134.87, 134.28, 133.27,130.79, 130.69, 130.09, 129.52, 128.01, 125.75, 119.65, 119.57, 119.39,63.20, 47.19, 47.16, 46.42, 46.34, 46.31, 43.12, 40.42, 40.28, 40.14, 40.00,39.86, 39.72, 39.58, 36.24, 31.74, 31.22, 29.53, 29.48, 29.43, 29.32, 29.28,29.19, 29.15, 29.03, 27.07, 27.00, 26.38, 26.33, 26.27, 26.22, 25.56, 25.41,22.55, 14.39.HRMS (ESI): calcd. for C52H45I2N11O4 [M-2I / 2+H] + = 443.68225found 443.68308. t R = 7.98 min (MeOH : H2O = 90 : 10), HPLC purity: 96.8%。 Example 2
[0038] The in vitro chemiluminescence activator was investigated, and the process was as follows: The imidazopyrazinone luminescent group has different sensitivities to different active oxygen species, and the investigation of active oxygen responsiveness is an effective test of the luminescent performance of chemiluminescence probe I. Different active oxygen species (H2O2, O2 - , ClO - , TBHP, ¹O2, •OH) were placed in a 96-well plate, and the same concentration (concentration of 100 μM) of chemiluminescence probe I was quickly added, and then immediately placed in a full-automatic multifunctional imaging system for imaging, with an exposure time of 30 s. All samples were repeated three times. The detailed experimental conditions for determining the relative chemiluminescence intensity of chemiluminescence probe I in the presence of various active oxygen (H2O2, O2 - , ClO - , TBHP, ¹O2, •OH) are listed below.
[0039] H2O2: hydrogen peroxide (1 mM, 10 μl); O2- : 6-hydroxy purine (50 mM, 10 μl) and xanthine oxidase (50 U / ml, 20 μl); ClO - : sodium hypochlorite (1 mM, 10 μl); TBHP: tert-butyl hydroperoxide (1 mM, 10 μl); ¹O2: hydrogen peroxide (0.3 M, 35 μl) and sodium hypochlorite (0.1 mM, 10 μl); •OH: hydrogen peroxide (0.3 M, 35 μl) and ferrous sulfate (0.1 mM, 10 μl).
[0040] It can be seen from the above that the chemiluminescent probe I has certain sensitivity to different active oxygen species, and the sensitivity to hydroxyl radicals is the highest. Figure 1 Example 3
[0041] The change of the luminescence intensity of the chemiluminescent probe I with time was explored, and the process was as follows: The chemiluminescent probe I (concentration of 100 μM) was placed in a 96-well plate, and the same concentration (volume fraction of 0.1%) of hydrogen peroxide solution was quickly added, and then immediately placed in a full-automatic multifunctional imaging system for imaging, with an exposure time of 30 s every 3 min.
[0042] It can be seen from the above that the chemiluminescent probe I has certain sensitivity to different active oxygen species, and the sensitivity to hydroxyl radicals is the highest. Figure 2 It can be seen from the above that the chemiluminescent probe I has certain sensitivity to different active oxygen species, and the sensitivity to hydroxyl radicals is the highest. Example 4
[0043] The selectivity of the chemiluminescent probe I in different nucleic acid structures was explored, and the process was as follows: The thiazole orange (TO) displacement method (G4-FID) is an efficient method for testing the relative selectivity of G-quadruplex ligands to different nucleic acid structures. The different types of nucleic acid sequences selected are shown in Table 1.
[0044] Selected DNA / RNA oligonucleotides were dissolved in G4 folding buffer (10 mM Tris pH 7.4, 100 mM KCl) at a concentration of 100 μΜ. The samples were heated to denature at 95 °C for 5 min using a metal bath. After denaturation, the samples were slowly cooled to room temperature and then refrigerated at -4 °C overnight for later use. G4 and dsDNA were pre-folded (at a concentration of 0.25 μΜ) in 10 mM Tris-HCl (pH 7.4), 100 mM KCl buffer, then thiazole orange (0.50 μΜ) was added, mixed at room temperature, and the fluorescence spectrum (excitation wavelength: 480 nm, fluorescence detection range: 500-530 nm) was recorded as the initial fluorescence intensity (FI0). Subsequently, the test sample (concentration from 0.125 μΜ to 7.5 μΜ) was gradually added, and the fluorescence spectrum (FI) was recorded after a 3 min equilibration period. The DC 50 value of the test sample (i.e. the concentration required to displace 50% TO) was determined by Graphpad nonlinear fitting (Percentage = 100-[(FI / FI0) x 100]), and the corresponding percentage was 50. All sample concentrations were repeated three times. 50
[0045] Table 1: Oligonucleotide sequences used for nucleic acid selectivity test Name Sequence (5'→3') Configuration 21HT GGGTTAGGGTTAGGGTTAGGG Polymeric 24 TTG TTGGG(TTAGGG)3A Mixed 3+1 c-MYC TGAGGGTGGGTAGGGTGGGTAA Parallel c-Kit2 GGGCGGGCGCGAGGGAGGGG Parallel 22CTA AGGGCTAGGGCTAGGGCTAGGG Anti-parallel TERRA r(AGGGUUAGGGUUAGGGUUAGGG) Parallel RNA NRAS r(GGGAGGGGCGGGUCUGGG) Parallel RNA ssDNA GGCATAGTGCGTGGGCG Single-stranded DNA dsDNA GGGTTACTACGAACTGG Double-stranded DNA RNA hairpin CAGUACAGAUCUGUACUG RNA Table 2: Selectivity of chemiluminescent probe I for different DNA DC 50 / μM 21HT 24 TTG c-MYC c-Kit2 22CTA ssDNA dsDNA Probe I 0.76 0.50 0.39 0.80 0.40 1.99 2.44 Table 3: Selectivity of chemiluminescent probe I for different RNA DC 50 / μM NRAS TERRA RNA hairpin Probe I 0.52 0.95 >2.5 From Tables 2, 3 and Figure 3 it can be seen that chemiluminescent probe I has very high specificity for G-quadruplexes (including DNA G-quadruplexes or RNA G-quadruplexes) and weak affinity for other types of nucleic acids (including dsDNA, ssDNA, RNA hairpin). Example 5
[0046] The cytotoxicity test of chemiluminescent probe I was explored, and the process was as follows: The cell growth effects of the test samples on human embryonic kidney cells (HEK-293T) and human osteosarcoma cells (U-2 OS) were tested by measuring the number of viable cells using the Cell Counting Kit-8 (CCK-8) (KGI Biotechnology, Nanjing). HEK-293T and U-2 OS cells were cultured in Dulbecco modified Eagle medium containing 1% glutamine and 10% fetal bovine serum (FBS) at 37°C for 24 h. These cells were then treated with gradient concentrations (3.125–200 μM) of chemiluminescent probe I for 48 h. Then, 100 μl of 10% CCK-8 solution was added to the wells, and the cells were incubated at 37°C for another 1 h. Cytotoxicity was assessed based on the dose-dependent percentage of cell survival in the control group, and viability was calculated using the optical density (OD) detected at 450 nm using a multi-mode microplate reader. All sample concentrations were replicated three times.
[0047] Depend on Figure 4 It can be seen that after chemiluminescent probe I incubates cells for 48 hours, the cell's IC50 value is significantly increased. 50 At concentrations above 50 μM, it is suggested that chemiluminescent probe I has low cytotoxicity, and even long-term high-concentration imaging will not cause significant damage to cells. Example 6
[0048] The chemiluminescent probe I was investigated for luminescence imaging in nondeformable gel electrophoresis to verify its ability to image G-quadruplexes in vitro. The procedure is as follows: 10 μM FAM-labeled DNA / RNA G4 sequences were added to a solution containing 10 mM Tris-HCl (pH=7.4, 100 mM KCl). Chemiluminescent probe I was then added to a final volume of 20 μM. The total volume of each sample was 10 μL. Each sample underwent thermal denaturation and renaturation before loading onto the gel. Non-denaturing gel electrophoresis was performed on a 20% polyacrylamide gel at 4 °C, 8 V / cm, using 1×TBE buffer. Non-denaturing gel electrophoresis data were acquired using a fully automated chemiluminescence imaging system. Images were acquired using both 490–530 nm filters (FAM) and chemiluminescence imaging modes, followed by GelBlue staining and re-imaging. The images were then merged into a single image.
[0049] Depend on Figure 5 It is known that chemiluminescent probe I can bind to G-quadruplexes and emit light for imaging in vitro, but its binding to other non-G-quadruplex nucleic acids is weak, and the light emission is almost undetectable. Example 7
[0050] Chemiluminescent imaging of chemiluminescent probe I in normal human embryonic kidney cells (HEK-293T) and tumor cells human osteosarcoma cells (U-2 OS): HEK-293T and U-2 OS cells were cultured in DMEM medium containing 12% fetal bovine serum. Cells were cultured at 37°C for 12 hours in a humidified environment with 5 / 95 (v / v) CO2 / air. They were then seeded into 35 mm culture dishes with 14 mm coverslips at the bottom and incubated overnight to allow cell adhesion. After approximately 18 hours, the medium was replaced with 2 ml of fresh DMEM medium containing the chemiluminescent probe I (final concentration 30 μM), followed by a further 30 min incubation. After incubation, the DMEM medium containing chemiluminescent probe I was removed, and the cells were washed three times with PBS. Finally, the medium was replaced with PBS containing Hoechst (final concentration 2 μM) for nuclear staining, and the cells were incubated for 10 min. Hydroxyl radical buffer (H2O2, FeSO4, and PBS buffer) was then added, and chemiluminescence imaging was immediately recorded using an Osparing inverted fluorescence microscope (equipped with a low-temperature CCD camera). During imaging, the excitation light was turned off, and the image was recorded under an open filter for 30 seconds.
[0051] Depend on Figure 6 It is known that chemiluminescent probe I can image G-quadruplexes in normal human embryonic kidney cells (HEK-293T) and tumor cells human osteosarcoma cells (U-2 OS) under reactive oxygen species activator conditions, and can be used for intracellular G-quadruplex visualization and semi-quantification.
[0052] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.
[0053] It should be noted that the above content merely illustrates the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. For those skilled in the art, various improvements and modifications can be made without departing from the principle of the present invention, and all such improvements and modifications fall within the scope of protection of the claims of the present invention.
Claims
1. A chemiluminescent probe for G-quadruplex detection, characterized in that, The chemiluminescent probe is 3,3'-((4-(4-(2-methyl-3-oxo-3,7-dihydroimidazo[1,2-a]pyrazin-6-yl)benzamido)butyl)amino)-1,10-phenanthroline-2,9-dicarbonyl)bis(nitrogen diazyl))bis(1-methylquinolin-1-ium) iodide, and its structure is shown as formula I:
2. The method for preparing a chemiluminescent probe for G-quadruplex detection as described in claim 1, characterized in that, The method comprises the following steps: (1) nucleophilic substitution reaction of compound 1 and N-(tert-butoxycarbonyl)-1,4-butanediamine to obtain compound 2; (2) nitrogen methylation reaction of compound 2 and iodomethane to obtain compound 3; (3) deprotection of compound 3 to obtain compound 4; (4) Suzuki coupling reaction of 4-tert-butoxycarbonyl phenyl boronic acid and 2-amino-5-bromopyrazine as a luminescent group raw material to obtain compound 5; (5) nucleophilic addition reaction of compound 5 and methylglyoxal under acidic conditions, and deprotection to obtain compound 6; (6) condensation reaction of compound 4 and compound 6 to obtain the target probe I; 3. The method for preparing a chemiluminescent probe for G-quadruplex detection according to claim 2, characterized in that, In step (1), the molar ratio of compound 1 and N-(tert-butoxycarbonyl)-1,4-butanediamine is 1:1.2-1:2, the temperature of the nucleophilic substitution reaction is 110-120 DEG C, and the time is 1-2 hours; in step (2), the molar ratio of compound 2 and iodomethane is 1:45-1:90, the temperature of the nitrogen methylation reaction is 35-40 DEG C, and the time is 10-12 hours; in step (3), the temperature of the deprotection is 35-40 DEG C, and the reaction time is 10-12 hours.
4. The method for preparing a chemiluminescent probe for G-quadruplex detection according to claim 2, characterized in that, In step (4), the molar ratio of 4-tert-butoxycarbonyl phenyl boronic acid and 2-amino-5-bromopyrazine is 1:1.2-1:2, the temperature of the Suzuki coupling reaction is 80-85 DEG C, and the reaction time is 10-12 hours; in step (5), the molar ratio of compound 5 and methylglyoxal is 1:2-1:6, the temperature of the deprotection is 75-78 DEG C, and the time of the deprotection is 4-6 hours.
5. The method for preparing a chemiluminescent probe for G-quadruplex detection according to claim 2, characterized in that, In step (6), the molar ratio of compound 4 and compound 6 is 1:1.2-1:2, the temperature of the condensation reaction is 0-4 DEG C, and the time is 1-2 hours.
6. The method for preparing a chemiluminescent probe for G-quadruplex detection according to claim 2, characterized in that, In step (6), an organic solvent, a condensing agent and a base are added in the condensation reaction, the organic solvent is N,N-dimethylformamide or dioxane, the condensing agent is HBTU, EDCI or HATU, PyBOP, and the base is triethylamine or N,N-diisopropyl ethylamine.
7. The chemiluminescent probe of claim 1 is applied in detection of G-quadruplex structure.
8. The chemiluminescent probe of claim 1 is applied in cell luminescence imaging.
9. A kit for detecting G-quadruplexes, characterized in that, The method comprises the chemiluminescent probe of claim 1, H2O2, FeSO4 and PBS buffer.