Mutant cell strain of ZNF717 L39V

Abstract

The invention relates to a mutant cell strain of ZNF717 L39V, which is characterized in that CTG is mutated into GTG, leucyl (L) at the 39th site is mutated into valine (V), and the mutation sequence of the valine (V) is GGTGTCCTTGAGGAGGTAGCTGCACCTCGGGAGGAGTGGCAGGATGATGCTCAG. The mutant cell strain of ZNF717 L39V is characterized in that CTG is mutated into GTG, leucyl (L) at the 39th site is mutated into valine (V), and the mutation sequence of the valine (V) is shown in the specification. According to the gRNA sequence of the ZNF717 L39V and the ssDNA donor sequence of the ZNF717 L39V, which are designed by the invention, a mutation sequence can be obtained, the mutation efficiency is high, and a mutation site and a base sequence after mutation can be accurately controlled.

Description

TECHNICAL FIELD

[0001] The application relates to a mutant cell strain of ZNF717 L39V. BACKGROUND

[0002] The CRISPR-Cas9 system is originally an immune mechanism found in bacteria, which is used to resist foreign viruses and plasmids. In gene editing, researchers design a single-stranded RNA guide molecule (SGRNA) complementary to the target DNA sequence, which is introduced into the target cell together with the Cas9 protein complex. The SGRNA guides Cas9 to locate the target DNA sequence and prompts Cas9 to cut the DNA double strand at the position. When the cell repairs the DNA break caused by cutting, mutations can be introduced, so as to realize the knockout, insertion or replacement of genes.

[0003] At present, some pathogenic gene mutations are a major direction of biomedical research for treating human diseases. The mutant cell strain of ZNF717 L39V is found in the existing pathogenic gene, but the current gene mutation is natural mutation or chemical mutagenesis, which has the defects of low mutation efficiency and no position specificity. In the mutation process, if an accurate sequence is designed, the mutation efficiency can be improved. SUMMARY

[0004] The technical problem to be solved by the application is to provide a mutant sequence of ZNF717 L39V, improve the mutation efficiency, and solve the problem of low mutation rate.

[0005] The technical solution for solving the above technical problem is a mutant cell strain of ZNF717 L39V, and the mutant sequence of ZNF717 L39V is that CTG is mutated into GTG and the leucine (L) at the 39th position is mutated into valine (V): GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGACGTGGATGATGCTCAG.

[0006] A further technical solution of the application is that the gRNA sequence of ZNF717 L39V is GGTAGCTGTGCACTTCACCT. The ssDNA donor sequence of ZNF717 L39V is: GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGACGTGGATGATGCTCAG.

[0007] A mutation method of ZNF717 L39V, comprising the following steps: Step A. Designing gRNA sequence of ZNF717 L39V The gRNA sequence of ZNF717 is as follows: GGTAGCTGTGCACTTCACCT; Designing gRNA sequence of ZNF717 near the mutation sequence, and synthesizing sgRNA top / bottom oligo. L39V

[0008] Step B. Constructing cas9-gRNA knockout vector; linking gRNA sequence of ZNF717 in step A to Cas9 vector to construct knockout vector. L39V

[0009] Step C. Designing ssDNA donor sequence of ZNF717 L39V The ssDNA donor sequence of ZNF717 is as follows: GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGACGTGGATGATGCTCAG; Step D. Transfecting SW403 cells with cas9-gRNA knockout vector and ssDNA donor sequence; introducing cas9-gRNA knockout vector in step B and ssDNA donor sequence of ZNF717 in step C into target cells, and replacing the obtained mutation sequence after; L39V Step E. Screening mutation sequence of ZNF717 The mutation sequence of ZNF717 obtained in step D is screened, that is, the mutation cell of ZNF717 L39V L39V

[0010] Due to the above technical scheme, the mutation cell strain of ZNF717 L39V has the following beneficial effects: Through the designed gRNA sequence of ZNF717 L39V and the ssDNA donor sequence of ZNF717 L39V , the mutation sequence can be obtained, the mutation efficiency is high, and the mutation site and the base sequence after mutation can be accurately controlled. ZFN can realize the knockout of target genes and the insertion of exogenous genes at specific sites in the genome, solve the problem of low mutation rate, and be beneficial to the research on diseases. DETAILED DESCRIPTION

[0011] ​​​​A mutant cell strain of ZNF717 L39V, the mutant sequence of ZNF717 L39V is that CTG is mutated into GTG, and the leucine (L) at the 39th position is mutated into valine (V): GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGACGTGGATGATGCTCAG.

[0012] ZNF717 L39V The gRNA sequence of ZNF717 is GGTAGCTGTGCACTTCACCT.

[0013] ZNF717 L39V The ssDNA donor sequence of ZNF717 is: GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGACGTGGATGATGCTCAG.

[0014] Selection of gRNA sequence: gRNA: GGTAGCTGTGCACTTCACCT ssDNA donor sequence: GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGAC GTG GATGATGCTCAG The bold underlined part is the mutation site, CTG is mutated into GTG.

[0015] A mutant sequence of ZNF717 L39V, comprising the following steps: Step A. Design the gRNA sequence of ZNF717 L39V The gRNA sequence of ZNF717 is: GGTAGCTGTGCACTTCACCT; Design the gRNA sequence of ZNF717 L39V near the mutant sequence, and synthesize sgRNA top / bottom oligo.

[0016] Step B. Construct a cas9-gRNA knockout vector; link the gRNA sequence of ZNF717 L39V in step A to the Cas9 vector to construct a knockout vector.

[0017] Step C. Design the ssDNA donor sequence of ZNF717 L39V The ssDNA donor sequence of ZNF717 is: GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGACGTGGATGATGCTCAG; Step D. Transfect SW403 cells with cas9-gRNA knockout vector and ssDNA donor sequence simultaneously; introduce cas9-gRNA knockout vector in step B and ZNF717 L39V ssDNA donor sequence in step C into target cells, and replace the resulting mutant sequence; Step E. Screen mutant cell lines of ZNF717 L39V In step D, the resulting mutant sequence is the mutant cell line of ZNF717 L39V .

[0018] The method for constructing the cas9-gRNA knockout vector in step B can be a conventional method for constructing a knockout vector. The method for constructing the cas9-gRNA knockout vector can be as follows: Method for constructing sgRNA-Cas9 plasmid: 1. Download the ZNF717 genomic sequence from the NCBI website and mark the mutation site; 2. Select 100 bp sequences upstream and downstream of the mutation site; 3. Use the sequences in step 2 above to design gRNA sequences at https: / / portals.broadinstitute.org / gppx / crispick / public, and design donor sequences according to the target sequence site, gRNA sequences and donor sequences are synthesized by Beijing Qikexing Biological Technology Co., Ltd.; 4. Prepare 100 μM sgRNA top / bottom oligo solution with ddH2O, and prepare the following reaction system: Component Amount (μl) sgRNA top (100 μM) 1 sgRNA bottom (100 μM) 1 ddH2O 8 5. Use a PCR instrument to anneal oligos according to the following program: 95 °C for 5 min; reduce to 25 °C at a rate of 5 °C / min; 12 °C hold; 6. Take 1 μL of the product obtained in step 4, and dilute 200 times with ddH2O; 7. Prepare the following reaction system: Component Amount (μl) px459 V2 (100 ng / μl) 1 Diluted oligo duplex from step (6) 1 T4 DNA ligase buffer 1 Bbs I endonuclease 0.5 T4 DNA ligase 0.5 ddH2O 6 8. Perform the following reaction on a PCR instrument:

[0019] 9. Transform the ligation product from the previous experiment into competent cells, pick positive clones for sequencing verification.

[0020] Nucleotide Sequence Listing: gtgcccctgg aggttggtgg cagtgtgacg gaggtgccgc gggcggtcgg ggacacgggg 60 cgagcacggc tgtcgctccg ctgaggggag cggaagggtc ggtgggtggg aaccgtccgg 120 gacgcggatg ccggctggtg aagcgccggt tggcctgtgg cttcagtgat tacttctcgg 180 aggaggcgcc ctctggaagg ccggccatag ctaccagaag tttcgtgaac tgggggtcga 240 ggcgggctaa cgtgtggaga actttggaca ggagaatctg ggatgtagga gcaagccagg 300 ccagtccttt catgactccg ctccattcac cttctcttcc agctctgttt ccagagtcct 360 ctgtgtgttt ctaagagcaa cggaaaatgg atacatcttt ggggttggtg tcatttgagg 420 atgtggctgt gcacttcacc tgggaggagt ggcaggacct ggatgatgcc cagaggaccc 480 tgtacaagga cgtgatgctg gagacctaca gtagcgcag ctcgctcctc ctcctcctcc 540 ccaaacctga ggtgattgtc aagttggagc aagacgcaga accgtggact gtagaagcac 600 ccccaaacca gagcctccca gatgtccaga ctgtgggtga cctgatggag accagccagg 660 AAAATTAACG GCAGACGTTT GTGGCAAGCT GTAATCACCA ACAGCAAACA TC A CT A AGG 720 AGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAGAAGAA GAAGAAGAAG AAGAAGAAGA AGAAGAAGAAGAAGAAG 720 TAATAGTGGG AACTGTTCA GGAATGAAGC CAGAGGAGTT TAATGCATTT GAGAACACAT 840 TTCTCCCTAG AGCGCCTGA TGAGATGCCT GCTGGAGAGA AAGCTGAGGA CTGTCTTGTG A 900 CCGGGGAAAT CCCTCAGATC TGCTGAGCAT CCTAGTCA TCCTCAGGAG ACTCAAAC TGTGC 960 AGCAGGCTTC TGCATTTAGT GGACGAGGAG AGGCTTCAAC AAGGAGGCA GTAGTCCTTA 1020 CACATAGGGC TCGCATGGGA GGC ACTGCCTGT AGATATAAT GGACACTGGC AAGCTTG TG 1080 ATGAGTCAGC TCTCATTGC CCAAGAGAGA CGTCACGTAG GGAGGATCGC GATCGATGT A 1140 ACGAATGGGG GAAGACC GTTTGTGA AACCAACAC AACTGAGTCT TCACAGAGCT GATT 1200 TCAAGGAGCA ACACCATAA TATATCAAAG TGGGAAATAT TT TAGCAAGAA CTTACAGC 1260 TC ACTCAGCG TC AGAGAATT C AGTTAGGAG AAAAAGCTTT CAATGT AATGT AGTGGTA 1320 AAACTTTCTA TAAGAAGTCT AATCTCACGA AACATCAGAG AACTCATACA GGGGAGAAAC 1380 cctatgcatg tgatgaatgt gggaaatcat tctaccagaa gccggctctc agtgtacatc 1440 agagaattca cagggagacg cctcatgaat gcagtggctg tggtaaaact ttccataaga 1500 agtcagctct cacggcacat cagagaactc acacaggaga aaaaccttat gaatgtaaag 1560 aatgtgggaa atcctttggc caccggccag ccctcactgt acatcagaga actcacacaa 1620 gagataaacc ttataaatgt aatgaatgtg ggaaatcctt ctgtgtgaaa ccaaaactca 1680 ctgtacatct gagacttcac acaggggaga aaccctatga atgtgaagaa tgcgggaaaa 1740 cattctacca gaagtcaaaa ctcactgtac accagagaac tcacacaggt gagaaacctt 1780 acaaatgtaa tgagtgtcgg aaaacctttt gtgagaagtc aaccctcaat agacatcaga 1860 gaactcacac aggagagaaa ccctatggat gtaaagaatg taggaaaact ttctatcaga 1920 agtcagccct cactgtacac cagagaactc acacgggaga gaagccctat gaatgtaatg 1980 aatgtggaaa aagcttttgc cagaagtcac acctcagcaa acatctgaga actcacacag 2040 ggcagaaatc atgtatggtg gagactggct atgtgtatgc caaaactcac tttctttttc 2100 tgttgggcac acagttagcc tgcgttctc agcctccttt gactatggt tggactatgt 2160 aactctggcc aggaatat gaacacaagt ggtgaacatt acttccaagg ctgactgcag 2220 aaatacttcc atgctcgggg ccggctttgt ggctgagtgg ttaagttcgc atgctccact 2280 ttggtggcct ggggttcact tgtttgatc ctggcatgg acctgcac tgctcgtga 2340 gccgtgctat ggaggcaccc caatagaag aactagaatg acttacaact aggtactggg 2400 gctttgggga gaaaaaaagg ggtggggggg agattggcaa cagatgttag ttcaggacca 2460 atcttcctca tcaaaaaaa aaaaaaaatgt atatatgctt ctagcaggg accagcctca 2520 tggcatagtg gttaagtttg gcatgctcca ttttggcagc cttggtttat gggttcagat 2580 cctgggcatg ggccacacc actcatcagc catgctgtgg tggcaaccca catataaagg 2640 gaggagatt ggcacagatg ttagctcagg gttaatctc ctcaagcgaa agaagtggaa 2700 ggttggcaac agatgttagc ttaagcta tctccctcgg caaaaagaa taaaaaaaat 2760 tcttcctctc tgacttgta ccctgtgtc ctgaggtca gattacccc aggttccct 2820 tgggagcata ggatgaatgt ggcaatcctg acttaagaca gaagggatgg aatggggaga 2880 gcagagatct tgccagctct acctaaaaaa atctccattt gtactcttca catgagtgag 2940 aaatatttat tgttgatccc ttccacgtgt gatctattta caacattacc agttcactgt 3000 agccggttca tttgatgaat ttggcacagc cttctgtgaa aagttatcag tccttgtgta 3060 gaaaattcct atgggaaaga acctgtgttg tcatcgttca tccccagttc aattgatgga 3120 gaaatcaaag aaatcatggg aagagataat gcaacagatg gagtgccttt attgggcaga 3180 gacagctctt tgaacactga gaataaagta aaaccttata aata 3224

Claims

1. A mutant cell line of ZNF717 L39V, characterized in that: The mutant sequence of ZNF717 L39V is to mutate CTG into GTG and the leucine (L) at the 39th position into valine (V): GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGACGTGGATGATGCTCAG.

2. The mutant cell line of ZNF717 L39V according to claim 1, characterized in that: ZNF717 L39V The gRNA sequence for ZNF217 is GGTAGCTGTGCACTTCACCT.

3. The mutant cell line of ZNF717 L39V according to claim 1, characterized in that: ZNF717 L39V The ssDNA donor sequence for ZNF217 is: GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGACGTGGATGATGCTCAG.

4. The mutant cell line of ZNF717 L39V according to claim 1, characterized in that: The method comprises the following steps: Step A. Design of gRNA sequence for ZNF717 L39V GAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA GGTAGCTGTGCACTTCACCT; Step B. Constructing a cas9-gRNA knockout vector; Step C. Design of ssDNA donor sequence for ZNF717 L39V ZNF717 GGTGTCCTTTGAGGAGGTAGCTGTGCACTTCACCTGGGAGGAGTGGCAGGACGTGGATGATGCTCAG; Step D. Simultaneously transfecting SW403 cells with the cas9-gRNA knockout vector and the ssDNA donor sequence; Step E. Screening a mutant cell strain of ZNF717 L39V .

Images