Trichoderma asperellum and application thereof

Abstract

The invention relates to the technical field of agricultural microorganisms, in particular to trichoderma asperellum and application thereof.The trichoderma asperellum comprises at least one of the following trichoderma asperellum TA727, the trichoderma asperellum TA727 is preserved in the Guangdong Microbial Culture Collection Center, and the preservation number is GDMCC NO. 63859. The trichoderma asperellum has the advantages that the trichoderma asperellum can be used for preparing the trichoderma asperellum; the trichoderma asperellum is high in sporulation quantity and strong in acid resistance, and has a relatively good pathogenic bacterium inhibition effect under an acidic condition, and volatile substances of the trichoderma asperellum also have an antibacterial effect. The trichoderma asperellum can effectively inhibit pathogenic bacteria in an acid soil environment and soil-borne diseases caused by the pathogenic bacteria, meanwhile, industrial production can be facilitated, and the trichoderma asperellum has wide application prospects.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of agricultural microorganism technology, and in particular to a Trichoderma asperellum and uses thereof. BACKGROUND

[0002] Soil pH is an important factor in determining the composition of microbial communities. With the decrease of pH, the soil micro-ecological environment changes, and the soil-borne pathogens proliferate. Studies have shown that for every unit decrease in pH, the incidence of plant diseases increases by 14% to 18%. Soil pH directly leads to the occurrence of plant diseases by affecting the survival of soil-borne pathogens. For example, the Fusarium oxysporum f. sp. Niveum, which causes watermelon wilt, is not conducive to the growth of watermelons but is conducive to the activity of the pathogen, especially in soil with a pH of 4.5 to 6, where the incidence is higher. Chemical agents such as carbendazim or tobramycin can provide some control effect but can easily cause environmental pollution. In addition, the Rhizoctonia solani, which causes rice, soybean, cotton, sugar beet, potato, and other crops to be infected and causes stand wilt, grows best in neutral to slightly acidic conditions, with a pH of 5.0 being optimal for mycelial growth and sclerotium germination. The Sclerotium rolfsii, which causes peanut white thread disease, is a soil-borne fungal disease caused by Sclerotium rolfsii, which exists in the form of sclerotia in the soil, mainly occurring in the stem or root of the plant, causing the base of the plant to rot. Peanut white thread disease mycelium can grow in a pH range of 2-13; the most sclerotia are formed at a pH of 6-7. In actual production, biological control and chemical control methods are used to control peanut white thread disease. However, peanut white thread disease mycelium mainly exists in the form of sclerotia in the soil and can survive in acidic conditions, making it difficult for chemical agents to control the disease and causing environmental pollution. Potato scab is a soil-borne disease caused by various Steptomyces spp. The Steptomyces spp. can still survive in soil with a pH below 5.2 or above 8.5.

[0003] Common plant fungal pathogens are resistant to acidic environments and can grow in acidic soil environments. However, acidic environments often weaken the control effect of conventional microbial agents or biocontrol agents. Therefore, it is necessary to screen a microbial agent that can survive in soil and adapt to a wide range of pH values, in order to more stably and effectively control soil-borne diseases that survive in acidic conditions.

[0004] Trichoderma is a kind of filamentous fungus easy to isolate, belonging to the class of filamentous fungi, the order of clavicipitaceous family. Trichoderma is widely distributed in nature, has the characteristics of fast growth rate, strong vitality and good adaptability, and has antagonistic effect on many pathogenic fungi and bacteria, so its development and application prospect is good. Studies have found that the biocontrol mechanism of Trichoderma has many kinds, such as forming a "protective cover" by competing for the growth site on the plant surface, hyperparasitic effect, even inducing the host to produce local resistance and systemic resistance, and its metabolites also have the function of resisting plant pathogenic fungi. At the same time, Trichoderma can improve plant biomass by improving nutrient utilization rate and producing plant hormones, thereby promoting plant growth.

[0005] In the prior art, CN117264783A discloses a strain of Trichoderma asperellum CMR1, which can grow in a culture medium with an acidic pH less than 3.8, but it can only inhibit the strawberry-specific form of Fusarium oxysporum, and the application range is narrow. CN114258923A discloses a strain of Trichoderma asperellum LYS1, which can inhibit a variety of pathogenic fungi, but can only grow in an environment with a pH value of about 5.5. Obviously, in the southern acidic soil (pH can be as low as 4-5), the bacteriostatic effect is not good. Therefore, it is necessary to screen Trichoderma that can prevent and control soil-borne disease pathogens under acidic conditions. SUMMARY

[0007] The technical problem to be solved by the present application is to provide a Trichoderma asperellum which has good control effect on soil-borne disease pathogens under acidic conditions.

[0008] The first aspect of the embodiment of the present application provides a Trichoderma asperellum, which is at least one of the following:

[0009] a strain with ITS sequence having at least 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identity with the sequence shown in SEQ ID NO. 1;

[0010] Trichoderma asperellum TA727, deposited in Guangdong Microbial Culture Collection Center, with the deposit number GDMCC No. 63859, the deposit address being No. 59 Building, 5th Floor, Guangzhou Xianlie Middle Road 100 Courtyard, the deposit date being October 7, 2023, the deposit number being GDMCC NO. 63859, and the deposit name being Trichoderma asperellum MN12721;

[0011] a strain having at least 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identity to the ITS sequence of Trichoderma asperellum TA727 described above;

[0012] a strain having an average nucleotide identity of at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% to the genome of any of the strains described above.

[0013] The Trichoderma asperellum has high sporulation capacity, strong acid tolerance, and good pathogenic bacteria inhibition effect under acidic conditions. The volatile substances of the Trichoderma asperellum also have an inhibitory effect. The Trichoderma asperellum can effectively inhibit pathogenic bacteria and soil-borne diseases caused by pathogenic bacteria in acidic soil environment, and is also convenient for industrialized production, and has broad application prospects.

[0014] wherein ITS is Internally Transcribed Spacer, and the ITS sequence is located between 18S, 5.8S and 28S rRNA genes of fungi, and is respectively ITS 1 and ITS 2. In fungi, 5.8S, 18S and 28S rRNA genes have high conservation, while ITS can tolerate more variation in the evolution process due to less natural selection pressure, and shows extremely wide sequence polymorphism in most eukaryotes. At the same time, the conservative performance of ITS is relatively consistent within the species, and the difference between species is obvious, which can reflect the difference between species, even between strains. The length of the fungal ITS region is generally 500-750 bp, and the ITS sequence fragment is small (the length of ITS 1 and ITS 2 is 350 bp and 400 bp respectively), which is easy to analyze, and has been widely used in the phylogenetic analysis of different species of fungi.

[0015] The term "identity" refers to the extent to which two nucleic acid sequences have the same nucleotide residues at the same positions when the two nucleic acid sequences are aligned to achieve the maximum level of identity, expressed as a percentage. The "identity" between the sequences of two nucleic acid molecules can be determined using known computer algorithms, such as at least one of the GCG program package, BLASTN or FASTA, and other commercial or publicly available programs such as the DNAStar-"MegAlign" program.

[0016] The term "Average nucleotide identity (ANI)" refers to the similarity of homologous genes between two bacterial genomes. There are various mature ANI value calculation tools, such as the local operation software Jspecies ( / jspecies) and Gegenees ( / documentation.html), online calculation tools ANI caculator (http: / enveomics.gatech.edu / ), EzGenome ( / ezgenome / ani) and ANItools, etc. Thus, the ANI value of the optional strain and the above-mentioned strain can be calculated by any one of the above-mentioned local operation software or online calculation tool or other tools or methods known in the art.

[0017] The term "strain" refers to any pure genetic type population formed by asexually reproducing from an independently isolated single cell and all its progeny. The progeny can also include vegetative, reproductive, sporulating structures produced at any stage of its life cycle, including but not limited to spores, fruiting bodies or mycelia, etc. In addition, it also includes protoplasts and the like used for genetic transformation and functional studies of fungi.

[0018] In another aspect of the present application, the use of the aforementioned Trichoderma asperellum in the preparation of a product having the function of inhibiting pathogenic fungi is provided.

[0019] The term "pathogenic fungi" refers to microorganisms that live parasitically and can cause diseases in parasitic hosts, usually including microorganisms of the kingdom Fungi, kingdom Protista, kingdom Chromista, etc., such as fungi, oomycetes, slime molds, plasmodiophoromycetes, mycorrhizal fungi, etc. The term "disease" refers to abnormal symptoms that appear inside or outside the tissues of the parasitic host, such as rust, powdery mildew, wilting, rot, etc. on the roots, stems, leaves, flowers, fruits, etc. of plants. The term "inhibit" refers to inhibiting the growth or proliferation of pathogenic fungi or killing them.

[0020] In some embodiments, the pathogenic fungi comprise Fungi.

[0021] In some embodiments, the pathogenic fungi comprise fungi of the subphylum Ascomycotina, the subphylum Basidiomycotina, and the subphylum Deuteromycotina.

[0022] In some embodiments, the pathogenic fungi comprise at least one fungus in the class Plectomycetes, Coelomycetes, Hyphomycetes, Pyrenomycetes, Hymenomycetes, Dothideomycetes.

[0023] In some of these embodiments, the pathogenic fungi comprise at least one fungus in the order Melanconiales, Moniliales, Agonomycetales, Sphaeriales, Sebacinales, Pleosporales.

[0024] In some of these embodiments, the pathogenic fungi comprise at least one fungus in the family Melanconidaceae, Tuberculariaceae, Ceratobasidiaceae, Diaporthaceae, Moniliaceae, Pleosporaceae.

[0025] In some of these embodiments, the pathogenic fungi comprise at least one fungus in the genus Sclerotium, Colletotrichum, Fusarium, Rhizoctonia, Sclerotinia, Phytophthora, Botrytis, Gaeumannomyces, Glomerella, Valsa, Pyricularia, Alternaria, Exserohilum, Bipolaria, Verticillium.

[0026] In some embodiments, the pathogenic fungi include at least one of Athelia rolfsii (the sexual stage of Sclerotium rolfsii), Sclerotium rolfsii, Colletotrichum capsici, Colletotrichum gloeosporioides, Glomerella cingulata, Fusarium commune, Fusarium oxysporum, Fusarium graminearum, Rhizoctonia solani, Sclerotinia sclerotiorum, Phytophthora infestans, Phytophthora capsici, Phytophthora nicotianae, Botrytis cirerea, Gaeumannomyces critici, Valsa mali Miyabe et Yamada, Valsa ceratosperma (Tode et Fr.) Maire, Pyricularia grisea, Alternaria solani, Exserohilum turcicum, Bipolaria maydis, Verticillium dahliae, and Verticillium albo-atrum.

[0027] It can be understood that the above-mentioned fungi do not necessarily all cause diseases in parasitic hosts, and the pathogenic fungi in the embodiments of the present application refer to fungi known in the art which can cause diseases.

[0028] In some embodiments, the host of the pathogenic fungi includes plants.

[0029] In some embodiments, the plants include plants in the fields of agriculture, forestry, etc. Preferably, the plants include, but are not limited to, food crops, economic crops.

[0030] In some embodiments, the food crops include, but are not limited to, at least one of a cereal crop, a tuber crop, a legume crop, or a leafy vegetable, etc. In some embodiments, the cereal crops include, but are not limited to, at least one of the following Poaceae crops: rice, wheat, maize, barley, oat, rye, sorghum, millet, proso millet, foxtail millet, buckwheat, etc. In some embodiments, the tuber crops include, but are not limited to, at least one of the following: sweet potato, yam, potato, etc. In some embodiments, the legume crops include, but are not limited to, at least one of the following: soybean, broad bean, pea, mung bean, peanut, etc.

[0031] In some embodiments, the economic crops include, but are not limited to, at least one of the following economic crops: a Solanaceae plant, a Rosaceae plant, a Rutaceae plant, a Musaceae plant, a Cucurbitaceae plant, a Brassicaceae plant, an Orchidaceae plant, a Papilionaceae plant, a Asteraceae plant, a Liliaceae plant, a Zingiberaceae plant, a Passifloraceae plant, a Bromeliaceae plant, an Araliaceae plant, a Cactaceae plant, a Vitaceae plant, a Actinidaceae plant, etc.

[0032] In some embodiments, the Solanaceae plants include, but are not limited to, at least one of the following: tomato, pepper, potato, eggplant, etc. In some embodiments, the Rosaceae plants include, but are not limited to, at least one of the following: strawberry, papaya, etc. Preferably, the Rutaceae plants include, but are not limited to, at least one of the following: citrus, etc. In some embodiments, the Musaceae plants include, but are not limited to, at least one of the following: banana, etc. In some embodiments, the Cucurbitaceae plants include, but are not limited to, at least one of the following: cucumber, wax gourd, pumpkin, balsam pear, sponge gourd, watermelon, monk fruit, etc. In some embodiments, the Brassicaceae plants include, but are not limited to, at least one of the following: Chinese cabbage, rape, cabbage, radish, cauliflower, etc. In some embodiments, the Orchidaceae plants include, but are not limited to, at least one of the following: orchid, etc. In some embodiments, the Papilionaceae plants include, but are not limited to, at least one of the following: soybean, etc. In some embodiments, the Asteraceae plants include, but are not limited to, at least one of the following: lettuce, etc. In some embodiments, the Liliaceae plants include, but are not limited to, at least one of the following: garlic, etc. In some embodiments, the Zingiberaceae plants include, but are not limited to, at least one of the following: ginger, etc. In some embodiments, the Passifloraceae plants include, but are not limited to, at least one of the following: passion fruit, etc. In some embodiments, the Bromeliaceae plants include, but are not limited to, at least one of the following: pineapple, etc. In some embodiments, the Araliaceae plants include, but are not limited to, at least one of the following: Panax notoginseng, ginseng, etc. In some embodiments, the Cactaceae plants include, but are not limited to, at least one of the following: dragon fruit, etc. In some embodiments, the Apiaceae plants include, but are not limited to, at least one of the following: carrot. In some embodiments, the Vitaceae plants include grape.

[0033] In some embodiments, the Actinidaceae plants include kiwifruit.

[0034] In some embodiments, inhibiting the plant disease includes inhibiting the plant disease in an environment with pH≤8, which can be, for example, inhibiting the plant disease in an environment with pH=7, pH=6, pH=5, pH=4, pH=3, pH=2, pH=1.

[0035] In some embodiments, inhibiting plant diseases comprises inhibiting plant diseases in an environment with pH < 7.

[0036] In some embodiments, inhibiting plant diseases comprises inhibiting plant diseases in an environment with pH < 5.

[0037] In some embodiments, inhibiting plant diseases comprises inhibiting plant diseases in an environment with pH < 3.

[0038] In some embodiments, inhibiting plant diseases comprises inhibiting plant diseases in an environment with pH = 1-8.

[0039] In some embodiments, inhibiting plant diseases comprises inhibiting plant diseases in an environment with pH = 3-7.

[0040] In some embodiments, inhibiting plant diseases comprises inhibiting plant diseases in an environment with pH = 4-6.

[0041] In some embodiments, inhibiting plant diseases comprises inhibiting plant diseases in an environment with pH = 3-5.

[0042] In some embodiments, inhibiting plant diseases comprises inhibiting plant diseases in an environment with pH = 5-7.

[0043] In some embodiments, the environment comprises a soil environment.

[0044] In another aspect of the embodiments of the present application, a microbial inoculant is provided, which comprises at least one of Trichoderma asperellum, an inactivated form thereof, a culture thereof, a metabolite thereof, a volatile thereof, or an extract thereof.

[0045] In some embodiments, the microbial inoculant comprises at least one of Trichoderma asperellum, an inactivated form thereof, a culture thereof, a metabolite thereof, a volatile thereof, or an extract thereof.

[0046] In some embodiments, the microbial inoculant comprises, but is not limited to, an emulsion, a cream, a suspension, a solution, a powder, a tablet, a granule, a microgranule, a wettable powder, and the like.

[0047] In some embodiments, the culture further comprises a culture medium (e.g., a solid or liquid culture medium), or components of a culture medium. In some of these embodiments, the culture further comprises viable cells of Trichoderma asperellum. In some of these embodiments, the viable cells are present in the form of spores. In some of these embodiments, the spores are present in a liquid culture medium. In some of these embodiments, the culture comprises a culture supernatant of Trichoderma asperellum. In some of these embodiments, the culture medium comprises a carbon source (e.g., starch hydrolysate, corn meal, glucose, or sucrose), a nitrogen source (e.g., soybean meal, peptone), an inorganic salt (e.g., disodium hydrogen phosphate, magnesium sulfate, sodium carbonate), a trace element (e.g., Zn, Mn), or any combination thereof.

[0048] In another aspect of the embodiments of the present application, a microbial fungicide or microbial fertilizer or microbial pesticide or biological stimulant is provided, which comprises at least one of the aforementioned Trichoderma asperellum, inactivates thereof, cultures thereof, metabolites thereof, volatiles thereof, or extracts thereof.

[0049] In some embodiments, the pathogenic fungi against which the fungicide is directed comprise fungi.

[0050] In some embodiments, the pathogenic fungi comprise fungi of the subphylum Ascomycotina, Basidiomycotina, Deuteromycotina.

[0051] In some embodiments, the pathogenic fungi comprise at least one of the fungi of the classes Plectomycetes, Coelomycetes, Hyphomycetes, Pyrenomycetes, Hymenomycetes, Dothideomycetes.

[0052] In some of these embodiments, the pathogenic fungi comprise at least one of the fungi of the orders Melanconiales, Moniliales, Agonomycetales, Sphaeriales, Sebacinales, Pleosporales.

[0053] In some of these embodiments, the pathogenic fungi comprise at least one of the fungi of the families Melanconidaceae, Tuberculariaceae, Ceratobasidiaceae, Diaporthaceae, Moniliaceae, Pleosporaceae.

[0054] In some embodiments, the pathogenic fungi comprise at least one fungus of the genera Sclerotium, Colletotrichum, Fusarium, Rhizoctonia, Sclerotinia, Phytophthora, Botrytis, Gaeumannomyces, Glomerella, Valsa, Pyricularia, Alternaria, Exserohilum, Bipolaria, and Verticillium.

[0055] In some embodiments, the pathogenic fungi include at least one of Athelia rolfsii (the sexual stage of Sclerotium rolfsii), Sclerotium rolfsii, Colletotrichum capsici, Colletotrichum gloeosporioides, Glomerella cingulata, Fusarium commune, Fusarium oxysporum, Fusarium graminearum, Rhizoctonia solani, Sclerotinia sclerotiorum, Phytophthora infestans, Phytophthora capsici, Phytophthora nicotianae, Botrytis cirerea, Gaeumannomyces critici, Valsa mali Miyabe et Yamada, Valsa ceratosperma (Tode et Fr.) Maire, Pyricularia grisea, Alternaria solani, Exserohilum turcicum, Bipolaria maydis, Verticillium dahliae, and Verticillium albo-atrum.

[0056] It can be understood that the above-mentioned fungi do not necessarily all cause diseases in parasitic hosts, and the pathogenic fungi in the embodiments of the present application refer to fungi known in the art which can cause diseases.

[0057] In some embodiments, the host of the pathogenic fungi includes plants.

[0058] In some embodiments, the plants include plants in the fields of agriculture, forestry, etc. Preferably, the plants include, but are not limited to, food crops, economic crops.

[0059] In some embodiments, the food crops include, but are not limited to, at least one of a cereal crop, a tuber crop, a legume crop, or a leafy vegetable, etc. In some embodiments, the cereal crops include, but are not limited to, at least one of the following Poaceae crops: rice, wheat, maize, barley, oat, rye, sorghum, millet, proso millet, foxtail millet, buckwheat, etc. In some embodiments, the tuber crops include, but are not limited to, at least one of the following: sweet potato, yam, potato, etc. In some embodiments, the legume crops include, but are not limited to, at least one of the following: soybean, broad bean, pea, mung bean, peanut, etc.

[0060] In some embodiments, the economic crops include, but are not limited to, at least one of the following economic crops: Solanaceae, Rosaceae, Rutaceae, Musaceae, Cucurbitaceae, Brassicaceae, Orchidaceae, Papilionaceae, Asteraceae, Liliaceae, Zingiberaceae, Passifloraceae, Bromeliaceae, Araliaceae, Cactaceae, Umbelliferae, Vitaceae, Actinidaceae, etc.

[0061] In some embodiments, the Solanaceae plants include, but are not limited to, tomato, pepper, potato, eggplant, etc. In some embodiments, the Rosaceae plants include, but are not limited to, strawberry, papaya, etc. Preferably, the Rutaceae plants include, but are not limited to, citrus, etc. In some embodiments, the Musaceae plants include, but are not limited to, banana, etc. In some embodiments, the Cucurbitaceae plants include, but are not limited to, cucumber, wax gourd, pumpkin, balsam pear, sponge gourd, watermelon, monk fruit, etc. In some embodiments, the Brassicaceae plants include, but are not limited to, Chinese cabbage, rape, cabbage, radish, cauliflower, etc. In some embodiments, the Orchidaceae plants include, but are not limited to, orchid, etc. In some embodiments, the Papilionaceae plants include, but are not limited to, soybean, etc. In some embodiments, the Asteraceae plants include, but are not limited to, lettuce, etc. In some embodiments, the Liliaceae plants include, but are not limited to, garlic, etc. In some embodiments, the Zingiberaceae plants include, but are not limited to, ginger, etc. In some embodiments, the Passifloraceae plants include, but are not limited to, passion fruit, etc. In some embodiments, the Bromeliaceae plants include, but are not limited to, pineapple, etc. In some embodiments, the Araliaceae plants include, but are not limited to, Panax notoginseng, etc. In some embodiments, the Cactaceae plants include, but are not limited to, dragon fruit, etc.

[0062] In some embodiments, the Trichoderma asperellum is the aforementioned Trichoderma asperellum.

[0063] In some embodiments, inhibiting the plant disease includes inhibiting the plant disease in an environment with a pH≤8, which can be, for example, inhibiting the plant disease in an environment with a pH=7, a pH=6, a pH=5, a pH=4, a pH=3, a pH=2, a pH=1.

[0064] In some embodiments, inhibiting the plant disease includes inhibiting the plant disease in an environment with a pH≤7.

[0065] In some embodiments, inhibiting the plant disease comprises inhibiting the plant disease in an environment having a pH < 5.

[0066] In some embodiments, inhibiting the plant disease comprises inhibiting the plant disease in an environment having a pH < 3.

[0067] In some embodiments, inhibiting the plant disease comprises inhibiting the plant disease in an environment having a pH = 1-8.

[0068] In some embodiments, inhibiting the plant disease comprises inhibiting the plant disease in an environment having a pH = 3-7.

[0069] In some embodiments, inhibiting the plant disease comprises inhibiting the plant disease in an environment having a pH = 4-6.

[0070] In some embodiments, the environment comprises a soil environment.

[0071] In another aspect of the embodiments of the present application, a composition is provided, the composition comprising at least one of the aforementioned Trichoderma asperellum, inactivates thereof, cultures thereof, metabolites thereof, volatiles thereof, or extracts thereof.

[0072] In some embodiments, the composition further comprises at least one of an additional active agent, an adjuvant.

[0073] In some embodiments, the additional active agent comprises one or more biological control agents, one or more chemical agents, one or more fertilizers, one or more herbicides, one or more growth promoters, or any combination thereof.

[0074] In some embodiments, the additional active agent can be a plant nutrient, a plant growth promoter, a biological stimulant (microelement), a fertilizer, a seed coating agent, etc.

[0075] In some embodiments, the fertilizer comprises, but is not limited to, at least one of an amino acid fertilizer, a fulvic acid fertilizer, a seaweed fertilizer, a humic acid fertilizer, a pollen polysaccharide-containing fertilizer, a polypeptide fertilizer, a microbial fertilizer. The term "microbial fertilizer" refers to a product containing specific microorganisms applied in agricultural production, which can obtain specific fertilizer effects. Such effects not only include the supply of soil, environment and plant nutrients, but also the beneficial effects of metabolites produced by the microorganisms on plants.

[0076] In some embodiments, the additional active agent can include one or more chemical agents, one or more microbial agents. In some embodiments, the chemical agents include, but are not limited to, insecticides, bactericides, fungicides, viricides, nematicides, insecticides, acaricides, gastropodides, herbicides, and the like, or combinations thereof. In some embodiments, the chemical agents include one or more of bactericides, fungicides, nematicides. In some embodiments, the bactericides include, but are not limited to, one or more of Agrimycin, Bio-Act, Bordeaux mixture, Bucoprex, Cuisyl Thio, Copper Oxychloride, Copper Hydroxide, Kocide, Copper Sulfate, Copper Sulfate Heptahydrate, Cuprofix, Chlorine Dioxide, Chlorine Dioxide Gas, Chlorine Dioxide Solution, Copper Sulfate Pentahydrate, or Cuprous Oxide. In some embodiments, the fungicides include, but are not limited to, one or more of Carbendazim, Manzate, Phosetyl-Al, Metalaxyl, Trichoderma viride, Cymoxanil, Dimoxystrobin, Flumetover, Silver Fungicide, Benomyl, Carbendazim, Difenoconazole, or Propiconazole. In some embodiments, the nematicides include, but are not limited to, one or more of halogenated hydrocarbons, methylthionam, organophosphates, carbamates, or abamectin.

[0077] In some embodiments, the additional active agent can include one or more additional biological control agents.

[0078] In some embodiments, the additional biological control agents include, but are not limited to, microbial control agents (including, but not limited to, bacteria, fungi (e.g., yeast), viruses), insect biological control agents, nematode biological control agents, or any combination thereof.

[0079] In some embodiments, the microbial control agents include strains of Burkholderia, Trichoderma, Bacillus, or any combination thereof, or metabolites selected from Trichoderma, Bacillus, or any combination thereof, or fermentation broth, fermentation supernatant selected from Trichoderma, Bacillus, or any combination thereof.

[0080] In some embodiments, the bacteria of Bacillus include at least one of Bacilus velezensis, Bacilus subtilis, Bacilus pumilus, Bacilus coagulans, Paenibacillus polymyxa, Bacillus amyloliquefaciens.

[0081] In some embodiments, the microbial control agent comprises at least one of Trichoderma harzianum, Purpureocillium lilacinum, Penicillium bilaiae, Bacillus subtilis, Burkholderia rinojensis, Bacillus pumilus, Bacillus velezensis, Methylobacterium rhodesianum, Methylobacterium extorquens, and Paenibacillus peoriae.

[0082] In some embodiments, the Trichoderma harzianum is Trichoderma harzianum with accession number CGMCC NO. 15679.

[0083] In some embodiments, the Purpureocillium lilacinum is Purpureocillium lilacinum with accession number CGMCC NO. 12773.

[0084] In some embodiments, the Penicillium bilaiae is Penicillium bilaiae with accession number CGMCC NO. 12767.

[0085] In some embodiments, the Bacillus subtilis is Bacillus subtilis with accession number CGMCC NO. 12908.

[0086] In some embodiments, the Burkholderia rinojensis is Burkholderia rinojensis with accession number GDMCC NO. 61156.

[0087] In some embodiments, the Bacillus pumilus is Bacillus pumilus with accession number GDMCC NO. 61962.

[0088] In some embodiments, the Bacillus velezensis is Bacillus velezensis with accession number GDMCC NO. 61434.

[0089] In some embodiments, the Methylobacterium rhodesianum is Methylobacterium rhodesianum with accession number GDMCC NO. 60729.

[0090] In some embodiments, the Methylobacterium extorquens is Methylobacterium extorquens with accession number GDMCC NO. 62943.

[0091] In some embodiments, the Paenibacillus peoriae is Paenibacillus peoriae with the accession number of GDMCC NO. 60482.

[0092] In some embodiments, the adjuvant is selected from an agriculturally or horticulturally acceptable carrier, diluent, stabilizer, filler, humectant, colorant, solvent, co-solvent, film-forming agent, self- promoting agent, emulsifying agent, dispersing agent, preservative, antifreeze, thickening agent, adjuvant, or any combination thereof.

[0093] In some embodiments, the bacteria of the biological control agent can include, for example, bacteria selected from the group consisting of Bacillus, Burkholderia, and the like, or any combination thereof.

[0094] In some embodiments, the additional active agent can include a combination of two or more of the aforementioned chemical agents and additional biological control agents.

[0095] In some embodiments, the composition can be provided in the form of a microbial inoculant. In some embodiments, the composition is used as a biofertilizer, a biopesticide, or a bioherbicide. In addition, the composition can be used to prepare a microbial inoculant, a biofertilizer, a biopesticide, or a bioherbicide, etc.

[0096] The term “biofertilizer” and “plant growth promoter” are used interchangeably to refer to a preparation that has a plant growth promoting (growth promoting) effect with a living organism or a derivative thereof as a main effective component. The term “biopesticide” and “biological insecticide” are used interchangeably to refer to a preparation that uses a living organism or a derivative thereof to kill or inhibit agricultural pests such as plant pathogens that cause plant diseases. The biofertilizer, the biopesticide, can also be referred to as a microbial fertilizer, a microbial pesticide, and specifically, the living organism used therein includes, for example, Trichoderma asperellum as in the embodiments of the present disclosure.

[0097] In some embodiments, the composition can be provided in the form of a solid, a liquid, a powder, or any combination thereof, etc. For example, the composition of the embodiments of the present disclosure can be formulated into at least one of a solution, a powder, a granule, an emulsion, an emulsion suspension, a suspension, a tablet, a microparticle, and a wettable powder, etc.

[0098] In some embodiments, the composition of the present disclosure can be used to prepare a biofertilizer or a biopesticide.

[0099] In some embodiments, the biofertilizer or the biopesticide can be applied to a plant or a seed.

[0100] In some embodiments, the bio-fertilizer or bio-pesticide can be used to control soil-borne diseases of plants.

[0101] Another aspect of the embodiments of the present application also provides the use of the aforementioned Trichoderma asperellum, or microbial inoculant, or microbial fungicide, or microbial fertilizer, or microbial pesticide, or bio-stimulant, or composition in inhibiting pathogenic bacteria in soil environment, and / or, controlling plant diseases and pests.

[0102] In some embodiments, the plant diseases and pests include plant re-planting diseases, plant bacterial diseases, plant fungal diseases, plant viral diseases, plant soil-borne diseases, plant oomycete diseases, and the like.

[0103] In some embodiments, the plant diseases and pests are caused by one or more of plant bacterial pathogens, plant fungal pathogens, viruses, insects, and nematodes.

[0104] In some embodiments, the aforementioned plant bacterial pathogens include, but are not limited to, at least one of Streptomyces scabies, Ralstonia solanacearum, Bacillus subtilis, Pseudomonas syringae pv. actinidiae, Xanthomonas campestris pv. Oryzae, Erwinia aroideae, Xanthomonas arboricola pv. juglandis, Erwinia carotovora, and Staphylococcus aureus.

[0105] In some embodiments, the plant fungal pathogen described above includes, but is not limited to, at least one of Athelia rolfsii (saprobes), Sclerotium rolfsii, Colletotrichum capsici, Colletotrichum gloeosporioides, Glomerella cingulata, Fusarium commune, Fusarium oxysporum, Fusarium graminearum, Rhizoctonia solani, Sclerotinia sclerotiorum, Phytophthora infestans, Phytophthora capsici, Phytophthora nicotianae, Botrytis cirerea, Gaeumannomyces critici, Valsa mali Miyabe et Yamada, Valsa ceratosperma (Tode et Fr.) Maire, Pyricularia grisea, Alternaria solani, Exserohilum turcicum, Bipolaria maydis, Verticillium dahliae, and Verticillium albo-atrum.

[0106] Among them, the pepper anthracnose fungus can grow in the environment of pH 4.5-6.5 (Xie, B. Y., Ouyang, B. Y., and Ouyang, F. Biological characteristics of Colletotrichum capsici. Microbiology of China, 1992, 19(06): 321-324.). Colletotrichum gloeosporioides can tolerate low pH environment, and grows in neutral or slightly acidic conditions. The asexual state of Colletotrichum gloeosporioides is Glomerella cingulata, and the optimal pH for growth is 4-7.2 (Wu, G. B., et al. "Biological studies on the pathogens of apple ring rot and anthracnose." China Fruit Trees 1 (2001): 5.). Pyricularia grisea grows best at pH 6.0-6.5.

[0107] Rhizoctonia solani can grow at pH 3-12 (Tai, L. M., et al. Biological characteristics of Rhizoctonia solani on potato. Plant Protection, 2015, No. 01).

[0108] Fusarium oxysporum, Fusarium graminearum, Fusarium equiseti and other Fusarium are widely present in acid soil. Studies have shown that the pathogenicity of Fusarium is stronger in acid soil with pH about 5.2-5.8 (Fang, X., You, M. P. & Barbetti, M. J. Reduced severity and impact of Fusarium wilt on strawberry by manipulation of soil pH, soil organic amendments and crop rotation. Eur J Plant Pathol 134, 619-629 (2012)).

[0109] Sclerotinia sclerotiorum can grow at pH 4.7-8.5 (Shi, J. R., Wang, Y. Z., Shen, S. W., et al. Influence of pH on the growth of Sclerotinia sclerotiorum. Jiangsu Agricultural Science, 1999, 27(03): 47-49.).

[0110] Phytophthora infestans can grow in the environment of pH 5-7 (Zhu Jiehua, Zhang Zhiming, Ding Mingya, et al. The influence of culture conditions on the oospore production of Phytophthora infestans [J]. Microbiology Bulletin, 2000, 27(5): 317-320.); the hyphal growth of Phytophthora capsici is best when the pH value is between 6-7 (Zhang Zhengbing. The biological characteristics of Phytophthora capsici and the chemical control of pepper blight. Hunan Agricultural University, 2004.); the hyphal growth of Phytophthora nicotianae is good when the pH value is between 5-8 (Shen Huifang, Biological characteristics of Phytophthora nicotianae, the pathogen of pineapple heart rot in Hainan, Guangdong Agricultural Sciences, 2014, No. 2).

[0111] The mycelial growth and spore germination of Botrytis cinerea prefer acidic environment, and can grow and produce spores in the pH range of 3-12, especially in the Peberdy medium with pH 3-4 (Xu Ming, Li Haitao, Zhang Zijun, Zou Qingdao. (2009). Study on the biological characteristics of the pathogen of tomato gray mold. Guizhou Agricultural Sciences, 37(3), 4.; Zhu Baocheng, Zhou Yujun. (1994). Culture, toxin extraction and bioassay of strawberry gray mold. Plant Pathology Report, 24(3), 5.).

[0112] The pH value range for the growth of Alternaria solani, which causes early blight of potato, tomato, pepper, eggplant, tobacco and other plants, is 3.7-8.7 (Xiao Yuyu, et al. Study on the biological characteristics of tomato early blight fungus, Jiangsu Journal of Agricultural Sciences, 2010, No. 3).

[0113] The pH value range for the growth of Exserohilum turcicum is 3-11 (Chen Xuefei. Study on the biological characteristics and spatiotemporal dynamics of Exserohilum turcicum in Ya'an region [J]. Sichuan Agricultural University, 2013.); the pH value range for the growth of Bipolaria maydis is 3-11 (Xie Honghui, Study on the biological characteristics of Bipolaria maydis, Guangxi Tropical Agriculture, 2010, No. 6); the optimal pH value range for the growth of Verticillium dahliae is 5.0-5.5, and the growth condition is good at pH 3.6 (Zhu Jianlan, Chang Yongyi. Identification of the pathogen of eggplant verticillium wilt in Lanzhou region [J]. Journal of Gansu Agricultural University, 2004, 39(5): 5.).

[0114] Therefore, the common plant fungal pathogens described above are all resistant to acidic environment and can grow in acidic soil environment. The acidic soil environment usually affects the growth and metabolism of microorganisms, thereby weakening the control effect of conventional microbial inoculants or biocontrol agents. The Trichoderma asperellum provided in the present application can maintain high growth activity in acidic environment, and has excellent pathogenic bacteria inhibition performance in acidic environment.

[0115] In some embodiments, the plant disease includes, but is not limited to, at least one of anthracnose, damping-off, foot rot, fusarium wilt, head rot, root rot, stem rot, scab, bunt, blight, gray mold, blight, blast, early blight, late blight, downy mildew, verticillium wilt, large patch, small patch, sheath blight, leaf scorch, bacterial wilt, damping-off, black shank, black sigatoka, and the like.

[0116] In some embodiments, the plant disease includes at least one of anthracnose caused by Colletotrichum spp., damping-off caused by Fusarium spp., head rot, root rot, stem rot, scab, bunt, blight, and damping-off caused by Rhizoctonia solani.

[0117] In some embodiments, the nematode includes, but is not limited to, one or more of Meloidogyne spp. and Caenorhabditis elegans. In other embodiments, the Meloidogyne spp. includes, but is not limited to, one or more of M. incognita, M. hapla, M. arenaria, and M. javanica.

[0118] In some embodiments, the insect includes, but is not limited to, one or more of insects in the order Orthoptera, Isoptera (e.g., termites), Hemiptera (e.g., stink bugs), Homoptera, Thysanoptera (e.g., thrips), Coleoptera (e.g., beetles), Lepidoptera (e.g., moths or butterflies), Diptera, and Hymenoptera (e.g., bees).

[0119] In addition, in other embodiments, the plant disease can also include a plant disease caused by mites. The mites include, but are not limited to, one or more of Tetranychidae, Tenuipalpidae, Eriophyidae, and Acaridae.

[0120] In some embodiments, the plant includes a plant in the field of agriculture, forestry, and the like. Preferably, the plant includes, but is not limited to, a food crop, an economic crop, and the like.

[0121] In some embodiments, the food crops include, but are not limited to, at least one of a cereal crop, a tuber crop, a legume crop, or a leafy vegetable, etc. In some embodiments, the cereal crops include, but are not limited to, at least one of the following Gramineae crops: rice, wheat, corn, barley, oat, rye, sorghum, millet, proso millet, foxtail millet, buckwheat, etc. In some embodiments, the tuber crops include, but are not limited to, at least one of the following: sweet potato, yam, potato, etc. In some embodiments, the legume crops include, but are not limited to, at least one of the following: soybean, broad bean, pea, mung bean, peanut, etc.

[0122] In some embodiments, the economic crops include, but are not limited to, at least one of the following economic crops: Solanaceae, Rosaceae, Rutaceae, Musaceae, Cucurbitaceae, Brassicaceae, Orchidaceae, Papilionaceae, Asteraceae, Liliaceae, Zingiberaceae, Passifloraceae, Bromeliaceae, Araliaceae, Cactaceae, Umbelliferae, Vitaceae, Actinidaceae, etc.

[0123] In some embodiments, the Solanaceae plants include, but are not limited to, tomato, pepper, potato, eggplant, etc. In some embodiments, the Rosaceae plants include, but are not limited to, strawberry, papaya, etc. Preferably, the Rutaceae plants include, but are not limited to, citrus, etc. In some embodiments, the Musaceae plants include, but are not limited to, banana, etc. In some embodiments, the Cucurbitaceae plants include, but are not limited to, cucumber, wax gourd, pumpkin, balsam pear, sponge gourd, watermelon, monk fruit, etc. In some embodiments, the Brassicaceae plants include, but are not limited to, Chinese cabbage, rape, cabbage, radish, cauliflower, etc. In some embodiments, the Orchidaceae plants include, but are not limited to, orchid, etc. In some embodiments, the Papilionaceae plants include, but are not limited to, soybean, etc. In some embodiments, the Asteraceae plants include, but are not limited to, lettuce, etc. In some embodiments, the Liliaceae plants include, but are not limited to, garlic, etc. In some embodiments, the Zingiberaceae plants include, but are not limited to, ginger, etc. In some embodiments, the Passifloraceae plants include, but are not limited to, passion fruit, etc. In some embodiments, the Bromeliaceae plants include, but are not limited to, pineapple, etc. In some embodiments, the Araliaceae plants include, but are not limited to, Panax notoginseng, etc. In some embodiments, the Cactaceae plants include, but are not limited to, dragon fruit, etc. In some embodiments, the Umbelliferae plants include, but are not limited to, carrot, etc. In some embodiments, the Vitaceae plants include, but are not limited to, grape, etc. In some embodiments, the Actinidaceae plants include, but are not limited to, kiwifruit, etc.

[0124] In some embodiments, the plants include plants at various stages, including plants at the seed germination stage, seedling growth stage, strong seedling development stage, mature seedling flowering stage, and seed formation stage, so the plants in the embodiments of the present application include not only seedlings, but also plants after growth and development.

[0125] In addition, the plant in the embodiments of the present application also includes plant tissues and plant organs. In some embodiments, the plant tissues include, but are not limited to, meristematic tissues, protective tissues, fundamental tissues, and transport tissues, etc. In some embodiments, the plant organs include, but are not limited to, roots, stems, leaves, flowers, fruits, and seeds.

[0126] In some embodiments, the soil environment is an acidic soil environment.

[0127] In some embodiments, the plant disease includes a disease caused by a pathogenic bacterium in the soil.

[0128] In some embodiments, the pathogenic bacterium includes a pathogenic bacterium that can survive in an environment with pH≤8, for example, a pathogenic bacterium that can survive in an environment with pH=7, pH=6, pH=5, pH=4, pH=3, pH=2, pH=1.

[0129] In some embodiments, the pathogenic bacterium includes a pathogenic bacterium that can survive in an environment with pH≤7.

[0130] In some embodiments, the pathogenic bacterium includes a pathogenic bacterium that can survive in an environment with pH≤5.

[0131] In some embodiments, the pathogenic bacterium includes a pathogenic bacterium that can survive in an environment with pH≤3.

[0132] In some embodiments, the pathogenic bacterium includes a pathogenic bacterium that can survive in an environment with pH=1-8.

[0133] In some embodiments, the pathogenic bacterium includes a pathogenic bacterium that can survive in an environment with pH=3-7.

[0134] In some embodiments, the pathogenic bacterium includes a pathogenic bacterium that can survive in an environment with pH=4-6.

[0135] In some embodiments, the pathogenic bacterium includes a pathogenic bacterium that can survive in an environment with pH=3-5.

[0136] In some embodiments, the pathogenic bacterium includes a pathogenic bacterium that can survive in an environment with pH=5-7.

[0137] Another aspect of the embodiments of the present application also provides a method for preparing a fermentation broth of Trichoderma asperellum, which includes the following steps: first, activating culture of Trichoderma asperellum, and then fermentation culture.

[0138] In some embodiments, the activation culture is performed on a solid culture medium.

[0139] In some embodiments, the fermentation culture is performed in a liquid culture medium.

[0140] In some embodiments, the solid medium used in the activation culture can use conventional medium for fungal culture, for example, can be PDA (potato dextrose agar medium), PSA (potato sucrose agar medium), CDA (Chapeau's medium), high salt Chapeau's medium, SDA (Sabouraud dextrose agar medium), etc. The above-mentioned media are conventional fungal culture media in research and industry.

[0141] In some embodiments, the activation culture uses PDA medium, which includes potato, glucose and agar. For example, 200 grams of potato, 20 grams of glucose and 15 grams of agar are added to 1 liter of water.

[0142] In some embodiments, the fermentation culture can use conventional medium for fungal fermentation culture, for example, can be SDB (liquid Sabouraud dextrose medium), PDB (potato dextrose broth), steamed rice seed medium, etc., and the liquid form of the above-mentioned solid medium. The above-mentioned media are conventional fungal culture media in research and industry.

[0143] In some embodiments, the fermentation culture uses steamed rice seed medium. The steamed rice seed medium includes steamed rice and water in a mass ratio of 5:4.

[0144] In some embodiments, the activation culture is carried out at 20-30°C for 1-7 days, for example, can be 1, 2, 3, 4, 5, 6, 7 days.

[0145] In some embodiments, the fermentation culture is carried out at 20-30°C for 1-7 days, for example, can be 1, 2, 3, 4, 5, 6, 7 days.

[0146] In another aspect of the embodiments of the present application, a method for preventing and treating plant diseases and / or promoting plant growth is provided, which comprises applying Trichoderma asperellum, or microbial inoculant, or microbial fungicide, or microbial fertilizer, or microbial pesticide, or biological stimulant, or composition to plants.

[0147] In some embodiments, the application site of the plant includes plant tissue, plant organ or seed.

[0148] In some embodiments, the application method includes at least one of root soaking, leaf spraying, spraying, composting, seed soaking, coating, field flooding, drip irrigation of plants, etc.

[0149] In some embodiments, the plant disease includes plant replant disease, plant bacterial disease, plant fungal disease, plant viral disease, plant soil-borne disease, plant oomycete disease, etc.

[0150] In some embodiments, the plant disease is caused by one or more of a plant bacterial pathogen, a plant fungal pathogen, a virus, an insect, an insect egg, and a nematode.

[0151] In some embodiments, the plant bacterial pathogen described above includes, but is not limited to, at least one of Streptomyces scabies, Ralstonia solanacearum, Bacillus subtilis, Pseudomonas syringae pv. actinidiae, Xanthomonas campestris pv. Oryzae, Erwinia aroideae, Xanthomonas arboricola pv. juglandis, Erwinia carotovora, and Staphylococcus aureus.

[0152] In some embodiments, the plant fungal pathogen includes, but is not limited to, at least one of Athelia rolfsii (sclerotium rolfsii sexual stage), Sclerotium rolfsii, Colletotrichum capsici, Colletotrichum gloeosporioides, Glomerella cingulata, Fusarium commune, Fusarium oxysporum, Fusarium graminearum, Rhizoctonia solani, Sclerotinia sclerotiorum, Phytophthora infestans, Phytophthora capsici, Phytophthora nicotianae, Botrytis cirerea, Gaeumannomyces critici, Valsa mali Miyabe et Yamada, Valsa ceratosperma (Tode et Fr.) Maire, Pyricularia grisea, Alternaria solani, Exserohilum turcicum, Bipolaria maydis, Verticillium dahliae, and Verticillium albo-atrum.

[0153] In some embodiments, the plant disease includes, but is not limited to, at least one of scab, bacterial wilt, damping-off, black tusk, black suture disease, and the like.

[0154] In some embodiments, the nematode includes, but is not limited to, one or more of Meloidogyne spp. and Caenorhabditis elegans. In other embodiments, the Meloidogyne spp. includes, but is not limited to, one or more of M. incognita, M. hapla, M. arenaria, and M. javanica.

[0155] In some embodiments, the insect includes, but is not limited to, insects of the order Orthoptera, Isoptera (e.g., termites), Hemiptera (e.g., stink bugs), Homoptera, Thysanoptera (e.g., thrips), Coleoptera (e.g., beetles), Lepidoptera (e.g., moths or butterflies), Diptera and Hymenoptera (e.g., bees), and the like.

[0156] In addition, in other embodiments, the plant disease can also include plant diseases caused by mites. The mites include, but are not limited to, mites of the family Tetranychidae, Lardidae, Eriophyidae, Acaridae, and the like.

[0157] In some embodiments, the plant includes plants in the fields of agriculture, forestry, and the like. Preferably, the plant includes, but is not limited to, food crops, economic crops, and the like.

[0158] In some embodiments, the food crop includes, but is not limited to, at least one of a cereal crop, a tuber crop, a legume crop, or a leafy vegetable, and the like. In some embodiments, the cereal crop includes, but is not limited to, at least one of the following Gramineae crops: rice, wheat, corn, barley, oat, rye, sorghum, millet, foxtail millet, barnyard millet, buckwheat, and the like. In some embodiments, the tuber crop includes, but is not limited to, at least one of the following: sweet potato, yam, potato, and the like. In some embodiments, the legume crop includes, but is not limited to, at least one of the following: soybean, broad bean, pea, mung bean, peanut, and the like.

[0159] In some embodiments, the economic crop includes, but is not limited to, at least one of the following economic crops: Solanaceae, Rosaceae, Rutaceae, Musaceae, Cucurbitaceae, Brassicaceae, Orchidaceae, Papilionaceae, Asteraceae, Liliaceae, Zingiberaceae, Passifloraceae, Bromeliaceae, Araliaceae, Cactaceae, Umbelliferae, Vitaceae, Actinidaceae, and the like.

[0160] In some embodiments, the Solanaceae plants include, but are not limited to, tomato, pepper, potato, eggplant, and the like. In some embodiments, the Rosaceae plants include, but are not limited to, strawberry, papaya, and the like. Preferably, the Rutaceae plants include, but are not limited to, citrus and the like. In some embodiments, the Musaceae plants include, but are not limited to, banana and the like. In some embodiments, the Cucurbitaceae plants include, but are not limited to, cucumber, wax gourd, pumpkin, bitter gourd, sponge gourd, watermelon, momordica grosvenori, and the like. In some embodiments, the Brassicaceae plants include, but are not limited to, Chinese cabbage, rape, cabbage, radish, cauliflower, and the like. In some embodiments, the Orchidaceae plants include, but are not limited to, orchid and the like. In some embodiments, the Fabaceae plants include, but are not limited to, soybean and the like. In some embodiments, the Asteraceae plants include, but are not limited to, lettuce and the like. In some embodiments, the Liliaceae plants include, but are not limited to, garlic and the like. In some embodiments, the Zingiberaceae plants include, but are not limited to, ginger and the like. In some embodiments, the Passifloraceae plants include, but are not limited to, passion fruit and the like. In some embodiments, the Bromeliaceae plants include, but are not limited to, pineapple and the like. In some embodiments, the Araliaceae plants include, but are not limited to, panax notoginseng, ginseng, and the like. In some embodiments, the Cactaceae plants include, but are not limited to, dragon fruit and the like. In some embodiments, the Apiaceae plants include, but are not limited to, carrot and the like. In some embodiments, the Vitaceae plants include, but are not limited to, grape and the like. In some embodiments, the Actinidaceae plants include, but are not limited to, kiwifruit and the like.

[0161] In some embodiments, the plants include plants at various stages, including plants at the seed germination stage, seedling growth stage, strong seedling development stage, adult seedling flowering stage, and seed formation stage, so the plants in the embodiments of the present application include not only seedlings but also plants after growth and development.

[0162] In addition, the plants in the embodiments of the present application also include plant tissues and plant organs. In some embodiments, the plant tissues include, but are not limited to, meristematic tissue, protective tissue, fundamental tissue, and transport tissue. In some embodiments, the plant organs include, but are not limited to, roots, stems, leaves, flowers, fruits, and seeds.

[0163] In some embodiments, the plant diseases include plant diseases in an environment with pH≤8, for example, plant diseases in an environment with pH=7, pH=6, pH=5, pH=4, pH=3, pH=2, pH=1.

[0164] In some embodiments, the plant diseases include plant diseases in an environment with pH≤7.

[0165] In some embodiments, the plant diseases include plant diseases in an environment with pH≤5.

[0166] In some embodiments, the plant diseases include plant diseases in an environment with pH≤3.

[0167] In some embodiments, the plant disease includes a plant disease in an environment with pH = 1-8.

[0168] In some embodiments, the plant disease includes a plant disease in an environment with pH = 3-7.

[0169] In some embodiments, the plant disease includes a plant disease in an environment with pH = 4-6.

[0170] In some embodiments, the environment includes a soil environment.

[0171] The technical scheme of the embodiments of the present application has the following advantages:

[0172] The Trichoderma asperellum TA727 is preserved in the Guangdong Microbial Culture Collection Center, and the preservation number is GDMCC NO.63859. The Trichoderma asperellum, the inactivator thereof, the culture thereof, the metabolite thereof, the volatile thereof, and the extract thereof have the effect of inhibiting pathogenic bacteria, especially under acidic conditions, not only have a good growth rate, but also have a better inhibitory effect on some pathogenic bacteria, thereby effectively preventing and treating pathogenic bacteria and plant diseases including soil-borne diseases under acidic environmental conditions, and in addition, can facilitate industrial production and have a broad application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0173] Figure 1 : Plate colony morphology of Trichoderma asperellum TA727

[0174] Figure 2 : Spore production test of Trichoderma asperellum TA727 DETAILED DESCRIPTION

[0175] The following examples are provided to better further understand the present application and are not limited to the best mode of the present application, and do not constitute a limitation on the content and protection scope of the present application. Any person under the inspiration of the present application or the combination of the present application with other prior art features can obtain any product identical or similar to the present application, which falls within the protection scope of the present application.

[0176] The specific experimental steps or conditions not mentioned in the examples can be performed according to the conventional experimental steps described in the literature in the art or the operation or conditions. The reagents or instruments not mentioned by the manufacturer are conventional reagent products that can be obtained by market purchase.

[0177] Example 1: Screening and identification of Trichoderma asperellum TA727 strain

[0178] Screening of TA727 strain:

[0179] Trichoderma asperellum TA727 was isolated from the agricultural soil collected from mulberry planting land in Fucheng District, Mianyang City, Sichuan Province (North Latitude 31°20'37.87'', East Longitude 104°38'59.89'').

[0180] 5 g of soil was weighed, 45 mL of sterile water was added, and then the mixture was shaken for 5 min using a vortex shaker, and then gradient dilution was performed to obtain 10 -1 ~10 -4 Then, plate coating was performed, and the mixture was coated on PDA solid medium (including 200 g of potato, 20 g of glucose, 15 g of agar, and 1 L of water), three repeats were performed for each coating, and the mixture was cultured in an inverted manner in a 28 °C constant temperature incubator for 4 days. After 4 days, single colony strains were picked and streaked on new PDA plates, and the plates were cultured at 28 °C for 4 days. Strain TA727 and its pure culture were obtained, and the mixture was stored in a glycerol tube in a -80 °C refrigerator.

[0181] Identification of TA727 strain:

[0182] The ITS sequence fragment of the strain was determined, and the sequence of the amplification primer was as follows:

[0183] ITS4: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO. 2)

[0184] ITS5: 5'-GGAAGTAAAAGTCGTAACAAGG-3' (SEQ ID NO. 3).

[0185] The determination results are as follows:

[0186] CCGGAAATGGGGGACGCGGAGGGACATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTATTTCTTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGATCGGCGTTGGGGATCGGGACCCCTCACACGGGTGCCGGCCCCTAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA (SEQ ID NO. 1).

[0187] By BLAST homologous alignment, the strain was determined to be Trichoderma asperellum, named Trichoderma asperellum TA727. The strain was sent to the Guangdong Microbial Culture Collection Center (GDMCC) for preservation, the preservation address: No. 59 Building, 5th Floor, Guangzhou Xianlie Middle Road 100 Courtyard, the preservation date: October 07, 2023, the preservation number: GDMCC NO. 63859, and the preservation name was Trichoderma asperellum MN12721.

[0188] Example 2 Spore production capacity test of Trichoderma asperellum TA727 strain

[0189] The TA727 strain was activated on PDA medium: the strain stored in a-80°C refrigerator was inoculated on PDA solid medium for activation, and cultured in a 28°C constant temperature incubator for 5-7 days to full plate with green spores.

[0190] The spores on the surface of the culture medium were washed with 1‰ sterilized Tween water, and the spore number was adjusted to 1-2.5 × 10 7 The spore number was adjusted to 1-2.5 × 10

[0191] The results showed that the spore yield of Trichoderma asperellum TA727 could reach 11.7 billion spores / mL at 7d, and the spore yield was good, and the production potential was good.

[0192] Example 3 Evaluation of the acid tolerance of Trichoderma asperellum TA727 strain

[0193] After high temperature and high pressure sterilization, the PDA medium was cooled to about 60 ℃, and the pH value of the medium was adjusted to 3, 5, 7 with 1 mol / L HCl or NaOH sterile solution, and the plate was prepared for use. A 5 mm diameter agar cake was taken from the edge of the activated strain in Example 2 and inoculated in the center of the different pH value medium, repeated 3 times, and cultured at 25-28 ℃. When the culture was 48 h, the colony diameter was measured and recorded, and the change of the colony diameter with time was used to represent the growth rate.

[0194] The results are shown in the table below. The growth rate of Trichoderma asperellum TA727 on neutral PDA plate was 1.32 cm / d, and the growth rate on pH 5 PDA plate was the fastest, reaching 2.22 cm / d. In other words, the growth was not inhibited in weak acid environment, but was improved by a large margin. The growth rate of Trichoderma asperellum TA727 on pH 3 plate was basically the same as that on pH 7 plate, indicating that the strain could adapt to acidic environment well and grow rapidly in a wide pH range, and had the function of soil colonization and pathogen inhibition in a wide pH range.

[0195] Table 1: Growth rate of Trichoderma asperellum TA727 on different pH value medium

[0196] pH value 3 5 7 Growth rate of colony diameter (cm / d) 1.31 2.22 1.32

[0197] Example 4 Evaluation of the acid tolerance of Trichoderma asperellum TA727 strain

[0198] Rhizoctonia solani (hereinafter abbreviated as R.s, isolated from cotton diseased plants), Fusarium commune (hereinafter abbreviated as F.c, isolated from strawberry diseased plants), Fusarium oxysporum (hereinafter abbreviated as F.o, isolated from watermelon diseased plants) and Colletotrichum gloeosporioides (hereinafter abbreviated as C.g, isolated from strawberry diseased plants) were used as test pathogenic fungi.

[0199] A 5 mm diameter agar plug was taken from the edge of the 3 d activated pathogenic fungus colony and placed in the center of one side of a PDA plate with pH 3.0, pH 5.0, pH 7.0; and a 5 mm diameter agar plug was taken from the edge of the 3 d activated TA727 strain colony and placed in the center of the other side of the PDA plate with pH 3.0, pH 5.0, pH 7.0, so that the line connecting the centers of the pathogenic fungus and the TA727 strain passed through the center of the plate, and incubated at 28°C for 10 d, with 5 replicates for each, as the experimental group.

[0200] A 5 mm diameter agar plug was taken from the edge of the 3 d activated pathogenic fungus colony and placed in the center of one side of a PDA plate with pH 3.0, pH 5.0, pH 7.0; and a 5 mm diameter agar plug was taken from the edge of the 3 d activated TA727 strain colony and placed in the center of the other side of the PDA plate with pH 3.0, pH 5.0, pH 7.0, so that the line connecting the centers of the pathogenic fungus and the TA727 strain passed through the center of the plate, and incubated at 28°C for 10 d, with 5 replicates for each, as the experimental group.

[0201] After inoculation, the plates were incubated upside down, and the pathogenic fungus diameter was measured every 24 h, and the inhibition rate was calculated according to the following formula:

[0202] .

[0203] The results are shown in the following table.

[0204]

[0205] Table 2. Inhibition effect of TA727 on pathogenic fungi at different pH

[0206] Under the condition of pH 7.0, after 10 d of growth, the inhibition rate of the TA727 strain on C. gloeosporioides was the highest, reaching 63.43%, and the inhibition effect did not decrease under the condition of pH 5.0, and slightly decreased under the condition of pH 3.0, but was still as high as 55.49%. The inhibition rates of the TA727 strain on R.solani and F.commune under acidic conditions were higher than those under neutral conditions. It was shown that the Trichoderma asperellum TA727 had good effect on inhibiting pathogenic fungi under acidic conditions.

[0207] Example 5 Evaluation of the antibacterial ability of volatile substances of Trichoderma asperellum TA727 strain

[0208] A 5 mm diameter mycelial block was inoculated on the edge of an activated TA727 colony on a PDA plate (pH = 7), and cultured until the colony diameter reached 35 mm. Then, the PDA plate was paired with a 2-day-old Rhizoctonia solani (Rhizoctonia solani on top, Trichoderma asperellum TA727 on the bottom), and a blank PDA plate was paired with a Rhizoctonia solani PDA plate inoculated under the same conditions as the control. Each treatment was repeated 3 times, and incubated at 28°C.

[0209] When the control Rhizoctonia solani colony covered the entire Petri dish, the cross-intersection method was used to measure and record the control growth (colony diameter) and treatment growth (colony diameter) of Rhizoctonia solani, and calculate the antibacterial rate:

[0210] .

[0211] The calculated antibacterial rate of the volatile substances of the TA727 strain against R. solani was 36.08%, indicating that the volatile substances of the strain had a good inhibitory effect on the growth of Rhizoctonia solani.

[0212] In summary, the Trichoderma asperellum TA727 of the present application not only grows well in an acidic environment, but also does not reduce the inhibitory effect on pathogenic bacteria under acidic conditions, and its volatile substances also have an antibacterial effect. It has a good inhibitory effect on pathogenic bacteria and is easy to industrialize, and has a broad application prospect.

[0213] Obviously, the above examples are only examples for clarity, and do not limit the embodiments. For those skilled in the art, other different forms of changes or variations can be made on the basis of the above description. Here, it is not necessary and impossible to exhaust all embodiments. The obvious changes or variations derived therefrom are still within the protection scope of the present application.

Claims

1. A Trichoderma asperellum characterized in that it is characterized in that, For any one of the following A1)~A4): A1) a strain whose ITS sequence is at least 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to the sequence set forth in SEQ ID NO. 1; A2) Trichoderma asperellum TA727, deposited in Guangdong Microbial Culture Collection Center, with the accession number of GDMCC No. 63859; A3) a strain whose ITS sequence is at least 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% or 100% identical to the ITS sequence of the strain of A2); A4) a strain whose genome has at least 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% average nucleotide identity to the genome of any one of the strains of A1)~A3).

2. Use of the Trichoderma asperellum of claim 1 in the preparation of a product having the function of inhibiting pathogenic bacteria. Preferably, the inhibiting pathogenic bacteria comprises inhibiting pathogenic bacteria surviving in an environment with pH≤8. Preferably, the inhibiting pathogenic bacteria comprises inhibiting pathogenic bacteria surviving in an environment with pH≤7. Preferably, the inhibiting pathogenic bacteria comprises inhibiting pathogenic bacteria surviving in an environment with pH≤5. Preferably, the inhibiting pathogenic bacteria comprises inhibiting pathogenic bacteria surviving in an environment with pH≤3. Preferably, the inhibiting pathogenic bacteria comprises inhibiting pathogenic bacteria surviving in an environment with 3≤pH≤5, 5≤pH≤7, 3≤pH≤7. Preferably, the environment comprises a soil environment. Preferably, the pathogenic bacteria comprises fungi. Preferably, the pathogenic bacteria comprises fungi of Ascomycota, Basidiomycota, and Deuteromycota. Preferably, the pathogenic bacteria comprises at least one of the fungi of Coelomycetes, Sclerosporae, Sphaeropsidales, Taphrinales, and Pyronematales. Preferably, the pathogenic bacteria comprises at least one of the fungi of Melanopsaceae, Lecanorales, Sphaeropsidaceae, Taphrinales, and Pyronematales. ​ Preferably, the pathogenic fungi comprise at least one of Sclerotium, Colletotrichum, Fusarium, Rhizoctonia, Sclerotinia, Phytophthora, Botrytis, Gaeumannomyces, Glomerella, Valsa, Pyricularia, Alternaria, Exserohilum, Bipolaria, Verticillium; Preferably, the pathogenic fungi comprise at least one of Athelia rolfsii, Sclerotium rolfsii, Colletotrichum capsici, Colletotrichum gloeosporioides, Glomerella cingulata, Fusarium commune, Fusarium oxysporum, Fusarium graminearum, Rhizoctonia solani, Sclerotinia sclerotiorum, Phytophthora infestans, Phytophthora capsici, Phytophthora nicotianae, Botrytis cirerea, Gaeumannomyces critici, Valsa mali Miyabe et Yamada, Valsa ceratosperma (Tode et Fr.) Maire, Pyricularia grisea, Alternaria solani, Exserohilum turcicum, Bipolaria maydis, Verticillium dahliae, Verticillium albo-atrum.

3. A microbial inoculant, characterized in that, comprise at least one of the following B1) to B6): B1) the Trichoderma asperellum of claim 1; B2) an inactivated form of B1); B3) a culture of B1); B4) a metabolite of B1); B5) a volatile of B1); B6) an extract of at least one of B1) - B5).

4. A microbicide or a microbial fertilizer or a microbial pesticide or a bio-stimulant, characterized in that, comprising at least one of B1) - B6): B1) Trichoderma asperellum as claimed in claim 1; B2) an inactivated form of B1); B3) a culture of B1); B4) a metabolite of B1); B5) a volatile of B1); B6) an extract of at least one of B1) - B5). Preferably, the pathogenic fungi against which the fungicide is directed comprise fungi of the subphylum Ascomycotina, Basidiomycotina, Deuteromycotina; Preferably, the pathogenic fungi comprise at least one of the fungi of the classes Fungi Imperfecti, Ascomycetes, Basidiomycetes; Preferably, the pathogenic fungi comprise at least one of the fungi of the classes Fungi Imperfecti, Ascomycetes, Basidiomycetes; Preferably, the pathogenic fungi comprise at least one of the fungi of the orders Diaporthales, Moniliales, Sphaeropsidales, Tulasnellales, Valsales, Pyriculariales, Cucumisales, Alternariales; Preferably, the pathogenic fungi comprise at least one of the fungi of the families Diaporthe, Gnomoniaceae, Gnomoniaceae, Valsaceae, Pyricularia, Cucumis, Alternaria, Exserohilum, Bipolaria, Verticillium; Preferably, the pathogenic fungi comprise at least one of the fungi of the genera Sclerotium, Colletotrichum, Fusarium, Rhizoctonia, Sclerotinia, Phytophthora, Botrytis, Gaeumannomyces, Glomerella, Valsa, Pyricularia, Alternaria, Exserohilum, Bipolaria, Verticillium. Preferably, the pathogenic fungi include at least one of Athelia rolfsii (the sexual stage of Sclerotium rolfsii), Sclerotium rolfsii, Colletotrichum capsici, Colletotrichum gloeosporioides, Glomerella cingulata, Fusarium commune, Fusarium oxysporum, Fusarium graminearum, Rhizoctonia solani, Sclerotinia sclerotiorum, Phytophthora infestans, Phytophthora capsici, Phytophthora nicotianae, Botrytis cirerea, Gaeumannomyces critici, Valsa mali Miyabe et Yamada, Valsa ceratosperma (Tode et Fr.) Maire, Pyricularia grisea, Alternaria solani, Exserohilum turcicum, Bipolaria maydis, Verticillium dahliae, Verticillium albo-atrum; Preferably, the host of the pathogenic fungi comprises a plant; Preferably, the plant is selected from at least one of a food crop, an economic crop; Preferably, the food crop is selected from at least one of a cereal crop, a tuber crop, a legume crop, or a leafy vegetable; Preferably, the cereal crop comprises at least one of the following Gramineae crops: rice, wheat, corn, barley, oat, rye, sorghum, millet, proso millet, foxtail millet, buckwheat; preferably, the tuber crop comprises at least one of sweet potato, yam, potato; preferably, the legume crop comprises at least one of soybean, broad bean, pea, mung bean, peanut; Preferably, the plant is selected from at least one of a food crop, an economic crop; Preferably, the food crop is selected from at least one of a cereal crop, a tuber crop, a legume crop, or a leafy vegetable; Preferably, the cereal crop comprises at least one of the following Gramineae crops: rice, wheat, corn, barley, oat, rye, sorghum, millet, proso millet, foxtail millet, buckwheat; preferably, the tuber crop comprises at least one of sweet potato, yam, potato; preferably, the legume crop comprises at least one of soybean, broad bean, pea, mung bean, peanut; Preferably, the economic crops comprise at least one economic crop selected from the group consisting of Solanaceae plants, Rosaceae plants, Rutaceae plants, Musaceae plants, Cucurbitaceae plants, Brassicaceae plants, Orchidaceae plants, Leguminosae plants, Asteraceae plants, Liliaceae plants, Zingiberaceae plants, Passifloraceae plants, Bromeliaceae plants, Araliaceae plants, Cactaceae plants, Umbelliferae plants, Vitaceae plants, Actinidaceae plants; Preferably, the Solanaceae plants comprise at least one selected from the group consisting of tomatoes, peppers, potatoes, eggplants; preferably, the Rosaceae plants comprise at least one selected from the group consisting of strawberries, papayas; preferably, the Rutaceae plants comprise citrus; preferably, the Musaceae plants comprise bananas; preferably, the Cucurbitaceae plants comprise at least one selected from the group consisting of cucumbers, wax gourds, pumpkins, balsams, loofahs, watermelons, momordica grosvenori; preferably, the Brassicaceae plants comprise at least one selected from the group consisting of Chinese cabbages, oilseed rapes, cabbages, radishes, cauliflowers; preferably, the Orchidaceae plants comprise orchids; preferably, the Leguminosae plants comprise soybeans; preferably, the Asteraceae plants comprise lettuces; preferably, the Liliaceae plants comprise garlic; preferably, the Zingiberaceae plants comprise raw ginger, zingiber officinale; preferably, the Passifloraceae plants comprise passion fruits; preferably, the Bromeliaceae plants comprise pineapples; preferably, the Araliaceae plants comprise panax notoginseng, ginseng; preferably, the Cactaceae plants comprise dragon fruits; preferably, the Umbelliferae plants comprise carrots; preferably, the Vitaceae plants comprise grapes; preferably, the Actinidaceae plants comprise kiwis.

5. A composition characterized in that, The composition comprises at least one of B1)~B6) below: B1) the Trichoderma asperellum of claim 1; B2) an inactivant of B1); B3) a culture of B1); B4) a metabolite of B1); B5) a volatile of B1); B6) an extract of at least one of B1)~B5).

6. The composition of claim 5, wherein, The composition further comprises at least one of an additional active agent, an adjuvant.

7. The composition of claim 6, wherein, The additional active agent comprises one or more biological control agents, one or more chemical agents, one or more fertilizers, one or more herbicides, one or more growth promoters, or any combination thereof; Preferably, the biological control agents comprise at least one selected from the group consisting of microbial control agents, insect biological control agents, nematode biological control agents; Preferably, the microbial control agents comprise a strain of Burkholderia, Trichoderma, Bacillus, or any combination thereof, or a metabolite selected from Trichoderma, Bacillus, or any combination thereof, or a fermentation broth, a fermentation supernatant selected from Trichoderma, Bacillus, or any combination thereof. Preferably, the bacteria of the genus Bacillus comprise at least one of Bacilus velezensis, Bacilus subtilis, Bacilus pumilus, Bacilus coagulans, Paenibacillus polymyxa, Bacillus amyloliquefaciens; Preferably, the microbial control agent comprises at least one of Trichoderma harzianum, Purpureocillium lilacinum, Penicillium bilaiae, Bacillus subtilis, Burkholderia rinojensis, Bacillus pumilus, Bacillus velezensis, Methylobacterium rhodesianum, Methylobacterium extorquens, and Paenibacillus peoriae; Preferably, the Trichoderma harzianum is Trichoderma harzianum with the accession number of CGMCC NO. 15679; Preferably, the Purpureocillium lilacinum is Purpureocillium lilacinum with the accession number of CGMCC NO. 12773; Preferably, the Penicillium bilaiae is Penicillium bilaiae with the accession number of CGMCC NO. 12767; Preferably, the Bacillus subtilis is Bacillus subtilis with the accession number of CGMCC NO. 12908; Preferably, the Burkholderia rinojensis is Burkholderia rinojensis with the accession number of GDMCC NO. 61156; Preferably, the Bacillus pumilus is Bacillus pumilus with the accession number of GDMCC NO. 61962; Preferably, the Bacillus velezensis is Bacillus velezensis with the accession number of GDMCC NO. 61434; Preferably, the Methylobacterium rhodesianum is Methylobacterium rhodesianum with the accession number of GDMCC NO. 60729; Preferably, the Methylobacterium extorquens is Methylobacterium extorquens with the accession number of GDMCC NO. 62943; Preferably, the Paenibacillus peoriae is Paenibacillus peoriae with the accession number of GDMCC NO. 60482; Preferably, the adjuvant is selected from an agriculturally or horticulturally acceptable carrier, diluent, stabilizer, filler, humectant, colorant, solvent, co-solvent, film forming agent, self- promoting agent, emulsifying agent, dispersing agent, preservative, anti-freezing agent, thickening agent, adjuvant, or any combination thereof.

8. Use of the Trichoderma asperellum of claim 1, the microbial inoculant of claim 3, the microbial fungicide or microbial fertilizer or microbial pesticide or biological stimulant of claim 4, or the composition of any one of claims 5-7, in inhibiting pathogenic fungi in a soil environment, and / or, in controlling plant diseases and pests.

9. The use of claim 8, wherein, Preferably, the soil environment is an acidic soil environment; Preferably, the plant disease includes a disease caused by a pathogenic fungus in soil; Preferably, the pathogenic fungus includes a pathogenic fungus that survives in an environment with pH < 8; Preferably, the pathogenic fungus includes a pathogenic fungus that survives in an environment with pH < 7; Preferably, the pathogenic fungus includes a pathogenic fungus that survives in an environment with pH < 5; Preferably, the pathogenic fungus includes a pathogenic fungus that survives in an environment with pH < 3; Preferably, the inhibiting pathogenic fungus includes inhibiting a pathogenic fungus that survives in an environment with 3 < pH < 5, 5 < pH < 7, 3 < pH < 7; Preferably, the pathogenic fungus includes a fungus in subphylum Ascomycotina, subphylum Basidiomycotina, subphylum Deuteromycotina; Preferably, the pathogenic fungus includes at least one fungus in class Fungi Imperfecti, class Coelomycetes, class Hyphomycetes, class Sclerodermata, class Discomycetes, class Pyrenulata; Preferably, the pathogenic fungus includes at least one fungus in order Melanopsisi, order Moniliellales, order Acholeplasmatales, order Capnodiales, order Tulasnellales, order Pyrenulales; Preferably, the pathogenic fungus includes at least one fungus in family Melanopsisiaceae, family Gnomoniaceae, family Chaetothyriaceae, family Diaporthaceae, family Moniliellaceae, family Pyrenulaceae; Preferably, the pathogenic fungus includes at least one in genus Sclerotium, genus Colletotrichum, genus Fusarium, genus Rhizoctonia, genus Sclerotinia, genus Phytophthora, genus Botrytis, genus Gaeumannomyces, genus Glomerella, genus Valsa, genus Pyricularia, genus Alternaria, genus Exserohilum, genus Bipolaria, genus Verticillium. Preferably, the pathogenic fungi include at least one of Athelia rolfsii, Sclerotium rolfsii, Colletotrichum capsici, Colletotrichum gloeosporioides, Glomerella cingulata, Fusarium commune, Fusarium oxysporum, Fusarium graminearum, Rhizoctonia solani, Sclerotinia sclerotiorum, Phytophthora infestans, Phytophthora capsici, Phytophthora nicotianae, Botrytis cirerea, Gaeumannomyces critici, Valsa mali Miyabe et Yamada, Valsa ceratosperma (Tode et Fr.) Maire, Pyricularia grisea, Alternaria solani, Exserohilum turcicum, Bipolaria maydis, Verticillium dahliae, Verticillium albo-atrum; Preferably, the pathogenic fungi include at least one of Colletotrichum gloeosporioides, Fusarium commune, Fusarium oxysporum, Rhizoctonia solani; Preferably, the plant is selected from a food crop, an economic crop; Preferably, the food crop is selected from at least one of a cereal crop, a tuber crop, a legume crop, or a leafy vegetable; Preferably, the cereal crop includes at least one of the following Gramineae crops: rice, wheat, corn, barley, oat, rye, sorghum, millet, proso millet, foxtail millet, buckwheat; preferably, the tuber crop includes at least one of sweet potato, yam, potato; preferably, the legume crop includes at least one of soybean, broad bean, pea, mung bean, peanut; Preferably, the plant is selected from a food crop, an economic crop; Preferably, the food crop is selected from at least one of a cereal crop, a tuber crop, a legume crop, or a leafy vegetable; Preferably, the cereal crop includes at least one of the following Gramineae crops: rice, wheat, corn, barley, oat, rye, sorghum, millet, proso millet, foxtail millet, buckwheat; preferably, the tuber crop includes at least one of sweet potato, yam, potato; preferably, the legume crop includes at least one of soybean, broad bean, pea, mung bean, peanut; Preferably, the economic crops include at least one of the following: Solanaceae plants, Rosaceae plants, Rutaceae plants, Musaceae plants, Cucurbitaceae plants, Brassicaceae plants, Orchidaceae plants, Leguminosae plants, Asteraceae plants, Liliaceae plants, Zingiberaceae plants, Passifloraceae plants, Bromeliaceae plants, Araliaceae plants, Cactaceae plants, Umbelliferae plants, Vitaceae plants, Actinidaceae plants; Preferably, the Solanaceae plants include at least one of the following: tomatoes, peppers, potatoes, eggplants; preferably, the Rosaceae plants include at least one of the following: strawberries, papayas; preferably, the Rutaceae plants include citrus; preferably, the Musaceae plants include bananas; preferably, the Cucurbitaceae plants include at least one of the following: cucumbers, wax gourds, pumpkins, balsams, loofahs, watermelons, momordica grosvenori; preferably, the Brassicaceae plants include at least one of the following: Chinese cabbages, oilseed rapes, cabbages, radishes, cauliflowers; preferably, the Orchidaceae plants include orchids; preferably, the Leguminosae plants include soybeans; preferably, the Asteraceae plants include lettuces; preferably, the Liliaceae plants include garlic; preferably, the Zingiberaceae plants include ginger; preferably, the Passifloraceae plants include passion fruits; preferably, the Bromeliaceae plants include pineapples; preferably, the Araliaceae plants include panax notoginseng and ginseng; preferably, the Cactaceae plants include dragon fruits; preferably, the Umbelliferae plants include carrots; preferably, the Vitaceae plants include grapes; preferably, the Actinidaceae plants include kiwifruits.

10. A method for controlling plant diseases, and / or, promoting plant growth, characterized by, comprising applying to the plant the Trichoderma asperellum of claim 1, or the microbial inoculant of claim 3, or the microbial fungicide or microbial fertilizer or microbial pesticide or biological stimulant of claim 4, or the composition of any one of claims 5-7; Preferably, the plant diseases include at least one of the following: diseases caused by pathogenic bacteria in soil; Preferably, the plant diseases include at least one of the following: diseases caused by pathogenic bacteria in acidic soil; Preferably, the plant diseases include at least one of the following: anthracnose, damping-off, stem base rot, fusarium wilt, ear rot, root rot, stem rot, scab, bunt, blight, gray mold, blight, blast, early blight, late blight, downy mildew, wilt, large spot, small spot, sclerotium blight, sheath blight, scab, bacterial wilt, damping-off, black foot disease, black scurf disease, and the like; Preferably, the plant diseases include at least one of the following: anthracnose caused by Colletotrichum gloeosporioides, damping-off, ear rot, root rot, stem rot, scab, bunt caused by Fusarium, damping-off caused by Rhizoctonia solani.

Images