SONAR gene for regulating heat resistance, nodulation and immunity of plants and application of SONAR gene

By regulating the overexpression and knockout of the SONAR gene, the problems of plant heat tolerance, nodule number and immune pre-stimulation were solved, and the heat tolerance and nodule number were increased under pathogen-free conditions, providing new soybean germplasm biomaterials.

CN121378436AActive Publication Date: 2026-01-23YAZHOUWAN NATIONAL LABORATORY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511961060.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-24
Publication Date
2026-01-23
Estimated Expiration
2045-12-24

AI Technical Summary

Technical Problem

Existing technologies struggle to achieve heat resistance, nodulation and nitrogen fixation activity, and immune pre-stimulation in plants under ambient temperature/no-inoculation conditions. Furthermore, existing improvement schemes suffer from poor environmental stability, high metabolic burden, or incomplete compatibility with soybean growth/rhizobium symbiosis.

Method used

We provide SONAR gene overexpression and knockout technologies, and use the CRISPR/Cas9 system to regulate the expression or knockout of the SONAR gene in plants. We construct overexpression and knockout vectors to regulate the SONAR protein, improve the heat resistance and nodule formation of plants, and induce immune pre-stimulation.

Benefits of technology

It significantly improved the plant's tolerance to high temperatures, increased the number of nodules, and enhanced the expression level of immune-related genes in the absence of pathogens, thus achieving immune pre-stimulation and providing biological materials for the cultivation of new soybean germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121378436A_ABST
    Figure CN121378436A_ABST
Patent Text Reader

Abstract

The invention discloses an SONAR gene for regulating and controlling heat resistance, nodulation and immunity of plants and application, and belongs to the field of gene engineering. The invention provides an SONAR gene of which the nucleotide sequence is shown as SEQ ID NO.1, and a soybean plant of which the SONAR gene is over-expressed and knocked out and an arabidopsis thaliana plant of which the SONAR gene is over-expressed are respectively constructed. Experimental results show that overexpression of the SONAR gene can significantly improve the tolerance of soybean and arabidopsis thaliana to 40 DEG C high temperature stress, and under the condition of no pathogen, the basic expression level and transcription response amplitude of immune related genes are effectively improved, and plant immune pre-excitation is induced. The knockout of the SONAR gene can significantly increase the nodulation number of soybean plants. The invention provides a new regulation target for the heat resistance, nodulation quantity and immune pre-excitation of plants, and provides a biological material for the cultivation of new soybean germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular to a SONAR gene for regulating plant heat tolerance, nodulation and immunity and application thereof. BACKGROUND

[0002] Global warming is making crops face frequent and persistent heat stress. Soybean is the fourth largest food crop in the world and the main source of vegetable oil and protein, which is extremely sensitive to temperature anomalies. High temperature not only inhibits pollen viability and yield, but also significantly reduces nodule formation efficiency and nitrogenase activity, thereby weakening its key role in sustainable agriculture.

[0003] Genomic structural variations (SVs) are considered an important genetic basis for driving plant adaptive evolution. However, large-scale pericentric inversions have been rarely reported in plants, and their comprehensive effects on three-dimensional genome structure, epigenetic regulation and trait variation remain to be systematically analyzed.

[0004] Existing heat tolerance improvement is mostly focused on downstream effect genes such as heat shock proteins (HSPs) or engineered antioxidant pathways, often with poor environmental stability, high metabolic burden or incomplete compatibility with soybean growth / nodule symbiosis. Existing nodule regulation is mostly focused on NIN / NSP pathway nodes, and there is still a lack of an upstream integrated stress and symbiotic membrane localization regulatory factor. The lineage of newly generated genes activated by pericentric inversion has not been reported in public literature, which can simultaneously participate in heat response and nodule regulation and has cross-species portability. At the same time, for immune enhancement, most solutions rely on inducers or pathogen-related treatments, which are difficult to achieve basic level immune priming under normal temperature / no inoculation conditions and take into account agronomic traits.

[0005] Therefore, it is urgent to provide a gene for regulating heat tolerance response, nodule nitrogen fixation activity and immune priming and application thereof. SUMMARY

[0006] The purpose of the present application is to provide a SONAR gene for regulating plant heat tolerance, nodulation and immunity and application thereof to solve the problems existing in the prior art. The present application provides a new regulatory target for plant heat tolerance, nodule number and immune priming, and provides biological materials for the cultivation of new soybean germplasm.

[0007] To achieve the above purpose, the present application provides the following solutions.

[0008] The present application provides a SONAR protein, and the amino acid sequence of the SONAR protein is shown in SEQ ID NO. 2.

[0009] The application also provides a coding gene of the above-mentioned SONAR protein, and the nucleotide sequence of the coding gene is shown in SEQ ID NO. 1.

[0010] The application also provides an overexpression vector containing the above-mentioned coding gene.

[0011] The application also provides an engineered bacterium containing the above-mentioned overexpression vector.

[0012] The application also provides a knockout vector targeting the above-mentioned coding gene.

[0013] The application also provides an engineered bacterium containing the above-mentioned knockout vector.

[0014] The application also provides application of the above-mentioned SONAR protein, the above-mentioned coding gene, the above-mentioned overexpression vector or the above-mentioned engineered bacterium in any one of the following aspects:

[0015] (1) improving the heat tolerance of plants;

[0016] (2) cultivating transgenic plants with improved heat tolerance;

[0017] (3) inducing immune priming of plants;

[0018] (4) preparing products for inducing immune priming of plants.

[0019] The application also provides application of the above-mentioned SONAR protein, the above-mentioned coding gene, the above-mentioned knockout vector or the above-mentioned engineered bacterium in any one of the following aspects:

[0020] (1) increasing the nodule number of soybeans;

[0021] (2) cultivating transgenic soybeans with increased nodule number.

[0022] The application also provides a method for improving the heat tolerance of plants and / or inducing immune priming of plants, which comprises the step of overexpressing a SONAR gene in the plants.

[0023] The nucleotide sequence of the SONAR gene is shown in SEQ ID NO. 1.

[0024] The application also provides a method for increasing the nodule number of soybeans, which comprises the step of knocking out a SONAR gene in the soybeans.

[0025] The nucleotide sequence of the SONAR gene is shown in SEQ ID NO. 1.

[0026] The application discloses the following technical effects:

[0027] The application provides a SONAR gene with a nucleotide sequence shown in SEQ ID NO. 1, and constructs soybean plants overexpressing and knocking out the SONAR gene and Arabidopsis plants overexpressing the SONAR gene. Experimental results show that overexpression of the SONAR gene can significantly improve the tolerance of soybean and Arabidopsis to high-temperature stress of 40 DEG C, and effectively improve the basic expression level and transcription response amplitude of immune-related genes in the absence of pathogens, and induce plant immune pre-activation. Knocking out the SONAR gene can significantly increase the nodule number of soybean plants. The application provides a new regulation target for plant heat tolerance, nodule number and immune pre-activation, and provides biological materials for the cultivation of new soybean germplasm. BRIEF DESCRIPTION OF DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0029] Figure 1 Figure for expression level detection results of SONAR overexpression plants;

[0030] Figure 2 Figure for RNA-seq sequencing results of SONAR knockout plants;

[0031] Figure 3 Figure for nodule number and nitrogenase activity experimental results of soybean plants overexpressing or knocking out SONAR; wherein a is the nodule phenotype observation of wild-type and SONAR-knocking-out soybean plants; b is the nodule number statistics of wild-type and SONAR-knocking-out soybean plants; b is the nitrogenase activity results of wild-type and SONAR-knocking-out soybean plants; d is the nodule phenotype observation of wild-type and SONAR-overexpressing Wm82 plants; e is the nodule number statistics of wild-type and SONAR-overexpressing Wm82 plants; f is the nitrogenase activity results of wild-type and SONAR-overexpressing Wm82 plants;

[0032] Figure 4 Figure for high-temperature stress experimental results of soybean plants overexpressing or knocking out SONAR and Arabidopsis plants overexpressing SONAR;

[0033] Figure 5 Figure for transcriptome analysis results of the overexpression of the SONAR gene in soybean;

[0034] Figure 6 Figure for transcriptome analysis results of the overexpression of the SONAR gene in Arabidopsis. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present application will now be described in detail, with reference being made to the figures. The detailed description is not to be taken in a limiting sense, but is made merely for the purpose of describing certain aspects, features and embodiments of the present application.

[0036] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of a parameter, unless otherwise stated, each intervening value of the parameter is also specifically included within the scope of the present application. The intervening values of the parameter are combined with a stated value of the parameter in range form. These are only exemplary embodiments of the present application, and numerous changes and modifications can be made by those skilled in the art without departing from the inventive concepts disclosed herein.

[0037] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference to the extent allowed by law. In the case of conflict between the descriptions herein and that of any such incorporated reference, the present specification will control.

[0038] Various modifications and changes can be made to the specific embodiments described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application in any way.

[0039] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0040] Example 1

[0041] 1. Gene Identification and Sequence Information

[0042] The present application identified a 20.43 Mb pericentric inversion through pan-genome comparison of 95 soybean high-quality genomes (28 of which are new tropical / subtropical assemblies), and discovered a previously unannotated, highly expressed gene locus in all tissues, named SONAR (Spatially Organized Nexus of Adaptive Response) in the context of the inversion. The CDS sequence of SONAR is shown as SEQ ID NO. 1, and the amino acid sequence of the expressed protein is shown as SEQ ID NO. 2.

[0043] SEQ ID NO. 1:

[0044]

[0045] SEQ ID NO.2:

[0046] MSESLDPKAQQQPISMADDSSSTLQIQNLKNLNALLLKETTQHRQQIHSLQSAEMNLRFDSLVGDRDYEVSALKHQLSDLVACLENKTTALAEERDRLVREMKRLKASVDRERKLLEEAEKDRSEGEEVLSRKQRDIAKLKIERDLAVKSSQESCTTIGTLKEAIEAVSREKSEIQSRNNALETKIGYLETELKQLNDYTKKEEEITRAKILELEGNLGIAMQKEEEMKMGISAHLKEKKEHELDEAVKGRSEIEEVKVNLENKIVELRGIVLSETVVVMERFSLKLGVDGVVLTNEFSNILCCKCKHKIYMCLLGGFLADSFLGRYKTIGIFASIQTLFVGIGKRYRYKRSFGSPIVHIFQVIAASIKKRKMQLPYNVGSLYEDTPEASRIEHTEQFRPNSNETLGVLILSSHGFFPEAYWYWIGIGALIEMINQGYTKRSCSSEMLQRMKSSISYKQERALLVSQLALSYRFYVCCLTFDRLLFSAKIMYKLGISSSKINLLLPILKEFAKITREGSLALVALPFDGILGLGFQDTSVGKVTPVCYTPELH.

[0047] 2. Construction of knockout / overexpression materials

[0048] The soybean plants with SONAR deletion were constructed by using CRISPR / Cas9 technology, and gRNA was designed online following the off-target score threshold; the editing target points used were: target point 1: TGTTCTCGAGACAAGCGACG (SEQ ID NO. 3); target point 2: CAGGAGTCGTGTACTACGAT (SEQ ID NO. 4); target point 3: ATCTCCATGGCTGATGACTC (SEQ ID NO. 5). The edited soybean germplasm was red bean.

[0049] The SONAR gene was overexpressed by using the pH7FWG2 vector, the promoter was CaMV 35S, the sequence shown in SEQ ID NO. 1 was inserted into the multiple cloning site of the pH7FWG2 vector, and the terminator was NOS. The edited soybean germplasm was Wm82, and the Arabidopsis was Col-0.

[0050] 3. Transformed plant cultivation

[0051] Soybean transformation: Transformed by Agrobacterium rhizogenes K599 hairy root system, screened positive plants, and planted in the conventional greenhouse to the stable growth period.

[0052] Arabidopsis transformation: Transformed by Agrobacterium GV3101 flower dipping method, screened positive plants, and planted in the conventional greenhouse to the stable growth period.

[0053] 4. Construction of transformed plants for function verification

[0054] qRT-PCR was used to detect the expression level of SONAR in overexpression soybean plants, and the results are shown in Figure 1 , the expression of SONAR in overexpression plants (SONAR-OE-1 / 2 / 3) was significantly up-regulated.

[0055] RNA-seq sequencing was used to detect whether the target was successfully edited in the knockout plants, and the results are shown in Figure 2 , the guanine (G) in the knockout plants was edited to thymine (T).

[0056] 5. Regulation of nodule formation and nitrogenase activity

[0057] Nodulation was performed by inoculating Bradyrhizobium diazoefficiens USDA110, and nodule counting was performed; nitrogenase activity was determined by acetylene reduction (ARA) method.

[0058] As shown in a, b and c in Figure 3 , compared with the wild type plants of ChiDOU (ChiDOU_WT), the nodule number of ChiDOU plants with knockout (KO) SONAR (ChiDOU_CR) was significantly increased, and the nitrogenase activity was significantly decreased;

[0059] As shown in d, e and f in Figure 3 , compared with the wild type plants of Wm82 (Wm82_WT), the nodule number of Wm82 plants with overexpression of SONAR (Wm82_OE) was significantly reduced, and the nitrogenase activity showed no significant difference.

[0060] 6. High temperature stress and phenotype evaluation

[0061] Soybean plants were incubated at 26°C, and Arabidopsis plants were incubated at 22°C.

[0062] Soybean knockout plants, soybean overexpression plants and their wild type plants were subjected to heat treatment at 40°C for 12 days, and Arabidopsis overexpression plants and wild type plants were subjected to heat treatment at 40°C for 3 days, and the growth of plants was observed.

[0063] Results are shown in Figure 4 Fig. 2, the expression level of SONAR gene was significantly up-regulated under high temperature treatment, and the ChiDOU plants with KO SONAR (ChiDOU_CR) wilted significantly compared with the wild type ChiDOU plants (ChiDOU_WT), indicating that KO SONAR resulted in reduced heat tolerance;

[0064] Compared with the Wm82 wild type plants (Wm82_WT), the Wm82 plants overexpressing SONAR (Wm82_OE) did not show yellowing or wilting, indicating that overexpression of SONAR resulted in increased heat tolerance;

[0065] Compared with the Arabidopsis Col-0 wild type plants (Col-0_WT), the Arabidopsis Col-0 plants overexpressing SONAR (Col-0_OE) showed significantly reduced yellowing and wilting, indicating that overexpression of SONAR resulted in increased heat tolerance; indicating that the function of SONAR in regulating plant heat tolerance is cross-species portable.

[0066] 7. Immune priming function and application

[0067] The roots / leaves of soybean Wm82 wild type plants, Wm82 plants overexpressing SONAR, and ChiDOU plants, as well as wild type and Arabidopsis plants overexpressing SONAR were collected at 22°C, and the expression level changes of immune-related genes in the plants were analyzed by transcriptome analysis.

[0068] Results are shown in Figure 5 and Figure 6 The soybean plants overexpressing SONAR showed up-regulated expression of stress resistance-related pathways in the transcriptome, including fatty acid metabolism, response to jasmonic acid signal, phenylpropanoid metabolism, and cell wall development, etc.; SONAR introduced into Arabidopsis showed up-regulated expression of immune response and ubiquitin ligase-related genes, such as ERF / AP2, HSP, PUB28, etc.; GO / KEGG enrichment items included defense response, response to biotic stimulus, and immune system process, etc.

[0069] The above results show that SONAR up-regulation can increase the basic expression level and / or transcriptional response amplitude of immune-related genes, which is manifested as immune priming. Overexpression of SONAR increases the expression of immune / disease marker genes in plants without inoculation of pathogens, achieving immune priming.

[0070] The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application.

Claims

1. A SONAR protein, characterized in that, The amino acid sequence of the SONAR protein is shown as SEQ ID NO.

2.

2. A gene encoding the SONAR protein of claim 1, wherein The nucleotide sequence of the coding gene is shown as SEQ ID NO.

1.

3. An overexpression vector comprising the coding gene of claim 2.

4. An engineered bacterium comprising the overexpression vector of claim 3.

5. A knockout vector targeting the coding gene of claim 2.

6. An engineered bacterium comprising the knockout vector of claim 5.

7. Use of the SONAR protein of claim 1, the coding gene of claim 2, the overexpression vector of claim 3, or the engineered bacterium of claim 4 in any of the following: (1) improving the heat tolerance of a plant; (2) breeding a transgenic plant with improved heat tolerance; (3) inducing immune priming of a plant; (4) preparing a product for inducing immune priming of a plant; The plant is soybean or Arabidopsis.

8. Use of the SONAR protein of claim 1, the coding gene of claim 2, the knockout vector of claim 5, or the engineered bacterium of claim 6 in any of the following: (1) increasing the nodule number of soybean; (2) breeding a transgenic soybean with increased nodule number.

9. A method for increasing heat tolerance and / or inducing immune priming in a plant, characterized in that, comprising the step of overexpressing a SONAR gene in the plant; The nucleotide sequence of the SONAR gene is shown as SEQ ID NO. 1; The plant is soybean or Arabidopsis.

10. A method of increasing the number of nodules on soybean plants, comprising, comprising the step of knocking out a SONAR gene in the soybean; The nucleotide sequence of the SONAR gene is shown as SEQ ID NO. 1.

Citation Information

Patent Citations

  • Nitrate transporter gene AtNRT1.1, coding protein and applications

    CN103642820A

  • Method for culturing plant with high nodulation and nitrogen fixation capacity

    CN108841863A

  • Soybean protein GmDISS2 and application of coding gene thereof in regulation of plant stress tolerance

    CN110294795A

  • Application of GmCDPKb gene in regulation and control of soybean symbiotic nodulation number

    CN121065256A

  • Gene belonging to soy nitrate transporter 1 gene family

    JP2002281975A