Preparation method and application of novel immune cell

Abstract

The invention relates to the field of immune cells. According to the preparation method and application of the novel immune cell, lentivirus containing DNA molecules subjected to gene modification is used for transfecting cells in peripheral blood of mammals, so that the cells can be passaged for multiple times, and the cells have the antigen presenting capacity and the capacity of activating and amplifying natural killer cells. After the cell is further genetically modified, better transmembrane transfer, antigen presentation and natural killer cell activation can be realized. After gene modification, the cell and different cytokines or small molecules jointly activate and amplify mononuclear cells to obtain a larger number of natural killer cells with higher purity, epigenetics are regulated and controlled to change the receptor and ligand expression quantity of the natural killer cells, and then the cytotoxicity of effector cells is improved. The invention can be used for preparing antigen presenting cells and CTL cells aiming at different antigens and an application method. The cells and the using method have wide application prospects in the aspects of prevention and treatment of tumors and infectious diseases.

Description

Technical Field

[0001] This invention relates to immune cells, and more particularly to engineered dendritic cells (DCs) that stimulate specific CTLs and NK cells produced by PBMCs, their preparation methods, and applications. Background Technology

[0002] (I) Cellular Immunotherapy and its Types

[0003] Cellular immunotherapy involves collecting human immune cells, modifying and culturing them in vitro to increase their number hundreds or thousands of times and enhance their targeted killing function, and then reinfusing them into the body to kill pathogens, cancer cells, mutated or virus-infected cells in the blood and tissues. This breaks immune tolerance, activates and enhances the body's immune capacity, and achieves both therapeutic and health-preserving effects. Currently, cellular immunotherapy includes cytokine-induced killer cell (CIK) therapy, dendritic cell (DC) therapy, API biological immunotherapy, DC-CIK cell therapy, natural killer cell (NK) therapy, DC-T cell therapy, chimeric antigen receptor T-cell immunotherapy (CAR-T), and T-cell receptor T-cell immunotherapy (TCR-T), among others.

[0004] DC-CIK immunotherapy is a treatment method that uses modern biotechnology to stimulate the body's own immune system to fight tumors. Its basic principle is to extract immature immune cells from the patient, culture them in vitro, and then reinfuse them into the patient. This not only accurately and efficiently kills tumor cells but also stimulates the body to produce an anti-tumor immune response, allowing the immune system to function normally to kill tumor cells and initiating immune surveillance to prevent tumor metastasis and recurrence. DC cells recognize antigens, activate the acquired immune system's ability to kill tumor cells, and possess killing capabilities. CIK cells kill tumor cells by exerting their own cytotoxicity and secreting cytokines. The combination of these two methods can enhance the activity of CIK cells, hence DC-CIK biotherapy. However, DC cells can only exert their specific cytotoxic effect by transmitting specific signals to CIK cells after recognizing antigens in vivo or loading them in vitro, which greatly limits the actual efficacy of this therapy.

[0005] NK cells are the body's first line of defense in the immune system, used for non-specific anti-tumor and anti-viral infections, clearing necrotic cells and waste such as fat, and combating aging cells. NK cells have a broad-spectrum anti-tumor effect, without exhibiting tumor-specific killing or MHC restriction. Their role is particularly important when the function of other immune cells (such as T and B cells) is low. However, the limited efficiency and purity of NK cell expansion in vitro significantly restricts their clinical application.

[0006] Dendritic cells (DCs) are the most powerful professional antigen-presenting cells in the body. They can efficiently take up, process and present antigens. Immature DCs have strong migration ability, while mature DCs can effectively activate naïve T cells and are at the center of initiating, regulating and maintaining the immune response.

[0007] (II) Types of human dendritic cells (DCs) and their functions in activating T cells and antigen presentation.

[0008] Human dendritic cells originate from hematopoietic stem cells. There are two main pathways for the origin of dendritic cells (DCs): ① Myeloid stem cells differentiate into DCs under the stimulation of GM-CSF, called myeloid DCs (mDCs), which share precursor cells with monocytes and granulocytes, including Langerhans cells, mesothelial (or dermal) DCs, and monocyte-derived DCs; ② They originate from lymphoid stem cells, called lymphoid DCs or plasmacytoid DCs (pDCs), which share precursor cells with T cells and NK cells. pDCs mediate anti-inflammatory responses after pathogen invasion by secreting large amounts of interferon-α (IFN-α), while mDCs play an important role in antigen presentation and taming naive T cells. The CD11c+ subtype is relatively abundant among mDCs, while the minority CD141+ mDC subtype exhibits a strong ability to present intracellular antigens on MHC-I to CD8+ T cells and promote their differentiation into cytotoxic T cells (CTLs). The process by which dendritic cells (DCs) mediate antigen presentation and ultimately differentiate T cells into cytotoxic effector T cells is an important step in inducing acquired immunity against viruses and cancer.

[0009] Dendritic cells (DCs), as professional antigen-presenting cells, can not only activate T cells but also present antigens to NK cells, which may be another novel pathway for DCs to initiate immune responses. In the absence of inflammation, DCs enter lymphoid tissues in small numbers and slowly. Although they can also present antigen information, their effect on T cells is to foster tolerance rather than activation. This is also related to the low expression of adhesion molecules and their mediating of corresponding DC adhesion and migration, and may be an important mechanism for the body to develop immune tolerance.

[0010] (III) The immune function of DCs is accomplished through adhesion cascade migration.

[0011] As dendritic cells (DCs) migrate, their adhesion phenotype and distribution also change, regulated by temporal expression. The expression of certain adhesion molecules, such as ICAM-1, gradually increases as other adhesion molecules are downregulated, which facilitates further adhesion between DCs and T cells. Increased cell adhesion promotes the connection and binding between DCs and T lymphocytes through the antigen peptide / MHC and TCR / CD3 complexes. Furthermore, the interaction between chemokines and their receptors is also a key factor in the chemotactic regulation of DC migration and precise localization.

[0012] It is generally believed that a dual-signal stimulation is required for T cell activation by an antigen. Adhesion molecules, through "molecular bridging" and co-signaling pathways, assist DCs in stimulating T cell activation during antigen presentation to T cells. As mentioned earlier, DCs can express various second-signal co-stimulatory molecules belonging to the adhesion molecule family, such as B7-1, B7-2, ICAM-I, ICAM-2, ICAM-3, and CD40. These components can bind to corresponding ligands expressed by T cells, such as CD28 / CTLA-4, LFA-I, and CD40L. Among them, the B7-CD28 / CTLA-4 pathway is considered to play a key role in T cell activation and is also closely related to immune tolerance. The B7 family can bind to CD28 to provide a co-stimulatory signal for T cell activation and can also bind to CTLA-4 to inhibit T cell proliferation.

[0013] DC-SIGN (DC-specific intercellular adhesion molecule-3 grabbing nonintegrin, also known as CD209) is a type II membrane protein with exogenous type C phytohemagglutinin. It is an adhesion receptor that is specifically and abundantly expressed on the surface of both mature and immature dendritic cells (DCs) and plays a crucial role in certain DC functions. For example, DC-SIGN can bind to its ligand, intercellular adhesion molecule-2 (ICAM-2), which is expressed on the endothelium of blood vessels and lymphatic vessels. The interaction between DC-SIGN and ICAM-2 can aggregate DCs and facilitate their transmembrane translocation, which may be essential for replenishing DCs to sites of inflammation and subsequently translocating them to lymphoid tissues. Abundant expression of DC-SIGN on peripheral tissue and lymphocyte DCs supports this view. The presence of DC-SIGN+ DC precursors in the blood suggests that these precursor cells are ready to leave the bloodstream to reach sites of inflammation and can be rapidly replenished to perform their immune surveillance role at these sites. DC-SIGN can also initiate the interaction between DCs and naive T cells. This function is achieved by DC-SIGN binding to another cell ligand, ICAM-3, which is highly expressed on the surface of naive T cells.

[0014] (iv) Deficiencies of existing DC cell therapies

[0015] The amount of dendritic cells (DCs) in blood is very small, less than 1% of peripheral blood mononuclear cells. Current DC cell therapies utilize antigen-loaded mononuclear cell-derived DCs (MoDCs), which are matured and activated after exposure to a series of cytokines and PRR stimulating factors. This method has been widely used in clinical trials for cancer vaccines, but its clinical benefits have been quite limited. This is mainly due to several significant drawbacks: compared to primary blood-derived DCs, MoDCs are more correlated with in vitro-derived macrophages; furthermore, in vitro-formed MoDCs have limited growth potential and are difficult to culture for extended periods, thus requiring repeated preparation of MoDCs for multiple rounds of vaccination.

[0016] (V) Factors have an important influence on the proliferation and development of immune cells.

[0017] IL-15 is a cytokine that regulates the activation and proliferation of T cells and natural killer cells. IL-15 can promote the directed differentiation of CD34+ hematopoietic stem cells into NK cells. IL-15 significantly upregulates the proportion of NK cells, and the NK cell subset distribution changes from predominantly CD56dim cells to predominantly CD56bright cells. This may be related to the different IL15R expression status of NK cells under different conditions. IL-15 can effectively transmit activation signals through the IL-2Rβ and γ chains. IL-15 and IL-2 have a synergistic effect in stimulating NK cell killing function. This is because IL-2 cannot induce the expression of high-affinity receptors; when IL-15 is added, it promotes the expression of high-affinity IL-2 receptors, thereby promoting NK cell killing function.

[0018] IL15RA is a high-affinity receptor for IL-15. IL15RA, as a heterotrimer, initiates signal transduction in conjunction with the β and γ subunits of the IL-2 receptor. IL-15 binds with high affinity to the α subunit of IL-15R. IL-15 also binds to the β and γ chains of the IL-2 receptor, but not to the α subunit. IL-15 is structurally and functionally related to IL-2. These two cytokines share some receptor subunits, allowing them to compete with each other and negatively regulate each other's activity.

[0019] OK432 is a freeze-dried bacterial vaccine. OK432-activated neutrophils can kill cancer cells treated with IFN-γ or TNF-α. The killing effect of OK432-induced neutrophils on autologous cancer cells is achieved through the reaction between CD11b / CD18 and ICAM-1. OK432-induced monocytes can also kill autologous cancer cells. OK432 stimulation of lymphocytes exhibits LAK cell activity; these activated lymphocytes even show activity against cancer cells that fight NK cells.

[0020] CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI)-anchored glycoprotein. It has a mature peptide containing only 12 amino acids and is highly expressed on human lymphocytes. CD52 / CDW52 may play a role in carbohydrate transport and direction. It is an excellent target for complement-mediated cell lysis.

[0021] Epigenetics is a crucial gene modification technique. Epigenetics refers to altering gene expression without changing the DNA sequence, thereby influencing an organism's phenotype. It is an important, heritable regulatory mechanism, encompassing DNA methylation, non-coding RNA regulation, histone modification, and chromatin remodeling. Epigenetics plays a vital role throughout the entire life process. Increasing research shows that epigenetic regulation not only participates in stem cell development and tissue differentiation but is also closely related to the development of tumors, immune diseases, metabolic diseases, and neurological disorders. Histone modification is one of the important epigenetic regulatory mechanisms, including methylation, acetylation, phosphorylation, and ubiquitination. Cells achieve changes in chromatin conformation and regulation of gene expression through reversible histone modification.

[0022] Histone methylation is a crucial histone modification mechanism that regulates various physiological and pathological processes in cells. The PRC2 complex (polycomb repressive complex 2) is a key protein complex regulating histone methylation. It consists of four subunits: EZH1, EZH2, Suz12, and Eed. EZH2 is the catalytic core of the PRC2 complex, regulating the trimethylation of lysine residue 27 of histone H3. Studies have shown that the histone methyltransferase EZH2 plays a vital role in regulating stem cell development and immune regulation. EZH2 can regulate early B cell development, the plasticity of CD4+ Th1 and Th2 cell differentiation, and maintain the stability of regulatory T cells.

[0023] Therefore, EZH2 may be a new target for drug treatment, which has important scientific research value and clinical application significance.

[0024] In order to produce cell vaccines with antigen-presenting capabilities, activated cytotoxic T lymphocytes, and natural killer cells, and to use them in clinical treatment, it is necessary to study new methods to prepare these cells. Summary of the Invention

[0025] The purpose of this invention is to solve at least one of the following problems: primary blood-derived dendritic cells (DCs) have limited growth potential and are difficult to culture for a long time; multiple rounds of vaccination require repeated preparation of MoDCs; and NK cell expansion is costly and the system is unstable.

[0026] The inventors of this application have discovered various methods in their research to improve the in vitro growth potential of DC cells, enhance DC antigen presentation capabilities, and activate CTL and NK cells.

[0027] The technical solution adopted in this invention is:

[0028] The inventors of this application made a surprising discovery through inventive sequence design and testing results: by independently designing lentiviral vectors of target genes and transfecting peripheral blood-derived PBMCs with the resulting lentiviruses, and by loading multiple target influencers and stimulating PBMCs with cytokines in stages and steps, engineered DCs, CTLs, and NK cells with enhanced killing power and antigen presentation capabilities were obtained.

[0029] The inventors first constructed lentiviral vectors carrying a self-designed recombinant NT gene and a gene carrying a cell-specific intercellular adhesion molecule-3 grabbing nonintegrin (SIGN) gene, respectively. Then, they transfected 293T cells with the lentiviral vector carrying the recombinant NT gene to obtain lentiviral particles containing the recombinant NT gene and the SIGN gene. The lentiviral particles carrying the recombinant NT gene were then transfected into dendritic cells (DCs) to obtain a monocyte-derived dendritic cell line (MoDC-NT). Antigens were loaded, and PBMCs with the same HLA-A as MoDC-NT were stimulated to obtain antigen-specific CTLs.

[0030] On the other hand, engineered NT-dendritic cells (EDC-NT) were obtained by transfecting PBMCs with lentiviral particles carrying the recombinant NT gene. Then, the engineered NT-dendritic cells (EDC-NT) were infected with lentiviral particles carrying the aforementioned SIGN gene to obtain functional NTSIGN dendritic cell lines (EDC-NTSIGN). PBMCs were then stimulated to prepare effector cells. Furthermore, the aforementioned EDC-NTSIGN lines were further infected with lentiviral particles carrying the HLA-A0201, HLA-A1101, and HLA-A2402 gene sequences to obtain multifunctional NT dendritic cells (E...). Further, lentiviral particles carrying antigen genes were used to infect multifunctional NT dendritic cells (EDC-NTA) to obtain antigen-specific multifunctional dendritic cells, which were then further stimulated in PBMCs to obtain antigen-specific CTLs with stronger killing ability; finally, the above-mentioned EDC-NTSIGN strain was transfected with lentivirus carrying cytokine and fusion protein genes to prepare a multifunctional NK feeder cell line (EDC-NK), which was then inactivated or not inactivated with a cell inactivation agent, and PBMCs were stimulated again, and then cultured with cytokines to obtain NK cells with faster killing ability and proliferation rate.

[0031] The technical solution adopted by this invention to achieve its objective is as follows:

[0032] In a first aspect, the present invention provides recombinant NT gene lentiviral particles for preparing novel immunotherapeutic cells, wherein the NT gene lentiviral particles are obtained by infecting host cells through a four-plasmid viral packaging system carrying a lentiviral vector containing the NT gene. In the lentiviral vector carrying the NT gene, the recombinant NT gene is composed of nucleotide sequence fragment A, nucleotide sequence fragment B, nucleotide sequence fragment C, and nucleotide sequence fragment D. The nucleotide sequence of the NT gene is selected from either the NT1 gene or the NT2 gene. The nucleotide sequence in the NT1 gene is A, the 5′ to 3′ sequence in the NT2 gene is -BCDE-, B encodes the Tax2 gene (1-3 aa), C encodes the Tax1 gene (2-255 aa), D encodes the T2A gene, and E encodes the Tax1 gene (227-337 aa).

[0033] The nucleotide sequence of NT1 is shown in SEQ ID No. 1, the gene sequence of Tax2 (1-3aa) is shown in SEQ ID No. 2, the gene sequence of Tax1 (2-255aa) is shown in SEQ ID No. 3, and the gene sequence of Tax1 (227-337aa) is shown in SEQ ID No. 4.

[0034] In one embodiment, the NT2 gene is structured as a 5′-3′ sequentially linked structure -Tax2(1-3aa)-Tax1(2-255aa)-T2A-Tax1(227-337aa)-, wherein the host cell is a 293T cell.

[0035] In this protocol, the Tax protein is encoded by the Tax gene in the pX gene region of the HTLV-1 genome. It has a molecular weight of 40 x 10³, consists of 353 amino acids, and its N-terminal 48 residues contain a nuclear localization signal (NLS). Distributed within the cell nucleus, Tax acts as a transactivator; it does not bind to DNA itself. Instead, it activates viral and cellular genes through direct or indirect interactions with host cell transcription factors. These transcription factors include cAMP response element-binding protein or activating transcription factor (REB / ATF), nuclear factor κB (NFκB), and serum response factor (SRF). Through interactions with these transcription factors, the Tax protein can activate not only the transcription of the virus's own long terminal repeat (LTR) sequences but also early serum response genes, cytokine genes, and their receptor genes. Activation of these cellular genes leads to T cell proliferation and transformation, and, along with other factors, participates in the development of leukemia.

[0036] In a second aspect, the present invention provides an engineered mononuclear cell-derived dendritic cell line (MoDC-NT), wherein the MoDC-NT line is obtained by transfecting dendritic cells with recombinant NT gene lentiviral particles as described in the first aspect, and the infection is simultaneously promoted by adding a lentiviral infection-promoting agent.

[0037] In one embodiment, the lentiviral infection-promoting agent is a polycationic compound polygluconine; in another embodiment, the lentiviral infection-promoting agent is a nanopolymer.

[0038] In one embodiment, the infection time is the 7th day of the dendritic cell culture.

[0039] In one embodiment, the dendritic cell culture medium containing IL-4 and GM-CSF is added every other day before and after lentivirus infection.

[0040] In one embodiment, TNF-α and LPS are added post-infection. In one embodiment, TNF-α and Poly(I:C) are added post-infection. In one embodiment, the TNF-α concentration is 5 ng / ml. In one embodiment, the TNF-α concentration is 20 ng / ml. In one embodiment, the LPS concentration is 5 μg / ml. In one embodiment, the LPS concentration is 20 μg / ml. In one embodiment, the Poly(I:C) concentration is 5 μg / ml. In one embodiment, the Poly(I:C) concentration is 50 μg / ml.

[0041] In one embodiment, all 10 cell lines using NT-1 lentivirus were successfully constructed, achieving cell expansion.

[0042] In one embodiment, all 10 cell lines using NT-2 lentivirus were successfully constructed, achieving cell expansion.

[0043] The monocyte-derived MoDC-NT cells prepared using this protocol exhibit a typical dendritic cell phenotype and can be passaged and proliferated multiple times. This provides a sufficient supply of autologous DC cells for antigen presentation to individuals who require a large number of antigen-presenting cells but cannot wait for extended periods. Furthermore, the cells prepared using this protocol have higher purity. These cells can also be used for HLA typing.

[0044] The third aspect of the present invention provides an antigen-specific CTL, the preparation steps of which include: (1) loading an antigen onto a mononuclear cell-derived dendritic cell (MoDC-NT) line prepared by the method described in the second aspect; (2) taking blood with the same HLA-A as the MoDC-NT described in the second aspect to prepare PBMCs; (3) stimulating the PBMCs obtained in (2) with the mononuclear cell-derived dendritic cells (MoDC-NT) loaded with antigen obtained in (1), wherein the addition ratio can be MoDC-NT∶PBMC=1∶1-1∶1000; (4) using an immune cell culture medium supplemented with IL-2; and (5) culturing continuously for a period of time.

[0045] In one embodiment, (3) the ratio of antigen-loaded dendritic cells (MoDC-NT) to added PBMCs can be MoDC-NT:PBMC = 1:1. In another embodiment, (3) the ratio of antigen-loaded dendritic cells (MoDC-NT) to added PBMCs can be MoDC-NT:PBMC = -1:1000.

[0046] In one embodiment, the antigen is loaded into the mononuclear cell-derived dendritic cell (MoDC-NT) line via antigen peptide loading. In another embodiment, the antigen is loaded into the mononuclear cell-derived dendritic cell (MoDC-NT) line by transfecting the antigen gene into the dendritic cell (MoDC-NT) line.

[0047] In one embodiment, (2) the blood is derived from peripheral blood; in another embodiment, (2) the blood is derived from umbilical cord blood. In one embodiment, the culture duration is one week; in another embodiment, the culture duration is two weeks; in yet another embodiment, the culture duration is three weeks or longer.

[0048] In one embodiment, the PBMC is a CD3+ T cell, and in another embodiment, it is a CD8+ T cell.

[0049] In one embodiment, M1-specific CTLs were prepared by stimulating MHC-matched PBMCs with a certain amount of MoDC-NT loaded with M1 peptide. The CD8+ positive cells accounted for 89.57% of CD3+CD56- cells, while CD3+CD56+ double positive cells accounted for 3.92%, and CD3-CD56+ double positive cells accounted for 1.70%. Among them, M1Tetramer-GILGFVFTL positive cells accounted for 20.73% of CD3+CD8+ double positive cells. In this way, it is possible to kill tumors expressing M1-specific antigens in patients, while also killing other diseased cells in patients who do not have this specific antigen, thereby achieving a preventive effect.

[0050] A fourth aspect of the present invention provides an engineered NT dendritic cell (EDC-NT) line, wherein the preparation method of the engineered NT dendritic cell (EDC-NT) line includes the following steps: infecting pre-cultured PBMCs with recombinant NT gene lentiviral particles as described in the first aspect of the present invention; after infection, continuing to culture and sorting to remove CD3+ cells; simultaneously adding a lentiviral infection promoter to accelerate the infection; before lentiviral infection, PBMCs are cultured in a culture system containing an immune agonist and a culture system containing IL-2, respectively; after infection, PBMCs are cultured in a culture system containing serum and IL-2.

[0051] In one embodiment, the method for preparing the engineered NT dendritic cell (EDC-NT) line includes the following steps: (1) isolating peripheral blood mononuclear cells (PBMCs) containing an anticoagulant; (2) culturing the cells obtained in (1) in a culture medium containing an immune cell agonist for 24 hours; (3) adding IL-2 to the culture system in (2) and continuing to culture for 4-5 days; (4) infecting the cells cultured in (3) with the recombinant NT gene lentiviral particles described in the first aspect, while adding a lentiviral infection-promoting reagent; (5) culturing the cells obtained in (4) in a culture medium containing serum and IL-2 for 1-2 weeks; (6) removing CD3+ cells from the cells obtained in (5) by magnetic beads or flow cytometry; (7) continuing to culture the cells retained in (6) under the culture conditions in (5) for 2-3 months.

[0052] In one embodiment, the immune agonist is PHA; in another embodiment, the immune agonist is PMA; in yet another embodiment, the immune agonist is another agonist. In one embodiment, the lentiviral infection-promoting reagent is a polycationic compound, polyglobulin; in yet another embodiment, the lentiviral infection-promoting reagent is a nanopolymer. In one embodiment, the sorting method is magnetic bead sorting; in yet another embodiment, the sorting method is flow cytometry screening.

[0053] In one embodiment, of the 10 cell lines using NT-1 lentivirus, one line stopped proliferating and gradually died after about a month of culture, while the remaining 9 lines were successfully constructed, with a cell construction success rate of approximately 90%.

[0054] In one embodiment, of the 10 cell lines using NT-2 lentivirus, two cell lines stopped proliferating and gradually died after about 40 days of culture, while the remaining 10 cell lines were successfully constructed, with a cell construction success rate of approximately 100%.

[0055] In one embodiment, the NT dendritic cell (EDC-NT) line exhibits a typical DC phenotype and can achieve long-term passage and proliferation. The EDC-NT cells for those in need can be prepared in advance, stored in liquid nitrogen for extended periods, and then thawed (or briefly expanded and cultured) for use when required. This provides an unlimited supply of autologous DC cells for antigen presentation to individuals requiring large quantities of antigen-presenting cells, and is a one-time preparation for lifetime use. These cells can also be used for HLA typing.

[0056] The fifth aspect of the present invention provides a novel immune cell, the preparation method of which includes the following steps: (1) loading or not loading antigens onto the NT dendritic cell (EDC-NT) line described in the fourth aspect; (2) preparing PBMCs from blood with the same or different HLA-A as the EDC-NT; (3) stimulating the PBMCs obtained in (2) with the NT dendritic cells (EDC-NT) obtained in (1) loaded or not loaded with antigens, and then mixing and culturing them; (4) using an immune cell culture medium supplemented with IL-2; and (5) culturing for a period of time.

[0057] In one embodiment, the NT dendritic cell (EDC-NT) line described in (1) is loaded with antigen peptides.

[0058] In one embodiment, the method of loading antigens into the NT dendritic cell (EDC-NT) line (1) is to transfect the antigen gene into the NT dendritic cell (EDC-NT) line.

[0059] In one embodiment (2), the PBMC has the same HLA-A as the EDC-NT. In another embodiment (2), the PBMC has a different HLA-A from the EDC-NT.

[0060] In one embodiment (2), the blood is derived from peripheral blood. In another embodiment (2), the blood is derived from umbilical cord blood.

[0061] In one embodiment (3), the PBMC is selected from PBMCs, and in another embodiment (3), the PBMC is CD3+ T cells and in yet another embodiment (3), the PBMC is CD8+ T cells.

[0062] In one embodiment (3), the cell ratio in the mixed culture is cell line:PBMC = 1:1. In another embodiment (3), the cell ratio in the mixed culture is cell line:PBMC = 1:1000.

[0063] The sixth aspect of the present invention provides an engineered functional NTSIGN dendritic cell (EDC-NTSIGN) line, the preparation method of which includes the following steps: (1) repeatedly infecting the engineered NT dendritic cell (EDC-NT) line described in the fourth aspect of the present invention with SIGN lentiviral particles; (2) adding a lentiviral infection promoter simultaneously with the viral infection in step (1); (3) sorting and collecting CD209+ cells from the cells obtained in step (2); and (4) continuing to culture the cells obtained in step (3) for a period of time.

[0064] The sequence of the SIGN gene is selected from the nucleic acid sequence shown in SEQ ID No. 5.

[0065] The method for preparing the lentiviral particles containing the SIGN gene includes infecting host cells with a four-plasmid viral packaging system containing a lentiviral vector carrying the SIGN gene.

[0066] The novel SIGN-designed base sequence enables efficient transcription and translation in human immune cells, thereby fully realizing its biological activity.

[0067] In one specific embodiment, the functional NTSIGN dendritic cell (EDC-NTSIGN) line has a typical DC phenotype and highly expresses DC-SIGN, which can achieve better signal transduction and is more conducive to activating T cells and NK cells, thus further improving the possibility of clinical application.

[0068] In one embodiment, the lentiviral infection-promoting reagent is a polycationic compound called polyglobulin; in another embodiment, the lentiviral infection-promoting reagent is a nanopolymer. In one embodiment, the sorting method is magnetic bead sorting; in another embodiment, the sorting method is flow cytometry screening.

[0069] In one specific embodiment, the effector cells that can be activated are T cells.

[0070] In one specific embodiment, the effector cells that can be activated are NK cells.

[0071] In one specific embodiment, compared to EDC-NT cells, EDC-NTSIGN cells can better activate effector cells (T cells, NK cells), with a 33.23% increase in total cell count over a 21-day culture period. (e.g.) Figure 14 (As shown). A larger number of effector cells makes it easier to meet clinical needs, reduces the pain of patients from large blood draws, and increases the likelihood of a cure.

[0072] The seventh aspect of the present invention provides a novel immune cell, the preparation method of which includes the following steps: (1) loading or not loading antigens onto the functional NTSIGN dendritic cell (EDC-NTSIGN) line described in the sixth aspect; (2) preparing PBMCs from blood with the same or different HLA-A as the EDC-NTSIGN; (3) stimulating the PBMCs obtained in (2) with the functional NTSIGN dendritic cell (EDC-NTSIGN) line obtained in (1) loaded or not loaded with antigens, and then mixing and culturing; (4) using an immune cell culture medium supplemented with IL-2; and (5) culturing continuously for a period of time.

[0073] In one embodiment, the antigen loading method of the functional NTSIGN dendritic cell (EDC-NTSIGN) line described in (1) is antigen peptide loading.

[0074] In one embodiment, the antigen loading method of the functional NTSIGN dendritic cell (EDC-NTSIGN) line described in (1) is to transfect the antigen gene into the EDC-NTSIGN cell line.

[0075] In one embodiment (2), the PBMC has the same HLA-A as EDC-NTSIGN. In another embodiment (2), the PBMC has a different HLA-A from EDC-NTSIGN.

[0076] In one embodiment (2), the blood is derived from peripheral blood. In another embodiment (2), the blood is derived from umbilical cord blood.

[0077] In one embodiment (3), the PBMC is selected from PBMCs, and in another embodiment (3), the PBMC is CD3+ T cells and in yet another embodiment (3), the PBMC is CD8+ T cells.

[0078] In one embodiment (3), the cell ratio in the mixed culture is cell line:PBMC = 1:1. In another embodiment (3), the cell ratio in the mixed culture is cell line:PBMC = 1:1000.

[0079] The eighth aspect of the present invention provides an engineered multifunctional NT dendritic cell (EDC-NTA) line, wherein the preparation method of the EDC-NTA line includes the following steps: (1) repeatedly infecting the EDC-NTSIGN cell line described in the sixth aspect of the present invention with lentiviral particles carrying one or more combinations of nucleotide sequences of HLA-A0201, HLA-A1101 and HLA-A2402 genes; (2) sorting and collecting HLA-A combination positive cells obtained in (1); and (3) continuing to culture the cells obtained in step (1) for a period of time.

[0080] The method for preparing lentiviral particles carrying HLA-A0201, HLA-A1101, or HLA-A2402 genes includes the steps of: obtaining them by infecting host cells with a four-plasmid virus packaging system containing a lentiviral vector carrying HLA-A0201, HLA-A1101, or HLA-A2402 genes, respectively, wherein the host cells are 293T cells.

[0081] In one embodiment, the HLA is HLA-A0201, wherein the nucleotide sequence of HLA-A0201 is shown in SEQ ID No. 6; in another embodiment, the HLA is HLA-A1101, wherein the nucleotide sequence of HLA-A1101 (HA-Tag) is shown in SEQ ID No. 7; and in yet another embodiment, the HLA is HLA-A2402, wherein the nucleotide sequence of HLA-A2402 is shown in SEQ ID No. 8. In one embodiment, the HLA is a combination of HLA-A0201 and HLA-A1101 (HA-Tag); in another embodiment, the HLA is a combination of HLA-A0201 and HLA-A2402 (HA-Tag); in yet another embodiment, the HLA is a combination of HLA-A1101 (HA-Tag) and HLA-A2402 (HA-Tag); and in yet another embodiment, the HLA is a combination of HLA-A0201, HLA-A1101 (HA-Tag), and HLA-A2402 (HA-Tag).

[0082] The resulting multifunctional NT dendritic cell line (EDC-NTA, i.e., EDC-NT-A0201 / 1101 / 2402) simultaneously possesses HLA-A0201, HLA-A1101, and HLA-A2402, the three most prevalent MHC class I molecules in the Chinese population. This cell line can be used for in vitro antigen presentation to cells containing one of these three MHC class I molecules, enabling large-scale production of target-specific CTLs.

[0083] The ninth aspect of the present invention provides a novel immune cell, the preparation method of which includes the following steps: (1) taking the multifunctional NT dendritic cell (EDC-NTA) line prepared by the method described in the eighth aspect of the present invention and mixing it with anticoagulated PBMCs for culture; (2) using an immune cell culture medium supplemented with IL-2; and (3) culturing for a period of time.

[0084] In one embodiment (1), the anticoagulated blood is derived from peripheral blood. In another embodiment (1), the anticoagulated blood is derived from umbilical cord blood.

[0085] In one embodiment (1), the PBMC is selected from PBMCs, and in another embodiment (3), the PBMC is CD3+ T cells and in yet another embodiment (3), the PBMC is CD8+ T cells.

[0086] In one embodiment (3), the cell ratio in the mixed culture is cell line:PBMC = 1:1. In another embodiment (3), the cell ratio in the mixed culture is cell line:PBMC = 1:1000.

[0087] The tenth aspect of the present invention provides an antigen-specific multifunctional dendritic cell line, the preparation steps of which include: (1) combining an antigen gene with an IκBα gene and then ligating it to a lentiviral vector plasmid; (2) infecting the multifunctional NT dendritic cells (EDC-NTA) of the eighth aspect of the present invention with a lentivirus carrying the sequence combination described in (1); (3) adding a lentiviral infection-promoting reagent simultaneously with the viral infection in step (2); (4) repeating steps (2) and (3) twice; (5) screening and collecting cells that are positive for the antigen gene in the obtained cells; and (6) continuing to culture. A period of time; wherein, (1) the structure of the combined gene is selected from one of the general formula IκBα(1-48aa)-antigen gene-IκBα(281-317aa), IκBα(1-317aa)-T2A-antigen gene, IκBα(1-48aa)-antigen peptide mini gene-IκBα(281-317aa) and IκBα(1-317aa)-T2A-antigen peptide mini gene; (5) the screening includes sorting by magnetic beads or flow cytometry or single cell cloning or resistance screening.

[0088] In one embodiment, the lentiviral infection-promoting agent is a polycationic compound, polybrene. In another embodiment, the lentiviral infection-promoting agent is another lentiviral infection-promoting agent.

[0089] In one embodiment, the screening method described in (3) is magnetic bead sorting; in another embodiment, the screening method described in (3) is flow cytometry sorting; in yet another embodiment, the screening method described in (3) is single-clone cell screening; and in yet another embodiment, the screening method described in (3) is resistance screening.

[0090] In one embodiment, the resistance screening is puromycin screening.

[0091] In one embodiment, the concentration of puromycin is 5 μg / ml.

[0092] In one embodiment, the concentration of puromycin is 10 ug / ml.

[0093] In one embodiment, the concentration of puromycin is 8 μg / ml.

[0094] In one embodiment, (1) the structure of the combined gene is the general formula IκBα(1-48aa)-antigen gene-IκBα(281-317aa).

[0095] In one embodiment, (1) the structure of the combined gene is the general formula IκBα(1-317aa)-T2A-antigen gene.

[0096] In one embodiment, (1) the structure of the combined gene is the general formula IκBα(1-48aa)-antigen peptide mini gene-IκBα(281-317aa).

[0097] In one embodiment, (1) the structure of the combined gene is the general formula IκBα(1-317aa)-T2A-antigen peptide mini gene.

[0098] The antigen genes or antigen peptide genes mentioned therein are selected from, but are not limited to, whole antigen genes or partial antigen genes of tumor antigen genes or viral antigen genes such as Mesothelin, CEA, NYESO-1, AFP, TPA, TPS, EGFR, VEGF, PDGFR, ALK, CA125, CA153, CA199, CA242, CA724, S100, HCG, HCH, B2-MG, MUC1 / 16, WT1, GD2, GPC3, PRAME, FOLR1, MAGEA3, Her2, Survivin, CD19, CD20, CD22, CD47, CD73, CD117, PD1, PD-L1, BCMA, etc.

[0099] Wherein IκBα is a novel, modified sequence that is artificially synthesized before use. In one embodiment, the specific antigen is selected from the group including Mesothelin, CEA, and NYESO1. The nucleotide coding sequence of IκBα is shown in SEQ ID No. 9, and the nucleotide coding sequence of T2A is shown in SEQ ID No. 10.

[0100] In some embodiments, the antigen-specific multifunctional dendritic cells include Mesothelin-specific multifunctional dendritic cell lines (EDC-Mesothelin), NYESO1-specific multifunctional dendritic cell lines (EDC-NYESO1), and CEA-specific multifunctional dendritic cell lines (EDC-CEA), as well as antigen-specific dendritic cell lines corresponding to other antigen genes. The Mesothelin gene sequence is shown in SEQ ID No. 11, the CEA gene sequence is shown in SEQ ID No. 12, and the NYESO1 gene sequence is shown in SEQ ID No. 13. The amino acid sequence of the antigen peptide mini gene is a series of repeating sequences of -antigen polypeptide-AYY-, and the nucleotide sequence of AYY is shown in SEQ ID No. 19: GCTTACTAC.

[0101] In one specific embodiment, the specific antigen is Mesothelin, and the lentiviral particles are Mesothelin lentiviral particles.

[0102] The Mesothelin lentiviral particles are obtained by infecting host cells T293 cells with a mixture of Mesothelin lentiviral vector and viral transfection plasmid system.

[0103] In one specific embodiment, the specific antigen is Mesothelin, a specific multifunctional dendritic cell (EDC-Mesothelin) line, wherein the nucleotide sequence linkage pattern is as follows: Figure 17 As shown.

[0104] In one specific embodiment, the specific antigen is CEA, and the lentiviral particle is a CEA lentiviral particle.

[0105] The CEA lentiviral particles are obtained by infecting host cells T293 cells with a mixture of CEA lentiviral vector and viral transfection plasmid system.

[0106] In one specific embodiment, the specific antigen is CEA, and the specific multifunctional dendritic cell (EDC-CEA) strain is described, wherein the nucleotide sequence linkage pattern is as follows: Figure 18 As shown.

[0107] In one specific embodiment, the specific antigen is NY-ESO-1, and the lentiviral particle is NY-ESO-1 lentiviral particle.

[0108] The NY-ESO-1 lentiviral particles are obtained by infecting host cells T293 cells with a mixture of NY-ESO-1 lentiviral vector and viral transfection plasmid system.

[0109] In one specific embodiment, the specific antigen is NY-ESO-1, a specific multifunctional dendritic cell line (EDC-NYESO1), wherein the NY-ESO-1 nucleotide sequence linkage pattern is as follows: Figure 19 As shown.

[0110] The nucleotide coding sequence of IκBα is shown in SEQ ID No. 9, the nucleotide coding sequence of T2A is shown in SEQ ID No. 10, the nucleotide coding sequence of Mesothelin is shown in SEQ ID No. 11, the nucleotide coding sequence of CEA is shown in SEQ ID No. 12, and the nucleotide sequence of NY-ESO-1 is shown in SEQ ID No. 13.

[0111] The IκBα sequence is a novel, engineered sequence that is then used. By using IκBα, the rapid degradation of Mesothelin, CEA, and NY-ESO-1 within cells can be promoted, leading to their presentation by MHC class I molecules. The construction of this cell line can be used to prepare Mesothelin, CEA, and NY-ESO-1 specific CTLs, providing a novel treatment option for patients with Mesothelin, CEA, and NY-ESO-1 positive tumors.

[0112] The eleventh aspect of the present invention provides a novel immune cell, the preparation method of which includes the steps of: (1) mixing and culturing antigen-specific multifunctional dendritic cells as described in the tenth aspect of the present invention with blood-prepared PBMCs, and (2) culturing continuously for a period of time.

[0113] In one embodiment, the blood is peripheral blood; in another embodiment, the blood is umbilical cord blood.

[0114] In one embodiment, the starting cells are PBMC cells.

[0115] In one embodiment, the starting cells are CD3+ T cells.

[0116] In one embodiment, the starting cells are CD8+T cells.

[0117] In one embodiment, the novel immune cell is an antigen-specific CTL.

[0118] In one embodiment, the novel immune cell is an antigen-specific NK cell.

[0119] In one embodiment, the blood-derived cells are matched with the antigen-specific multifunctional dendritic cell MHCI class molecules described in the tenth aspect of the present invention. In one embodiment, the blood-derived cells are HLA-A0201.

[0120] In one embodiment, the cell ratio in the mixed culture is cell line:PBMC = 1:1; in another embodiment, the cell ratio in the mixed culture is cell line:PBMC = 1:1000. In one embodiment, the culture system used is an immune cell culture medium supplemented with IL-2. In one embodiment, the culture time is one week; in another embodiment, the culture time is two weeks; in another embodiment, the culture time is three weeks, or in another embodiment, the culture time is other than one week. In one embodiment, the PBMC is CD3+ T cell; in another embodiment, the PBMC is CD8+ T cell.

[0121] The antigens mentioned therein are selected from any one or more of the following tumor antigens or viral antigens: Mesothelin, CEA, NYESO-1, AFP, TPA, TPS, EGFR, VEGF, PDGFR, ALK, CA125, CA153, CA199, CA242, CA724, S100, HCG, HCH, β2-MG, MUC1 / 16, WT1, GD2, GPC3, PRAME, FOLR1, MAGEA3, Her2, Survivin, CD19, CD20, CD22, CD47, CD73, CD117, PD1, PD-L1, BCMA, etc.

[0122] In one embodiment, the target antigen is selected from Mesothelin, NYESO1, and CEA.

[0123] In one specific embodiment, the specific antigen is Mesothelin. The prepared CTLs show a high percentage of CD3+CD8+ double-positive cells (89.57%), CD3+CD56+ double-positive cells (17.10%), and CD3-CD56+ cells (4.30%). This allows for the killing of tumors expressing the Mesothelin-specific antigen in the patient's body, as well as the killing of other diseased cells in the patient's body that do not have this specific antigen, thereby achieving a preventive effect.

[0124] In one specific embodiment, the specific antigen is CEA. The prepared CTLs contain up to 86.86% CD3+CD8+ double-positive cells, 23.85% CD3+CD56+ double-positive cells, and 3.64% CD3-CD56+ cells. This allows for the killing of tumors expressing the CEA-specific antigen in the patient's body, as well as the killing of other diseased cells in the patient's body that do not contain this specific antigen, thereby achieving a preventive effect.

[0125] In one specific embodiment, the specific antigen is NY-ESO-1. The prepared CTLs show a high percentage of CD3+CD8+ double-positive cells (89.74%), CD3+CD56+ double-positive cells (14.39%), and CD3-CD56+ double-positive cells (2.34%). This allows for the killing of tumors expressing the NY-ESO-1 specific antigen in the patient's body, as well as the killing of other diseased cells in the patient's body that do not have this specific antigen, thereby achieving a preventive effect.

[0126] The twelfth aspect of the present invention provides a multifunctional NK trophoblast cell (EDC-NK), the preparation method of which includes the following steps: (1) sequentially infecting the functional NTSIGN dendritic cell (EDC-NTSIGN) strain described in the fifth aspect of the present invention with a variety of lentiviral particles carrying specific cytokines; (2) adding a lentiviral infection-promoting reagent at the same time as the viral infection in step (1); (3) screening and collecting cells that positively express specific cytokine genes in the cells obtained in step (2); and (4) continuing to culture the cells obtained in step (3) for a period of time.

[0127] In one embodiment, the cytokines include three types: 4-1BBL, MICA, and IL-15&CD8 fusion protein. The lentiviral particles are obtained by sequentially infecting host cells with a four-plasmid viral packaging system containing a lentiviral vector carrying one of the genes for 4-1BBL, MICA, and IL-15&CD8 Fusion protein, respectively. The nucleotide sequences of the genes for 4-1BBL, MICA, signal peptide, IL-15, and CD8 are shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, and SEQ ID No. 18, respectively. The nucleotide composition of the IL-15&CD8 Fusion protein is: -signal peptide (87 bp) - extracellular region (IL-15Mat-peptide (342 bp) - Hinge (141 bp)) - transmembrane region (TM (72 bp)). The nucleotide sequence of the signal peptide gene is shown in SEQ ID No. 16.

[0128] The schematic diagram of the IL-15&CD8αFusion protein structure is shown below. Figure 25 As shown.

[0129] The method for preparing the lentiviral particles carrying cytokine genes includes the following steps:

[0130] (1) Design the nucleotide sequences encoding cytokines and their constituent nucleotide fragments;

[0131] (2) Enzymatic digestion and ligation to construct a lentiviral vector encoding nucleotide sequences for cytokines;

[0132] (3) Infect host cells with a lentiviral vector that encodes nucleotide sequences of cytokines and package them to obtain lentiviral particles carrying cytokine-encoding sequences.

[0133] The interaction between 4-1BBL and the NK cell activating receptor 4-1BB can repair NK cell responsiveness. MICA is a ligand that activates the NKG2D activating receptor, which is widely expressed on human NK cells. IL-15 can promote the directed differentiation of CD34+ hematopoietic stem cells into NK cells, significantly upregulating the proportion of NK cells, and changing the NK cell subset distribution from predominantly CD56dim cells to predominantly CD56bright cells. Successfully constructing EDC-NK cells provides a new option for NK cell preparation, and this approach allows for pre-stimulation of EDC-NK cells with antigens during NK cell preparation, generating antigen-specific cells. It may also become an alternative to the currently used K562 or other feeder cells for NK cell production in clinical practice.

[0134] The thirteenth aspect of the present invention provides a ready-to-use multifunctional NK trophoblast cell line (EDC-NK). The preparation method is selected from treating the cells with an EDC-NK cell suspension using a treatment selected from Co60 irradiation, gamma irradiation, chemical fixation solution, and other methods that can render the cells inactive.

[0135] In one embodiment, the inactivation method of the multifunctional NK trophoblast cell (EDC-NK) line involves fixing the cells with a tissue cell fixation solution such as paraformaldehyde. In another embodiment, the inactivation method of the multifunctional NK trophoblast cell (EDC-NK) line involves treating the cells using other methods that can render the cells inactive, while preserving their function and safety for application. It can be used clinically or in research as a vaccine or cell preparation.

[0136] In one embodiment, the preparation steps of the ready-to-use multifunctional NK trophoblast cell (EDC-NK) line include: (1) preparing a cell suspension from the multifunctional NK trophoblast cell (EDC-NK) line described in the ninth aspect of the present invention; (2) irradiating the cell suspension obtained in (1) with Co60 rays to inactivate it; (3) cooling the cells obtained after irradiation in (2) to -80°C using cell cryopreservation solution; and (4) preserving the cells obtained in (3).

[0137] In one embodiment, the multifunctional NK trophoblast (EDC-NK) cell line is inactivated by Co60 radiation; in another embodiment, the irradiation dose is Dmin = 19.85 kGy.

[0138] Irradiated EDC-NK cells are inactivated and cannot proliferate further, but they retain their original intracellular and surface molecular structures. This preserves their antigen-presenting ability and does not affect their activation capacity for T and NK cells, thus enhancing the safety for clinical applications. Irradiated cells can be used directly, or frozen cells can be thawed before use.

[0139] In one embodiment, a Co60BFT-II type (2#) irradiation device is used, and irradiation treatment is performed by fractional irradiation using a ring-shaped orbit. The absorbed dose of the cell suspension is Dmin = 19.85 kGy. In one embodiment, the cell inactivation method is other types of radiation, or in another embodiment, the cell inactivation method is a chemical reagent.

[0140] The fourteenth aspect of the present invention provides a novel immune cell, the preparation steps of which include: (1) taking the cell line described in the fourth, sixth, eighth, tenth, twelfth or thirteenth aspects of the present invention and mixing it with PBMCs derived from peripheral blood or umbilical cord blood for culture, the cell ratio being cell line:PBMC = 1:1 to 1:1000; (2) using an immune cell culture medium supplemented with IL-2; (3) histone methyltransferase (EZH2) inhibitors and / or cytokines may be added to the culture system described in step (2); (4) culturing continuously for a period of time.

[0141] In one embodiment, the PBMCs described in (1) are derived from peripheral blood, or in another embodiment, the PBMCs described in (1) are derived from umbilical cord blood. In one embodiment, the cell ratio in (1) is cell line:PBMC = 1:1; in another embodiment, the cell ratio in (1) is cell line:PBMC = 1:1000.

[0142] In one embodiment, the culture time of (4) is selected from one week, two weeks, three weeks or other durations.

[0143] In one embodiment, a histone methyltransferase (EZH2) inhibitor is added to the culture medium used to activate PBMCs for NK cell preparation. In one embodiment, the inhibitor is preferably UNC1999; in another embodiment, the inhibitor is preferably EPZ005687.

[0144] In one embodiment, cytokines are added to the culture medium used to activate PBMCs for NK cell preparation. In one embodiment, the cytokines are preferably one or more combinations of IL-15, IL-15RA, OK432, and CD52. In one embodiment, the cytokine is IL-15. In one embodiment, the cytokine is IL-15RA. In one embodiment, the cytokine is OK432. In one embodiment, the cytokines are IL-15 and OK432. In one embodiment, the cytokines are IL-15 and CD52. In one embodiment, the cytokines are IL-15, OK432, and CD52.

[0145] In one embodiment, NK cells are prepared by adding (irradiated or unirradiated) EDC-NK and multi-cytokine-stimulated PBMCs.

[0146] In one embodiment, the multiple cytokines are any combination of IL15, IL-15RA, OK432, and CD52.

[0147] In one embodiment, the combined cytokines are IL15, IL-15RA, OK432, and CD52.

[0148] IL-15 is a cytokine that regulates the activation and proliferation of T cells and natural killer cells. IL-15 can promote the directed differentiation of CD34+ hematopoietic stem cells into NK cells. IL-15 can significantly upregulate the proportion of NK cells, and the distribution of the NK cell subset changes from predominantly CD56dim cells to predominantly CD56bright cells. This may be related to the different IL15R expression status of NK cells under different conditions. IL-15 can effectively transmit activation signals through the IL-2Rβ and γ chains. IL-15 and IL-2 have a synergistic effect in stimulating NK cell killing function. This is because IL-2 cannot induce the expression of high-affinity receptors; when IL-15 is added, it promotes the expression of high-affinity IL-2 receptors, thereby promoting NK cell killing function. The increase of the CD56bright subset will significantly promote cytokine secretion, while the increase of the CD56dim subset will promote the killing activity of NK cells. However, the CD56dim and CD56bright subsets are not functionally separate.

[0149] IL15RA is a high-affinity receptor for IL-15. IL15RA, as a heterotrimer, initiates signal transduction in conjunction with the β and γ subunits of the IL-2 receptor. IL-15 binds with high affinity to the α subunit of IL-15R. IL-15 also binds to the β and γ chains of the IL-2 receptor, but not to the α subunit. IL-15 is structurally and functionally related to IL-2. These two cytokines share some receptor subunits, allowing them to compete with each other and negatively regulate each other's activity.

[0150] OK432 is a freeze-dried bacterial vaccine. OK432-activated neutrophils can kill cancer cells treated with IFN-γ or TNF-α. The killing effect of OK432-induced neutrophils on autologous cancer cells is achieved through the reaction between CD11b / CD18 and ICAM-1. OK432-induced monocytes can also kill autologous cancer cells. OK432 stimulation of lymphocytes exhibits LAK cell activity; these activated lymphocytes even show activity against cancer cells that fight NK cells.

[0151] CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI)-anchored glycoprotein. It has a mature peptide containing only 12 amino acids and is highly expressed on human lymphocytes. CD52 / CDW52 may play a role in carbohydrate transport and direction. It is an excellent target for complement-mediated cell lysis.

[0152] Epigenetics is a crucial gene modification technique. Epigenetics refers to altering gene expression without changing the DNA sequence, thereby influencing an organism's phenotype. It is an important, heritable regulatory mechanism, encompassing DNA methylation, non-coding RNA regulation, histone modification, and chromatin remodeling. Epigenetics plays a vital role throughout the entire life process. Increasing research shows that epigenetic regulation not only participates in stem cell development and tissue differentiation but is also closely related to the development of tumors, immune diseases, metabolic diseases, and neurological disorders. Histone modification is one of the important epigenetic regulatory mechanisms, including methylation, acetylation, phosphorylation, and ubiquitination. Cells achieve changes in chromatin conformation and regulation of gene expression through reversible histone modification.

[0153] Histone methylation is a crucial histone modification mechanism that regulates various physiological and pathological processes in cells. The PRC2 complex (polycomb repressive complex 2) is a key protein complex regulating histone methylation. It consists of four subunits: EZH1, EZH2, Suz12, and Eed. EZH2 is the catalytic core of the PRC2 complex, regulating the trimethylation of lysine residue 27 of histone H3. Studies have shown that the histone methyltransferase EZH2 plays a vital role in regulating stem cell development and immune regulation. EZH2 can regulate early B cell development, the plasticity of CD4+ Th1 and Th2 cell differentiation, and maintain the stability of regulatory T cells.

[0154] The combined use of IL15, IL-15RA, OK432, and CD52 with small molecule inhibitors of EZH2 can better promote the activation and proliferation of NK cells, improve the purity of NK cells in the final product, and at the same time change the epigenetics of NK cells, thereby enhancing their killing activity against target cells.

[0155] In one embodiment, NK cells are prepared by stimulating PBMCs with (irradiated or unirradiated) EDC-NK and histone methyltransferase (EZH2) inhibitors.

[0156] In one embodiment, NK cells are prepared by adding (irradiated or unirradiated) EDC-NK and histone methyltransferase (EZH2) inhibitors and multi-cytokine stimulation to PBMCs.

[0157] In one embodiment, activating PBMCs with EDC-NK stimulation yielded NK (CD3-CD56+) and NKT (CD3+CD56+) cells, accounting for 81.11% and 4.45% respectively, and the cells expanded 253-fold after 21 days of culture.

[0158] In one embodiment, activating PBMCs with EDC-NK stimulation using combined cytokines yielded NK (CD3-CD56+) and NKT (CD3+CD56+) cells, accounting for 95.43% and 0.86% respectively, resulting in a 394-fold increase in cell volume after 21 days of culture. This further improved NK purity and cell expansion.

[0159] In one embodiment, combining histone methyltransferase (EZH2) inhibitors and cytokines with EDC-NK stimulation to activate PBMCs can better activate NK (CD3-CD56+) and increase its proportion; at the same time, the NKG2D+CD56+ cell subset also increases with the addition of EZH2 inhibitors; the killing ability of effector cells against target cells is also significantly improved after the addition of EZH2 inhibitors; the inhibitors have almost no effect on cell expansion efficiency during the 21-day culture period.

[0160] In one embodiment, (1) the PMBC has the same HLA-A as the cell line of step (1); in another embodiment, (1) the PMBC has a different HLA-A from the cell line of step (1).

[0161] In one embodiment, (1) the cell line addition ratio is cell line:PBMC = 1:1, and in another embodiment, (1) the cell line addition ratio is cell line:PBMC = 1:1000.

[0162] In one embodiment, the cell line described in (1) is loaded with antigen before co-culturing. In another embodiment, the cell line described in (1) is not loaded with antigen before co-culturing.

[0163] In one embodiment, the antigen is loaded by antigen peptide loading; in another embodiment, the antigen is loaded by transfecting an antigen gene into a cell line. Attached Figure Description

[0164] Figure 1 .Structural diagram of the NT-2 nucleic acid sequence fragment of the present invention

[0165] Figure 2 pCDH-EF1-MCS-T2A-copGFP plasmid map

[0166] Figure 3Gel electrophoresis results after double digestion of plasmid pUC57-NT or pCDH-EF1-MCS-T2A-copGFP: Note: ①: DNA Marker; ②: pCDH-EF1-MCS-T2A-copGFP double digestion; ③: pUC57-NT double digestion;

[0167] Figure 4 Gel electrophoresis verification of the results of double enzyme digestion and NT-ligated vector plasmid.

[0168] Note: ①: DNA Marker; ②: pCDH-EF1-MCS-T2A-copGFP-NT was double-digested;

[0169] Figure 5 pCDH-EF1-MCS-T2A-Tdtomato plasmid map

[0170] Figure 6 Gel electrophoresis results after double digestion of plasmid pUC57-SIGN or pCDH-EF1-MCS-T2A-Tdtomato: Note: ①: DNA Marker; ②: pCDH-EF1-MCS-T2A-Tdtomato double digestion; ③: pUC57-SIGN double digestion;

[0171] Figure 7 Gel electrophoresis verification of the results of double digestion of SIGN-ligated vector plasmid. Note: ①: DNA Marker; ②: pCDH-EF1-MCS-T2A-Tdtomato-SIGN was double digested.

[0172] Figure 8 Flow cytometry results of mononuclear cell-derived dendritic cell line (MoDC-NT)

[0173] Figure 9 Morphology of mononuclear cell-derived dendritic cell (MoDC-NT) lines

[0174] Figure 10 Flow cytometry results of preparing M1 peptide-specific CTL cells from PBMCs stimulated with MoDC-NT / M1

[0175] Figure 11 Flow cytometry results of NT dendritic cell lines (EDC-NT) carrying the NT (NT-1 or NT-2) gene.

[0176] Figure 12 NT dendritic cell (EDC-NT) strain obtained by infecting PBMCs with lentiviral particles carrying the NT (NT-1 or NT-2) gene. Figure 13 Flow cytometry results of the functional NTSIGN dendritic cell line (EDC-NTSIGN)

[0177] Figure 14 Proliferation curves of EDC-NT and EDC-NTSIGN cell-activated effector cells (T, NK cells).

[0178] Figure 15 Flow cytometry phenotype of the multifunctional NT dendritic cell line (EDC-NTA, i.e., EDC-NT-A0201 / 1101 / 2402)

[0179] Figure 16 pCDH-EF1-MCS-T2A-Puro plasmid map

[0180] Figure 17 Mesothelin nucleic acid sequence linkage structure diagram

[0181] Figure 18 .CEA nucleic acid sequence linkage structure diagram

[0182] Figure 19 .NY-ESO-1 nucleic acid sequence linkage structure diagram

[0183] Figure 20 Flow cytometry analysis of Mesothelin-specific CTLs prepared by EDC-Mesothelin stimulation of PBMCs.

[0184] Figure 21 Flow cytometry analysis of CEA-specific CTLs prepared by EDC-CEA stimulation of PBMCs.

[0185] Figure 22 Flow cytometry analysis of NY-ESO-1 specific CTLs prepared by PBMC stimulation with EDC-NYESO1.

[0186] Figure 23 Analysis of the specific CTL cell killing ability induced by EDC-Mesothelin stimulation

[0187] A. Western blotting was used to detect the expression of mesothelin in FIB and FIB / A0201 / Mesothelin;

[0188] B. Flow cytometry analysis of HLA-A0201 expression;

[0189] C. The killing activity of PBMC-generated cells stimulated by EDC-Mesothelin against FIB / A0201 and FIB / A0201 / Mesothelin; D. Analysis of the degree to which cytotoxicity is limited by MHCI by adding HLA-A2-blocking antibody.

[0190] Figure 24 Analysis of the specific CTL cell killing ability generated by EDC-NYESO1 stimulation

[0191] A. Western blot analysis of NY-ESO-1 expression in FIB, A549 / NYESO1dim, and A549 / A0201 / NYESO1;

[0192] B. Flow cytometry analysis of HLA-A0201 expression;

[0193] C. Analyze the killing activity of cells generated by EDC-NYESO1-stimulated PBMCs against FIB and A549 / A0201 / NYESO1.

[0194] Figure 25 Schematic diagram of the IL-15 & CD8α fusion protein structure

[0195] Figure 26 Flow cytometry analysis of the multifunctional NK feeder cell line (EDC-NK) obtained by infecting NT dendritic cells (EDC-NTSIGN) with lentivirus containing BBL, MICA, IL-15 & CD8 Fusion protein.

[0196] Figure 27 Flow cytometry analysis of NK cells prepared by stimulating PBMCs with inactivated EDC-NK over three weeks.

[0197] Figure 28 EDC-NK stimulation was used to activate PBMCs and generate cell count expansion curves for NK and NKT cells.

[0198] Figure 29 Flow cytometry analysis of NK cells prepared by stimulating PBMCs with EDC-NK combined with cytokines IL-15RA, OK432, and CD52.

[0199] Figure 30 EDC-NK combined with cytokine stimulation to activate PBMCs and prepare cell count expansion curves for NK and NKT cells.

[0200] Figure 31 Cytotoxicity of NK cells (A549) prepared by EDC-NK stimulation of PBMCs with a combination of histone methyltransferase (EZH2) inhibitor and EDC-NK inhibitors on target cells after 14 days of culture.

[0201] Figure 32 The cell count expansion curve after PBMC stimulation with EDC-NK using a combination of histone methyltransferase (EZH2) inhibitors and cytokines. Detailed Implementation

[0202] Materials and reagents:

[0203]

[0204]

[0205] The technical solution of the present invention will be further illustrated below with reference to exemplary experiments. However, the present invention is not limited to these embodiments.

[0206] Example

[0207] Example 1. Construction of NT gene lentiviral vector

[0208] Construction of NT viral vector

[0209] A newly designed NT base sequence was artificially synthesized, with Xba I and BamHI restriction sites at both ends. NT can be either NT1 or NT2. The sequence is as follows:

[0210] NT-1 (SEQ ID No. 1):

[0211]

[0212] The newly designed NT base sequence enables it to be transcribed and translated efficiently in human immune cells, thereby fully realizing its biological activity.

[0213] The structure of NT-2 is as follows Figure 1 As shown, the structure is composed of sequentially connected components: -Tax2(1-3aa)-Tax1(2-255aa)-T2A-Tax1(227-337aa)-.

[0214] Tax2(1-3aa)(SEQ ID No.2):Atggcccac

[0215] Tax1(2-255aa)(SEQ ID No.3):

[0216] Ttccccggcttcggccagagcctgctgttcggctaccccgtgtacgtgttcggcgactgcgtgcagggcgactggtgccccatcagcggcggcctgtgcagcgcccgcctgcaccgccacgccctgctggccacctgccccgagcaccagatcacctgggaccccatcgacggccgcgtgatcggcagcgccctgcagttcctgatcccccgcctgcccagcttccccacccagcgcaccagcaagaccctgaaggtgctgaccccccccatcacccacaccacccccaacatcccccccagcttcctgcaggccgtgcgcaagtacagccccttccgcaacggctacatggagcccaccctgggccagcacctgcccaccctgagcttccccgaccccggcctgcgcccccagaacctgtacaccctgtggggcggcagcgtggtgtgcatgtacctgtaccagctgagcccccccatcacctggcccctgctgccccacgtggtgttctgccaccccggccagctgggcgccttcctgaccaacgtgccctacaagcgcatcgaggagctgctgtacaagatcagcctgaccaccggcgccctgatcatcctgcccgaggactgcctgcccaccaccctgttccagcccgtgcgcgcccccgtgaccctgaccgcctggcagcacggcctgctgcccttccacagcaccctgaccacccccggcctgatctggaccttcaccgacggcacccccatgatc

[0217] T2A(SEQ ID No.10):Gagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggccca

[0218] Tax1(227-337aa)(SEQ ID No.4):

[0219] Gcctggcagcacggcctgctgcccttccacagcacctgaccacccccggcctgatctggaccttcaccgacggcacccccatgatcagcggcccctgccccaaggacggccagcccagcctggtgctgcagagcagcagcttcatcttccacaagttccagacca aggcctacccaccccagcttcctgctgagccacggcctgatccagtacagcagcttccacaacctgcacctgctgttcgaggagtacaccaacatccccatcagcctgctgttcaacgagaaggaggccgacgacaacgaccacgagccccagatcagccccggcgag

[0220] The lentiviral vector plasmid used to link the NT gene is pCDH-EF1-MCS-T2A-copGFP, such as... Figure 2 As shown.

[0221] pUC57-NT and pCDH-EF1-MCS-T2A-copGFP were double-digested with Xba I and BamHI, respectively, in the following reaction system:

[0222]

[0223] Note: Plasmid represents pUC57-NT or pCDH-EF1-MCS-T2A-copGFP.

[0224] Gel electrophoresis is used to detect and recover the target fragment, and ultraviolet gel imaging is performed as follows: Figure 3 As shown.

[0225] T4Ligase ligates the recovered NT and pCDH-EF1-MCS-T2A-copGFP fragments in the following reaction system:

[0226]

[0227] The ligation product was heat-transformed into trans 1 competent cells, incubated for 1 hour, and plated overnight. Single colonies were picked, inoculated into LB medium, and cultured overnight. Plasmids were extracted, and their size was verified by double enzyme digestion. The plasmids were then validated by gel electrophoresis, and the UV gel imaging results are shown below. Figure 4 As shown.

[0228] Example 2. Construction of the SIGN viral vector

[0229] The newly designed SIGN gene base sequence was artificially synthesized, with Xba I and BamH I restriction sites at both ends, as shown below:

[0230] SIGN (SEQ ID No. 5):

[0231]

[0232] The newly designed SIGN gene base sequence enables it to be transcribed and translated efficiently in human immune cells, thereby fully realizing its biological activity.

[0233] The lentiviral vector plasmid used to link the SIGN gene is pCDH-EF1-MCS-T2A-tdTomato, such as... Figure 5 As shown.

[0234] pUC57-SIGN and pCDH-EF1-MCS-T2A-tdTomato were double-digested with BamHI and EcoRI, respectively, and the reaction system is as follows:

[0235]

[0236] Note: Plasmid represents pUC57-SIGN or pCDH-EF1-MCS-T2A-tdTomato.

[0237] Gel electrophoresis was used to detect and recover the target fragment, and the ultraviolet gel imaging image is shown below. Figure 6 As shown.

[0238] T4Ligase was used to ligate the recovered SIGN and pCDH-EF1-MCS-T2A-tdTomato fragments to obtain pCDH-EF1-MCS-T2A-tdTomato-SIGN. The reaction system is as follows:

[0239]

[0240] The ligation product was heat-transformed into trans 1 competent cells, incubated for 1 hour, and plated overnight. Single colonies were picked, inoculated into LB medium, and cultured overnight. Plasmids were extracted, and their size was verified by double enzyme digestion. The results of gel electrophoresis after enzyme digestion were verified by UV imaging, as shown in the image. Figure 7 As shown.

[0241] Example 3. Lentiviral preparation

[0242] The day before transfection, 293T cells were digested and passaged. In cell culture dishes, the culture medium was Opti-MEM (+10% FBS). After incubation at 37°C for approximately 18-24 hours, cell confluence was approximately 80%.

[0243] The four plasmids pLP1 (Gag / Pol), pLP2 (Rev), pLP / VSVG (VSV-G), and pCDH-EF1-MCS-T2A-copGFP-NT were mixed evenly in a mass ratio of 1:1:1:1 and the concentration was adjusted to 4 mg / ul.

[0244] Take 920 μL of Opti-MEM culture medium and 80 μL of Lipofectamine 3000, mix them thoroughly, and use them as tube one for later use.

[0245] Take 893 μL of Opti-MEM culture medium and 27 μL of plasmid mixture, mix them well, then add 80 μL of P3000 reagent and mix thoroughly. This mixture will be used as tube two.

[0246] Slowly add the mixture from tube one to tube two, mix thoroughly, and let stand at room temperature for 5 minutes.

[0247] Add the mixture to the cells to be transfected, shake well, and return to the incubator. After 72 hours, harvest the supernatant, which is the virus stock solution.

[0248] Lentiviral stock solution corresponding to pCDH-EF1-MCS-T2A-tdTomato-SIGN plasmid was prepared using the same method described above.

[0249] Example 4. Preparation of engineered mononuclear cell-derived dendritic cell (MoDC-NT) lines

[0250] (1) Take 10 human peripheral blood samples, each 50 ml, containing heparin sodium;

[0251] (2) Dendritic cells (DC cells) in peripheral blood were isolated using Ficoll;

[0252] (3) Resuspend the isolated cells in 1640 serum-free medium, adjust the cell density to 3E+6 cells / ml, add them to the cell culture flask, incubate at 37℃ and 5% CO2 for 1.5-2h, discard the suspended cells and medium, wash twice with medium, add complete medium 1640 (containing 10% FBS or 5% human AB serum or 5% autologous plasma), and add IL-4 (5ng / ml) and GM-CSF (20ng / ml);

[0253] (4) IL-4 (10 ng / ml) and GM-CSF (10 ng / ml) were added daily on days 1, 3 and 5;

[0254] (5) On the 7th day, add the NT (NT-1 or NT-2) lentivirus particles prepared in Example 3 with an MOI of 20, and add polybrene (10ug / ml) at the same time. Continue to culture for one week, and add IL-4 and GM-CSF every other day.

[0255] (6) Then add IL-2 (100U / ml) and amplify and culture for a period of time.

[0256] (7) Add TNF-α (10 ng / ml) and LPS (10 ug / ml) [or Poly(I:C), 25 ug / ml] and continue culturing for two days. Analyze cell phenotype by flow cytometry. The results are as follows: Figure 8 As shown, the cell morphology is as follows Figure 9 As shown.

[0257] Example 5. Preparation of engineered mononuclear cell-derived dendritic cell (MoDC-NT) lines

[0258] Except for (3) adding IL-4 (10 ng / ml) and GM-CSF (5 ng / ml), (6) and (4) adding IL-4 (20 ng / ml) and GM-CSF (20 ng / ml) daily on days 1, 3 and 5, (5) adding nanopolymer (5 ug / ml), (6) adding IL-2 (200 U / ml), and (7) adding TNF-α (5 ng / ml) and LPS (20 ug / ml) [or Poly(I:C), 10 ug / ml], the rest are the same as in Example 4.

[0259] Example 6. Preparation of engineered mononuclear cell-derived dendritic cell (MoDC-NT) lines

[0260] Except for (3) adding IL-4 (20 ng / ml) and GM-CSF (40 ng / ml), (6) and (4) adding IL-4 (5 ng / ml) and GM-CSF (40 ng / ml) daily on days 1, 3 and 5, (5) adding nanopolymer (20 ug / ml), (6) adding IL-2 (200-U / ml), and (7) adding TNF-α (5 ng / ml) and LPS (20 ug / ml) [or Poly(I:C), 10 ug / ml], the rest are the same as in Example 4.

[0261] Flow cytometry results showed that all 10 cell lines using NT-1 and NT-2 lentiviruses were successfully constructed, achieving cell expansion.

[0262] The use of NT-1 and NT-2 lentiviruses enabled the large-scale expansion of MoDC-NT cells. All 10 cell lines constructed were successfully built, with a cell construction success rate of approximately 100%, providing sufficient cells for clinical and research use.

[0263] The monocyte-derived MoDC-NT cells prepared by this method have a typical dendritic cell phenotype and can be passaged and proliferated multiple times. The cells prepared by this method have higher purity, and the cells can also be used for HLA typing. This can provide a sufficient number of autologous DC cells for antigen presentation for some people who need a large number of antigen-presenting cells but cannot wait for a long time.

[0264] Example 7. Preparation of M1 peptide-specific CTL cells

[0265] The method for preparing the mononuclear cell-derived dendritic cell (MoDC-NT) line is as described in Example 4.

[0266] (1) Take a dendritic cell line (MoDC-NT) with good growth status and prepare a suspension of 2E+6 cells / ml. Add M1 peptide to a final concentration of 50μg / ml and continue to culture for 48h.

[0267] (2) Take 50 ml of peripheral blood from a human (same as MoDC-NT HLA-A, HLA-A0201), containing heparin sodium;

[0268] (3) PBMCs were isolated using Ficoll, a portion of which were used for CTL preparation and the remaining cells were cryopreserved for later use.

[0269] (4) Dilute PBMC to a suspension of 2E+6 cells / ml and seed it into a cell culture flask. Add MoDC-NT / M1:PBMC to the culture flask at a ratio of 1:10, and add IL-2 to a final concentration of 200U / ml (IL-2 needs to be added to this concentration throughout the culture process). Mix well and then place in a cell culture incubator for culture.

[0270] (7) Continue culturing for two more weeks, and take a small amount of cell suspension for quality control analysis such as flow cytometry. The flow cytometry results are as follows: Figure 10 As shown.

[0271] Example 8. Preparation of M1 peptide-specific CTL cells

[0272] (1) Add M1 polypeptide to a final concentration of 15 μg / ml. (2) Take 50 ml of human (same as MoDC-NT HLA-A, HLA-A0201) heparin sodium umbilical cord blood. (3) Use Ficoll to separate CD8+ T cells. The ratio of antigen-MoDC-NT to CD8+ T cells is 1:500. Add IL-2 to a final concentration of 50 U / ml. (7) Continue culturing for one week. The rest is the same as in Example 5.

[0273] Example 9. Preparation of M1 peptide-specific CTL cells

[0274] (1) Add M1 polypeptide to a final concentration of 25 μg / ml. (2) Take 50 ml of human umbilical cord blood containing heparin sodium (same as MoDC-NT HLA-A, HLA-A0201). (3) Use Ficoll to separate CD3+ T cells. The ratio of antigen-MoDC-NT to CD3+ T cells is 1:1000. Add IL-2 to a final concentration of 800 U / ml. (7) Continue culturing for three weeks. The rest is the same as in Example 5.

[0275] Flow cytometry results showed that M1-specific CTLs prepared by stimulating MHC-matched PBMCs with a certain amount of MoDC-NT loaded with M1 peptide had 89.57% CD8+ positive cells and 3.92% CD3+CD56+ double positive cells, and 1.70% CD3-CD56+ double positive cells. Among them, M1Tetramer-GILGFVFTL positive cells accounted for 20.73% of CD3+CD8+ double positive cells. This indicates that the protocol can achieve specific antigen presentation, which can kill tumors expressing M1 specific antigen in patients, as well as other diseased cells in patients without this specific antigen, thereby achieving a preventive effect.

[0276] Example 10. Preparation of NT dendritic cell line (EDC-NT)

[0277] (1) Take 10 human peripheral blood samples, each 50 ml, containing heparin sodium;

[0278] (2) Use Ficoll to separate PBMCs;

[0279] (3) Resuspend PBMCs in 1640 medium (containing 10% FBS or 5% human AB serum or 5% autologous plasma), adjust the cell density to 2E+6 cells / ml, add to cell culture flask, add immune cell agonist PHA to a final concentration of 5ug / ml, and culture at 37℃ and 5% CO2 for 24h.

[0280] (4) On the third day, add IL-2 to the culture supernatant to a final concentration of 100 U / ml and continue culturing for 4-5 days;

[0281] (5) On day 7, add NT (NT-1 or NT-2) lentivirus particles with an MOI of 20, and add polybrene (10ug / ml) at the same time, and continue to culture for 1-2 weeks;

[0282] (6) Collect cells and wash them twice with PBS. Add Anti-CD3 antibody magnetic beads and incubate for 2 hours. Then perform magnetic bead sorting to remove CD3+ cells.

[0283] (7) Adjust the remaining cells to a density of 2E+6 cells / ml, add them to a cell culture flask, and continue culturing for 2-3 months. Analyze the cell phenotype using flow cytometry. The flow cytometry results are as follows: Figure 11 As shown. Cell morphology as... Figure 12 As shown.

[0284] Example 11. Preparation of NT dendritic cell line (EDC-NT)

[0285] Except for (3), where an immune cell agonist was added to PMA to a final concentration of 10 ug / ml, (4) where IL-2 was added to a final concentration of 500 U / ml, (5) where the MOI was 10 and polybrene (20 ug / ml) was added, and (6) where cells were collected, washed twice with PBS, and then screened by flow cytometry to remove CD3+ cells, the rest were the same as in Example 6.

[0286] Example 12. Preparation of NT dendritic cell line (EDC-NT)

[0287] Except for (3), where an immune cell agonist was added to PMA to a final concentration of 20 ug / ml, (4) where the final concentration of IL-2 was 200 U / ml, (5) where the MOI was 15 and a nanopolymer (10 ug / ml) was added, and (6) where cells were collected, washed twice with PBS, and then screened by flow cytometer to remove CD3+ cells, the rest were the same as in Example 6.

[0288] The results showed that

[0289] The NT-1 base sequence allows the protein to be expressed better in cells, resulting in a 90% success rate in constructing the EDC-NT cell line. Of the 10 cell lines using NT-1 lentivirus, one cell line stopped proliferating and gradually died after about a month of culture, while the other nine cell lines were successfully constructed, resulting in a cell construction success rate of approximately 90%.

[0290] The NT-2 amino acid sequence enables multiple passages and expansions of EDC-NT cells, and the cell line construction success rate is very high, reaching 100%. All 10 cell lines using NT-2 lentivirus were successfully constructed, achieving a 100% cell construction success rate.

[0291] The NT dendritic cell line (EDC-NT) prepared by this method exhibits the typical dendritic cell phenotype and can be passaged and proliferated for extended periods. EDC-NT cells can be prepared in advance for those in need, stored in liquid nitrogen long-term, and used immediately after thawing (or through brief expansion culture). This method also provides an unlimited supply of autologous DC cells for antigen presentation to individuals requiring large quantities of antigen-presenting cells, and is a one-time preparation for lifetime use. Furthermore, these cells can also be used for HLA typing.

[0292] Example 13. Preparation of functional NTSIGN dendritic cell line (EDC-NTSIGN)

[0293] (1) Take EDC-NT cells in good growth condition, add SIGN lentivirus particles prepared by the methods in Examples 2 and 3, with an MOI of 20, and add polybrene (10ug / ml) at the same time, and continue to culture for 1 week;

[0294] (2) Take some cells infected with SIGN virus and repeat the infection with SIGN lentivirus twice at an MOI of 20. At the same time, add polybrene (10ug / ml) and continue culturing for 1 week.

[0295] (3) Collect cells and wash them twice with PBS. Add Anti-CD209 antibody magnetic beads, incubate for a while, and then sort them with magnetic beads to collect CD209+ cells.

[0296] (4) Adjust the collected cell density to 2E+6 cells / ml, add it to a cell culture flask, and continue culturing for 1-2 weeks. Analyze the generated EDC-NTSIGN by flow cytometry. The results are as follows: Figure 13 As shown.

[0297] Example 14. Preparation of functional NTSIGN dendritic cell line (EDC-NTSIGN)

[0298] Except that the polygluconate (10ug / ml) in (1) and (2) was changed to nanopolymer (20ug / ml), and the Anti-CD209 antibody magnetic bead incubation screening in (3) was changed to flow cytometry screening to collect CD209+ cells, the rest were the same as in Example 13.

[0299] Flow cytometry results show that

[0300] The EDC-NTSIGN cell line, prepared by transfecting EDC-NT cells with the SIGN gene, exhibits a typical DC phenotype and can initiate the interaction between DCs and naive T cells. This function is achieved through the binding of DC-SIGN to another cell ligand, ICAM-3, which is highly expressed on the surface of naive T cells. This cell line highly expresses DC-SIGN, enabling better signal transduction, which is beneficial for activating T cells and NK cells. This leads to increased DC-CTL expansion efficiency and antigen-specific CTLs, resulting in a larger number of effector cells, which is more likely to meet clinical needs, reduces the suffering caused by large-volume blood collection for patients, increases the possibility of patient cure, and further enhances the possibility of clinical application.

[0301] Example 15. Activation of effector cells using the NTSIGN dendritic cell line (EDC-NTSIGN).

[0302] (1) Take 50ml of human peripheral blood containing heparin sodium;

[0303] (2) PBMCs were isolated using Ficoll, and a portion of the cells were used for effector cell preparation, while the remaining cells were cryopreserved for later use.

[0304] (3) Dilute PBMC to a suspension of 2E+6 cells / ml and seed it into a cell culture flask. Add EDC-NTSIGN to the culture flask at a ratio of 1:100 and add IL-2 to a final concentration of 500U / ml (IL-2 needs to be added to this concentration throughout the culture process). Mix well and place in a cell culture incubator. The basic culture medium is X VIVO-15 + 10% FBS.

[0305] (4) After three weeks of continuous cell culture, a small amount of cell suspension was taken for quality control analysis, such as flow cytometry. The cell proliferation curve is shown below. Figure 14 As shown.

[0306] The results showed that, compared with EDC-NT cells, EDC-NTSIGN cells could better activate effector cells (T cells and NK cells). During the 21-day culture period, the total number of cells increased by 33.23%. The larger number of effector cells is more likely to meet clinical application needs, reduce the pain caused by large blood collection for patients, and increase the possibility of patient cure.

[0307] Example 16. Preparation of a multifunctional NT dendritic cell line (EDC-NTA, i.e., EDC-NT-A0201 / 1101 / 2402).

[0308] (1) Take a suspension of EDC-NTSIGN cells in good growth condition;

[0309] (2) Simultaneously add lentiviral particles carrying the gene sequences of HLA-A0201 (as shown in SEQ ID No. 6), HLA-A1101 (as shown in SEQ ID No. 7) and HLA-A2402 (as shown in SEQ ID No. 8), with an MOI of 20 for each, and add polybrene (10 ug / ml), and continue culturing for 1 week;

[0310] (3) Repeat step (2) twice;

[0311] (4) After diluting the cells, they were aliquoted into 96-well plates for single-clone cell selection. DCs were then analyzed by flow cytometry after culture. Results were as follows: Figure 15 As shown.

[0312] HLA-A0201 (SEQ ID No. 6):

[0313]

[0314] HLA-A1101(HA-Tag)(SEQ ID No.7):

[0315]

[0316] HLA-A2402(SEQ ID No.8):

[0317]

[0318] The results showed that the multifunctional NT dendritic cell line (EDC-NTA, i.e., DC-A0201 / 1101 / 2402) simultaneously possesses HLA-A0201, HLA-A1101 and HLA-A2402, the three most prevalent MHC class I molecules in Chinese people, and can also be other HLA subtypes. This cell line can be used to present antigens in vitro to cells containing one of the corresponding MHC class I molecules, making it possible to produce large-scale targeted specific CTLs.

[0319] Example 17. Preparation of functional NT dendritic cell line (EDC-NTA, i.e., EDC-NT-A0201)

[0320] Except for (2) adding lentiviral particles carrying the HLA-A0201 gene sequence (as shown in SEQ ID No. 6) with an MOI of 10 and adding nanopolymer (20ug / ml), and continuing to culture for 2 weeks, (4) the screening method is to wash twice with PBS, add Anti-HLA-A02 antibody magnetic beads, incubate fully, and then perform magnetic bead sorting to collect EDC-NTA0201 cells; the rest is the same as in Example 16.

[0321] Example 18. Preparation of a multifunctional NT dendritic cell line (EDC-NTA, i.e., EDC-NT-A1101)

[0322] Except for (2) adding lentiviral particles carrying the HLA-A1101 gene sequence (as shown in SEQ ID No. 7) with an MOI of 10 and adding polyglobulin (10ug / ml), and continuing to culture for 3 weeks, (4) the screening method is to wash twice with PBS, add anti-tag antibody flow cytometry antibody, incubate fully, sort by flow cytometer, and collect EDC-NTA1101 cells; the rest is the same as in Example 16.

[0323] Example 19. Preparation of a multifunctional NT dendritic cell line (EDC-NTA, i.e., EDC-NT-A0201 / 1101).

[0324] Except for (2) the addition of lentiviral particles carrying the gene sequences of HLA-A0201 (as shown in SEQ ID No. 6) and HLA-A1101 (as shown in SEQ ID No. 7), the rest is the same as in Example 16.

[0325] Example 20. Preparation of a multifunctional NT dendritic cell line (EDC-NTA, i.e., EDC-NT-A0201 / 2402).

[0326] Except for (2) the addition of lentiviral particles carrying the gene sequences of HLA-A0201 (as shown in SEQ ID No. 6) and HLA-A2402 (as shown in SEQ ID No. 8), the rest is the same as in Example 16.

[0327] Example 21. Preparation of a multifunctional NT dendritic cell line (EDC-NTA, i.e., EDC-NT-A1101 / 2402).

[0328] Except for (2) the addition of lentiviral particles carrying the gene sequences of HLA-A1101 (as shown in SEQ ID No. 7) and HLA-A2402 (as shown in SEQ ID No. 8), the rest is the same as in Example 16.

[0329] Example 22. Preparation of Mesothelin lentiviral particles, CEA lentiviral particles and NY-ESO-1 lentiviral particles

[0330] As shown in Examples 2 and 3, the newly designed Mesothelin, CEA, and NY-ESO-1 base sequences were artificially synthesized. A novel IκBα sequence was designed, and the new sequence was combined with the antigen genes in a recombinant viral vector. Xba I and BamHI restriction sites were respectively added to both ends. The lentiviral vector plasmid used to link the three antigen genes was pCDH-EF1-MCS-T2A-Puro. Figure 16 As shown. Lentiviral virus was prepared using a four-plasmid system.

[0331] Except for replacing pCDH-EF1-MCS-T2A-copGFP-NT with the target antigens pCDH-EF1-MCS-T2A-Puro-Mesothelin, pCDH-EF1-MCS-T2A-Puro-CEA, and pCDH-EF1-MCS-T2A-Puro-NY-ESO-1, the rest is the same as in Example 3.

[0332] (1) The target antigen nucleic acid sequence structure is IκBα(1-48aa)-Mesothelin-IκBα(281-317aa), except that pCDH-EF1-MCS-T2A-copGFP-NT is replaced with plasmid pCDH-EF1-MCS-T2A-Puro-IκBα(1-48aa)-Mesothelin-IκBα(281-317aa), otherwise it is the same as in Example 3.

[0333] (2) The target antigen nucleic acid sequence structure is IκBα(1-317aa)-T2A-CEA. Except for replacing pCDH-EF1-MCS-T2A-copGFP-NT with plasmid pCDH-EF1-MCS-T2A-Puro-IκBα(1-317aa)-T2A-CEA, the rest is the same as in Example 3.

[0334] (3) The target antigen nucleic acid sequence structure is IκBα(1-48aa)-NYESO1mini gene-IκBα(281-317aa). Except for replacing pCDH-EF1-MCS-T2A-copGFP-NT with plasmid pCDH-EF1-MCS-T2A-Puro-IκBα(1-48aa)-NYESO1-mini gene-IκBα(281-317aa), the rest is the same as in Example 3.

[0335] The structural formula of the target antigen nucleic acid sequence is as follows: (1) The structure of the combined gene is selected from one of the general formulas IκBα(1-48aa)-antigen gene-IκBα(281-317aa), IκBα(1-317aa)-T2A-antigen gene, IκBα(1-48aa)-antigen peptide mini gene-IκBα(281-317aa) and IκBα(1-317aa)-T2A-antigen peptide mini gene.

[0336] The sequence configurations of Mesothelin, CEA, and NY-ESO-1 are as follows: Figure 17 , Figure 18 and Figure 19 As shown. The antigen sequences of IκBα, Mesothelin, CEA and NY-ESO-1 are shown in SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 12 and SEQ ID No. 13, respectively.

[0337] IκBα (SEQ ID No. 9):

[0338] Atgttccaggccgccgagcgcccccaggagtgggccatggagggcccccgcgacggcctgaagaaggagcgcctgctggacgaccgccacgacagcggcctggacagcatgaaggacgaggagtacgagcagatggtgaaggagctgcaggagatccgcctggagccccaggaggtgccccgcggcagcgagccctggaagcagcagctgaccgaggacggcgacagcttcctgcacctggccatcatccacgaggagaaggccctgaccatggaggtgatccgccaggtgaagggcgacctggccttcctgaacttccagaacaacctgcagcagacccccctgcacctggccgtgatcaccaaccagcccgagatcgccgaggccctgctgggcgccggctgcgaccccgagctgcgcgacttccgcggcaacacccccctgcacctggcctgcgagcagggctgcctggccagcgtgggcgtgctgacccagagctgcaccaccccccacctgcacagcatcctgaaggccaccaactacaacggccacacctgcctgcacctggccagcatccacggctacctgggcatcgtggagctgctggtgagcctgggcgccgacgtgaacgcccaggagccctgcaacggccgcaccgccctgcacctggccgtggacctgcagaaccccgacctggtgagcctgctgctgaagtgcggcgccgacgtgaaccgcgtgacctaccagggctacagcccctaccagctgacctggggccgccccagcacccgcatccagcagcagctgggccagctgaccctggagaacctgcagatgctgcccgagagcgaggacgaggagagctacgacaccgagagcgagttcaccgagttcaccgaggacgagctgccctacgacgactgcgtgttcggcggccagcgcctgaccctg

[0339] T2A(SEQ ID No.10):

[0340] Gagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggccca

[0341] Mesothelin(SEQ ID No.11):

[0342]

[0343] CEA(SEQ ID No.12):

[0344]

[0345] NY-ESO-1 (SEQ ID No. 13):

[0346] Atgcaggccgaaggccggggcacagggggttcgacgggcgatgctgatggcccaggaggcctggcattcctgatggcccagggggcaatgctggcggcccaggagaggcgggtgccacgggcggcagaggtccc cggggcgcaggggcagcaagggcctcggggccgggaggaggcgccccgcggggtccgcatggcggcgcggcttcagggctgaatggatgctgcagatgcggggccagggggccggagagccgcctgcttgagttc tacctcgccatgcctttcgcgacacccatggaagcagagctggcccgcaggagcctggcccaggatgccccaccgcttcccgtgccaggggtgcttctgaaggagttcactgtgtccggcaacatactgactatc cgactgactgctgcagaccaccgccaactgcagctctccatcagctcctgtctccagcagctttccctgttgatgtggatcacgcagtgctttctgcccgtgtttttggctcagcctccctcagggcagaggcgc

[0347] The amino acid sequence of the antigen peptide mini gene is a series of repeating sequences of -antigen polypeptide-AYY-, and the nucleotide sequence of AYY is shown in SEQ ID No. 19: GCTTACTAC.

[0348] By designing a novel IκBα sequence, lentiviruses are prepared by artificially synthesizing the new sequence and antigen gene. The gene is then transferred into MoDC-NT, EDC-NT, or EDC-NTSIGN, enabling antigen presentation after intracellular degradation.

[0349] Example 23. Preparation of Mesothelin-Specific Multifunctional Dendritic Cell Line (EDC-Mesothelin)

[0350] (1) Take a suspension of multifunctional NT dendritic cells (EDC-NTA) in good growth condition;

[0351] (2) Mesothelin lentivirus particles obtained in Example 22 were added at the same time, with an MOI of 20, and polybrene (10ug / ml) was added. The mixture was then cultured for another week.

[0352] (3) Repeat step (2) twice;

[0353] (4) Add puromycin to the cell culture medium to a final concentration of 5ug / ml and culture under pressure for one week.

[0354] (5) After removing puromycin, continue to expand the culture for later use.

[0355] The results showed that the use of IκBα can promote the rapid degradation of mesothelin in cells and its presentation by MHC class I molecules. The construction of this cell line can be used to prepare mesothelin-specific CTLs, providing a new option for the treatment of mesothelin-positive tumor patients.

[0356] Example 24. Preparation of CEA-specific multifunctional dendritic cell (EDC-CEA) line

[0357] (1) Take a suspension of multifunctional NT dendritic cells (EDC-NTA) in good growth condition;

[0358] (2) At the same time, CEA lentivirus particles obtained in Example 22 were added, with an MOI of 20, and nanopolymer (20ug / ml) was added, and cultured for another 2 weeks.

[0359] (3) Repeat step (2) twice;

[0360] (4) Add puromycin to the cell culture medium to a final concentration of 8ug / ml and culture under pressure for one week.

[0361] (5) After removing puromycin, continue to expand the culture for later use.

[0362] The results showed that the use of IκBα can promote the rapid degradation of CEA in cells and its presentation by MHCI molecules. The construction of this cell line can be used to prepare CEA-specific CTLs, providing a new option for the treatment of CEA-positive tumor patients.

[0363] Example 25. Preparation of NY-ESO-1 specific multifunctional dendritic cell line (EDC-NYESO1)

[0364] (1) Take a suspension of multifunctional NT dendritic cells (EDC-NTA) in good growth condition;

[0365] (2) At the same time, add the NY-ESO-1 lentivirus particles obtained in Example 22, with an MOI of 20, and add polybrene (20ug / ml), and continue to culture for 1 week;

[0366] (3) Repeat step (2) twice;

[0367] (4) Add puromycin to the cell culture medium to a final concentration of 10ug / ml and culture under pressure for one week.

[0368] (5) After removing puromycin, continue the culture and prepare for future use.

[0369] The results showed that the use of IκBα can promote the rapid degradation of NY-ESO-1 in cells and its presentation by MHC class I molecules. The construction of this cell line can be used to prepare NY-ESO-1 specific CTLs, providing a new option for the treatment of NY-ESO-1 positive tumor patients.

[0370] Example 26. Preparation of EGFR-specific multifunctional dendritic cell (EDC-EGFR) line

[0371] Except for (2) replacing NY-ESO-1 lentivirus particles with EGFR lentivirus particles, the rest is the same as in Example 25.

[0372] Example 27. Preparation of CA153-specific multifunctional dendritic cell line (EDC-CA153)

[0373] Except for (2) replacing the NY-ESO-1 lentivirus particle with the CA153 lentivirus particle, the rest is the same as in Example 25.

[0374] Example 28. Preparation of MAGEA3-specific multifunctional dendritic cell line (EDC-MAGEA3)

[0375] Except for (2) replacing the NY-ESO-1 lentivirus particles with β2-MG lentivirus particles, the rest is the same as in Example 25.

[0376] Example 29. Preparation of Mesothelin-Specific CTL Cells

[0377] (1) Take 50ml of peripheral blood from a human (HLA-A0201) sample containing heparin sodium;

[0378] (2) CD3+ T cells isolated by Ficoll were used for CTL preparation, and the remaining cells were cryopreserved for future use.

[0379] (3) Dilute CD3+ T cells to a suspension of 2E+6 cells / ml and seed them into a cell culture flask. Add EDC-Mesothelin to the culture flask at a ratio of 1:1000 and add IL-2 to a final concentration of 200U / ml (IL-2 needs to be added to this concentration every day during the entire culture process). Mix well and place in a cell culture incubator for culture.

[0380] (4) On day 7 of cell culture, EDC-Mesothelin was added to the culture flask at a ratio of 1:200, and the cells were cultured for another two weeks. A small amount of cell suspension was then taken for flow cytometry and other quality control analyses. The results are as follows: Figure 20 As shown.

[0381] The results showed that Mesothelin-specific CTLs prepared by stimulating MHC class I molecule-matched PBMCs with a certain amount of EDC-Mesothelin had a high percentage of CD3+CD8+ double-positive cells (89.57%), CD3+CD56+ double-positive cells (17.10%), and CD3-CD56+ cells (4.30%). This allows for the killing of tumors expressing Mesothelin-specific antigens in patients, as well as the killing of other diseased cells in patients who do not have this specific antigen, thus achieving a preventive effect.

[0382] Example 30. Preparation of CEA-specific CTL cells

[0383] (1) Take 50ml of peripheral blood from a human (HLA-A0201) sample containing heparin sodium;

[0384] (2) CD8+ T cells isolated by Ficoll were used for CTL preparation, and the remaining cells were cryopreserved for future use.

[0385] (3) Dilute CD8+T cells to a suspension of 2E+6 cells / ml and seed them into a cell culture flask. Add EDC-CEA to the culture flask at a ratio of 1:100 and add IL-2 to a final concentration of 200U / ml (IL-2 needs to be added to this concentration every day during the entire culture process). Mix well and place in a cell culture incubator for culture.

[0386] (4) On day 7 of cell culture, add EDC-CEA at a ratio of 1:200 to the culture flask and continue culturing for another week. Take a small amount of cell suspension for flow cytometry and other quality control analyses. The results are as follows: Figure 21 As shown.

[0387] The results showed that CEA-specific CTLs prepared by stimulating MHCI-type molecularly matched PBMCs with a certain amount of EDC-CEA had a high percentage of CD3+CD8+ double-positive cells (86.86%), CD3+CD56+ double-positive cells (23.85%), and CD3-CD56+ cells (3.64%). This allows for the killing of tumors expressing CEA-specific antigens in patients, as well as the killing of other diseased cells in patients who do not have this specific antigen, thus achieving a preventive effect.

[0388] Example 31. Preparation of NY-ESO-1 specific CTL cells

[0389] (1) Take 50ml of human (HLA-A0201) umbilical cord blood containing heparin sodium;

[0390] (2) PBMCs were isolated using Ficoll, and a portion of the cells were used for CTL preparation, while the remaining cells were cryopreserved for later use.

[0391] (3) Dilute PBMC to 2E+6 cells / ml suspension, seed it into cell culture flask, add EDC-NYESO1 to the culture flask at a ratio of 1:10, and add IL-2 to a final concentration of 200U / ml (IL-2 needs to be added to this concentration every day during the entire culture process). Mix well and place in a cell culture incubator for culture.

[0392] (4) Continue culturing for three weeks, and take a small amount of cell suspension for quality control analysis such as flow cytometry. Results are as follows: Figure 22 As shown.

[0393] The results showed that NY-ESO-1-specific CTLs prepared by stimulating MHCI-type molecularly matched PBMCs with a certain amount of EDC-NYESO1 had a high percentage of CD3+CD8+ double-positive cells (89.74%), CD3+CD56+ double-positive cells (14.39%), and CD3-CD56+ cells (2.34%). This allows for the killing of tumors expressing the NY-ESO-1 specific antigen in patients, as well as the killing of other diseased cells in patients who do not have this specific antigen, thus achieving a preventive effect.

[0394] It can start with PBMC, or it can start with CD3+T or CD8+T.

[0395] Example 32. Analysis of the cytotoxic ability of specific CTL cells induced by EDC-Mesothelin stimulation

[0396] Human fibroblasts (FIBs) (HLA-A01:01A33:03) provided by Jinmeitai Biotechnology Hebei Co., Ltd. were selected as a negative control. HLA-A0201 cells were transfected into FIBs via lentivirus to obtain FIB / A0201. Mesothelin was further transfected into FIB / A0201 cells via lentivirus to obtain FIB / A0201 / Mesothelin. Western blotting was used to detect the expression of Mesothelin in FIBs and FIB / A0201 / Mesothelin. The results are as follows: Figure 23 As shown in Figure A; flow cytometry analysis of HLA-A0201 expression. Figure 23 As shown in Figure B; and the killing activity of EDC-Mesothelin-stimulated PBMCs against FIB / A0201 and FIB / A0201 / Mesothelin was analyzed. Figure 23 As shown in C; simultaneously, the degree of cytotoxicity limitation by MHCI was analyzed by adding HLA-A2-blocking antibody, and the results are as follows. Figure 23 As shown in D.

[0397] Western blot analysis showed that Mesothelin transfected into FIB cells via lentivirus was successfully expressed intracellularly, while it was not expressed in FIB cells without Mesothelin transfection. Flow cytometry results showed that HLA-A0201 transfected into FIB cells via lentivirus was successfully expressed intracellularly and could be transported to the cell membrane surface. Cell killing results showed that CTL cells generated by PBMCs stimulated by EDC-AFP Mesothelin could specifically kill target cells expressing Mesothelin antigen. Anti-HLA A2 antibody blocking assay showed that the killing of target cells expressing Mesothelin antigen by CTL cells generated by PBMCs stimulated by EDC-Mesothelin was limited by HLC1 molecules.

[0398] Example 33. Analysis of the cytotoxic ability of specific CTL cells generated by EDC-NYESO1 stimulation

[0399] Human fibroblasts (FIBs) (HLA-A01:01A33:03) provided by Jinmeitai Biotechnology Hebei Co., Ltd. were selected as negative controls. HLA-A0201 and NY-ESO-1 were sequentially transfected into HLA-A0201 negative cells A549 / NYESO1dim via lentivirus. Western blotting was used to detect the expression of NY-ESO-1 in FIBs, A549 / NYESO1dim, and A549 / A0201 / NYESO1 cells. The results are as follows: Figure 24As shown in Figure A; flow cytometry analysis of HLA-A0201 expression is shown in Figure 24B; and the killing activity of cells generated by EDC-NYESO1-stimulated PBMCs against FIB and A549 / A0201 / NYESO1 is analyzed as shown in Figure 24C.

[0400] Western blot analysis showed that A549 / NYESO1dim cells expressed low levels of NY-ESO-1, while NY-ESO-1 expression was significantly enhanced in A549 / NYESO1dim cells after lentiviral transfection, whereas the control group FIB cells did not express NY-ESO-1. Flow cytometry results showed that HLA-A0201 transfected into A549 cells via lentiviral transfection was successfully expressed intracellularly and transported to the cell membrane surface. Cell killing results showed that cells generated by EDC-NYESO1-stimulated PBMCs could effectively kill A459 / NYESO1dim cells without MHC class I molecule restriction, mainly due to the role of NK and NKT molecules. Furthermore, in the case of CTL-inactivated MHC... Under the condition of class I molecule restriction and enhanced expression of NY-ESO-1 specific antigen by A549 / NYESO1dim, CTL cells generated by EDC-NYESO1 stimulation of PBMCs can further enhance the killing effect on target cells, showing stronger killing activity against A549 / A0201 / NYESO1.

[0401] Example 34. Preparation of a multifunctional NK trophoblast cell line (EDC-NK)

[0402] (1) Take a suspension of NT dendritic cell line (EDC-NTSIGN) in good growth condition;

[0403] (2) Simultaneously add lentiviral particles containing the fusion proteins 4-1BBL (as shown in SEQ ID No. 14), MICA (as shown in SEQ ID No. 15), IL-15Mat-peptide (as shown in SEQ ID No. 17), and Hinge / TM CD8 (as shown in SEQ ID No. 18). (The structure of the IL-15 & CD8α fusion protein is shown in...) Figure 25 As shown in the figure, the MOI was 20 for all samples, and polybrene (10ug / ml) was added. The samples were then cultured for another week.

[0404] (3) Repeat step (2) twice;

[0405] (4) After dilution, the cells were aliquoted into 96-well plates for single-clone cell selection. After culture, flow cytometry analysis of dendritic cells (DCs) was performed. The results are as follows: Figure 26 As shown.

[0406] 4-1BBL (SEQ ID No. 14):

[0407] atggaatacgcctctgacgcttcactggaccccgaagccccgtggcctcccgcgccccgcgctcgcgcctgccgcgtactgccttgggccctggtcgcggggctgctgctgctgctgctgctcgctgccgcctgcgccgtcttcctcgcctgcccctgggccgtgtccggggctcgcgcctcgcccggctccgcggccagcccgagactccgcgagggtcccgagctttcgcccgacgatcccgccggcctcttggacctgcggcagggcatgtttgcgcagctggtggcccaaaatgttctgctgatcgatgggcccctgagctggtacagtgacccaggcctggcaggcgtgtccctgacggggggcctgagctacaaagaggacacgaaggagctggtggtggccaaggctggagtctactatgtcttctttcaactagagctgcggcgcgtggtggccggcgagggctcaggctccgtttcacttgcgctgcacctgcagccactgcgctctgctgctggggccgccgccctggctttgaccgtggacctgccacccgcctcctccgaggctcggaactcggccttcggtttccagggccgcttgctgcacctgagtgccggccagcgcctgggcgtccatcttcacactgaggccagggcacgccatgcctggcagcttacccagggcgccacagtcttgggactcttccgggtgacccccgaaatcccagccggactcccttcaccgaggtcggaa

[0408] MICA(SEQ ID No.15):

[0409]

[0410] IL-15&CD8α Fusion protein:

[0411] Signal peptide (SEQ ID No.16):

[0412] Atgagaatttcgaaaccacatttgagaagtatttccatccagtgctacttgtgtttacttctaaacagtcattttctaactgaagct

[0413] IL-15 Mat-peptide (SEQ ID No.17):

[0414] Aactgggtgaatgtaataagtgatttgaaaaaaattgaagatcttattcaatctatgcatattgatgctactttatatacggaaagtgatgttcaccccagttgcaaagtaacagcaatgaagtgctttctcttggagttacaagttatttcacttgagtccggagatgcaagtattcatgatacagtagaaaatctgatcatcctagcaaacaacagtttgtcttctaatgggaatgtaacagaatctggatgcaaagaatgtgaggaactggaggaaaaaaatattaaagaatttttgcagagttttgtacatattgtccaaatgttcatcaacacttct

[0415] Hinge / TM CD8 (SEQ ID No.18):

[0416] Gcgaagcccaccacgacgccagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagcggcggggggcgcagtgcacacgagggggctggacttcgcctgtgatatctacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactggttatcaccctttac

[0417] The results showed that EDC-NTSIGN cells could be successfully transfected with the genes 4-1BBL, MICA, IL-15, and CD8 Fusion protein to prepare EDC-NK cells. The interaction between 4-1BBL and the NK cell activating receptor 4-1BB can repair NK cell responsiveness. MICA is a ligand for activating the widely expressed human NK cell activating receptor NKG2D. IL-15 can promote the directed differentiation of CD34+ hematopoietic stem cells into NK cells, significantly upregulating the proportion of NK cells, and changing the NK cell subset distribution from predominantly CD56dim cells to predominantly CD56bright cells. The successful construction of EDC-NK cells provides a new option for NK cell preparation, and this approach allows for pre-stimulation of EDC-NK cells with antigens during NK cell preparation, generating antigen-specific cells. Furthermore, it may become an alternative to the currently used K562 feeder cells for NK cell production.

[0418] Example 35. Inactivation treatment of multifunctional NK trophoblast cells (EDC-NK) line

[0419] (1) Take EDC-NK cells in good growth condition, adjust the cell density to 2E+6 cells / ml, and place the cell suspension in a cell culture flask;

[0420] (2) The cell suspension was sent to the laboratory of Beijing Hongyi Sifang Radiation Technology Co., Ltd. for irradiation treatment. The Co60BFT-II type (2#) irradiation device was used, and the irradiation treatment was carried out in stages by the ring-shaped track. The absorbed dose of the cell suspension was: Dmin = 19.85kGy.

[0421] (3) The test method is GB / T 15053-2008 "Standard method for measuring absorbents using radiation colorimetric films and polymethyl methacrylate dosimetry systems".

[0422] (4) Take back the cell suspension after irradiation, centrifuge to collect the cells and then freeze them. The freezing density is 1E+7 cells / ml. The freezing solution is GMP grade cell freezing solution. The freezing is carried out by programmed cooling.

[0423] (5) Irradiated cells can be used directly or frozen cells can be thawed before use.

[0424] Analysis shows that EDC-NK cells treated with irradiation are inactivated cells, unable to proliferate further, but retain their original intracellular and surface molecular structures. This preserves their antigen-presenting ability and does not affect their activation of T and NK cells, thus enhancing their safety for clinical application. Alternatively, cells can be fixed with paraformaldehyde or other cell fixatives, or treated in ways that inhibit cell proliferation, while maintaining their function and safety for application. They can be used clinically or in research as vaccines or cell preparations.

[0425] Example 36. Preparation of NK cells

[0426] (1) Take 50ml of human peripheral blood containing heparin sodium;

[0427] (2) PBMCs were isolated using Ficoll, and a portion of the cells were used for NK cell preparation, while the remaining cells were cryopreserved for later use.

[0428] (3) Dilute PBMC to 2E+6 cells / ml suspension and seed it into cell culture flask. Add (irradiated or unirradiated) EDC-NK to the culture flask at a ratio of 1:50. At the same time, add IL-2 to the final concentration of 500U / ml (IL-2 needs to be added to this concentration each time the liquid is replenished during the entire culture process). Mix well and place in a cell culture incubator for culture. The basic culture medium is X VIVO-15 + 10% FBS.

[0429] (4) After three weeks of continuous cell culture, a small amount of cell suspension was taken for flow cytometry analysis. The results are as follows: Figure 27 As shown.

[0430] Cell expansion curves of NK (CD3-CD56+) and NKT (CD3+CD56+) cells obtained by PBMC activation using EDC-NK stimulation after 21 days of culture are shown below. Figure 28 As shown.

[0431] The results showed that EDC-NK could stimulate and activate PBMCs to specifically expand NK cell subsets, with NK (CD3-CD56+) and NKT (CD3+CD56+) accounting for 81.11% and 4.45%, respectively. After 21 days of culture, the cells expanded 253 times. This method can be used as a novel approach for NK cell preparation.

[0432] Example 37. Preparation of NK cells by combining EDC-NK with cytokines

[0433] (1) Take 50 ml of peripheral blood containing heparin sodium from a person with the same HLA-A as EDC-NK;

[0434] (2) PBMCs were isolated using Ficoll, and a portion of the cells were used for NK cell preparation, while the remaining cells were cryopreserved for later use.

[0435] (3) Dilute PBMC to a suspension of 2E+6 cells / ml and seed it into a cell culture flask. Add (irradiated or unirradiated) EDC-NK to the culture flask at a ratio of 1:50. At the same time, add IL-2 to a final concentration of 500U / ml (IL-2 needs to be added to this concentration each time the culture is replenished). Add IL-15RA to a final concentration of 20ng / ml, OK432 to a final concentration of 0.2KE / ml, and CD52 to a final concentration of 10ug / ml. Mix well and place in a cell culture incubator. After culturing for 7 days, continue to supplement with basal culture medium containing only IL-2. The basal culture medium is X VIVO-15 + 10% FBS.

[0436] (4) After three weeks of continuous cell culture, a small amount of cell suspension was taken for flow cytometry analysis. The results are as follows: Figure 29 As shown.

[0437] The combined use of EDC-NK stimulation to activate PBMCs with cytokines yielded NK (CD3-CD56+) and NKT (CD3+CD56+) cells. The cell expansion curve after 21 days of culture is shown below. Figure 30 As shown.

[0438] The results showed that EDC-NK, combined with stimulation of cytokines IL-15RA, OK432, CD52, and IL-2, activated PBMCs to specifically expand NK cell subsets. The resulting NK (CD3-CD56+) and NKT (CD3+CD56+) subsets accounted for 95.43% and 0.86%, respectively, and the cells expanded 394-fold after 21 days of culture. The further improved NK purity and cell expansion fold can be used as a novel protocol for NK cell preparation.

[0439] Example 38. Preparation of NK cells using a combination of histone methyltransferase (EZH2) inhibitors.

[0440] (1) Take 50 ml of human umbilical cord blood containing heparin sodium from individuals with different HLA-A levels than EDC-NK;

[0441] (2) PBMCs were isolated using Ficoll, and a portion of the cells were used for NK cell preparation, while the remaining cells were cryopreserved for later use.

[0442] (3) Dilute PBMC to a suspension of 2E+6 cells / ml and seed it into a cell culture flask. Add (irradiated or unirradiated) EDC-NK to the culture flask at a ratio of 1:50. At the same time, add IL-2 to a final concentration of 500U / ml (IL-2 needs to be added to this concentration each time the liquid is replenished during the entire culture process). Add IL-15RA to a final concentration of 20ng / ml, OK432 to a final concentration of 0.2KE / ml, and CD52 to a final concentration of 10ug / ml.

[0443] (4) Divide the cells into three groups. The first group is not added with inhibitors; the second group is added with EPZ005687 at a final concentration of 2.5uM; the third group is added with UNC1999 at a final concentration of 2.5uM. After mixing, the cells are placed in a cell culture incubator and cultured for 7 days. Then, the basic culture medium containing only IL-2 is added. The basic culture medium is X VIVO-15 + 10% FBS.

[0444] (5) After two weeks of continuous cell culture, a small amount of cell suspension was taken for flow cytometry analysis. Samples were taken after 14 days of culture to assess the cell's killing ability against target cells A549 (E:T = 10:1). The results are as follows: Figure 31 As shown in Table 1, the flow cytometry results of NK cell preparation by stimulating PBMCs with EDC-NK using a combination of histone methyltransferase (EZH2) inhibitor and cytokines are shown in Table 1. The cell expansion curves after a 21-day culture period for PBMC activation using EDC-NK stimulation with a combination of histone methyltransferase (EZH2) inhibitor and cytokines are shown in the figure. Figure 32 As shown.

[0445]

[0446] Table 1. Percentage of individual cell subpopulations in the parent population

[0447] The results showed that combining histone methyltransferase (EZH2) inhibitors and cytokines with EDC-NK stimulation to activate PBMCs could better activate NK (CD3-CD56+) and increase its proportion; at the same time, the proportion of NKG2D+CD56+ double-positive cell subsets also increased with the addition of EZH2 inhibitors; the killing ability of effector cells against target cells was also significantly improved after the addition of EZH2 inhibitors; the inhibitors had almost no effect on cell expansion efficiency during the 21-day culture period.

[0448] The above examples demonstrate that by designing novel gene sequences, preparing lentiviruses, and infecting immune cells to obtain cell lines, and further stimulating PBMCs with these cell lines or in combination with cytokines, the following cell lines can be obtained sequentially: monocyte-derived dendritic cell line (MoDC-NT), engineered NT dendritic cells (EDC-NT), functional NTSIGN dendritic cells (EDC-NTSIGN), multifunctional NT dendritic cells (EDC-NTA cells), target antigen-specific multifunctional dendritic cells, target antigen-specific CTLs, engineered multifunctional NK trophoblast cells, and NK cells. This novel immune cell preparation method successfully prepared a variety of engineered functional cell lines and immune cells.

[0449] This invention provides a novel method for preparing immune cells and its application, relating to the field of immune cells, and particularly to the preparation of DNA molecules, viral vectors containing the DNA molecules and cells, the modification and application of cells with antigen-presenting capabilities, and the modification and application of cells with NK stimulation capabilities.

[0450] This invention involves genetically modifying mammalian peripheral blood cells using lentiviruses to create cells capable of antigen presentation and activating the proliferation of natural killer (NSC) cells. Further genetic modification of these cells enables improved transmembrane transfer, antigen presentation, and NSC activation. After genetic modification, these cells can present antigen information via antigen loading or antigen gene transfection. They can also present antigen information to a wider range of HLA-type mononuclear cells. Furthermore, these genetically modified cells can induce and stimulate the proliferation and differentiation of mononuclear cells into NSCs; even cells that have lost their proliferative activity after irradiation or treatment with fixatives such as paraformaldehyde or cell inactivators retain this function. This genetically modified cell line can stimulate the expansion and differentiation of mononuclear cells into cytotoxic T lymphocytes with specific killing functions against cells expressing specific antigens. It can also activate and expand natural killer (NSC) cells. Furthermore, co-activation and expansion of mononuclear cells with different cytokines after genetic modification can yield a larger number of NSCs. Adding a histone methyltransferase (EZH2) inhibitor and co-activating and expanding mononuclear cells with cytokines after genetic modification can increase the proportion of NSCs in effector cells. It can also regulate epigenetic alterations in receptor and ligand expression in NSCs, while simultaneously enhancing the cytotoxicity of effector cells. The cells prepared in this invention, possessing antigen-presenting and NSC activation and expansion capabilities, have multi-generational expansion capabilities and can undergo multiple genetic modifications. This invention can prepare antigen-presenting cells, CTL cells, and application methods specific to Mesothelin, CEA, NY-ESO-1, or other antigens. This invention can also produce high-purity, high-cytotoxic NSCs on a large scale and provide application methods. These cells and application methods have broad application prospects in the prevention and treatment of tumors and infectious diseases.

[0451] This invention improves the in vitro growth potential of DC cells, enhances the ability of DCs to present antigens, and activates CTL and NK cells, greatly promoting the advancement of cell immunotherapy in medical practice and possessing broad industrialization prospects and commercial potential.

Claims

1. The application of a recombinant NT gene lentiviral particle in the preparation of engineered immune cells, characterized in that, The recombinant NT gene comprises the NT1 gene as shown in SEQ ID No. 1 and / or the NT2 gene with a composition of -BCDE- from 5′ to 3′, wherein B, C, D, and E respectively contain the encoding code for the Tax2 gene (1-3aa) as shown in SEQ ID NO: 2, the encoding code for the Tax1 gene (2-255aa) as shown in SEQ ID NO: 3, D is the encoding code for the T2A gene as shown in SEQ ID NO: 10, and E is the encoding code for SEQ ID NO:

10. The gene encoding Tax1 (227-337aa) shown in NO:4 is obtained by infecting host cells with a lentiviral particle containing a lentiviral vector carrying the recombinant NT gene. The engineered immune cells are selected from any one of the following: engineered monocyte-derived dendritic cell (MoDC-NT) strains, antigen-specific cytotoxic T lymphocytes (CTL), engineered NT dendritic cell (EDC-NT) strains, engineered functional NTSIGN dendritic cell (EDC-NTSIGN) strains, multifunctional NT dendritic cell (EDC-NTA) strains, antigen-specific multifunctional dendritic cell strains, multifunctional NK trophoblast cell (EDC-NK) strains, and ready-to-use multifunctional NK trophoblast cell (EDC-NK) strains.

2. An engineered dendritic cell line derived from mononuclear cells, characterized in that, The mononuclear cell-derived dendritic cell (MoDC-NT) strain contains a recombinant NT gene obtained by transfection with the lentiviral particles. The recombinant NT gene contains the NT1 gene as shown in SEQ ID No. 1 and / or the NT2 gene with a 5′ to 3′ configuration of -BCDE-, wherein B, C, D, and E respectively contain the encoding code for the Tax2 gene (1-3 aa) as shown in SEQ ID NO: 2, the encoding code for the Tax1 gene (2-255 aa) as shown in SEQ ID NO: 3, D is the encoding code for the T2A gene as shown in SEQ ID NO: 10, and E is the encoding code for SEQ ID NO:

10. NO:4 shows the encoding of the Tax1 gene (227-337aa), wherein the method for preparing the mononuclear cell-derived dendritic cell (MoDC-NT) line includes the following steps: (1) isolating mononuclear cells (PBMCs) from peripheral blood containing anticoagulant; (2) resuspending the PBMCs obtained in (1) with immune cell culture medium and seeding them into a cell culture container, and incubating them in the cell culture container at 37°C and 5% CO2 for 0.5-24 hours; (3) removing the suspended cells and culture medium in (2), washing with culture medium, and adding culture medium containing IL-4 and GM-CSF; (4) adding IL-4 and GM-CSF to (3) on days 1, 3, and 5 respectively; (5) infecting the cells cultured in (4) with lentiviral particles of the recombinant NT gene on day 7, and adding a lentiviral infection-promoting reagent at the same time; (6) continuing to culture the cells obtained in (5), adding IL-4 and GM-CSF every two days; (7) continuing to culture the cells obtained in (6) for a period of time, adding IL-2 every day or every other day; (8) Add TNF-α and one of LPS or Poly(I:C) to the cells obtained in (7) and continue culturing for two days; optionally, the lentiviral infection-promoting reagent in (5) is selected from polycationic compounds polygluconine and nanopolymers, or other lentiviral infection-promoting reagents; wherein the concentration of IL-4 in (6) is 5-20 ng / ml, and the concentration of GM-CS is 5-40 ng / ml; wherein the concentration of TNF-α in (8) is 5-20 ng / ml, the concentration of LPS is 5-20 ug / ml, and the concentration of Poly(I:C) is 5-50 ug / ml.

3. An engineered NT dendritic cell line (EDC-NT), characterized in that, The NT dendritic cell line (EDC-NT) contains the recombinant NT gene obtained by transfection with the lentiviral vector. The recombinant NT gene contains the NT1 gene as shown in SEQ ID No. 1 and / or the NT2 gene with a composition of -BCDE- from 5′ to 3′ as shown in SEQ ID No. 1, wherein B, C, D, and E respectively contain the encoding code for the Tax2 gene (1-3 aa) as shown in SEQ ID No. 2, the encoding code for the Tax1 gene (2-255 aa) as shown in SEQ ID No. 3, D is the encoding code for the T2A gene as shown in SEQ ID No. 10, and E is the encoding code for SEQ ID No.

10. NO:4 shows the encoding of the Tax1 gene (227-337aa), wherein the method for preparing the NT dendritic cell (EDC-NT) line includes the following steps: (1) isolating mononuclear cells (PBMCs) from human blood containing anticoagulant; (2) culturing the cells obtained in (1) in a culture medium containing an immune cell agonist; (3) adding IL-2 to the culture system in (2) and continuing to culture; (4) infecting the cells cultured in (3) with lentiviral particles of the recombinant NT gene, while adding a lentiviral infection-promoting reagent; (5) culturing the cells obtained in (4) in a culture medium containing serum and IL-2; (6) sorting and removing C from the cells obtained in (5). (7) Continue culturing the cells retained in (6) under the culture conditions in (5); Optionally, the immune cell agonist in (2) is selected from PHA and PMA and other agonists, and the culture time is 24 hours; the culture time in (3) is 4-5 days; the lentiviral infection-promoting reagent in (4) is selected from polycationic compounds polyaluminamine or nanopolymers, or other lentiviral infection-promoting reagents; the culture time in (5) is 1-2 weeks; the sorting method in (6) is selected from magnetic bead sorting and flow cytometry sorting; and the culture time in (7) is 2-3 months.

4. An engineered functional NTSIGN dendritic cell line (EDC-NTSIGN), characterized in that, The functional NTSIGN dendritic cell line (EDC-NTSIGN) contains the recombinant NT gene obtained by transfection with the lentiviral vector. The recombinant NT gene contains NT1 as shown in SEQ ID No. 1 and / or NT2 genes with a 5′ to 3′ composition of -BCDE-, wherein the nucleotide sequence of A is as shown in SEQ ID No. 1, B is the gene encoding Tax2 (1-3 aa), C is the gene encoding Tax1 (2-255 aa), D is the gene encoding T2A, and E is the gene encoding Tax1 (227-337 aa). The Tax2 (1-3 aa) gene sequence is as shown in SEQ ID No. 2, the Tax1 (2-255 aa) gene sequence is as shown in SEQ ID No. 3, the T2A gene sequence is as shown in SEQ ID No. 10, and the Tax1 (227-337 aa) gene sequence is as shown in SEQ ID No.

10. As shown in No. 4; the method for preparing the functional NTSIGN dendritic cell (EDC-NTSIGN) line includes the following steps: repeatedly infecting the engineered NT dendritic cell (EDC-NT) line of claim 3 with SIGN gene lentiviral particles, sorting, collecting and culturing CD209+ cells, wherein a lentiviral infection-promoting reagent is added simultaneously with the infection; optionally, wherein the lentiviral infection-promoting reagent is selected from polycationic compounds polyglobulin or nanopolymers, or other lentiviral infection-promoting reagents; wherein the sorting method is selected from magnetic bead sorting and flow cytometry sorting.

5. An engineered functional NT dendritic cell line (EDC-NTA), characterized in that, The EDC-NTA strain comprises a recombinant NT gene obtained by transfection with the lentiviral vector, the recombinant NT gene comprising the NT1 gene selected as shown in SEQ ID No. 1 and the NT2 gene with a composition of -BCDE- from 5′ to 3′. Specifically, B, C, D, and E respectively contain the encoding genes for Tax2 (1-3 aa) as shown in SEQ ID NO: 2, the encoding genes for Tax1 (2-255 aa) as shown in SEQ ID NO: 3, D is the encoding gene for T2A as shown in SEQ ID NO: 10, and E is the encoding gene for Tax2A as shown in SEQ ID NO:

10. The method for preparing the EDC-NTA strain, as shown in NO:4, encodes the Tax1 gene (227-337aa). The method comprises the steps of: infecting the functional NTSIGN dendritic cell (EDC-NTSIGN) strain of claim 4 with lentiviral particles carrying gene sequences selected from HLA-A0201, HLA-A1101, HLA-A2402, or other HLA-A or one or more combinations of these HLA-A sequences; subsequently sorting, collecting, and culturing HLA-A combination-positive cells; wherein, a lentiviral infection-promoting reagent is added simultaneously during the infection; wherein the HLA-A combination includes HLA-A0201, HLA-A1101, and HLA-A2402, wherein the sequence of HLA-A0201 is shown in SEQ ID No. 6, the sequence of HLA-A1101 is shown in SEQ ID No. 7, and the sequence of HLA-A2402 is shown in SEQ ID No.

7. As shown in No. 8; optionally, the lentiviral infection-promoting reagent is selected from polycationic compounds such as polyaluminum or nanopolymers, or other lentiviral infection-promoting reagents; the sorting method is selected from magnetic bead sorting, flow cytometry sorting, and monoclonal cell screening.

6. An engineered antigen-specific multifunctional dendritic cell line, characterized in that, The antigen-specific dendritic cells contain the recombinant NT gene obtained by transfection with the lentiviral vector, wherein the recombinant NT gene contains the NT1 gene as shown in SEQ ID No. 1 and / or the NT2 gene with a composition of -BCDE- from 5′ to 3′, wherein B, C, D and E respectively contain the encoding code Tax2 gene (1-3aa) as shown in SEQ ID NO: 2, the encoding code Tax1 gene (2-255aa) as shown in SEQ ID NO: 3, the encoding code T2A gene as shown in SEQ ID NO: 10, and the encoding code Tax1 gene (227-337aa) as shown in SEQ ID NO: 4, wherein the method for preparing the antigen-specific dendritic cells includes the steps of: infecting the multifunctional NT dendritic cells (EDC-NTA) of claim 5 with a lentivirus carrying the combination of the antigen gene and the IκBα gene, and then screening, collecting and culturing cells that are positive for the antigen gene; Optionally, the combination of the antigen gene and the IκBα gene can be selected from one of IκBα(1-48aa)-antigen gene-IκBα(281-317aa) and IκBα(1-317aa)-T2A-antigen gene and IκBα(1-48aa)-antigen peptide mini gene-IκBα(281-317aa) and IκBα(1-317aa)-T2A-antigen peptide mini gene; the amino acid sequence of the antigen peptide mini gene is a repetitive linked sequence of multiple -antigen polypeptide-AYY-, and the nucleotide sequence of AYY is as shown in SEQ ID. As shown in No. 19; wherein the lentiviral infection-promoting reagent is selected from polycationic compounds polyaluminum or nanopolymers, or other lentiviral infection-promoting reagents; wherein the screening method (4) includes magnetic bead sorting, flow cytometry sorting, single cell clonal screening or resistance screening; optionally, wherein the antigen gene or antigen peptide gene is selected from Mesothelin, CEA, NYESO-1, AFP, TPA, TPS, EGFR, VEGF, PDGFR, ALK, CA125, CA153, CA199, CA242, CA724, S100, HCG, HCH, β2-MG, MUC1 / 16, WT1, GD2, GPC3, PRAME, FOLR1, M The antigens include full or partial antigen genes of tumor antigen genes or viral antigen genes such as AGEA3, Her2, Survivin, CD19, CD20, CD22, CD47, CD73, CD117, PD1, PD-L1, and BCMA; optionally, the antigen-specific multifunctional dendritic cells include Mesothelin-specific multifunctional dendritic cell lines (EDC-Mesothelin), NYESO1-specific multifunctional dendritic cell lines (EDC-NYESO1), and CEA-specific multifunctional dendritic cell lines (EDC-CEA) and other antigen-specific dendritic cell lines corresponding to antigen genes, wherein the Mesothelin gene sequence is shown in SEQ ID No. 11, the CEA gene sequence is shown in SEQ ID No. 12, the NYESO-1 gene sequence is shown in SEQ ID No. 13, and the amino acid sequence of the antigen peptide mini gene is a series of repeating sequences of -antigen polypeptide-AYY-.

7. An engineered multifunctional NK trophoblast cell line (EDC-NK), characterized in that, The multifunctional NK trophoblast (EDC-NK) contains a recombinant NT gene obtained by transfection with the lentiviral vector, wherein the recombinant NT gene contains the NT1 gene selected as shown in SEQ ID No. 1 and the NT2 gene with a composition of -BCDE- from 5′ to 3′. B, C, D, and E respectively contain the encoding gene for Tax2 (1-3 aa) as shown in SEQ ID NO: 2, the encoding gene for Tax1 (2-255 aa) as shown in SEQ ID NO: 3, the encoding gene for T2A as shown in SEQ ID NO: 10, and the encoding gene for Tax1 (227-337 aa) as shown in SEQ ID NO:

4. The method for preparing the multifunctional NK trophoblast (EDC-NK) line includes the steps of: using 4-1BBL, MICA, IL-15 & CD8 Fusion, respectively. The three lentiviral particles corresponding to the protein were repeatedly used to infect the functional NTSIGN dendritic cell line (EDC-NTSIGN) of claim 4, followed by screening, collection, and culture of cells positively expressing the three genes 4-1BBL+ / MICA+ / IL-15&CD8 Fusion protein+; wherein a lentiviral infection-promoting reagent was added simultaneously during the infection; optionally, the nucleotide sequences of the genes 4-1BBL, MICA, IL-15, and CD8 are shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 17, and SEQ ID No. 18, respectively; wherein the lentiviral infection-promoting reagent is selected from polycationic compounds such as polyglobulin or nanopolymers, or other lentiviral infection-promoting reagents; wherein the screening method includes magnetic bead sorting, flow cytometry sorting, single-clone cell screening, or resistance screening.

8. An engineered, ready-to-use, multifunctional NK trophoblast cell line (EDC-NK), characterized in that, The multifunctional NK trophoblast (EDC-NK) contains a recombinant NT gene obtained by transfection with the lentiviral vector, wherein the recombinant NT gene contains NT1 as shown in SEQ ID No. 1 and NT2 genes with a composition of -BCDE- from 5′ to 3′, wherein B, C, D, and E respectively contain the encoding code for the Tax2 gene (1-3aa) as shown in SEQ ID NO: 2, the encoding code for the Tax1 gene (2-255aa) as shown in SEQ ID NO: 3, D is the encoding code for the T2A gene as shown in SEQ ID NO: 10, and E is the encoding code for SEQ ID NO:

10. The gene encoding Tax1 (227-337aa) shown in NO:4, wherein the method for preparing the engineered ready-to-use multifunctional NK trophoblast (EDC-NK) cell line includes the following steps: taking the multifunctional NK trophoblast (EDC-NK) cell line of claim 7 and preparing it into a cell suspension; irradiating the obtained cell suspension with radiation or treating it with chemical reagents to inactivate it; then using cell cryopreservation solution to perform programmed cooling to -80°C; and storing the obtained cells in liquid nitrogen or liquid nitrogen vapor; optionally, wherein the radiation irradiation inactivation in (2) is selected from Co60 radiation irradiation, γ-ray irradiation, and other radiation irradiation.

9. The use of the engineered cell according to any one of claims 2-8 in the preparation of novel immune cells, characterized in that, The method for preparing the novel immune cells includes the following steps: (1) mixing the engineered immune cell line described in claims 2, 3, 4, 5, 6, 7 or 8 with PBMCs derived from anticoagulated blood for culture; (2) using an immune cell culture medium supplemented with IL-2; (3) adding and / or not adding histone methyltransferase (EZH2) inhibitors and / or cytokines to the culture system described in step (2); and (4) culturing for a period of time. Optionally, the anticoagulated blood in (1) is selected from peripheral blood and umbilical cord blood, and the cell ratio in the mixed culture is cell line:PBMC = 1:1-1: 1000; wherein (2) the inhibitor is preferably UNC1999 and EPZ005687, and the cytokine is selected from one or more combinations of IL-15, IL-15RA, OK432, and CD52; wherein (4) the culture time is selected from one week, two weeks, three weeks, or other durations, and optionally, (1) the prepared PMBC has the same or different HLA-A as the cell line in step (1); optionally, the cell line in (1) is loaded or not loaded with antigen before mixed culture; wherein the method of loading antigen is selected from antigen peptide loading or transfecting the antigen gene into the cell line.

10. The application of claim 9, wherein, The novel immune cells include antigen-specific cytotoxic T lymphocytes (CTL), natural killer cells (NK), and natural killer T cells (NKT).

Images